Upload
others
View
8
Download
0
Embed Size (px)
Citation preview
i
Process Optimization for Up-regulation of
Strigolactones and Their Role in Abiotic Stresses
By
Wajeeha Saeed
CIIT/FA13-PBM-007/ISB
PhD Thesis
in
Biochemistry and Molecular Biology
COMSATS University Islamabad
Pakistan
Spring, 2019
Style Definition: TOC 3: Line spacing: 1.5 lines, Tab
stops: 0.92", Left + 5.93", Right,Leader: …
ii
COMSATS University Islamabad
Process Optimization for Up-regulation of
Strigolactones and Their Role in Abiotic Stresses
A Thesis Presented to
COMSATS University Islamabad
In partial fulfillment
of the requirement for the degree of
PhD (Biochemistry and Molecular Biology)
By
Wajeeha Saeed
CIIT/FA13-PBM-007/ISB
Spring, 2019
iii
Process Optimization for Up-regulation of
Strigolactones and Their Role in Abiotic
Stresses
_________________________________________
A Post Graduate Thesis submitted to the Department of Biosciences as partial
fulfillment of the requirement for the award of the Degree of PhD in Biochemistry
and Molecular Biology.
Name Registration Number
Wajeeha Saeed CIIT/FA13-PBM-007/ISB
Supervisor
Dr. Zahid Ali
Assistant Professor
Department of Biosciences
COMSATS University Islamabad (CUI)
Islamabad, Campus.
Formatted: Left, Indent: Left: 0"
iv
Certificate of Approval
This is to certify that the research work presented in this thesis, entitled “Process
Optimization for Up-regulation of Strigolactones and Their Role in Abiotic Stresses” was
conducted by Ms. Wajeeha Saeed (CIIT/FA13-PBM-007/ISB), PhD Scholar under the
supervision of Dr. Zahid Ali. No part of this thesis has been submitted anywhere else for
any other degree. This thesis is submitted to the Department of Biosciences, COMSATS
University Islamabad (CUI) in partial fulfillment of the requirements for the degree of
Doctor of Philosophy in the field of Biochemistry and Molecular Biology.
Student Name: Wajeeha Saeed Signature: __________
Examination Committee:
Signature: ___________
External Examiner 1
Prof. Dr. Shaheen Asad
National Institute of Biotechnology
and Genetic Engineering, Faisalabad.
Signature: ___________
External Examiner 2
Prof. Dr. M. Inam-ul-Haq
Chairman, Department of Plant
Pathology,
PMAS-Arid Agriculture University
Murree Road, Rawalpindi
Signature: ___________
Dr. Zahid Ali
Supervisor
Department of Biosciences
COMSATS University Islamabad, Islamabad Campus
Signature: ___________
Prof. Dr. Mahmood Akhtar Kayani
HoD, Department of Biosciences
COMSATS University Islamabad, Islamabad Campus
Signature: ___________
Prof. Dr. Habib Bokhari
Chairman, Department of Biosciences
COMSATS University Islamabad
Signature: ___________
Prof. Dr. Arshad Saleem Bhatti
Dean Faculty of Science,
COMSATS University Islamabad
v
Author’s Declaration
I Wajeeha Saeed, CIIT/FA13-PBM-007/ISB, hereby state that my PhD thesis titled
“Process Optimization for Up-regulation of Strigolactones and Their Role in Abiotic
Stresses” is my own work and has not been submitted previously by me for taking any
degree from this University i.e. COMSATS University Islamabad (CUI) or anywhere else
in the country/world.
At any time if my statement is found to be incorrect even after my Graduation the university
has the right to withdraw my PhD degree.
Date: __________ Signature: _______________
Wajeeha Saeed
CIIT/FA13-PBM-007/ISB
vi
Plagiarism Undertaking
I solemnly declare that research work presented in the thesis titled “Process Optimization
for Up-regulation of Strigolactones and Their Role in Abiotic Stresses” is solely my
research work with no significant contribution from any other person. Small
contribution/help wherever taken has been duly acknowledged and that complete thesis has
been written by me.
I understand the zero-tolerance policy of the HEC and COMSATS University Islamabad
towards plagiarism. Therefore, I as an Author of the above titled thesis declare that no
portion of my thesis has been plagiarized and any material used as a reference is properly
referred/cited.
I. undertake that if I am found guilty of any formal plagiarism in the above titled thesis
even after award of PhD degree, the University reserves the rights to withdraw/revoke my
PhD degree and that HEC and the University has the right to publish my name on the
HEC/University website on which names of students are placed who submitted plagiarized
thesis.
Date: __________ Student Signature: _______________
Wajeeha Saeed
CIIT/FA13-PBM-007/ISB
vii
Certificate
It is certified that Wajeeha Saeed, CIIT/FA13-PBM-007/ISB has carried out all the work
related to this thesis under my supervision at the department of Biosciences, COMSATS
University Islamabad and the work fulfill the requirements for award of PhD degree.
Date: __________
Supervisor:
__________
Dr. Zahid Ali
Assistant Professor, Department of Biosciences
Head of Department:
_____________________________
Prof. Dr. Mahmood Akhtar Kayani
HoD, Department of Biosciences
viii
DEDICATION
This dissertation is dedicated to:
My beloved parents:
Mr. Saeed Ahmad & Mrs.Sajida Saeed, thank you for your guidance,
unfathomable love, efforts and prayers.
I also dedicate this work to my Husband Mr. Naveid Abbas Imani for his
love, care and support throughout my Ph.D. studies.
ix
ACKNOWLEDGEMENTS
In the name of ALLAH (S.W.T), the Most Beneficent, the Most Merciful and Gracious,
the one who is the source of all knowledge and entitled to the divine attributes, bestowed
upon me the wisdom and capability to achieve this work. Whose guidance and
uncountable blessing have given me strength during my hard times, to fulfill my project
whole heartedly. Then, I offer my humble praise and immense gratitude to Prophet
Muhammad (P.B.U.H) The perfect amongst those born on earth, who is the universal
guidance and role model for humanity and love his followers for their remembrance.
The dissertation marks the end of a long and eventful journey wouldn’t be possible without
the contribution of many people who have accompanied and supported me throughout my
PhD journey.
Foremost, I would like to express my earnest gratitude to my supervisor Dr. Zahid Ali
from department of Biosciences,Assistant professor COMSATS University Islamabad. I
have been extremely lucky to have him as my tremendous mentor by encouraging my
research and allowing me to grow as a research scientist. His feedback and advice have
been instrumental in shaping this manuscript. He has been there providing his earnest
support, unwavering guidance, scholastic supervision, collegiality, and mentorship in my
quest for knowledge. He has not only motivated me to pursue my research and explore
the vast avenues of possible vistas in experimental work, but also uplifted my abilities
with his inspirational discussion. I would also like to extend my recognition to Dr. Saadia
Naseem Assistant professor COMSATS University Islamabad & my co-supervisor from
department of Biosciences, COMSATS University Islamabad for her insightful
discussion, constructive comments and meticulous guidance throughout the experimental
and thesis work and publications.
I would also like to extend warm thanks and appreciation for Prof. Dr. Francesca
Cardinale and her team at Department of Agricultural, Forest and Food Sciences
University of Turin, Italy during my IRSIP fellowship and for providing me opportunity
to avail WWS-2 Young scientist award of scholarship at University of Turin. Her
x
immaculate direction as well as professional encouragement kept me going with absolute
zeal and zest. I would also like to thank Post Doc lab fellows Dr. Ivan Visentin and Dr.
Chiara Pagliarani for their help in experimental work at DISAFA.
Special thanks to German Collection of Microorganisms and Cell Cultures (DSMZ)
Germany for providing dicistronic binary vector construct and Max Perutz Labs, Vienna
Bio center for GFP reporter construct. I am extremely obliged for the research
collaboration with Prof. Dr. Cristina Prandi and Prof. Dr. Pilar Cubas, Department of
chemistry, university of Turin, Italy and Plant Molecular Genetics Department National
Centre of Biotechnology (CNB-CSIC), Spain. They generously provided and synthesized
all the synthetic molecules and transgenic Arabidopsis seeds.
I owe a deep sense of gratitude to my supervisory committee member Dr. Muhammad
Muddassar, Assistant professor COMSATS University Islamabad for his guidance in
bioinformatics and docking simulations. I am also grateful to Prof. Dr. Mahmood
Akhtar Kayani HoD, Department of Biosciences COMSATS University Islamabad and
all the administration of campus for providing best possible environment for research. Not
forgotten, my appreciation to my Lab fellows specially Saira Karimi, Anam Saleem,
Sobia Anwar and Saba Saleem for their assistance in completion of research work, and
moral support. I am grateful to them all for countless hours spent discussing fruitful ideas
in the lab as well as over cups of tea at the campus cafe.
Most importantly, none of this would have been possible without my pillars of strength
my father Saeed Ahmad and my husband Navied Imani. Both of them never stopped
believing my abilities. I am forever in their debt. It is to them all; along with my
affectionate mother Sajida Saeed to whom I dedicate this dissertation. Thank you all for
giving me strength to reach for stars and chase my dreams. I am generously thankful to
my beloved sister Khuzaima Saeed for her moral support and companionship during my
PhD experience. Moreover, I would be unable to persue my carrier as PhD doctorate
without my uncle Dr. Abdur Rashid (Late), previous Head of Electrical Engineering
Department COMSATS Abbottaad made to ensure that I had an excellent education. This
dissertation is dedicated to first doctorate of our family.
xi
Finally yet importantly, I would like to take this opportunity to acknowledge Higher
Education Commission (HEC), Pakistan for financial support through HEC Indigenous
Scholarship (PIN no 2BM2-161) and IRSIP award at University of Turin Italy.
In the end, I would like to thank my institute COMSATS University for making my PhD
possible. I will be leaving the university with a heavy heart. May COMSATS progress by
leaps and bounds in each and every field of Science and Technology, Ameen
Wajeeha Saeed
CIIT/FA13-PBM-007/ISB
xii
ABSTRACT
Process Optimization for Up-regulation of Strigolactones and
Their Role in Abiotic Stresses
Strigolactones (SLs) are novel plant hormones, which contribute significantly to improve
overall plant architecture, performance, and tolerance in response to environmental
stresses. Expansion of novel technologies that can assist in characterization of the
molecular mechanisms regulating plant hormone synthesis, signalling, and action are
facilitating the modification of hormone biosynthetic pathways for the production of
transgenic crop plants with enhanced abiotic stress tolerance. The present research project
deals in exploration of the SLs role against abiotic stresses in plants. The expression of
Carotenoid cleavage oxygenase (CCD7) from Lotus japonicas in tomato (as a model plant)
was carried out for the amelioration of drought stress tolerance. To achieve seamless
transfer of traits into cultivated varieties of tomato, optimization of highly reproducible and
efficient protocol for in vitro regeneration and efficient Agrobacterium mediated
transformation applicable to several varieties of Solanum lycopersicum L. [cv. Riogrande,
cv. Romagrande, local hybrid 17905 and model cv. M82] was done. First, conventional
indirect organogenesis was developed for all four varieties used in this study followed by
somatic embryogenesis (SE) and Agrobacterium mediated transformation. One-week-old
tomato seedlings were used as a source of cotyledon and hypocotyl segments, which served
as explants. The explants were subsequently cultured on Murashige and Skoog (MS)
medium supplemented with different combination and concentrations of plant growth
regulators (PGRs). Substantial trends in regeneration and propagation were observed
among the varieties and treatments. The two commercial cvs. Rio grande and Roma
showed preferential response to callus induction when cultured for 2 weeks on growth
media CIMT9 (0.5 mg/L NAA, 1 mg/L BAP) and CIMT12 (2 mg/L IAA, 2 mg/L NAA, 2
xiii
mg/L BAP, 4 mg/L KIN). cv. Riogrande, being the most responsive commercial variety,
was selected for in vitro morphogenesis via somatic embryogenesis (SE). During SE,
young cotyledons and hypocotyls explants were tested on media with different ranges of
pH (3 – 7) supplemented with 0.5 and 2 mg/L NAA. SE was induced from both explants
at pH 4.0 in dark conditions and numerous rhizoids (approximately~38) were produced
from each explant. Further incubation of each rhizoid under light conditions, led to the
formation of a novel structure - rhizoid tubers (RTBs) on MS media supplemented with 5
mg/L TDZ/BAP at pH 4.0. It has been observed that only lower pH-induced rhizoids and
RTBs regenerated into multiple individual shoots on media at normal pH (5.8). The RTBs
led to a complete plantlets regeneration in 45 days compared to the conventional invitro
morphogenesis (60 days). The time for in vitro regeneration form individual RTBs was
found to be more proficient as compared to previously reported methods. For genetic
transformation, Agrobacterium tumefaciense strains EHA105 and GV3101 harboring
pGreenII0029-35S-TL-GFP-CCD7, pGreenII0029-35S-TL-GFP-D14 and
pGreenII0029MAS-CCD7-CP148-LUC with Kanamycinkanamycin selection marker
were used. Vector functionality was confirmed via transient histochemical GUS staining
and GFP imaging. Various parameters were optimized for short time transformation of cv.
Riogrande including explant type/age/orientation, optical density of bacterium, infection
and co-cultivation time, preculture treatment of explant and bacteriostatic antibiotic. 40–-
45% transformation efficiency was achieved with 2–-5 days precultured one-week old
cotyledons transformed with Agrobacterium culture (OD 0.4–-0.6) for 15 min followed by
48 hr of co cultivation in the presence of 200 µM Acetosyringoneacetosyringone. The
strigolactone (SL) up regulated shoots were successfully confirmed with PCR
amplification of 1900 bp CCD7, 817 bp D14, 405 bp GFP and 800 bp of LUC genes in
subsequently transformed T0 and T1 plants. The acclimatized plants were subjected to
drought stress survival assay, leaf water loss index and relative water content,
subsequently; morphological as well as physiochemical analysis showed that CCD7 over
expressing T0 and T1 (OE0 &OE1) lines were more resistant to extreme water deficit with
a survival rate of 80% as compared to WT plants. Ectopic expression of CCD7 regulated
above ground architecture of plants by reducing number of primary and secondary braching
in transgenic lines in comparisonas compared to wild type plants. Furthermore, CCD7 over
xiv
lines showed enhanced reactive oxygen species (ROS) scavenging system with high
antioxidant enzyme system of peroxidases (including SOD, POD, APX and CAT) stable
elevated total chlorophyll content and lower lipid peroxidation levels (MDA) levels during
21 days drought stress challenge. Moreover, the antioxidant properties due to phenols and
flavonoid content also showed more than 50 % increase under well-irrigated conditions.
The results showed overexpression of CCD7 SL precursor gene in cv. Riogande confers
tolerance against abiotic stresses particularly in extreme water deprivation, which was due
to organ level dynamics of SL in ABA dependent manner. Hormonal cross talk between
SL–-ABA and structure and activity relationship were further studied by development of
synthetic SL analogues and mimics and their structural activity relationship (SAR) was
quantified in transgenic Arabidopsis where AtD14 was fused to firefly luciferase. A D14
luminescence quenching based assay in parallel to germination-inducing bioassay on
parasitic weed were developed for series of D-Lactams analogues of SL. The result
obtained showed that the assay is quantitative, robust and less laborious for quantification
and SAR studies of natural as well as synthetic SLs, plant hormones with shared lineage,
SL mimics, and florescent molecules having bulky functional groups. Stability,
germination and receptor binding results conveyed that various compounds tested were
active only at higher concentration when compared with GR24 as a reference. The results
of D14 degradation assay were extrapolated by in silico docking which showed favorable
binding pose and activity of D-Lactams and ABA co crystallized with synthetic rac-GR24,
once again to ratify bioisosteric approach of SL perception and signaling. Finally, the
presented work indicated that SLs are involved in spatial and temporal regulation of ABA
mediated abiotic stress management in tomato and Arabidopsis model systems. The natural
and synthetic SLs are stereo specifically required by land plants to orchestrate hormonal
cross talk and stress resilience. LjCCD7 gene, when upregulated in tomato not only altered
the architecture of transgenic plants, but also enhanced their adaptability to drought stress
and enhanced water use efficiency.
xv
TABLE OF CONTENTS
1. Introduction ..........................................................................................................2
Drought stress and improved water use efficiency: A retrospective ..................2
Strigolactones (SLs): multidimensional plant hormones ...................................4
Structure and functionality relationships (SAR) ...................................... 65
SLs biosynthesis and perception ............................................................ 109
SLs signal transduction by α/β-hydrolase proteins ............................... 1110
SLs function in response to stress ............................................................... 1514
SL-ABA regulation during Abiotic stresses ......................................... 1615
Tomato as model organism ........................................................................ 1918
Tomato cultivation in Pakistan ................................................................... 2019
Tomato varieties grown in Pakistan ............................................................ 2120
Challenges faced by tomato production ...................................................... 2221
Biotic factors ...................................................................................... 2221
Abiotic factors .................................................................................... 2221
Genetic engineering for improved stress tolerance ...................................... 2322
Factors effecting tomato transformation ..................................................... 2625
2. Material and Methods .................................................................................... 3433
Experimental procedures ............................................................................ 3433
Plant material ...................................................................................... 3433
Sterilization and germination of seeds ................................................. 3433
xvi
Cell culture experiments ............................................................................. 3736
Effect of plant growth regulators (PGRs) on callus induction via direct
organogenesis ................................................................................................... 3736
Effect of medium pH and auxins on induction of somatic embryogenesis
(SE) 3938
Effect of cytokinins on immature somatic embryos ............................. 3938
Microscopic studies of RTBs .............................................................. 4039
Shooting response of novel structures RTBs and regenerating calli ..... 4039
Rooting medium and establishment of in vitro seedling in soil ............ 4140
Cloning of strigolactone (SL) biosynthetic genes........................................ 4241
Primer designing ................................................................................. 4241
Isolation of SLs biosynthetic pathways genes ...................................... 4241
Purification and sequencing of targeted gene fragments ...................... 4746
Plant expression vector construction ................................................... 4847
Cloning strategy of LjCCD7 ....................................................................... 4948
Double digestion of vector and insert .................................................. 5150
Gel purification of digested fragment and setting up Ligations ............ 5150
Chemically competent E. coli cells preparation ................................... 5453
Heat shock transformation of competent cells ..................................... 5554
Screening of colonies by colony PCR.................................................. 5554
Plasmid Isolation by alkaline lysis....................................................... 5655
PCR confirmation ............................................................................... 5756
Agrobacterium tumefaciens competent cells ........................................ 5756
Freeze thaw transformation of Agrobacterium competent cells ............ 5856
Glycerol stocks preparation ................................................................. 5857
Transient expression analysis by agroinfiltration ........................................ 5958
xvii
GUS histochemical staining ................................................................ 6059
Stable transformation of Solanum lycopersicum cv. Riogrande .................. 6160
Ex-Plants preparation .......................................................................... 6160
Agrobacterium mediated infection ...................................................... 6160
Co-cultivation and selection ................................................................ 6261
Regeneration of transformed explants ................................................. 6261
Ex-vitro acclimatization and transfer of rooted plants .......................... 6362
β-glucuronidase (GUS) activity ........................................................... 6362
Molecular analysis of transformed shoots ............................................ 6462
Morphological phenotyping of transgenic plants ........................................ 6563
Biochemical test for antioxidant enzyme potential under drought stress ..... 6564
Dehydration response assay ................................................................ 6564
Relative water content (RWC) ............................................................ 6564
Leaf water loss index .......................................................................... 6664
Enzyme extraction .............................................................................. 6665
Nitroblue tetrazolium SOD assay ........................................................ 6665
Guaiacol peroxidase (POD) activity .................................................... 6766
Catalase (CAT) activity....................................................................... 6866
Malondialdehyde (MDA) content analysis .......................................... 6867
Ascorbate peroxidase activity (APX) .................................................. 6967
Chlorophyll content analysis ............................................................... 6968
Total Phenols, Flavonoid and antioxidant estimation of transgenic tomato
plants………………………………………………………………………………
Statistical Analysis ..................................................................................... 7270
Development of Smart molecular tools STRItools (STRIgolactone tools)
xviii
Synthesis of SL analogues ................................................................... 7270
Stability analysis ................................................................................. 7574
Germination assay ............................................................................... 7574
Luminometer in planta assays ............................................................. 7675
Docking analysis ................................................................................. 8079
Analysis of ABA dynamics using in planta luminescence based assay.... 8179
Luminescence based assays ................................................................. 8179
Gene expression by quantitative reverse-transcription PCR (qRT-PCR)
cDNA synthesis .................................................................................. 8281
Quantification of gene expression ....................................................... 8281
In silico docking ..................................................................................... 8483
3. Results ............................................................................................................. 8685
Tomato cell culture .................................................................................... 8685
Seed germination and contamination control ....................................... 8685
In vitro callus formation is genotype-dependent .................................. 9089
Effect of media pH & NAA concentrations on in vitro morphogenesis 9291
Secondary embryogenesis and novel structures “Rhizoid tubers” (RTB)
formation ........................................................................................................ 10099
Shoot organogenesis from RTBs and calli ....................................... 103102
Histological Analysis of RTBs ........................................................ 111110
Cloning of putative SL biosynthetic genes and transformation of S. lycopersicum
cv. Riogrande ................................................................................................... 115114
Vector construction and functionality test ....................................... 117116
Vector functionality in tomato by transient infiltration .................... 125124
Stable transformation of S. lycopersicum cv. Riogrande ......................... 129128
Effect of age and orientation of explants ......................................... 129128
Formatted: Line spacing: 1.5 lines
xix
Effect of pre-culture on regeneration of transformed shoots ............ 129128
Infection and co cultivation duration ............................................... 130129
Antibiotic sensitivity test ................................................................. 134133
Regeneration of putatively transformed explants and shooting ........ 135134
Ex-vitro acclimatization of transformed plantlets ............................ 136135
Molecular characterization of transformed shoots................................... 138137
Morphological assessment of T0 & T1 plants ........................................... 140139
Physiological indices associated to dehydration resistance of transgenic tomato
plants 142141
Estimation of antioxidant enzyme potential, MDA and chlorophyll content
analysis of drought stressed transgenic lines. ................................................ 147146
Development of STRI Tools: SL analogues and in planta quantitative assay to
study SL binding mode ..................................................................................... 156155
Synthesis of new molecules ............................................................ 156155
Stability of newly synthesized compounds ...................................... 157156
Germination activity of new SL- Analogues .................................... 159157
Luminometer based D14 degradation assay ..................................... 160159
Docking of D-Lactams .................................................................... 171170
Luminometer assay based dynamic of other phytohormones .................. 174173
Docking simulation of ABA in At-D14 ........................................... 179178
4. Discussion ................................................................................................... 184183
Tomato cell culture, somatic embryogenesis and Agrobacterium mediated
transformation studies ...................................................................................... 187185
Overexpression of LjCCD7 gene enhances drought stress tolerance in tomato by
ROS scavenging mechanism ............................................................................ 201199
Formatted: Line spacing: 1.5 lines
Formatted: Line spacing: 1.5 lines
xx
Structure and activity relationships (SARs) in natural and synthetic analogues
decoded via quantitative in planta assay and docking simulations .................... 208205
5. References ................................................................................................... 221218
APPENDIX- I ..................................................................................................... 261256
APPENDIX- II ................................................................................................... 264259
APPENDIX- III .................................................................................................. 267262
APPENDIX- IV .................................................................................................. 268263
APPENDIX- V.................................................................................................... 270264
APPENDIX- VI .................................................................................................. 271265
xxi
LIST OF FIGURES
Figure 1.1 Chemical structure of strigolactones (SLs) and related compounds…………87
Figure 1.2 Signalling and perception pathway of strigolactones (Saeed et al.,
Figure 1.3 Overview of Agrobacterium mediated transformation in
Figure 1.4 Schematic overview of in vitro regeneration in
Figure 2.1 Restriction map of SLCCD7 coding
Figure 2.2 Restriction map 1 of LjCCD7 coding
Figure 2.3 Restriction map 2 of LjCCD7 coding
Figure 2.4 Restriction map SLD14 coding
Figure 2.5 T-DNA cassette of dicistronic vector (Ali et al.,
Figure 2.6 LjCCD7 harboring T-DNA
Figure 2.7 T-DNA cassette of reporter gene construct
Figure 2.8 T-DNA cassette of GFP fusion with
Figure 2.9 T-DNA cassette of GFP fusion with
Figure 2.10 Agro infiltration of tomato leaves and fruit for transient gene
Figure 2.11 Modification of GR24 to D-
Figure 2.12 D-Lactams analogues and mimics synthesized in this
Figure 2.13 Multimode Luminometer based quantitative in planta assay for quantification
of SL and SL related
Figure 2.14 Mode of SL-D14 interaction and real time monitoring of SL related activity
……………………………………………………………………………...79
Figure 2.15 qRT-PCR reaction conditions used in the
xxii
Figure 3.1 Germination of Solanum lycopersicum L. cvs. Riogrande, Roma, M82 and
hybrid (17905) on full and ½ strength MS medium without
Figure 3.2 Callus morphology of Solanum lycopersicum L. cvs. Riogrande, Roma, M82
and hybrid (17905) on optimized
Figure 3.3 Callus morphology of Solanum lycopersicum L. cvs. Riogrande, Roma, M82
and hybrid (17905) on optimized
Figure 3.4 Effect of increasing concentration of NAA at pH 4.0 on S.E from cotyledon
and hypocotyl of S. lycopersicum cv.
Figure 3.5 The effect of medium pH (4.0) on rhizoids production from cotyledon and
hypocotyl explants of S. lycopersicum cv.
Figure 3.6 Effect of pH 4.0 + 2 mg/L NAA vs pH 3, 5, 6 & 7…………………………9998
Figure 3.7 Effect of NAA*pH level on RTBs
Figure 3.8 Origination of RTBs from rhizoids at pH 4.0.
Figure 3.9 Induction of RTBs from rhizoids on MS media supplemented with TDZ/BAP
(5 mg/L) at pH 4.0.
Figure 3.10 Stages of whole plantlet development via in vitro shooting from excised
RTBs………………………………………………………………………105
Figure 3.11 Steps of complete in vitro regeneration in S. lycopersicum cv. Riogrande.
110109
Figure 3.12 Light microscopic sections of rhizoid tubers (RTBs) stained with safranin
stain on tuber induction medium supplemented with 5 mg/L TDZ at pH 4.0
from cotyledon explants of S. lycopersicum cv. Riogrande. 112111
xxiii
Figure 3.13 Histology of somatic embryos developed via direct somatic embryogenesis
from cotyledons explants of S. lycopersicum cv.
Figure 3.14 Histology of rhizoid cluster containing RTBs, globular and torpedo shaped
embryos…………………………….……………………………………..114
Figure 3.15 Cross talk between SLs and abscisic acid (ABA) biosynthesis for the
adaptability of plants in response to challenging
Figure 3.16 Total RNA quality and quantity from leaves and roots of
Figure 3.17 Vector map of pGEX-LjCCD7 (Liu et al.,
Figure 3.18 Amplified LjCCD7 fragment of 1899 bp and restriction map created with
XbaI-HindIII digestion.
Figure 3.19 PCR amplified LJCCD7 and SLD14
Figure 3.20 TA cloning of LjCCD7 & SLD14 in pGEMT
Figure 3.21 Blue white screening of TA clones in E.
Figure 3.22 Colony PCR results showing desired gene from white positive clones
containing TA cloned gene of
Figure 3.23 Restriction enzyme digestion of vector and
Figure 3.24 Sub cloning of LjCCD7 in dicistronic vector in
Figure 3.25 Sub-cloning of LjCCD7 fused with N terminal of GFP in
Figure 3.26 Sub-cloning of SLD14 fused with N terminal of GFP in
Figure 3.27 Analysis of reporter gene expression in detached leaves and fruits of S.
lycopersicum cv.
Figure 3.28 Effect of pre-culture treatment on transformation
Figure 3.29 Effect of bacterial density on transformation
xxiv
Figure 3.30 Effect of pre culture treatment Vs fresh cotyledons after co-cultivation of S.
lycopersicum cv.
Figure 3.31 Regeneration of Agrobacterium infected transformed cotyledon
explants………………………………………………………………...137
Figure 3.32 Acclimatization of CCD7 transformed regenerated plants and development of
flowers and fruits in S. lycopersicum cv.
Figure 3.33 PCR confirmation of LUC, GFP and CCD7 genes in putative transformed
lines…………………………….…………………………………………139
Figure 3.34 Phenotypic evaluation of transgenic CCD7 lines in comparison to WT
Riogrande at reproductive
Figure 3.35 Drought tolerance response of LJCCD7 overexpressing Riogrande
plants………………………………………………………………………143
Figure 3.36 (1-3) Drought tolerant attributes of transgenic LJCCD7 overexpressing
Riogrande
Figure 3.37 SOD content analysis of leaves and stem of CCD7 overexpressing lines
against
Figure 3.38 POD content analysis of leaves and stem of CCD7 overexpressing Riogrande
lines against
Figure 3.39 Effect of drought stress on H2O2 scavenging acticity due to CAT and APX in
leaves and stem of CCD7 overexpressing Riogrande lines against
Figure 3.40 Malondialdehyde (MDA) levels in the transgenic OE1 tomato after 21 days
of drought stress
xxv
Figure 3.41 Leaf chlorophyll content analysis of CCD7 overexpressing Riogrande
tomato……………………………………………………………………..154
Figure 3.42 Synthesis module of GR24-D-
Figure 3.43 Germination-inducing activity of D-Lactams on Phelipanche aegyptiaca
seeds…………………………….………………………………………...160
Figure 3.44 Dose response assay with (+)-GR24 & EGO10 normalized to acetone
control…………………………….………………………………………162
Figure 3.45 Luciferase assay with D-Lactam based SL analogues
Figure 3.46 A-B Percent efficacy of D-Lactams (rac1, rac2, rac6 & rac8) in comparison
with at 1 μM (+)-
Figure 3.47 Highest concentrationn (100 μM) of D-Lactam analogues in comaprison to
(+)-
Figure 3.48 Luciferase competition test between rac-9 and (+)-
Figure 3.49 (A-B) Luciferase D14 degradation activity over 15 hr treatment against 1µM
(+)-
Figure 3.50 Luciferase D14 degradation assay with SL mimics across a range of
concentrations (0.01–100 μM)
Figure 3.51 Docking model of rac-3 and rac-4 in the binding site of rice
Figure 3.52 Docking model of rac-9 in the binding site of rice
Figure 3.53 SL cross talk with various phytohormones during abiotic stresses (Saeed et
al., 2017)
Figure 3.54 Luminometer based D14 degradation assay with phytohormones at T=3
hr…………………………….……………………………………………176
xxvi
Figure 3.55 Luminometer based D14 degradation assay with phytohormones over 15
hr…………………………….……………………………………………177
Figure 3.56 Transcript accumulation of genes involved SL & ABA metabolism following
ABA
Figure 3.57 Transcript accumulation of genes involved SL & ABA metabolism following
100 µM ABA
Figure 3.58 Plausible binding mode of (+)-GR24 (cyan-a) in AtD14 (green) binding
pocket……………………………………………………………………..180
Figure 3.59 Plausible binding mode of S-(+)-ABA (yellow-b) in AtD14 (green) binding
pocket…………………………….……………………………………….181
Figure 3.60 Superimposed pose of (+)-GR24 (cyan) & S-(+)-ABA (yellow) in AtD14
(green) binding
Figure 4.1 Organ level dynamics of strigolactones during abiotic stresses encountered by
plants…………………………….………………………………………...186
Figure 4.2 Morphological assessment of T0 Transgenic plants of cv.
Figure 4.3 Morphological features of T1 transgenic plants Vs WT
Figure 4.4 Morphological assessmet of T1 transgenic
Figure 4.5 SLs quantification based on LUC degradation activity of tomato root exudates
normalized to mock and acetone control………………………………… Luc
activity of tomato root exudates normalized to mock and acetone
xxvii
LIST OF TABLES
Table 1.1 An overview of in vitro regeneration events and tranformation done in
tomato……………………. .................................................................... 2928
Table 2.1 Treatments used for seed disinfection ....................................................... 3534
Table 2.2 Optimized media formulations for in vitro morphogenesis and transformation
of S. lycopersicum cultivar(s)… ............................................................. 3635
Table 2.3 List of callus induction media used in the study ........................................ 3837
Table 2.4 List of primers used in the study ............................................................... 4443
Table 2.5 High capacity cDNA synthesis from total RNA ........................................ 4544
Table 2.6 PCR reaction conditions and master mix ................................................... 4544
Table 2.7 Reaction mix for NcoI- NotI double digestion ........................................... 5352
Table 2.8 Reaction mix for XbaI-HindIII double digestion ....................................... 5352
Table 2.9 Reaction mix for XmaI-NotI double digestion ........................................... 5352
Table 2.10 Rapid ligation mix for PCR products for TA cloning .............................. 5352
Table 2.11 Ligation reaction of vector and gene of interest ....................................... 5453
Table 3.1 Effect of Clorox (NaOCl) concentration on sterilization of seeds of Solanum
lycopersicum L cvs. Riogrande, Roma, M82 and hybrid (17905) on full and
½MS medium without sucrose ............................................................... 8886
Table 3.2 The effect of various combinations of PGRs on callogenesis in Solanum
lycopersicum cultivars irrespective of explant type. ................................ 9189
Table 3.3 The Effect of Various Concentrations of NAA and pH values on rhizoid
induction in S. lycopersicum cv. Riogrande. ........................................... 9694
Table 3.4 Effect of TDZ/BAP concentration on rhizoid tubers (RTBs) induction at low
pH in S. lycopersicum cv. Riogrande (no distinction of explant type). .. 10199
xxviii
Table 3.5 Effect of pH values on development of rhizoid tubers (RTBs) irrespective of
explant type in S. lycopersicum cv. Riogrande supplemented with 5 mg/L of
TDZ ..................................................................................................... 10199
Table 3.6 Effects of culture media and explant type on shoot regeneration in four S.
lycopersicum cultivars. ....................................................................... 107105
Table 3.7 Effect of auxins on rooting of in vitro regenerating shoots of four S.
lycopersicum cultivars after 8-10 weeks of incubation. ....................... 109107
Table 3.8 Effect of optical density on transient expression of T-DNA .................. 126124
Table 3.9 Effect of acetosyringoneAcetosyringone concentration on transient expression
of vector T-DNA ................................................................................ 127125
Table 3.10 Agrobacterium mediated stable transformation parameters optimized for S.
lycopersicum cv. Riogrande ............................................................... 131129
Table 3.11 Antibiotic sensitivity screening for selection media optimized for S.
lycopersicum cv. Riogrande ............................................................... 134132
Table 3.12 Regeneration efficiency of putatively transformed kanamycin resistant shoots
of S. lycopersicum cv. Riogrande ....................................................... 135133
Table 3.13 Physiochemical characteristics of T1 transgenic plants ........................ 155153
Table 3.14 Chemical stability of lactams, named as described in Fig. 2.11, in 30% MeOH
or 1:1 acetonitrile (ACN): water at 21 °C and pH 6.7. ........................ 158156
xxix
LIST OF ABBREVIATIONS
NaOH Sodium hydroxide
µg Micogram
µL Microliter
2, 4-D Dichlorophenoxyacetic acid
ABA Abscisic acid
ABA Abscisic acid
AM Arbuscular mycorrhiza
AM fungi Arbuscular mycorrhizal fungi
ANOVA Analysis of variance
Amp Ampicillin
APX Ascorbate Peroxidase
AtD14 Arabidopsis α/β-fold hydrolase DWARF 14
BAP Benzyl aminopurine
BRs Brassinosteroids
bp Base pairs
CAT Catalase
CCD Carotenoid cleavage dioxygenases
CIM Callus Induction Media
D14 α/β-fold hydrolase DWARF 14
DAS Days after stress
DMSO Dimethyl Sulfoxide
DNA Deoxyribo nucleic acid
DPPH 2,2-diphenyl-1-picrylhydrazyl
ent Enantiomer
epi Epimer
FAO Food and Agriculture Organization
xxx
FC reagent Folin-Cioceltau reagent
GA3 Gibberellic Acid
GAE Gallic acid equivalent
Gent Gentamycin
GFP Green Fluorescent Protein
GUS β Glucuronidase
hr Hour
IAA Indole acetic acid
Kan Kanamycinkanamycin
Kb kilo basepairs
KIN Kinetin
LUC Luciferase
MDA Malondialdehyde
mg Milligram
mg/L milligram per liter
mL Millilitre
NAA Naphthalene acetic acid
NaOCl Sodium hypochlorite
NCED 9‐cisepoxycarotenoid dioxygenase
OD Optical Density
PCR Polymerase Chain Reaction
PGRs Plant growth regulators
pH -log H+
POD Peroxidase
QE Quercetin
rac Racemic mixture
Rif rRifampicin
RIM Root Induction Media
ROS Reactive oxygen species
xxxi
RT-PCR Reverse Transcriptase PCR
RWC Relative water content
SA Salicylic Acid
S.E Standard error of mean
SAR Structure and Activity Relationship
SE Somatic embryogenesis
SIM Shoot Induction Media
SL Strigolactone
SLs Strigolactones
SOD Superoxide dismutase
T-DNA Transfer DNA
TDZ N-Phenyl-N'-1, 2, 3-thiadiazol-5-ylurea
Tet Tetracycline
WT Wild type
X-Gluc 5-Bromo-4-Chloro-3-indoyl-β-D-glucuronide
ZEA Zeatin
Introduction Chapter 1
1
Chapter 1
Introduction
Introduction Chapter 1
2
1. Introduction
Drought stress and improved water use efficiency: A retrospective
Plants are particularly sensitive to water deficit and they require abundant irrigation water
for their vegetative and reproductive growth, flower and fruit development. Drought stress
poses severe threats to normal physiology of plants due to its unpredictable nature and
dependency on external factors such as level of precipitation and its distribution,
hydrodynamics of soil and climate changes (Shinozaki and Yamaguchi-Shinozaki, 2006).
Unpredictable climate changes and their geographical distribution are making drought
stress an acute problem for domestic cultivation of various important crops like tomato
with negative impacts on plant growth, water absorption and photosynthesis rate, transport
of water and soluble solutes for fruit development, their productivity and quality (Mitchell
et al., 1991; Nahar and Gretzmacher, 2011). Water deficit is escalating day by day due to
global warming, with more abrupt changes in evapotranspiration of crops leading to
physiochemical and molecular changes in adaptability and tolerance of plants (Fischlin et
al., 2007). Plants have evolved adaptation and tolerance to water paucity at molecular and
cellular levels by expression of various defence mechanism, accumulation of proteins,
osmolytes, hormones and invoking alterations in cellular metabolism involved in stress
tolerance. Therefore differential changes in regulation of stress responsive pathways, genes
and proteins are observed with substantial cross-linking of signalling networks, which may
improve resistance to multiple abiotic stresses. Manipulation of the key genes and proteins
Introduction Chapter 1
3
and convergence of gene regulatory pathways may aid in the process of counteracting
multiple stresses. Hence, tolerance to certain unfavourable homeostasis caused by water
deficit may be presumed as plasticity in metabolic functions that allows plant to depict
avoidance, tolerance or recovery from drought (Ahuja et al., 2010; Ku et al., 2018). This
defence mechanism defined by limiting the damage due to abiotic stress is termed as
tolerance of plant. Adaptation or tolerance of plant to various stresses is a complicated
phenomenon characterized by activation of multitude of gene regulatory pathways. The
comprehension of dynamics and advancements in multifarious gene interplay can be
investigated further to unleash the adaptive mechanism of plants under different abiotic
stresses (da Silva and Costa de Oliveira, 2014; Mittler, 2006). Elucidation of molecular
control and underlying physiology of plant under stress is pivotal for understanding how
plants can survive under unwanted conditions which may provide basis for engineering
more resistant crops by using molecular tools to introduce specific stress related genes
(Osakabe et al., 2011; Wang et al., 2003; Wei et al., 2017). Drought inducesd physiological
and morphological imprints to minimize the negative impacts of water deficit. These
alterations include reduction in biomass, shortening of life cycle, changes in root structure,
proliferation & depth, reduced leaf size, area & number to minimize water use, reduction
in transpiration, increase in stomatal resistance, increase in root/shoot biomass ratio, short
stature, accumulation of soluble solutes (sugars, proline, amino acids, sugars) for
maintenance of water potential and enhanced production of antioxidant defence enzymes
to withstand oxidative damage. These drought avoidance and tolerance traits are
adaptations governed by differential expression of genes, transcription factors and most
importantly phytohormones to maintain water budget and reduce injury of plants under
stress. This native plasticity in plants in turn depends on stress severity, duration and
susceptibility of plants (Ahuja et al., 2010; Fujita et al., 2011; Shinozaki and Yamaguchi-
Shinozaki, 2006; Umezawa et al., 2006).
Dynamic approaches to combat abiotic stresses specifically water deficit include
phytohormones engineering besides conventional breeding program to transfer abiotic
stress resistant genes. Phytohormones are endogenous growth mediators produced in small
quantities and are responsible for plant protective functions by acclimatization to single or
combination of abiotic stresses. These signalling molecules involve organ level dynamics
Introduction Chapter 1
4
to change the physiological and molecular state of plant by and exerting their effect often
from their site of production (Khan et al., 2012; Ku et al., 2018). Last decade opened new
possible outcomes of phytohormones engineering by manipulation of their biosynthesis
and catabolism to enhance stress tolerance, growth regulation, source/sink transitions and
differential plasticity of plants under unfavourable environment. These phytohormones
include abscisic acid (ABA), auxins (IAA), gibberellins (GAs), cytokinins (CKs), salicylic
acid (SA), brassinosteroids (BRs), jasmonates (JAs) and strigolactones (SLs) –, a new class
of signalling mediators (Saeed et al., 2017; Sreenivasulu et al., 2012).
Strigolactones (SLs): multidimensional plant hormones
Among various plant hormones, SLs are contemporary hormones discovered recently with
myriad of new revenues and remarkable breakthroughs in phytohormones research. With
SLs discovery, researchers got a clue to look for regulation of plant development and their
meticulous adaptation to environmental constraints. These research endeavours also
opened new chapters of hormone cross talk responsible for overall response in plants
(Saeed et al., 2017). It has been established that SLs are responsible for diverse
physiological activities coherently in plant development besides shoot branching. They
regulate plant growth and architecture by facilitating phosphate availability from the soil
by AM fungi colonization and root hair elongation for inorganic phosphate acquisition
from the soil (Brewer et al., 2013). These signalling molecules produced by the plants in a
very low concentrations (µM and pM) have been detected in root exudates of wide variety
of both dicots and monocot plants. These compounds particularly unstable in aqueous
environment with manifold functional aspects as well as physiological roles are produced
in different plants in diverse forms under certain conditions (Xie et al., 2010). The SLs
have been detected in the root exudates of a wide range of monocot and dicotyledonous
plant species. Different plant species and even various varieties of one crop species produce
diverse SLs and/or mixtures of these signalling compounds with roots being main site of
synthesis. However, production of SLs in lower part and its translocation from roots to
shoot for inhibition of shoot branching has also been reported. Several other groups also
supported the transportation of root derived SLs (Abe et al., 2014; Kohlen et al., 2013).
Introduction Chapter 1
5
The manifestation of physiological role of this new hormone was reported using
branching/increased tillering mutants, including both SL-biosynthesis and SL-signalling
mutations of different species. These mutants are more axillary growth (max) in
Arabidopsis (Stirnberg et al., 2002; Booker et al. 2004), ramosus (rms) in pea (Sorefan et
al., 2003), dwarf (d ) & high tillering dwarf (htd ) in rice (Arite et al., 2007) and decreased
apical dominance (dad ) in petunia (Simons et al., 2007). Level of SLs in root exudates of
these mutants depicted by grafting experiments were remarkably low as compare to WT
due to defective biosynthesis and transport of signal from roots to shoot. Since SLs are
produced in roots, for their execution of branch inhibition they need to be transported shoot
ward through vasculature (Dun et al., 2009; Mouchel and Leyser, 2007). It has been well
established that SLs are responsible for diverse physiological activities coherently in plant
development besides shoot branching. They regulate plant growth and architecture by
facilitating phosphate availability from the soil by AM fungi colonization and root hair
elongation for inorganic phosphate acquisition from the soil (Agusti et al., 2012; Brewer
et al., 2013; Rasmussen et al., 2012). Studies conducted on SL deficient and SL insensitive
mutants showed denser lateral roots and shorter primary roots in comparison to their wild
counterparts (Brewer et al., 2015; Gomez-Roldan et al., 2008; López-Ráez et al., 2008;
Rasmussen et al., 2013). Additional roles of SLs in plant physiology includes interaction
with plant growth hormone for regulation of secondary growth and increase in stem
thickness through interaction with auxins (Agusti et al., 2012), inhibition of adventitious
root formation in Pea, Arabidopsis and tomato (Kohlen et al., 2013; Rasmussen et al.,
2012), positive regulation of internode length , promotion of leaf senescence, seed
germination, seedling and root development (Kapulnik et al., 2011; Ruyter-Spira et al.,
2011; Zhang et al., 2013). Moreover, several studies have demonstrated positive role of
SLs in seed germination and early seedling development in Arabidopsis (Tsuchiya et al.,
2010).
Additionally synthetic active analogue of SLs, GR24 has been shown to promote
nodulation in Alfalfa and many other rhizobial plants (De Cuyper et al., 2015; Foo et al.,
2014; Soto et al., 2010). Finally, strigolactones have been proposed to play a direct or
indirect role in plant defence in different fungal pathosystems (Dor et al., 2011; Torres-
Vera et al., 2014). With increasing interest in biological and physiological role of SLs in
Introduction Chapter 1
6
plant development and regulation, additional functions are likely to be identified in future
as more research groups probe SLs mediated signalling pathways.
Structure and functionality relationships (SAR)
So far 18-20 natural SLs have been characterized and they share similar chemical
architecture (Al-Babili and Bouwmeester, 2015). Structurally, they are tricyclic lactones
referred as ABC rings linked to methylbutenolide via an enol ether bridge to an invariable
α, β-unsaturated furanone moiety named D ring. The bioactiphore resides within the region
that connects the D-ring to the core; chemical diversity is given by the stereochemistry of
the B-C ring junction, the size of the A ring, and the substitution patterns of the A and B
rings (Al-Babili and Bouwmeester, 2015). A and B rings vary in their structure due to
presence of one or two methyl groups while C and D-rings mostly remain constant except
their stereoisomers have been reported on enol ether bridge which is believed to mediate
biological activity of SLs (Rani et al., 2008; Xie et al., 2010). Signaling and perception
mechanism of strigolactones and their bioactivity depends on stereochemistry of CD rings.
SLs contain several stereocenters and often exist as mixture of stereoisomers. Among
various stereoisomers of natural SLs, activity differs remarkably. The absolute stereo
chemical configuration system according to IUPAC system (International Pure and
Applied Chemistry) designated R or S system indicating chirality. The SL intermediate
carlactone is converted to two distinct classes of molecules define by 5DS/ (+)-strigol and
(−)-orobanchol from which all the SLs are derived (Xie et al., 2013). The structure shown
in Figure 1.1 showed that in general, A ring with oxygen function may occur at different
position and BC junction at C-2 could be accounted for stereo specificity.
Introduction Chapter 1
7
Figure 1.1 Chemical structure of strigolactones (SLs) and related compounds
Introduction Chapter 1
8
Two naturally occurring SLs are produced from SL intermediate carlactone namely strigol and orobanchol, with the
characteristic ABC-ring to D-ring structure. Both stereomers have different in hydroxyl groups at the C5 and C4 positions
and the differing stereochemistry at the B-ring to C-ring junctions. The stereochemistry at C2′ is the same in both strigol
and orobanchol marked by red arrow. Adapted from (Lombardi et al., 2017)
The two precursors of SLs are actually opposite to each other on B-C ring stereochemistry
and termed as diastereomers 2′R D-ring configuration as shown in Figure 1.1. Thus, SL
nomenclature has been defined by using ent for enantiomer i.e. mirror image and epi for
epimer i.e. opposite stereochemistry at one carbon with referenced to their parent scaffold.
This notion pertains to either (+)-strigol where by 5-deoxystrigol (5DS) is considered as
reference compound and for (−)-orobanchol, 4-deoxyorobanchol (4DO; ent-2′-epi-5DS) is
an appropriate reference compound (Xie et al., 2013; Zwanenburg and Pospíšil, 2013). The
classification of naturally occurring SLs aided in detection and stereo chemical assignment
of synthetic SL analogues, derivatives and mimics. For example, synthetic SL
representative GR24 is widely used in research as racemic mixture containing two
enantiomers with 5DS configuration. The stereo specificity of SLs and SL like compounds
has important role in activity and regulation of prime biological functions such as parasitic
weed germination, promotion of hyphal branching factors in arbuscular mycorrhizal (AM)
fungi, branch inhibition, rice tillering as well as activation of downstream signaling effector
protein. Various biological functions are regulated by stereo specificity of natural and
synthetic SLs. Strigol like compounds (sorgolactone, GR24, 5-deoxystrigol, sorgomol etc)
have been found to stimulate greater activity in Striga hermonthica seed germination as
compared to their enantiomers, while germination in Striga gesnerioides is inhibited by
same compounds and promoted by orobanchol type compounds (Nomura et al., 2013).
Based on choice of structure and activity diversity and complex organic process to
synthesize sizeable quantities of synthetic SLs, series of active analogues have been
Introduction Chapter 1
9
prepared (Artuso et al., 2015; Lombardi et al., 2017). It has been verified now via bioassay
and detailed SAR studies that the presence of enol ether and the ABC scaffold is required
for nucleophilic attack on CD junction through Michael addition on enol ethers present in
SLs, thus an easy leaving group as well as butenolide D ring is released, subsequently
mediating SL perception (Prandi et al., 2014; Zwanenburg and Mwakaboko, 2011;
Zwanenburg et al., 2009). In order to understand the response nuances observed not only
at genus level but also contrasting stereo-specificity displayed within species, detailed
insights are required to comprehend the mechanism involved in perception of SLs. For this
purpose series of synthetic analogues with modification of ABCD ring system have been
used (Bhattacharya et al., 2009; Jamil et al., 2018; Nefkens et al., 1997; Sanchez et al.,
2018; Zwanenburg and Mwakaboko, 2011; Zwanenburg et al., 2009). Also due to scarce
quantity of SLs produced as root exudates in picomolar amount/plant, the functional
structures are difficult to maintain, dampened by minimal synthesis rate. For same reason
natural SLs cannot be used for bioactivity assays when large amount of product is required
to actually generate a response while, organic synthesis has cost constrictions as well. All
the mentioned hitches in potential use of natural SLs prompted for chemical synthesis of
SL like synthetic compounds with structural requirements only required to maintain the
biological activity. These analogues not only serve as smart tool to decipher SARs but also
broadens choice of available modifications in structure according to practical applications.
Elucidation of their activity and structure relationships will further engender missing leads
in the perception and binding of natural and synthetic SLs in receptor bioactiphore (Artuso
et al., 2015; Lace and Prandi, 2016; Lombardi et al., 2017).
SLs biosynthesis and perception
Determination of SLs biosynthetic origin was carried out in a study where plants treated
with inhibitors of carotenoid biosynthesis lead to lower level of SLs in root exudates,
suggesting a biosynthetic link of SLs with carotenoids (Matusova et al., 2005). Following
this discovery, carotenoid cleavage dioxygenases based hypothetical SLs biosynthetic
pathway was proposed with β-carotene as a prime substrate of the reaction. Later on
Gomez-Roldan et al., (2008) and Umehara et al., (2008) independently discovered
carotenoid cleavage dioxygenases (CCDs) required for SLs biosynthesis. Both discoveries
unravel the detection of novel signalling molecule in plants responsible for inhibition of
Introduction Chapter 1
10
shoot branching/tillering in plants. Wide collection of branching mutants such as: more
axillary growth (max) mutants of Arabidopsis, dwarf (d) or high tillering dwarf (htd) of
Oryza sativa, ramosus (rms) of Pisum sativum and decreased apical dominance (dad) of
Petunia, particularly led to the detection of SL biosynthesis and signaling pathways (Arite
et al., 2007; Booker et al., 2005; Snowden et al., 2005; Waters et al., 2012).
Plastid localized carotenoid cleavage enzymes specifically cleaves double bonds in
carotenoid molecules to form carbonyl compounds called apocarotenoids (Auldridge et al.,
2006). Two SL biosynthesis related genes CCD7 and CCD8 have been characterized in
different plants like D17/HTD1, D10 in rice; RMS5/RMS1 in Pea, DAD3/DAD1 in Petunia
and MAX3/MAX4 in Arabidopsis respectively (Morris et al. 2001; Sorefan et al. 2003;
Booker et al. 2004; Arite et al. 2007). D27 an iron binding plastid localized enzyme works
upstream of CCD7 and CCD8 being all-trans to 9-cis-β-carotene isomerase enzyme, it is
responsible to catalyze the isomerization of trans-β-carotene into 9-cis-β-carotene. The
later acts as substrate for CCD7 enzyme activity to cleave cis configured carotenoids into
9-cis-β-apo-10′-carotenal (Alder et al., 2012). CCD8 then acts on the product of first
enzymatic cleavage to form a compound Carlactone (CL), which is an intermediate
compound in SL pathway and act as precursor molecule for more specific SLs as shown in
Figure 1.1.
The genes acting downstream to CL are mainly responsible for signal perception and
regulation. These Genes include More Axillary Growth 1 (MAX1) in Arabidopsis which
encode a cytochrome P450 CYP711A1 gene and is responsible for the conversion of
carlactone into functional SL like 5-deoxystrigol (Alder et al., 2012; Booker et al., 2004;
Stirnberg et al., 2002). MAX1 putatively converts CL into functional SL by rearrangements
and modifications (hydroxylation, oxidation), converting CL to carlactonic acid (CLA) and
methyl carlectonoate (MeCLA). Further investigation of MAX1 genes and its orthologues
in Arabidopsis and Rice revealed that this gene is expressed in all vascular tissues and
functions only in late steps of SLs synthesis and responsible for structural diversity of SLs
(Booker et al., 2005; Umehara et al., 2010). More recently, another gene was reported to
be involved in branching phenotype and act downstream of MAX1. This gene Lateral
Branching Oxidoreductase (LBO) in Arabidopsis encode oxidoreductase-like enzyme of
the 2-oxoglutarate and Fe (II)-dependent dioxygenase superfamily. It has been suggested
Introduction Chapter 1
11
that in Arabidopsis LBO has similarity to MAX3 in expression pattern. Downstream of
MAX1, LBO enzyme acts on products of MAX1 like MeCLA or CLA and convert it into
SL like compound responsible for branching phenotype (Brewer et al., 2016).
SLs signal transduction by α/β-hydrolase proteins
Components of SLs signal transduction and perception consist of F-box leucine rich protein
MAX2/RMS4/D3, α/β-fold hydrolase DWARF 14 (D14, DAD2) which act as receptor and
repressor proteins in rice (DWARF53 D53, SLENDER RICE1 SLR1) and Arabidopsis
(BRI1-EMS-SUPPRESSOR1 BES1). D3 and MAX2 are leucine rich F-box proteins
involved in regulation of shoot branching and SLs responses. Both protein have been
shown to be part of SKP1-CUL1-F-box-protein (SCF)-type ubiquitin ligase complex and
performs ubiquitination and subsequent proteosomal degradation of target protein,
repressor/negative regulators (Stirnberg et al., 2007; J. Zhao et al., 2014). Putative
orthologues of D14 have been identified in rice (D14), Arabidopsis (ATD14), Petunia
(DAD2), Barley (HvD14) and Black cottonwood (PtD14) by using SL signaling mutants
(Arite et al., 2009; Hamiaux et al., 2012; Marzec, 2016; Waters et al., 2012; Zheng et al.,
2016). All of these receptors are members of α/β-fold hydrolase family, capable of SL
binding and hydrolysis in vitro. D14 mediated perception of SL depends on catalytic triad
(Ser,His,Asp) for binding and hydrolysis of SLs (Hamiaux et al., 2012). It has been
proposed that MAX2/D3 act as recognition subunit in SKP1-CUL1-F-box-protein (SCF)
while D14 mainly via its hydrophobic ligand binding pocket and particularly Ser147/Ser97
residues (nucleophilic) in the triad, attacks the D ring (carbonyl of butenolide) separate it
from ABC part (Scaffidi et al., 2012; Zhao et al., 2013a). The nucleophilic attack on D ring
of SL brings some conformational changes in ligand binding cavity and triggers specific
protein-protein interactions. D14-SLs complex is subsequently recognized by SKP1-CUL1
containing MAX2/D3 and further target proteins are selected for degradation by
polyubiquitination in SL dependent manner. The likely targets of degradation include rice
protein D53, SLR1 (Jiang et al., 2013; Nakamura et al., 2013; Zhao et al., 2013) and BES1
in Arabidopsis (Wang et al., 2013). As a result of this degradation both the receptor
(D14/MAX2) and the Ligand (SLs) are hydrolysed (Chevalier et al., 2014).
Introduction Chapter 1
12
Figure 1.21.2 Signalling and perception pathway of strigolactones (Saeed et al., 2017)
The catalytic triad serving as ligand binding moiety in receptor D14 act as ligand binding moiety and attacks
the enol ether bridge of synthetic or natural SL. Upon binding D ring, bound SL receptor complex undergoes
conformational changes to make co receptor moiety the F-box/MAX2 to bind with the D14-Ligand complex.
Such interaction promotes further binding between MAX2 and its target(s), leading to ubiquitination and
degradation of the latter by the proteasome machinery and downstream signalling pathways.
Introduction Chapter 1
13
The D14 induced hydrolysis of Rac-GR24 and co-crystallization of D14 receptor-GR24
complex resulted in D14 bound hydrolysis intermediates. X-ray structural data coupled
with computational modelling and hydrogen-deuterium exchange mass spectrometry
revealed that, D14 prioritize the binding of SL in ligand binding pocket and then binds with
D3/MAX2 in SL dependent manner particularly on the surface residue of D14 (Zhao et al.,
2015). This interaction is followed by systemic destabilization and hydrolysis of receptor,
hormone and the effector protein which is required for SL perception as shown in Figure
1.2.
It is; however, noteworthy that D14/DAD2 are highly specific for SL perception and
depends on stereo-specificity of SL molecules. Enantiomers of biologically active SLs bind
differently with D14 receptor depending on their orientation and induce conformational
changes that platforms D3/MAX2 interaction (Flematti et al., 2016). The paralogues of D14
in Arabidopsis KARRIKIN INSENSITIVE 2 (KAI2) structurally very similar to former is
involved in signalling and perception of Karrikins (KARs). Unlike SLs, KARs are smoke
derived butenolide compounds that promote seed germination and development of young
seedling. Nevertheless, both D14 and KAI2 have similar mechanism of binding the ligand
and degradation of effector proteins (Kagiyama et al., 2013). Both signalling pathways
putatively converge at D3/MAX2 and proteosomal degradation of repressor proteins
depending of type of stimulus and physiological response (Challis et al., 2013; Nelson et
al., 2011; Waters et al., 2012). However, there is still an ambiguity how MAX2
discriminates between different signalling pathways to generate multitude responses.
Nonetheless D53 orthologue in Arabidopsis SMAX1 promote KAI2 dependent signalling
in young seedlings and is required for KAI2-dependent signalling in seeds and seedlings
but does not apparently play a role in the control of shoot growth (Li et al., 2015). The
hitches in the current understanding SL signal perception and transduction and receptor-
ligand dynamics are being decoded now with the help of synthetic analogues. One of the
major potentials of synthetic SL analogues and mimics is to obtain structure and activity
information according to targeted functions like parasitic weed germination, AM fungi
promotion, downstream SL functions in comparison to GR24 as reference compound. To
aid the screening and synthesis of effective analogues, computational tools were developed
Introduction Chapter 1
14
for in silico analysis. Still a lot of work has to be done in designing, testing and application
of SL analogues and screening their virtual efficacy in planta.
More aspects about SLs biosynthesis, perception, and signalling as well as structure-
function relationships have been nicely addressed and updated in several recent reviews
(Al-Babili and Bouwmeester, 2015; Janssen and Snowden, 2012; Ruyter-Spira et al., 2013;
Zwanenburg and Pospíšil, 2013).
SLs function in response to stress
Plants in field conditions are exposed to multiple stresses at the same time, one or more
stress combines leading to stress protective plant response. SLs have emerged to be
substantial players of plant stress physiology like nutrient starvation (Bonneau et al., 2013;
Marzec et al., 2013; Yoneyama et al., 2012), drought and high salinity (Bu et al., 2014; Ha
et al., 2014; Liu et al., 2013; Saeed et al., 2017; Visentin et al., 2016), light stress
(Gonzalez-Perez et al., 2011; Jia et al., 2014).
ABA, sometime referred as stress responsive growth regulator, due to its role in stomatal
closure act as long range signal triggered by abiotic stresses like drought, desiccation,
salinity, pathogen and wounding (Davies et al., 2002; Zeevaart and Creelman, 1988).
During dehydration, ABA accumulation is the prime response in plants for stress response
and ultimately stromal closure. However, de novo synthesis of ABA in leaves and roots is
also reported (Boursiac et al., 2013). These sudden changes in ABA level peculiarly act as
messenger to change the architecture of plants at root and shoot level (Davies et al., 2002;
Verslues and Zhu, 2005; Wilkinson and Davies, 2002). At molecular level changes in ABA
biosynthesis induce expression of many genes directly or indirectly by upregulation
/downregulation of transcription factors (Chandler and Robertson, 1994). Although ABA
is the most studied stress-responsive hormone, the role of SLs in regulation of ABA
mediated stress resilience emerging. Crosstalk between the different plant hormones results
in synergetic or antagonist interactions that play crucial roles in response of plants to
abiotic stress (Arc et al., 2013; Fahad et al., 2015; Fujita et al., 2011; Wani et al., 2016).
SLs focused research has entered into new phase of attempts to reveal the molecular level
interaction with ABA in monitoring stress resilience in plants, which is comparatively new
and of utmost importance. The shared carotenoid precursors and catalysing enzymes of
Field Code Changed
Introduction Chapter 1
15
SLs and ABA shed light on many unseen molecular crosslinks between the two hormones
(section results Figure. 3.15). However, the biosynthetic and developmental interactions
suggest the underlying role of ABA on production or regulation of SLs and ABA (Saeed
et al., 2017). It is tempting to speculate that both hormones interact with each other at the
biosynthetic level, and that induction of ABA biosynthesis influences SLs formation and
vice versa. However, recent work done to reveal such endogenous interaction at
biosynthetic level have been sought in different prospects.
SL-ABA regulation during Abiotic stresses
In the first report of SL-ABA regulation and/or interaction ABA synthesis was blocked by
the specific NCEDs inhibitors (Abamine SG), the synthesis of 3 major SLs in tomato were
also observed to be dampened when compared to WT. Along with the reduction of SLs,
there was slight reduction of ABA in roots of treated plants (López-Ráez et al., 2010).
Interestingly, to investigate that low level of SL also affects ABA in the same way, plants
treated with inhibitor of SLs biosynthetic genes didn’t show any effect on ABA in roots.
The role of ABA in SL biosynthesis is apparently dependent on ABA level in roots, which
acts a signal to activate organ specific response. However, so far only few experimental
endeavours have been taken to unravel such interaction that too with partial contradictions.
Until now, the mechanism of how ABA affects SL or vice versa is still to some extent
ambiguous. Later Arabidopsis SL biosynthetic and signalling max mutants were subjected
to drought and salinity stress to investigate the involvement of SLs in abiotic stress
resilience. Both SL deficient and response mutants showed stress sensitive phenotype at
different developmental stages (Ha et al., 2014). If SLs contribute to drought resistance
one would expect their levels to increase under stress. This may be true in shoots, where
although metabolites remain under the detection threshold, the transcript of biosynthetic
genes are more concentrated in dehydrated than unstressed wild-type tissues, both in
Arabidopsis and tomato. However, surprisingly, the opposite is true for the main site of SL
production under normal conditions, i.e., the roots. There, both the transcript of genes
involved in SL biosynthesis and exudation, and the metabolites themselves in tissues and
exudates, were markedly decreased by drought or salinity in non-mycorrhized tomato
(Ruiz-Lozano et al., 2016; Visentin et al., 2016) and by osmotic stress in Lotus (Liu et al.,
2015). In the latter set of experiments, even the increase of SL exudation triggered by P
Introduction Chapter 1
16
starvation alone was reversed to a sharp decrease under combined osmotic/low-P stress,
indicating that in the case of multiple stresses, response to one can override the other. The
role of SL in circumventing abiotic stresses was further proved by exogenous application
of SL, where SL deficient mutants were rescued from abiotic stress but SL signalling
mutants were not. Further, exogenous ABA applied on SL depleted plants, to check if, SL
compromised plants under stress could be rescued with ABA as they did with exogenous
SL. Interestingly all SL mutants were insensitive to various concentrations of ABA as
compared to WT plants at germinating and seedling developmental stages. It was unclear
if SLs exerts their role in drought and salinity due to ABA or later regulate SLs when stress
is perceived. It could be presumed that both phytohormones target some shared protein and
/or genes which are drought/salinity inducible. In fact, ABA importer genes were found to
be downregulated in SL signalling mutants under normal as well as drought conditions
pointing towards failed or reduced stomatal closure even after application of ABA. Finally,
both MAX3 and MAX2 reduced expression under dehydration in SL signalling mutant
when compared with WT provides additional clue for regulatory role of SL in stress
tolerance. In addition, both genes were shown to be upregulated by stress and/or ABA
treatment. This also evinces that changes in SL synthesis is not only dependent on nutrient
limitation but also on endogenous ABA, which plays regulatory role in SL signalling at
post transcriptional level rather than correlation at enzyme levels (López-Ráez and
Bouwmeester, 2008).
Sensitivity of max2 i.e. SL signalling mutant in Arabidopsis against abiotic stresses as
reported by Ha et al., (2014) was somewhat confirmed by Bu et al., (2014) with shared
conclusion on hypersensitivity of SL signalling mutants to dehydration and elevated
transpiration rate due to reduced stomatal closure as compared to WT.
severalSeveral evidences to support interaction of both hormones at various level have
been mentioned and taken together role of SLs in ABA dependent and/or independent
stress resilience cannot be over-looked and further insights may reveal missing clues to the
puzzle. Positive role of SLs in osmotic stress and organ specific SL mediated stress
response was demonstrated in Lotus japonicas. Osmotic stress and nutrient starvation
together repressed ABA level in SL depleted shoots of Lotus as compared to WT, while in
root this effect was found missing. Since P starvation alone can alter SL but not ABA
Introduction Chapter 1
17
levels, but when both stresses P starvation and osmotic stress were combined a potent
interaction between two hormones was reported in SL deficient Lotus plants (Liu et al.,
2015). The mutants were found to be more prone to dehydration due to more loss of water
and altered stomatal conductance. In fact, ccd7 plants remained hyposensitive to exogenous
application of ABA (low concentration 5-20uM) just like Ha et al., (2014). This certainly
shows that endogenous SL have important positive role in stress modulation in ABA
dependent and/or independent manner at shoot level. If SLs do have role in improvement
of plants status when exposed to abiotic stress, then it could be possible that abiotic stress
other than P starvation can limit SL exudation as well. These organ specific dynamics were
interesting to speculate that roots and shoots perceive SL-ABA interactions in different
manner under stress condition.
As mentioned previously ABA mediated organ specific dynamics during dehydration are
main source of depletion or accumulation of ABA in roots and/or shoots (Manzi et al.,
2015). Likewise, SLs are reported to display shoot specific accumulation during osmotic
stress and decipher different root/shoot related dynamics under stress and normal
conditions. Both hormones travel towards shoot, during the drought stress SL level
decreases in roots which triggers localized ABA synthesis in roots as a chemical signal for
stress for above ground parts. However, SL depleted shoots during abiotic/drought stress
experience decrease in the level of ABA in shoots while in roots there is no such effect.
Thus drought hypersensitivity and ABA hyposensitivity shown by SL depleted plants
(Tomato, Lotus, Arabidopsis) is a persuasive proof that during the stress, ABA needs SLs
at shoot level to exert its effects (Saeed et al., 2017)
In tomato WT/SL- hetero grafts of SL depleted root stocks and WT scions, which mimics
partly the mild stressed state depicted low stomatal conductance under normal conditions.
This observation confirmed the previous hypothesis that SL decrease in roots (that occurs
normally under stress) and slow increase in ABA, platforms a pseudo stress state in shoots
which becomes more sensitive to ABA and consequently low stomatal conductance occurs
(Visentin et al., 2016). This acclimation to drought/osmotic stress in shoots require SLs.
Seemingly as reported before (Lotus and Arabidopsis) and unlikely in tomato ccd8, whole
plant SL depletion (self-grafted SL-/SL-) increases the ABA level in roots and shoot
making SL depleted shoots, hyposensitive to exogenous ABA and hypersensitive to
Introduction Chapter 1
18
drought stress. Interestingly, to this model of SL mediated negative regulation of ABA in
stress response, the shutdown of SL in roots has been proposed as mobile signal which is
proposed to travel towards shoots by unknown players/regulators of stress adaptive
response. This could still keep SL-ABA façade under vital new discoveries to find missing
links.
In conclusion, so far role of SLs/ABA crossroads reflect the explosion of interest and
considerable progress that has recently been made in the dynamic field of plant biology,
with a particular focus on better understanding hormonal cross-talk in plant development
and stress responses. The growing interest in involvement of SLs as new players in abiotic
stress tolerance is escalating because of wide focus on possibility of phytohormones
engineering. Our growing knowledge of SLs definitely require deep insights into SL-ABA
dilemma before it could be used for improvement of crops under natural stress conditions.
These interactions are key regulators of plant adaptation to diverse range of stress levels
conferred by the plant and are mostly sought to understand how SLs biosynthesis and
regulation is linked to other factors for SL-regulated developmental processes. It is
tempting to speculate that overexpression of SL biosynthetic genes could create a quasi-
stress condition and organ level dynamics of both SL-ABA hormones can improve stress
tolerance or at least stress avoidance.
Tomato as model organism
Tomato being short-lived perennial dicot are cultivated mainly for their fruits, which are
considered savoury for their flavour. Plants are 1–-3m long, herbaceous, may grow as vines
or bushy and sprawling depending on their determinate or indeterminate nature. In addition
to high nutritious value, it also serves as a great tool for advancements in plant
biotechnological research. Tomato is a great model system for both basic and applied
research due to number of useful features it possesses. The relatively short life cycle,
smaller genome (950 Mbp), high self- fertility or inbreeding rate and homozygosity, ability
of asexual reproduction and heterografting, controlled pollination, ability to develop
haploids, availability of transformation system and diverse germplasm has made tomato
ideal model system for improvement of other dicotyledonous plants (Ling et al., 1994).
Interest in tomato as model plant in recent years has considerably increased due to
Introduction Chapter 1
19
availability of tomato genome sequence (Tomato Genome Consortium, 2012) and due to
its inherit adaptability to fluctuating growing conditions. The dwarf cultivar Micro-Tom
was created by crossing Florida Basket and Ohio 4013–-3 predominantly for ornamental
purpose is considered as emerging model system bearing all the above mentioned unique
characteristics (Kobayashi et al., 2014; Matsukura et al., 2008). After whole genome
sequencing of tomato “Heinz 1706” by an international collaboration (Tomato Genome
Consortium 2012), the reference genome sequence has been made available to compare the
DNA polymorphism and phenotypic differences across various cultivars of S.
lycopersicum. Several dedicated studies have been initiated after the availability of
reference genome sequence and mapping data regarding comparative transcriptomics and
expression analysis of genes associated with environmental stress response in wild as well
as cultivated tomato varieties for improvement of desirable traits (Aflitos et al., 2014;
Koenig et al., 2013; Lin et al., 2014). Tomato has been used as genetic model for fruit
crops for sequence and expression analysis, gene cloning as well as QTL mapping (Frary
et al., 2000; Zamir, 2001) due to its phylogenetically distant nature from routinely used
model plant organism like Arabidopsis, pea, rice, maize or poplar.
Tomato cultivation in Pakistan
Since, tomato is a subtropical crop hence annual production decline due to environmental
constrains such as temperature fluctuation, drought or excessive rains, compromised soil
conditions and pest/insect infestation (Hamza and Chupeau, 1993; Plastira and Perdikaris,
1997). According to food and agriculture organization (FAO) statistics Pakistan is ranked
34th among tomato producers globally. It is the second most cultivated crop and the
production has steadily increased from 268,800 tons in year 2000-01 to 561,900 tons during
2008-09. 599,588 tons of tomatoes has been produced from 62,930 hectares of land under
cultivation in 2014 (FAOSTAT, 2015). However, the annual production of tomato is less
than other countries in Asia. Nonetheless, favourable summer environment and ambient
temperature, yield losses due to pathogen invasion and devastating monsoon during the
year 2014–-2015, Pakistan has imported tomato from the neighbouring countries of worth
PKR 9.5 million [Ministry of National Food Security & Research Pakistan]. Tomato is
grown throughout the year in some parts of the country part of the country; however, being
Introduction Chapter 1
20
subtropical crop most of the commercial varieties are sensitive to different environmental
stresses, including salinity, drought, and excessive moisture etc. Hence, the supplies are
substantially reduced during intense heat and rains of summer and monsoon months from
June to August. In the hot-wet season, production shifts from lowlands to the relatively
cooler and dryer highlands. Because high land production areas are limited, tomato supply
dwindles in the wet season resulting in drastic price increases. Another period of stress is
the onset of frost during December and January when production is depressed. There is
limited genetic variation for abiotic stress tolerance within the cultivated species. Tomato
crop is also very susceptible to viruses (TMV, TYLCV) and mosaic diseases, especially
when the crop is transplanted early during the months of August-September (Khokhar,
2013). Activity of virus vector especially whitefly is very high at that time of the year.
Nematode problem is also becoming another serious problem. . Prevalence of high
temperatures in Punjab limits the production period in summers. Furthermore, variations
in biotype of insects and resistance development in plants against phytopathogens has been
a great threat to tomato production (Chaudhry et al., 2010; Shakoor et al., 2010).
Tomato varieties grown in Pakistan
Most commercial varieties grown widely in Pakistan have been imported from other
countries like USA and Europe. Total of 326 genotypes including determinate and
indeterminate varieties are cultivated with some exclusive preference due to
yield/productivity. Important varieties include determinate Nagia, Pakit, Naqeeb,
Riogrande, Roma, Napoli, Northern delight, while indeterminate include Baluchistan
cherry, Orange roma, New cherry, Nepal, Beef steak. Various hybrids have been developed
so far by crossing varieties with most desirable traits like fruit quality, shelf life, and
resistance to abiotic and biotic factors. Two new lines of hybrid tomatoes have been
established with desirable traits (yield/pathogen resistance) Sundar Hybrid (suitable for
high tunnels) and Ahmar Hybrid (low tunnels) by vegetable research institute Faisalabad
and being tested at multiple locations (Najeebullah, 2014).
Introduction Chapter 1
21
Challenges faced by tomato production
Biotic factors
Notwithstanding the importance of tomato as most cultivated vegetable crop, the
production is facing myriad of pitfalls due to environmental challenges like pest and
pathogen invasions. Tomato hosts >200 species of a wide variety of pests and pathogens
that can cause significant economic losses. These pests, often carrier of viral diseases are
significantly undermining the tomato chain due to pre and post-harvest yield losses
(Shakoor et al., 2010). Frequently, these pests and pathogens have to be controlled by using
chemical compounds like fungicides or pesticides. These methods may not be fully
effective, raise production costs and require compliance with chemical-use laws. They also
cause concern regarding potential risk for the growers, the consumers and for the
environment. The biotic factors includes viruses causing leaf curl and leaf mosaic, fungi
responsible for wilt and powdery mildew, bacterial scab caused by Xanthomonas
campestris and nematodes are responsible for devastating diseases leading to yield losses/
Arce up to 40% (Arshad et al., 2014; Oerke, 2006).
Abiotic factors
Abiotic stresses have far more indiscriminating impact on tomato production and causing
number of impediments to yield and cultivation of tomatoes. Most of commercial verities
are sensitive to environmental constraints in the form of abiotic stresses including salinity,
drought, humidity, nutrient starvation, temperature extremes, poor soil and water logging
conditions, oxidative shock, exposure to free radicals, UV irradiation, abnormal light and
unpredictable rainfall. Unlike abiotic stresses, resistance to abiotic stresses is a complex
process; many factors circumvent each other and often pose combined stress to plants.
Being perishable commodity post-harvest handling and losses, phenotypic disorders
(cracking, scalding, sun burning), temperature fluctuations also affect the market value of
tomato. Abiotic stresses lead to reduction in average production of tomato by 50%
worldwide (Lobell et al., 2011; W. Wang et al., 2003). Due to current scenario of drastic
climate changes abiotic stress like increased temperature and decrease precipitation can
enhance fecundity of certain pest and pathogen increasing the chances of host range
Introduction Chapter 1
22
expansion and certain biotype resistance to plant defense mechanism, thereby
combinatorial stressors cause devastating loss to tomato food chain (Kissoudis et al., 2016).
Tomato is highly sensitive to abiotic stresses like salinity, drought, oxidative burst,
extreme temperatures. Salinity and drought are two major constraints that limit the average
yield of tomato worldwide. Tomato grown in open field are often affected by high soil
salinity conditions. In early stages of life cycle it is responsible for inhibition of seed
germination while in later stages increased osmotic stress can cause stunted growth, tissue
necrosis, leaf rolling, and malfunctioned photosynthesis (Mittler, 2006). Drought and
salinity are often manifested together in tomato cultivation combinedly termed as osmotic
stress are accounted for physiological, molecular and biochemical changes in overall
homeostasis and ionic balance of plants. Similarly oxidative stress is often caused by
extreme water deficit due to high temperature and salinity leading to deleterious effects on
cellular proteins (Serrano et al., 2012). Furthermore, combinatorial stress factors are found
to exacerbate the competitive weed growth thus worsening the water use efficiency of
tomato plants (Fontanelli et al., 2013; Ziska et al., 2010).
Genetic engineering for improved stress tolerance
Conventional breeding for desirable traits and genetic engineering are two prime methods
for incorporation of important traits in crops. However later, is a robust tool for
introduction of single as well as complex pathways to regulate the temporal and spatial
expression of genes (Ali et al., 2010). Currently numeral technologies are available for
genetic improvement with transgenes encoding transcription factors, enzymes, membrane
proteins and biosynthetic pathways. Common methods for genetic transformation involve
direct and indirect gene transfer. Direct methods of gene transfer include microinjection
through direct injection into plant cell, direct DNA delivery into the plant by micro
projectile gene transfer through biolistic and high-speed laser beam are widely used. While
less efficient methods include vacuum infiltration, ultrasound waves (Birch, 1997;
Crossway et al., 1986; Klein et al., 1987). Indirect gene transfer technology is mainly based
on biological methods (Rao et al., 2009). Although direct gene transfer methods are more
popular among plant biotechnologist for introduction of genes due to simple and
straightforward procedure; however, they are expensive and often lead to low
Introduction Chapter 1
23
transformation efficiency. Agrobacterium tumefaciens and Agrobacterium rhizogenes are
mainly used soil borne bacteria for indirect gene transfer responsible for causing crown
gall disease by transfection of tumor inducing plasmids in host plant (Hooykaas, 2010).
This characteristic has been utilized for binary vector system, where plasmids are disarmed
and gene of interest is placed between T- DNA borders of Ti plasmid. Necessary oncogenic
and virulence gene are placed in a second vector. Upon transfer both plasmid homologous
recombination occurs and the T- DNA region with gene of interest is transferred to host
plant as a mode of transfection (Brothaerts et al., 2005; Gelvin, 2010; Lee and Gelvin,
2008). The Agrobacterium based binary vector system can be used for stable as well as
transient expression of genes. Thus, WT tumor inducing genes are removed and replaced
with the desired gene and propagated via advance expression vector system (Horsch et al.,
1985) with known selectable marker gene systems such as those encoding for
Kanamycinkanamycin resistance (Cheng et al., 1994). Agrobacterium mediated
transformation is by far most widely used method for stable integration of gene into
transcriptionally active region of chromosomal DNA (Aldemita and Hodges, 1996). This
method has been successfully used and reported for transformation of several
dicotyledonous plants such as cotton, potato, tomato and soybean (Ma et al., 2015;
Wimmer, 2003). Overview of transformation procedure is shown in Figure 1.3.
Introduction Chapter 1
24
Figure 1.3 Overview of Agrobacterium mediated transformation in plants
Introduction Chapter 1
25
Factors effecting tomato transformation
Although reports of tomato micropropagation and transformation are widespread since first
report (McCormick et al., 1986), different explant sources have been utilized for
organogenesis, still the process of in vitro regeneration is slow. The overview of successful
tomato ceall culture and transformation events has been summarized in Table 1.1.
In tomato the gene transfer via Agrobacterium is exceedingly genotype dependent
(Compton and Veilleux, 1991; Liza et al.,2013; Moghaieb et al., 1999; Rakha et al., 2011).
Most often the morphogenesis and totipotency of tomato has been reported to be lower
than other members of Solanaceae (Anne Frary and Earle, 1996; Trujillo-Moya et al.,
2014). In vitro morphogenesis response of various tomato cultivars relay on number of
factors such as genotype, type/size/age of explant, media formulations and growth room
conditions (humidity, temperature, photoperiod) due to which tomato transformation is not
reliable nor straightforward (Bhatia et al., 2005). Many established protocols for
transformation are laborious, time consuming and cumbersome involving preculture on
feeder layers of tobacco and/or petunia and that is also exceedingly genotype dependent
(Hamza and Chupeau, 1993; Plastira and Perdikaris, 1997). Thus establishment of
reproducible protocols for in vitro morphogenesis via direct organogenesis and somatic
embryogenesis can uplift the advancements for production of stress tolerant improved
varieties, disease free plants, germplasm conservation and rapid multiplication of in vitro
grown plants (Arshad et al., 2014; Devi et al., 2008).
Tissue culture techniques are now widely used for improvement of field crops, forest, and
horticulture and plantation crops for increased agricultural and forestry production. Today
tissue culture technology is utilized mainly for large-scale production of elite planting
material with desirable characteristics. This technology has now been used commercially
and has remarkable contribution in the high-quality production of planting material
(Horsch et al., 1985). Using in vitro regeneration potential of tomato many genes,
transcription factors and enzymatic pathways have been successfully engineered in tomato
for abiotic stress tolerance specially drought (Arshad et al., 2014; Ijaz et al., 2017; Zhang
et al., 2011; Zhang and Blumwald, 2001). Nevertheless, tThe bottleneck of tomato
Introduction Chapter 1
26
transformation is lack of universal protocol applicable to all verities irrespective of cell
culture intractability.
For successful transformation, various factors that affect overall transformation efficiency
needed to be optimized. These factors are detrimental cause of low transformation rated in
many crop plants include nutrient media, genotype, age and type of explant, plant growth
regulators (PGRs), culture conditions and pH (Wu et al., 2006). In vitro regeneration in
different genotypes and cultivars of tomato has been reported from leaf (Behki and Lesley,
1980), cotyledons (Costa et al., 2000; Hamza and Chupeau, 1993), hypocotyls (Chen et
al.,1999), meristems (Mirghis et al., 1995), inflorescence (Compton and Veilleux, 1991),
anthers (Zamir et al.,1980), suspension cells (Nover et al.,1982). Studies have shown that
explant characteristics are highly effective for the success and commercial viability of
tissue culture systems (Akin-Idowu et al., 2009; Bhau and Wakhlu, 2001).
Explants of different age have differing level of endogenous phytohormones, which shape
their response towards outer environment, and overall morphogenesis is also influenced.
Similarly the concentration of PGRs and various combinations were also found cultivar
dependent (Jehan and Hassanein, 2013; Kurtz S.M. Lineberger R.D. and Kurtz, S.M.
Lineberger, 1983; Plastira and Perdikaris, 1997), Therefore, development of callus cultures
and their subsequent morphogenesis with right PGRs is a prerequisite for cell cultures.
Different PGRs mainly auxins (Naphthaleneacetic acid NAA, Indole-3-acetic acid IAA,
Dichlorophenoxyacetic acid 2,4–-D) and cytokinins (Kinetin KIN, Zeatin ZEA,
Benzylaminopurine BAP) alone and their ratio may lead to variable regeneration response
(Bhatia et al., 2004, 2005). The right concentration and combination of PGRs determine
the mode of de differentiation. For example, in tomato cell culture regeneration can be
induced by callus induction or somatic embryogenesis. The fate of de differentiation and
subsequent regeneration depends on type of exogenous impulse in cell culture (PGRs and
pH). Conventional callus mediated organogenesis and embryogenesis, both are widely
used for in vitro regeneration in tomato (Dubois et al., 1990). However, latter has been
demonstrated as a process consisting of callusing and redetermination of cells and genotype
independent regeneration in plants. An outline of in vitro regeneration has been shown in
Figure 1.4.
Introduction Chapter 1
27
Figure 1.4 Schematic overview of in vitro regeneration in tomato
Introduction Chapter 1
28
Table 1.1 An overview of in vitro regeneration events and tranformation done in tomato
Cultivar
Name
Ex-plant type Age of Ex-
Plant
PGR
used
Response Reference
Avinash,
PusaRuby
and Pant
Bahr
Hypocotyls and
leaf discs
2-3 weeks IAA,
BAP,
GA3,
Kinetin
Callus leading
to regeneration
with IAA 0.5
mg/L + Kinetin
1.5 mg/L + GA3
0.5 mg/L
(Afroz et al.,
2009)
Not
specified
Leaf, stem,
cotyledons
15 days old IAA,
BAP, Kn
Direct
organogenesis,
Massive
Shooting and
Rooting
(Sheeja et al.,
2004)
Money
maker
Leaf disc
Hypocotyl
----------- NAA,
IAA,
BAP,
IBA, Kin
and
Zeatin
Callogenesis
(Chaudhry et al.,
2010)
Dhanashri Cotyledonary
leaves and
hypocotyls
15-days old IAA,
BAP,
IBA
Direct
organogenesis,
shoot formation,
and rooting
(Wayase and
Shitole, 2014)
Roma Meristem (root,
leaf, Node,
internode
------------- 2.4-D,
BAP,
NAA,
Kin
callogenesis
(Ishfaq et al.,
2012)
Roma, cv.
Riogrande
Grande,
Money
maker,
Nagina and
Festo
Hypocotyls, leaf
disc and shoot tip
17-18 zeatin
(ZEA)
and
(IAA)
Direct
organogenesis
(Nyla Jabeen,
Zubeda Chaudhry
And Mirza, 2003)
Money
maker
Cotyledon 7–10 IBA, IAA Direct
organogenesis
(Saker et al.,
2011)(Saker et
al., 2011)
Introduction Chapter 1
29
Daniela 144,
Brillante
179, Annan
3017, Galina
3019 and
Bernadine
5656
Cotyledon,
hypocotyls
7-10 IAA,
Zeatin,
BA, 2,4D
Optimal
regeneration
(Velcheva et al.,
2005)
Micro-Tom Cotyledon 4-5 IAA, IBA Callogenesis
and regeneration
(Qiu et al., 2007)
Hezuo 908 Cotyledon,
hypocotyls
10 IAA,
BAP
Direct
Organogenesis
(Sun et al., 2015)
cv.
Riogrande
Grande
Cotyledon 10 Zeatin,
IAA
Regeneration (Arshad et al.,
2014)
CastleRock Cotyledon,
hypocotyl
7 IAA,
ABA, BA
and
Zeatin
Callogenesis
and
organogenesis
(Abu-El-Heba et
al., 2008)
Micro-tom Cotyledon ----- Zeatin,
NAA
0.05mg/L
rooting
1.5mg/L
shooting
(Guo et al., 2012)
Rhubarb Cotyledons ----- IAA,
6BA
Direct
organogenesis
2.0 mg/L 6-BA
+ 0.2 mg/L IAA
0.5mg/L IAA
for rooting
(Juan et al., 2015)
Pusa ruby Cotyledon discs
and hypocotyl
30 BAP,
NAA
Regeneration/
organogenesis
(H D Sherkar and
A M Chavan,
2014)
Super Strain
B and Rio
Grande
Cotyledons,
hypocotyls
7-10 Zeatin,
IAA
direct
organogenesis
(Hanafy Ahmed
A. H, 2015)
UC82B Cotyledons 8 Zeatin,
IAA
Organogenesis (Cortina and Culi,
2004)
Micro-Tom Leaf 4 weeks BAP,
IAA and
Zeatin
Callogenesis
and
organogenesis
(Cruz-Mendívil
et al., 2011)
Introduction Chapter 1
30
Rio, Roma,
Money
maker
Leaf discs,
hypocotyls
----- BAP,
IAA,
Zeatin,
IBA
Organogenesis/
Shoot induction
(Shah et al.,
2016)
Zheza
No.905
Cotyledon, stem 4-5 NAA,
BA
callogenesis (Ma et al., 2015)
------ Leaf 2 months Kinetin,
2,4-D
Callogenesis (López et al.,
2015)
Roma, Rio
Grande
money
maker
Hypocotyl, leaf
discs
------ IAA,
BAP,
NAA,
GA3, 2Ip
and
Kinetin
Direct
organogenesis
and callogenesis
(Chaudhry et al.,
2007)
IPA 5 Anther ------ NAA,
BAP and
2,4-D
Callogenesis (Brasileiro et al.,
1999)
.
Introduction Chapter 1
31
Research aims
The objectives of Ph.D. thesis are
1. Deciphering the role of SLs in stress physiology, isolation and Cloning of CCD7 gene into
dicistronic vector system (Ali et al., 2010) driven by a constitutive promoter.
2. Screening the promising cultivar(s) of Solanum lycopersicum L by cell culture and vector
functionality in tomato through transient leaf infiltration assay followed by stable
Agrobacterium mediated transformation.
3. Molecular characterization of developed transgenic plants and comparative physiological
parameter studies under abiotic stress (dehydration).
4. Designing and synthesis of SL analogues and in planta SL quantification assay in
genetically encoded Arabidopsis model system.
o Array of SL related analogues and mimics will be tested via biological assays in parasitic
weed, receptor binding luminescence assay and validated through computational tools
o In planta quantitative assay to study SL-ABA and stress responses in Arabidopsis as a
model.
Materials and Methods Chapter 2
32
Chapter 2
Materials and Methods
Materials and Methods Chapter 2
33
2. Material and Methods
Experimental procedures
Plant material
The research was carried out at Plant Biotechnology & Molecular Pharming (PBMP) Lab,
COMSATS University Islamabad, Pakistan during 2014-2019. The seeds of three local
tomato cultivars cv. Riogrande, cv. Romagrande, Hybrid -17905 were obtained from
Institute of Agri-Biotechnology & Genetic Resources (IABGR) NARC, Islamabad. One
model cv. M82 was obtained form (DISAFA-Italy) were used for cell culture optimization.
Seeds of transgenic Arabidopsis pD14::D14::LUC were obtained from NCB Madrid Spain.
Seeds storage was maintained at 4oC in dark to break dormancy of the seeds and optimal
seed vigor.
Sterilization and germination of seeds
For seed sterilization, the seeds of all four varieties were first rinsed with autoclaved double
distilled water followed by immersion in 70% ethanol for 1-2 min and transferred to
different combinations of disinfectants [(NaOCl), (v/v1%-20%)], 6% NaOCl with 2 drops
of tween 20 and house hold bleach (8%) [Table 2.1]. Following sterilizationsterilization, ,
the seeds were washed five times with deionized autoclaved water and blotted dry on
sterilized filter paper. 150 seeds for each treatment were utilized in three replicates. Seed
were aseptically placed on MS growth media plus vitamins [Phytotechlabs, Product No.
M519] (Murashige and Skoog, 1962). Both full strength and half strength MS media with
varying concentration of sucrose (0%, 1%, 2% and 3%) were evaluated for their effects on
in vitro germination rate of tomato seeds. Two different gelling agents were individually
tested to solidify the culture medium: 8.0 g/L micropropagation grade plant agar
(Phytotechlabs Product ID. A296) and 4.0 g/L Phytagel (both gelling agents and
concentrations were optimized during preliminary experiments). All basal media consisted
of 4.15 g/L MS salts plus vitamins with 8.0 g/L plant agar and 20 g/L sucrose as otherwise
stated (Table 2.2). The pH of medium was adjusted to 5.8 before autoclaving. Seeds were
kept for 48 hr in dark and subsequently maintained at 23oC2, with 30–-50% humidity and
16/8 hr Light/Dark photoperiod provided by 70 μmolm-2s-1 cool white fluorescent lights in
Materials and Methods Chapter 2
34
growth room. Germination index was calculated from age of 8 days for newly emerged
seedling until 80% germination was achieved.
Table 2.1 Treatments used for seed disinfection
Disinfection
treatment
NaOCl
(% v/v)
House Hold
bleach (% v/v) Tween 20
T1 1 - -
T2 2 - -
T3 3 - -
T4 5 - -
T5 6 - -
T6 6 - 2 drops
T7 10 - -
T8 15 - -
T9 20 - -
T10 - 8 -
T11 2% or 50% v/v -
Materials and Methods Chapter 2
35
Table 2.2 Optimized media formulations for in vitro morphogenesis and transformation of
S. lycopersicum cultivar(s)
Optimized medium used for regeneration and transformation of tomato
Culture medium Additional Components
Germination medium (GM) 3.17 g/L MS salts, 8 g/L plant Agar and pH 5.8
Callus induction medium
(CIM)
4.15 g/ L, 20 g/L sucrose, 8 g/L plant Agar ,2 mg/L
NAA, 2 mg/L IAA, 2 mg/L BAP, 4 mg/L KIN pH
5.8. OR
4.15 g/ L, 20 g/L sucrose, 4 g/L Phytagel, 2 mg/L
NAA, 2 mg/L IAA, 2 mg/L BAP, 4 mg/L ZEA and
pH 5.8 (cv. M82)
Shoot induction Medium
(SIM)
4.15 g/ L MS salts, 20 g/L sucrose, 8 g/L plant Agar
,3 mg/L BAP and 0.1 mg/L IAA pH 5.8
Root induction Medium (RIM) 4.15 g/L MS salts, 20 g/L sucrose, 8 g/L plant Agar
and 0.5 mg/L NAA or 1 mg/L IBA pH 5.8
Rhizoids induction medium
(RhIM)
4.15 g/L MS salts, 20 g/L sucrose, 8 g/L plant Agar,
0.5 or 2 mg/L NAA and pH 4.0
Tubers induction Medium
(TIM)
4.15 g/L MS salts, 20 g/L sucrose, 8 g/L plant Agar,
5 mg/L BAP or 5 mg/L TDZ and pH 4.0
Pre-Culture Medium (PCM) 4.15 g/L MS salts, 20 g/L sucrose, 8 g/L plant Agar,
1 mg/L NAA, 1 mg/L BAP and pH 5.8
Co-Cultivation Medium
(CCM)
4.15 g/L MS salts, 20 g/L sucrose, 8 g/L plant Agar,
2 mg/L NAA, 2 mg/L IAA, 2 mg/L BAP, 4 mg/L
KIN and 200 μM acetosyringone Acetosyringone
and pH 5.8
Selection Medium (SM) 4.15 g/L MS salts, 20 g/L sucrose, 2 mg/L IAA, 2
mg/L BAP, 4 mg/L KIN, 300 mg/L Cefotaxime
cefotaxime or 300 mg/L Augmentinaugmentin, and
600 mg/L Ticarcillin ticarcillin pH 5.8
Infiltration Medium (IFM) 4.15 g/L MS salts, 20 g/L sucrose, 2 mg/L NAA and
200 μM acetosyringoneAcetosyringone
Inoculation Medium (IM) 4.15 g/L MS salts, 20 g/L sucrose and 200 μM
acetosyringoneAcetosyringone
Materials and Methods Chapter 2
36
Cell culture experiments
Effect of plant growth regulators (PGRs) on callus induction via
direct organogenesis
Tomato seedlings, one-week post emergence were deemed suitable explants for this study.
Well-developed cotyledons of about 2 cm in size were selected and thereafter excised. The
distal and proximal ends of the cotyledons were aseptically cut with a sterile blade and
approximately 1 cm explants were prepared. Depending on the seedling vigor and
genotype, seedlings were allowed to grow for 3 weeks time until they have fully expanded
cotyledons. Just below cotyledonary node an acropetal cut was made to excise hypocotyls
measuring 1 cm. Explants were horizontally placed on culture vessels with their adaxial
side (cotyledons) in contact with callus induction medium (CIM). 17 different MS basal
media formulations with varying concentrations of PGRs like Naphthalene acetic acid
(NAA), 6-Benzylaminopurine (BAP), Indole-3-acetic acid (IAA), Kinetin (KIN), Zeatin
(ZEA), 2,4–-Dichlorophenoxy acetic acid (2,4–-D) and Gibberellic acid (GA3) were used
independently and in combinations enlisted in Table 2.3. The stock solutions were prepared
as 1mg/mL (1000ppm) for ease of comparison. However, to compare the molecule-
molecule diffrences among same class of growth regulators, equivalent µM concentration
of each hormone is also calculated (Appendix II). Different cytokinins were used in
increasing concentration while keeping a fixed or low concentration of auxins. NAA
(alone), BAP + NAA, BAP + IAA, combination of two cytokinins (BAP, ZEA, KIN) and
auxins analogues (NAA, IAA, 2, 4–-D) were tested. Callus induction frequency on all
hormonal combinations was recorded after 4 weeks of treatment and calculated with the
equation:
Percentage of callus induction (%) = No of callus forming explants ×100
Materials and Methods Chapter 2
37
Table 2.3 List of callus induction media used in the study
Treatment (Callus
induction Medium) CIM
Contents
CIMT0 (MS basal medium) 4.15 g/L MS salts+ vitamins +2% Sucrose +0.8% plant
agar pH 5.8
CIMT1 0.2 mg/L NAA (MS basal medium)
CIMT2 0.5 mg/L NAA (MS basal medium)
CIMT3 1 mg/L NAA (MS basal medium)
CIMT4 2 mg/L NAA (MS basal medium)
CIMT5 0.2 mg/L NAA+1 mg/L BAP (MS basal medium)
CIMT6 0.2 mg/L NAA+2 mg/L BAP (MS basal medium)
CIMT7 0.2 mg/L NAA+3 mg/L BAP (MS basal medium)
CIMT8 0.2 mg/L NAA+4 mg/L BAP (MS basal medium)
CIMT9 0.5 mg/L NAA+1 mg/L BAP (MS basal medium)
CIMT10 1 mg/L NAA+1 mg/L BAP (MS basal medium)
CIMT11 1/0.5 mg/L IAA+1 mg/L BAP (MS basal medium)
CIMT12 2 mg/L IAA+2 mg/L NAA+2 mg/L BAP+4 mg/L
KIN (MS basal medium)
CIMT13 2 mg/L IAA+2 mg/L NAA+2 mg/L BAP+4 mg/L
ZEA (MS basal medium)
CIMT14 0.5 mg/L IAA+2/0.5 mg/L NAA+2 mg/L 2,4-D+0.2
mg/L ZEA (MS basal medium)
CIMT15 0.5 mg/L BAP+0.5 mg/L NAA+2 mg/L GA3 (MS
basal medium)
CIMT16 2 mg/L 2,4-D+0.5 mg/L BAP (MS basal medium)
Materials and Methods Chapter 2
38
Effect of medium pH and auxins on induction of somatic
embryogenesis (SE)
The explants (both cotyledons and hypocotyls) of all four cultivars harvested at one-week
stage were utilized for induction of direct and indirect SE. The two auxins analogues were
used in increasing concentration NAA (at 0.5, 1, 1.5, 2 and 4 mg/L) and 2, 4–-D (at 2, 3
and 5 mg/L) during preliminary experiments against fixed medium pH value. Another
simultaneous experiment was setup to see the effect of different pH range to investigate if
optimal concentration of auxins induce SE at pH level other than 4.0. Medium pH range
(3.0, 4.0, 5.0, 5.8, 6.0 & 7.0) with fixed concentration of two auxin analogues NAA and 2,
4-D were formulated to investigate the embryogenesis. The explants were incubated in
dark on rhizoid induction media (RhIM) i.e. initiation of SE was enforced by using
particular auxins and dark influx on range of media pH. Each treatment was carried out in
triplicate by using (100 mm x 15 mm) sterile plastic plates. Number of rhizoids formed per
explant against pH range were investigated and images were captured by Nikon D5200.
Effect of cytokinins on immature somatic embryos
The low medium pH along with auxins cultivated in dark marked the induction of primary
somatic embryogenesis by forming numerous threads like structures rhizoid. The rhizoid
clusters thus formed after two weeks of culture were sub-cultured independently on rhizoid
tubers induction medium (TIM) supplemented with cytokinins TDZ (N-Phenyl-N'-1,2,3-
thiadiazol-5-ylurea) at 0, 5, 10, 15, 20 mg/L at pH 4.0. After preliminary screening effect
of cytokinins dose, pH range and illumination were tested. Effect of equal concentration of
cytokinins analogue BAP 5 mg/L in comparison with TDZ was also tested at pH 4.0.
Unlike rhizoids, which were induced in dark, rhizoid tubers (RTBs) formation was initiated
in 16/8 hr Light/Dark photoperiod. The various stages of development in RTBs were
captured with Nikon digital camera D5200.
Materials and Methods Chapter 2
39
Microscopic studies of RTBs
The club shaped RTBs formed via SE after 4 weeks of culture on TIM were used to study
embryogenic background of novel structures. The embryonic cell masses on surface of
RTBs at different developmental stages and their ontogenic development were studied
microscopically. The culture plates incubated for 2 weeks on low pH (4.0) were transferred
to light conditions for another two weeks. The mature RTBs thus formed were fixed in a
fixing solution FAA (Formalin: acetic acid: 70% Alcohol, 1:1:8 v/ v/v) for 24 hr. The
samples were then dehydrated sequentially in graded alcohol series of 30%, 50%, 75%,
85%, 95% and 100% and subsequently embedded in paraffin. The paraffin embedded
samples were stored at 4oC until further use. A paraffin compatible rotary Microtome
(Amos scientific AEM 480) was used to cut into 12 mm thick transverse sections of the
samples. With the help of brush, sections were laid on filter paper with one drop of 0.1%
formaldehyde to allow stretching of sections. The conditioned sections were then placed
on glass slide and stained with 1% safranin stain (Sigma). The stained sections were then
treated with xylene to remove the wax and observed under an automatic scanning system
(Zeiss AS3000B with Renishaw serial# 7p5015 automated imaging UK) and
stereomicroscope (Olympus technologies DP 12 Japan BX41TF). The images were
captured at different magnifications (25–100X) by following method described by Yang et
al., (2012)
Shooting response of novel structures RTBs and regenerating calli
RTBs developed after 4 week of culture on optimized medium (TIM) were routinely sub-
cultured on the same medium for initiation of secondary somatic embryogenesis.
Increasing concentration of TDZ was used on maturation of pro embryos while sequential
incubation on TDZ and BAP (5 mg/mL) was followed for shoot organogenesis. The
processes of shoot organogenesis was initiated following the development of RTBs in two
ways viz: in vivo and in vitro shooting. For in vivo shooting RTBs cluster with many
primary and secondary embryos were allowed to mature on same induction medium at pH
4 for spontaneous shooting. Secondly, in vitro grown RTBs were excised from main cluster
of rhizoids and somatic embryos and cultivated sequentially on fixed concentration of TDZ
for 5 days followed by subculture on BAP supplemented medium. Thus individual RTBs
Materials and Methods Chapter 2
40
germinated to multiple shoot and root. Alongside effect of pH and increasing TDZ
concentration on shooting response was also investigated. The experiment was setup with
excised RTBs with increasing concentration of TDZ (0, 5, 10, 15, 20 mg/L) keeping pH
value fixed (4.0) to evaluate effect of low pH on shooting response. In another set of
experiment, keeping the TDZ level fixed to 5 mg/L pH 4.0 and 5.8 was compared for
optimal shoot forming ability of RTBs.
Regenerating calli were routinely sub-cultured after one week on optimized CIM to
increase the embryonic cell mass. The calli grown for four weeks on standardized medium
(Table 2.3/2.4) were measured in size and weight. The embryogenic callus measuring >3.5
mm in dimensions and weighing more than 0.3 g were selected for multiplication stage. To
optimize the direct and indirect shoot regeneration, individual explants growing calli were
inoculated on shoot induction medium (Treatment SIMT1–SIMT6). After standardization
of most suitable PGRs combination for shoot multiplication different combination
multiplication medium were also evaluated. The effects of BAP (2, 3, 5 mg/L) with and
without auxins (IAA, NAA) were investigated to determine the average shooting frequency
and maximum number of regenerated shoots from callus. For the standard shoot induction,
MS salts with vitamins 4.15 g/L, 2% sucrose, 0.8% agar and pH 5.8 was used with 16 h of
light incubation at 23˚C±2˚C. The percentage organogenesis and number of shoots per
explant were recorded after four weeks of culture. After standardizing optimizing the most
suitable growth regulator combination, different plant growth media were also evaluated
and compared to perceive the best suitable media for regeneration and multiplication.
Rooting medium and establishment of in vitro seedling in soil
Most of RTBs formed via SE from rhizoids germinated to shoots and roots on tuber
induction medium (TIM). To induce root, 1₋3 cm long shoots sprouting from individual
calli (4 weeks) and tip of cotyledonary embryo on RTBs (2 weeks), were excised and
cultivated on root induction medium (RIM) in 5.39 × 0.7 inch culture vessels with IBA
(0.1, 0.2, 0.5, 1 mg/L), NAA (0.5, 1 mg/L) and IAA (0.1, 0.2 mg/L) as rooting hormone.
The germinated somatic embryos with well-defined shoot tips on TIM were transferred to
pH 5.8 where, they formed adventitious shoots and roots simultaneously. After 45 days,
plantlets (5₋6 leaf stage) roots were removed from vessels and washed to remove agar.
Materials and Methods Chapter 2
41
Plantlets were trans- planted to transparent plastic pots (W × D × H: 4 × 3 ×7 inches; 22
oz) containing 750 g of autoclaved potting mix (organic compost: vermiculite; 1:1 w/w)
and covered with a polyethylene plastic bag (W × D × H; 8 × 4 × 12 inches, 1 MIL) with
3 holes to sustain humidity level. Plantlets were allowed to grow for 6 weeks under 23±2˚C,
30–50% humidity and a 16/8 h Light/Dark photoperiod. Each plantlet was given 1 mL of
half strength MS with vitamins twice in a week. Moreover, on daily basis, they were
exposed to an open-air environment for hardening before being fully transferred to a glass
house. Well-developed plantlets were transferred to a 900 g of substrate composed of soil:
peat: organic compost 1:1:1 (w/w/w) in plastic pots (W × D × H, 4.72×3.9×5.9 inches).
Cloning of strigolactone (SL) biosynthetic genes
Primer designing
Primers used in the study are enlisted in Table 2.4, used for the isolation, cloning and real
time quantitative PCR of targeted biosynthetic gene(s) designed by using Snapgene
software (GSL Biotech LLC) and synthesized by Sigma and Macrogen Korea. Primer
specificity was confirmed by Snapgene insilico PCR analysis and Sigma OligoEvaluator™
- Sequence Analysis tool. Each primer was dissolved in nuclease free water to make stock
solution of 100 μM stored at -20°C until further use. The stock solutions were diluted to
working concentration of 10 μM with final concentration of 1pmol/μL (1 μM).
Isolation of SLs biosynthetic pathways genes
Based on our preliminary studies done (Saeed et al., 2017) prime biosynthetic gene
carotenoid cleavage dioxygenases 7 (CCD7) and receptor protein of SL signaling
machinery α/β-fold hydrolase named (At) D14/DAD2/RMS3 was selected. The coding
sequence of Solanum lycopersicum CCD7 (GeneID: D100313501) and strigolactone
esterase D14 (GeneID: 101258450) were retrieved from NCBI nucleotide repository. Both
genes were isolated from Solanum lycopersicum cv. M82 in the first step by extraction of
total RNA from roots of tomato. Total RNA was extracted by using Spectrum™ Plant Total
RNA Kit (catalog# STRN250) according to manufacturer’s instruction. RNA integrity and
quantity were confirmed by gel electrophoresis and NanoDrop ND-2000. To minimize the
risk of genomic DNA contamination, RNA samples were treated with RNase-free DNase
I (NEB 2U µL−1 catalog# M0303S). For first-strand cDNA synthesis, 5 µg of DNase I
Materials and Methods Chapter 2
42
treated total RNA was taken in the reaction mixture using the High Capacity cDNA
Reverse Transcription kit (Catalog number: 4368814 Applied Biosystems) following the
suppliers manual as shown in Table 2.5. The 5’- and 3’- RACE CCD7 was performed with
primers listed in Table 2.4 to amplify the extreme 5’ end of cDNA pool using a SMART
RACE cDNA amplification kit according to the manufacturer’s instructions (Clontech Cat.
No. 634858).. Alongside model legume Lotus japonicus orthologue of CCD7 (LjCCD7)
previously cloned as fusion product GST–LjCCD7 into pGEX-5X-3 vector (Liu et al.,
2013) was used for amplification of LjCCD7 (Gene ID: GU441766) by using gene specific
primers. The PCR based amplification and cloning steps were performed according to
conditions in Table 2.6. The gene specific PCR products were confirmed with restriction
mapping and re-amplified with cloning primers for addition of restriction endonuclease
enzyme sites.
Materials and Methods Chapter 2
43
Table 2.4 List of primers used in the study
Primer Name Primer sequence
CCD7_F
CCD7_R
ATGGATCTTCAATTTGTATCACT
TTATTGTCCAAGTTTAACCATG
LjCCD7_F
LjCCD7_R
ATGCAAGCCAAACTTGTTCACAACA
TCAATTAGGTGCCCAGAAACCATGAA
Oligo
d(T)-Ancho
r Primer
GACCACGCGTATCGATGTCGACTTTTTTTTTTTTTTT
TV
RACE cDNA
synthesis
3'cDNA:AAGCAGTGGTATCAACGCAGAGTACGCGGG
5'cDNA: T25V N–3' (N = A, C, G, or T; V = A, G, or C)
RACE-PCR
GSP1 AATGCAGGCCAAAGCTTGCCATAATAT
GSP2 TTGTAGATTGGCTAGGCTAGAGTTGGTAG
UPM
CTAATACGACTCACTATAGGGCAAGCAGTGGTATCAACGCAGAGT
XbaILJCCD7_F
HindIIILJCCD7_R
AATCTAGATGCAAGCCAAACTTGTTCA
AAGCTTCAATTAGGTGCCCAGAAACCAT
P1_Xma1
P2_Not1
TCTCTCCCGGGAATGCAAGCCAAACTT
AAGCGGCCGCAAGAATTAGGTGCCCAGAAACCA
SLd14_F
SLd14_R
ATGGTGATATTGGATTTATTAAGAAATATG
CTAAGAAGTTAAGATTCTATGAATTACATC
NcoI D14F
NotI D14R
AACCATGGTGATATTGGATTTATTAAGA
AAGCGGCCGCAAGAAGTTAAGATTCTATGAAT
GFP- F
GFP- R
GTAAACGGCCACAAGTTCA
GTTCACCTTGATGCCGTTCTT
LUC-F
LUC-R
GATTACCAGGGATTTCAGTCGAT
TGTTACTTGACTGGCGACGTA
ATCCD8-F
ATCCD8-R
GTTACCGTGAATTCTCCGA
CAAATTTCCCGATCGTCTCT
ATCCD7-F:
ATCCD7-R
AATAGGTTCCATAGCGGCT
ATCGGTAAGAACAAGCGGAA
UBQ10-F
UBQ10-
GAAGTTCAATGTTTCGTTTCATGT
GGATTATACAAGGCCCCAAAA
AtNCED3
(AT3G14440)
AATCATACTCAGCCGCCATTATCGT
TTCATTCACCGGAGCAAAATTTCCG
Formatted: Font: Not Bold
Formatted: Font: Not Bold
Materials and Methods Chapter 2
44
Table 2.5 High capacity cDNA synthesis from total RNA
Table 2.6 PCR reaction conditions and master mix
Reaction Volume 100 µL RT-PCR Cycle
10X RT buffer 10 µL 25oC 10min,1X
100 mM dNTPs mix 4 µL 37oC 120min 1X
MultiScribe Reverse Transcriptase (50U/μL) 5 µL 85 oC 5min, 1X
50 µM OligodT primer mix 10 µL 4oC ∞
RNase Out 1.25 µL
5µg total RNA [DNase-1 treated] (vf=50
µL)
50 µL
PCR Water (DEPC) 19.75
µL
Reaction Volume 25 µL PCR Steps PCR Cycle
10X reaction
buffer
2.5 µL Initial
denaturation
95oC 5 min, 1X
10 mM dNTPs
mix
1.5 µL Denaturation 95oC 4 0sec, 35X
50 mM MgCl2 2 µL Annealing 58-62oC 4 0sec, 35X
10 µM Forward
primer P1
1 µL Extension 72oC 2 min, 35X
10 µM Reverse
primer P2
1 µL Final extension 72oC 10 min, 1X
Taq Polymerase
(5U/μL)
0.25 µL Storage 4oC ∞
Template DNA
100 pg-1µg
3 µL
PCR Water
(DEPC)
13.75 µL
Materials and Methods Chapter 2
45
Figure 2.12.1 Restriction map of SLCCD7 coding sequence
Figure 2.22.2 Restriction map 1 of LjCCD7 coding sequence
Materials and Methods Chapter 2
46
Figure 2.32.3 Restriction map 2 of LjCCD7 coding sequence
Figure 2.42.4 Restriction map SLD14 coding sequence
Purification and sequencing of targeted gene fragments
For all cloning steps the gene specific PCR products were first were separated via 1.2% gel
electrophoresis to confirm the fragment size and subsequently cleaned by using QIAquick
PCR purification kit as follows. Five volumes of Buffer PB were added to one volume of
the PCR sample and mixed by pipetting. QIAquick spin column was placed in 2 mL
collection tube provide with the kit and the sample was added to the center of the column
to bind the DNA. The column was closed and centrifuges at 17000 g for 1 min. The flow
through was discarded and column was replaced in the same collection tube. For washing
750 µL of buffer PE was added to the QIAquick column and centrifuged for 1 min. The
flow through was discarded again and column was placed back in the collection tube. The
Materials and Methods Chapter 2
47
empty column with collection tube was centrifuged for additional 2 min to remove the
residual ethanol from buffer PE. The collection tube was discarded and QIAquick column
was placed in a clean 1.5 mL microcentrifuge tube. 50 µL of elution buffer was added to
the center of the column and incubated at room temperature for 2 min. The column was
centrifuged again to elute DNA. The purification steps were followed for all the amplified
products used in the cloning procedure. The purified PCR products were cloned into TA
cloning vector pGEM-T to generate pGEM-T_LjCCD7, pGEM-T_SLD14 by using T4
DNA Ligase (Promega). The ligation reactions were set up using Promega TA cloning kit
according to manufacture instruction. Five µL of overnight ligation mixture was used to
transform JM109 competent cells provided with the kit by heat shock transformation
(section 2.4.4). Transformed cells were plated on LB-ampicillin X-Gal/IPTG agar plates.
Transformed colonies were selected based on blue white screening method and confirmed
by colony PCR with gene specific primers (Table 2.4). Screened positive colonies were
grown in 2 mL of LB liquid media with 50 µg/ mL ampicillin at 37oC with constant shaking
at 120 rpm. Cell were harvested by centrifugation and plasmids were purified using a
PerfectPrep™ Spin Mini Kit (5PRIME). The sequence of the inserted fragment in pGEM-
T vectors were verified by DNA sequencing (BMR genomics Italy) and the sequencing
results were analysed by Chromas lite software version 2.1
(https://technelysium.com.au/wp/).
Plant expression vector construction
Two types of pGreen binary vector based expression system were used in the study
(Hellens et al., 2000). First one was dicistronic gene expression vector system
pGII0229MASGUS/LUC (Ali et al., 2010) based on basic pGII0229 cassette having first
cistron β-glucuronidase (GUS) under the control of P-MAS and second cistron luciferase
reporter gene (LUC) under the control of tobacco mosaic virus (tmv) IRES element
generously provided by DSMZ-Braunschweig Germany by courtesy of Dr. Zahid Ali. . For
GFP fusion constructs assembly, pGreenII0029-35S-TL-GFP provided generously by Dr.
Alois Schweighofer (MAX F. PERUTZ LABORATORIES; Vienna Biocenter )by
courtesy of Prof. Francesca Cardinale) was utilized that harbors TL-TEV translational
leader sequence from tobacco etch virus. For cloning purpose, all vector modifications and
Materials and Methods Chapter 2
48
designing were carried out by using Snapgene molecular cloning software and confirmed
via Vector NTI Advance 11.0 (Invitrogen™ USA).
Cloning strategy of LjCCD7
For the construction of LjCCD7 vector,All the cloning steps were carried out at Department
of Agriculture, Forest and Food Sciences (DISAFA), UNITO Italy. In the first approach,
GUS gene was removed by double digestion cut out 1840 bp segment through XbaI-
HindIII and replaced with 1866 bp of LJCCD7. For GFP C/N terminal fusion constructs
the stop codons were removed via cloning primers from targeted genes. LJCCD7 was
cloned at multiple cloning site via XmaI- NotI cutout and N terminal of sGFP (S65T) was
fused with C terminal of target genes. Insertion of D14 was followed in a similar way by
NcoI- NotI double digestion. The vector cassettes used in pGreen binary vector system are
shown below.
Figure 2.52.5 T-DNA cassette of dicistronic vector (Ali et al., 2010)
Materials and Methods Chapter 2
49
Figure 2.62.6 LjCCD7 harboring T-DNA cassette
Figure 2.72.7 T-DNA cassette of reporter gene construct (GFP)
Figure 2.82.8 T-DNA cassette of GFP fusion with LjCCD7
Materials and Methods Chapter 2
50
Figure 2.92.9 T-DNA cassette of GFP fusion with SLD14
Double digestion of vector and insert
To proceed with sub-cloning of insert i.e. desired fragment with compatible restriction
enzyme (RE), both vector back bone and purified PCR product were subjected to restriction
enzyme digestion. The compatible XbaI-HindIII (Fermentas), XmaI- NotI and NcoI- NotI
(Fermentas), set of enzymes were used in double digestion at 37°C for one hr (Tables 2.7,
2.8, 2.9). Post double digestion the reaction was inactivated at 65°C for 10 min and vector
backbone was treated by 1 µL shrimp alkaline phosphatase (Fermentas) before heat
inactivation for additional 10 min at 37°C to remove the 5’ OH group and subsequent the
recircularization of vector backbone. Due to presence of HindIII restriction enzyme site
inside coding region of LjCCD7, full and partial digestion was carried out. Full digestion
produced partial fragment that contained truncated version of gene. XbaI-HindIII double
digestion was carried out in 100 µL reaction and incubated for 10, 20, 30 and 45 min at
37°C.
Gel purification of digested fragment and setting up Ligations
Following RE digestion, the fragments were separated by agarose gel electrophoresis.
Entire reaction mixture was loaded in 1.2% low melting agarose (LE Agarose Invitrogen).
The electrophoresed products of vector and gene of interest with desired size were excised
with sharp scalpel after visualization under UV light. The gel slices were weighed and
Materials and Methods Chapter 2
51
5PRIME GelExtract Mini Kit was used to purify DNA fragments directly from agarose gel
slice by following manufacture instruction. Three volumes of buffer PS was added to 1
volume (by weight) of gel slice. The gel was melted completely by incubation at 50°C with
continuous inversion after every 2 min for complete solubilisation. 500 µL of buffer BL to
CB2 PCRExtract mini column placed in 2 mL collection tubes. This step equilibrated the
column. Column was centrifuged for 1 min and flow through was discarded. The column
was placed back in collection tube. To bind the DNA fragment, the gel sample was added
to the center of column (800 µL at a time). The sample was centrifuged and flow through
was discarded. This step was repeated until the entire sample has been processed. The
bound DNA was washed with 700 µL of WB1 and centrifuged to discard the flow through.
2nd washing of the column was done by addition of WB2. The column was centrifuged
after flow through was discarded for additional 2 min to remove the traces of ethanol from
WB2. To elute the DNA fragments 50 µL of EB was added in the center of column
incubated at room temperature for 2 min. The column was centrifuged to get purified
product. DNA fragments purified and free from left overs of RE digestion were then
quantified by NanoDrop ND-2000. The ligations of desired vector back bone and insert
was carried out by 1:1, 1:3 and 1:5 vector to insert ratio as given in the Table 2.10 & 2.12.
Overnight ligations were carried out at 4°C; alternatively, 1 hr incubation at room
temperature was also done. At the end of incubation, the reaction was stopped by heat
inactivation at 70 °C for 10 min. 2-5 µL of ligation mix was used for transformation of
high efficiency competent cells.
Materials and Methods Chapter 2
52
Table 2.7 Reaction mix for NcoI- NotI double digestion
Reagents (Vf=50 µL) Standard reaction
10X Buffer O 5 µL
DNA (Insert or Vector 1µg) 2-5 µL
NcoI 4 µL (40 units 4₋fold excess)
NotI 1 µL (10 units)
DEPC water 38 µL
Table 2.8 Reaction mix for XbaI-HindIII double digestion
Reagents (Vf=50 µL) Standard reaction
10X Tango Buffer 5 µL
DNA (Insert or Vector 1 µg) 2-5 µL
XbaI 0.5 µL (5 units)
HindIII 1 µL (10 units 2₋fold excess)
DEPC water 41.5 µL
Table 2.9 Reaction mix for XmaI-NotI double digestion
Reagents (Vf=50 µL) Standard reaction
10X Cfr91/XmaI Buffer 5 µL
DNA (Insert or Vector 1 µg) 2-5 µL
XmaI 1 µL (10 units)
NotI 2 µL (20 units 2₋fold excess)
DEPC water 40 µL
Table 2.10 Rapid ligation mix for PCR products for TA cloning
Materials and Methods Chapter 2
53
Reagents (Vf=10 µL) Standard reaction
2X rapid ligation buffer 5 µL
pGEM-T Vector (50 ng) 1 µL
Purified PCR product 2 µL
T4 DNA Ligase 3U/ µL 1 µL
Deionized water 1 µL
Table 2.11 Ligation reaction of vector and gene of interest
Chemically competent E. coli cells preparation
For chemically competent E. coli cells preparation DHα5/TOP10/JM109 stored as 50%
glycerol stocks kept at -20°C were streaked on freshly prepared LB agar plate without
antibiotics and incubated overnight at 37°C. Individual isolated colonies were picked and
grown in LB broth medium overnight at 120 rpm until OD600~1. This starter culture was
used as inoculum in fresh medium with 1:50 ratio and grown at 120 rpm in 37°C shaker.
The bacterial density was measured as OD600 every hour until OD600~0.2. At this point
when bacteria have entered exponential growth phase, OD600 was monitored every 15 min.
When the OD600 reached 0.35-0.4, the cells were transferred for ice incubation for 30 min
with occasional swirling to ensure uniform cooling of culture. All the steps were done at 4
°C using refrigerated centrifuge (Sigma). The tubes and all the solutions were also pre
chilled. 45 mL chilled culture was centrifuged at 4400 rpm for 10 minutes to harvest the
cells. The supernatant was decanted and pellet was resuspended (by pipetting up and down
avoiding any jerk to cells) in 24 mL of cold 100 mM MgCl2. Cells were harvested again by
centrifugation for 10 min. The supernatant was again discarded, and pellet was re-dissolved
in 12 mL cold 100 mM CaCl2, all the tubes were combined at this stage and centrifuged
Reagents (Vf=10 µL) Standard
reaction
1:1, V: I
Standard
reaction
1:3, V: I
10X rapid ligation buffer 1 µL 1 µL
Purified Vector (80-90 ng/ µL) 1 µL 1 µL
Purified RE fragments 80-100
ng/ µL
1 µL 3 µL
T4 DNA Ligase 3u/µL 1 µL 1 µL
Deionized water 6 µL 4 µL
Materials and Methods Chapter 2
54
again for 10 min at 4400 rpm. After discarding the supernatant carefully without disturbing
the pellet, for 3rd time pellet was re-dissolved in 6 mL of 100 mM CaCl2 by gentle pipetting
while keeping the falcon tubes on ice. Tubes were again centrifuged to harvest the cells.
The supernatant was decanted and pellet was then carefully dissolved in cold 2 mL of ice
cold 80 mM CaCl2 & 20% glycerol. The final OD600 of the suspended cells was measured
up to ~ 200-250. The prepared cells were immediately dispensed into sterile chilled 1.5 mL
microfuge tubes and snap freeze by pouring liquid nitrogen on the tubes. The cells were
kept frozen in -80°C freezer for later use.
Heat shock transformation of competent cells
The multiplication of plasmids and ligations were done by transformation of chemically
competent cells. The frozen cells were gently allowed to thaw completely on ice. The
plasmid DNA or ligation reaction was briefly spinned prior to transformation. 2 µL of
plasmid DNA or 5 µL overnight ligation was gently mixed into 50 µL of competent cells.
The tubes were gently tapped twice with finger and incubated on ice for 20 min. Following
ice incubation, the reaction tubes were subjected to heat shock in water bath at 42oC for
45-50 seconds. The cells were restored back on ice for 2 min. 900 µL room temperature
SOC/LB medium (Appendix- I) was added to the tubes to minimize the damage due to heat
shock. The cells were allowed to grow for 90-100 min with continuous shaking at 180 rpm
at 37oC. Then these transformed cells were plated on agar plates containing selection
antibiotic kanamycin and incubated overnight at 37oC. Individual colonies of successfully
transformed cells were obtained by plating 50 and 100 µL of transformed cells on LB agar
plates containing 50 µg/ mL antibiotics like Kanamycinkanamycin or Ampicillin
ampicillin depending on type of plasmid/ ligation and overnight incubation at 37oC. Single
isolated colonies were picked for colony PCR confirmation and plasmid extraction was
followed for PCR positive colonies.
Screening of colonies by colony PCR
The well isolated colonies from heat shock transformation were picked with the help of
sterile tooth pick and suspended in sterile millipore water. This suspension was used as
template for colony PCR with target gene primers. Alternatively PCR reaction was set up
in a total volume of 10 µL reaction volume containing 1 µL of 10X PCR buffer
Materials and Methods Chapter 2
55
(Biotechrabbit GmbH), 1.2 µL 50 mM MgCl2 (Biotechrabbit GmbH), 0.25 µL 10 mM
dNTPs (Sigma), 0.8 µL of 10 mM primer pair, 0.12 µL of 5 unit/ µL Taq polymerase
(Biotechrabbit GmbH) and sterile millipore water. The colonies were picked individually
and inoculated directly to PCR tubes with sterile toothpicks. The tooth picks were removed
after 5-10 min from the PCR tubes. PCR amplification was done in the Bio-Rad T100 PCR
thermal cycler with following conditions. DNA was initially denatured at 94˚C for 5 min
followed by 30 cycles of denaturation at 94°C for 1 min, primer annealing at 59.1°C for 40
sec and primer extension at 72°C for 2 min. The final extension was done at 72°C for 10
min. PCR products were kept at 4°C. Amplified products were separated by electrophoresis
using 1.2% (v/w) agarose gel, stained with ethidium bromide and visualized under UV
illumination. The 100 kb & 1 kb DNA ladder (5PRIME & Viogene) were used as a
molecular weight marker to confirm the size of amplified products. The colonies showing
product size of ~ 2 kb & 800 bp were deemed suitable for further confirmation.
Plasmid Isolation by alkaline lysis
Plasmid isolation was performed by using 5PRIME PerfectPrep Spin Mini Kit and alkaline
lysis by Sambrook and Russell, (2006) with some modifications. Individual colonies of
bacteria screened by colony PCR were picked and grown in 10 mL of LB medium
supplemented with kanamycinKanamycin at 37oC in shaking incubator at 150 rpm. The
cells were harvested by centrifugation at 13000 rpm for 10 min and the supernatant was
decanted. The pellet was suspended in 200 µL of solution I (25 mM Tris- Hcl, pH 8.0, 10
mM EDTA, 50 mM Glucose and Lysozyme 2 mg/ mL or 100 µg/mL Rnase A) with
vigorous vortexing, and incubated for 5 min on ice. 400 µL of freshly prepared solution II
was added (0.2 N NaOH, 1% SDS), and mixed by inverting the tubes 2-3 times and
incubated at room temperature for 5 min. 300 µL solution III (3M potassium Acetate, pH
4.8) was added, mixed by inverting the tubes and incubated on ice for 20 min. The tubes
were centrifuged at 13,000 rpm for 10 min at 4oC. The supernatant was carefully collected
in new collection tubes. The supernatant containing plasmid was extracted twice with 500
µL chloroform. Then DNA was precipitated by adding two volumes of isopropanol. The
pellet obtained after this step was washed with 70% ethanol and dried for 1 hr at room
temperature. The pellet was dissolved in 20 µL of Tris EDTA (TE) buffer containing
RNaseA (10 mg/mL) [Fermentas]. Plasmid DNA were separated by electrophoresis using
Materials and Methods Chapter 2
56
1% (v/w) agarose gel prepared in 1X TBE buffer stained with and visualized under UV
imaging system. The plasmid were confirmed based on size and further analysed for
restriction enzyme digestion and PCR confirmation.
PCR confirmation
Plasmid obtained were confirmed by PCR amplification with forward and reverse primers
for GUS, and LUC and GFP genes as described in (Table 2.4).
Agrobacterium tumefaciens competent cells
The Agrobacterium strain EHA105 & GV3101pMP90 were first transformed with a helper
vector pSOUP containing a tetracycline resistance gene, giving rise to EHA105::pSOUP
and GV3101::pMP90::pSOUP. Both strains were inoculated from glycerol stocks at -20°C
on YEP agar medium (yeast extract 10 g/L, bacto peptone 10 g/L, NaCl 5 g/L ,15g/L at pH
7.0) with antibiotics (EHA105/Tet 25 mg/L, GV3101/Rif 50 mg/L+ Gent 20mg/L) at 28
°C for 48 hr. Well defined colonies were inoculated in 5 mL of YEP liquid medium with
antibiotics. Next day, tubes were initially observed visually for bacterial growth by
comparing it to control (YEP medium only). The OD600 nm of the overnight culture was
set to 1 on the Nano volume spectrophotometer. 50% glycerol stocks were made from
overnight grown culture and stored at -20°C.
The thermo competent cells of Agrobacterium strains EHA105 and GV3101 were prepared
using methodology described by (Sambrook and Russell, 2001) with some modifications.
Overnight bacterial culture in YEP liquid media with antibiotics having OD600 0.8-1 was
diluted 1:50 in fresh YEP medium and grown with vigorous shaking of 200 rpm at 28 °C
until OD600 reaches to 0.3. After this point the growth was measured every 10 min. The
culture with OD 0.4-0.6 was used to make thermo competent cells. All steps were followed
at 4 °C using refrigerated centrifuge. The culture was transferred to chilled 50 mL falcon
tubes and kept on ice for 10 min. 45 mL of culture was centrifuged at 3000 rpm for 10 min;
supernatant was discarded by draining and inverting the tubes. Pellet obtained was
dissolved in 10 mL of pre-chilled 20 mM CaCl2 and centrifuged again at 3000 rpm for 10
min. The supernatant was again discarded and pellet was dissolved in 2 mL 20 mM CaCl2
and centrifuged. The supernatant was finally decanted and pellet was carefully suspended
in 1 mL of 20 mM CaCl2. The cells were aliquoted into chilled tubes and snap frozeneeze
in liquid nitrogen.
Materials and Methods Chapter 2
57
Freeze thaw transformation of Agrobacterium competent cells
Transformation of Agrobacterium competent cells was done by freeze thaw method
reported by (Jiménez-Antaño et al., 2018; Weigel and Glazebrook, 2006). Frozen cells
were thawed on ice and in case of freshly prepared cells, 100 µL aliquot of cells were taken
directly in sterile 1.5 mL Eppendorf and 5 µL of plasmid DNA was added. The tubes were
tapped twice and incubated on ice for 5 min. The tubes were then sequentially submerged
in liquid nitrogen for 5 min and then at 37C for 5 min. The tubes were again returned to
ice for 5 min. 800 µL of SOC medium (Appendix I) stored at room temperature was added
to the tubes to release the heat shock. Tubes were then incubated at 28 °C at 200 rpm for
3-4 hr. 50 µL of the culture was spread on YEP agar plates with Rif 50 mg/L + Kan 50
mg/L (GV3101) and Kan 50 mg/L (EHA105). The plates were incubated at 28 °C for 48
hr and well defined isolated Kanamycinkanamycin resistant colonies were selected by
performing colony PCR described in section 2.8.4.6. Slight modification was made when
performing colony PCR of Agrobacterium strains. The colonies were grown overnight in
selective medium with constant shaking at 200 rpm. Next day 200 of overnight grown
culture was centrifuged for 5 min. The pellet was washed and suspended in 500 µL sterile
nuclease free water. The suspension was boiled in water bath at 95 °C for 5 min to release
the DNA. The tubes were then spinned to settle down the debris and 5ul of supernatant was
used as template in 10 µL reaction with gene specific primers for confirmation. PCR
positive colonies were selected and grown in antibiotics containing media for further
transformation procedure.
Glycerol stocks preparation
For storage of E. coli & Agrobacterium cells containing propagating plasmid of interest,
positive colonies that were confirmed by PCR were inoculated in 5 mL of LB or YEP liquid
medium in a shaking incubator for 3 hours. When cells have entered in an exponential
growth phase, this starter culture was used to inoculate fresh media with antibiotics
according to plasmid characteristics. The bacteria were allowed to grow overnight for 12-
16 hr until OD600 reaches to 0.8-1 or 1-1.2 for E. coli & Agrobacterium respectively. These
bacteria were used to make glycerol stocks. 86 % autoclaved glycerol was used to make
stocks. 500 µL of bacterial growth was added to 500 µL of 86% glycerol. The cryogenic
tubes were vortexed vigorously to evenly mix the suspension and stored at - 20 °C for 2
Materials and Methods Chapter 2
58
month and - 80 °C for six months. Alternatively, for one-time usage loop full bacterial
suspension was streaked on LB agar slants in 2 mL Eppendorf tubes (NEST) and stored
for future use.
Transient expression analysis by agroinfiltration
KanamycinKanamycin resistant transfected colonies were streaked on LB plates
containing Kanamycinkanamycin/rRifampicin (50 mg/L) and incubated at 28°C for 48 hr.
Freshly appeared individual colonies were inoculated in 20 mL YEP (yeast extract 10 g/L,
bacto peptone 10 g/L, NaCl 5 g/L at pH 7.0) containing appropriate antibiotics at 28°C at
200 rpm to an OD600~1. Bacterial culture was centrifuged at 4400 rpm and pellet was
resuspended in 1 mL of inoculation medium (IM) (Table 2.2) with 100-400 µM
Acetosyringone acetosyringone (AS). The OD600 for transient inoculation was set to 0.3-
0.6 and for stable transformation, 0.6-1 was used. The IM was left for 4 hr at room
temperature to settle down the cell debris. Before inoculation to facilitate the infiltration of
Agrobacterium strains, different concentration of NAA (1-2 mg/L) was added in
supernatant of inoculation medium i.e. infiltration medium (IFM) to aid in infiltration of
Agrobacterium strains. 0.9% saline was also used as control infiltration medium to achieve
best results and process optimization. 2 mL of the liquid above cell debris was taken for
leaf and fruit infiltration. Agro-infiltration was performed by modification of method by
Schöb et al., (1997). Bacterial suspension was applied with the help of syringe 1- mL
syringe with a 0.5-×16-mm needle, against the lower side of leaf lamina using upper young
leaves. Infusion was done by applying pressure on opposite side of leaf parenchyma until
half of the leaf gets infiltrated (Schöb et al., 1997). Fresh mature and immature fruits were
also infused with needle through stylar apex, 1-2 mL of IFM1 was infiltrated. Completely
infiltrated leaf samples which showed slight change of color were selected for further
analysis. Infiltrated samples were harvested for 24, 48 and 72 hr post inoculation and fixed
in ice cold pure acetone for one hr. The samples were subjected to GUS histochemical
staining and reporter gene confirmation via RT-PCR.
Materials and Methods Chapter 2
59
Figure 2.102.10 Agro infiltration of tomato leaves and fruit for transient gene expression
(A-C) Infiltration of tomato Riogrande leaves (B) Infiltration of immature fruits of Riogrande
GUS histochemical staining
Leaf and fruits were subjected to histochemical β-glucuronidase gene (GUS) staining by
modification of method by Jefferson et al., (1987). The leaves and fruits were cut into 2
cm long disc (slices in case of fruits) and immersed in XGluc staining solution (200 µL of
2mg/mL XGluc, 200 µL 0.5 M EDTA, 10% Triton X100, 2 mL of 200 mM PO4 buffer,
7.4 mL distilled H2O) and incubated overnight in dark at 37°C. Samples were washed
several times with absolute ethanol following day to remove the chlorophyll content from
leaves. Visualization of GUS expression was done as indigo blue stain while GFP reporter
(S65T-GFP) expression was observed under UV light and hand-held halogen spot lamp.
Materials and Methods Chapter 2
60
Stable transformation of Solanum lycopersicum cv. Riogrande
Ex-Plants preparation
Stable transformation of tomato was done mainly in Plant Biotechnology & Molecular
Pharming (PBMP) Lab, Department of Biosceinces COMSATS University Islamabad,
Pakistan. Newly emerged seedlings of cv. Riogrande were deemed suitable for
transformation after initial screening of regeneration potential out of four cultivars. Initially
cotyledons and hypocotyls were compared for transformation efficiency. 7-8 days old
cotyledons (1-2 cm) were cut through mid-vein region and trimmed from both sides. The
explants were wounded with sterile needle to enhance the infection and transfer of
Agrobacterium. The cut ends and wounding site also initiate callus induction in explants.
Effect of age, type of explant, orientation along with wounding were investigated. Explants
were first placed with their adaxial and abaxial sides in contact with pre-culture medium
(PCM, Table 2.2) for 2, 5 and 7 days prior to agro-infection at 23 2°C with 30–50%
humidity and 16/8 hr Light/Dark photoperiod provided by 70 μmolm-2s-1 cool white
fluorescent lights in a growth room.
Agrobacterium mediated infection
Agrobacterium strains GV3101 & EHA105 harboring plasmid constructs (MAS::
LJCCD7::CP148LUC, 35S:: TL::LJCCD7GFP & 35S:: TL::SLD14GFP) were streaked
from glycerol stocks on YEP agar plates with Rif 50 mg/L + Kan 50 mg/L (GV3101) and
Kan 50 mg/L (EHA105) incubated at 28 °C for 48 hr. On day 3 individual colonies were
picked and inoculated in 5 mL of YEP liquid medium for 3 hr in a shaking incubator. This
starter culture was used as inoculum for overnight growth with antibiotics in 50 mL of
fresh medium with constant shaking at 150 rpm at 28 °C. Appropriate blank controls were
also set up to compare the growth of cultures. On day 4th the cultures were checked for
their OD600~1-1.2 on nanodrop. The Agrobacterium culture were centrifuged at 4400 rpm
and pellet was resuspended in 1 mL of inoculation medium (IM) [Table 1] with 200 µM
acetosyringoneAcetosyringone (AS). The OD600 of the suspension was set to 0.2, 0.4, 0.5,
0.6, 0.8 and 1 by addition of MS liquid medium. Freshly prepared hypocotyl and cotyledon
explant along with precultured explants were used in the infection process. Explants were
immersed in Agrobacterium suspension medium with gentle shaking at 28°C for 10-15 min
followed by rinsing with sterile MS liquid twice to remove the excess of bacteria. Explants
Materials and Methods Chapter 2
61
were blotted dry from all sides to removes excess liquid. The effect of bacterial density,
preculture treatment and age of explant were investigated that influences transformation
efficiency.
Co-cultivation and selection
Thereafter, explants were co-cultivated with their abaxial side (preliminary screening)
down in dark at 19-24°C on co-cultivation medium CCM1 (Table 2.2) for 2-3 days. The
temperature at which successful co-cultivation occurs, concentration of
co-cultivation duration (24, 48 and 72 hr) were critical factors that influence the success of
transformation. Variable temperature & acetosyringone Acetosyringone (0 μM, 100 μM,
range was used for optimal transformation efficiency. Following co-cultivation subsequent
washing of explants was done by using sterile water containing combination of antibiotics
300 mg/L cefotaxime (phytotech) and 300 mg/L carbenicillin (sigma) in combination or
300-600 mg/L timentin (Phytotech) to suppress excess Agrobacterium growth on selection
medium. The cleaned explants were blotted dry from all sides on sterile filter paper sheets.
Later they were placed on selection medium (SM) [Table 2.2]. Alongside control, explants
without infection were also plated as negative control. 7 explants were plated on sterile
petri plates wrapped with parafilm and placed in dark at 23 2°C with 30–50% humidity
for callus induction. After 15 days, callus induction was initiated on the cut ends on
selection plates from viable explants that were sub-cultured to selection media containing
Kanamycinkanamycin 50 mg/L. Once callus induction was initiated plates and other
culture vessels were transferred under 16 hours photoperiod to theat a temperature of
25±20C under 16 hr photoperiod provided by 70 μmolm-2s-1 cool white fluorescent lights.
To increase the size of regenerating calli, sub culturinge was repeated every week.
Regeneration of transformed explants
Healthy proliferating calli were transferred to shoot induction medium (SIM). The
optimized concentration of PGRs used in cell culture experiments were utilized containing
BAP at 3 mg/L alone or in combination with IAA/NAA. After 2 weeks of cultivation on
SIM containing Kanamycinkanamycin, individual shoots were excised and place on root
induction medium (RIM) for extensive root formation. Transformation efficiency was
calculated in relation to various factors tested during the experiment.
Materials and Methods Chapter 2
62
Transformation efficiency % = No of Kan resistant regenerated shoots ×100
No of explants inoculated
Ex-vitro acclimatization and transfer of rooted plants
Regenerated explants were grown on RIM (Table 2.2) for four weeks until they were 3–-5
cm in length, plants with fully grown roots were removed from the medium and washed
with tap water gently to remove the extra medium. The plants were then transferred to
sterile soil and vermiculite mixture (1:1) in plastic pots and covered with clear plastic bag
with holes to sustain humidity level. Potted plants were kept in growth chamber for
hardening of plants at 24 ± 2 °C under white fluorescent light having 16/8 hr Light/Dark
photoperiod (70 μmolm-2s-1). Each day plants were kept in day light for 2-3 hr and then
transferred back to growth room. Plants were irrigated with MS salt w/vitamins for two
weeks and with distilled water for next two weeks until plants get hydrated in the soil. One
and half month hardened plants were then transferred to green house with normal day light
conditions for flowering and fruiting.
β-glucuronidase (GUS) activity
To confirm the transient and stable integration of T-DNA carrying gene of interest
histochemical GUS staining & GFP based imaging was done on callus and true leaves from
regenerating shoots. For the dicistronic binary vector carrying LjCCD7, GUS gene was
replaced during cloning process. Hence, positively transformed cells of callus/leaves were
GUS negative. While in case of GFP, UV light and hand held GFP lamp was used for leaves.
For transient expression analysis, explants were dipped in staining solution immediately
after co-cultivation by the method explained above (section 2.8.4.13). Stable expression was
confirmed via dipping 4 weeks old calli/leaves in staining solution and examined under
stereomicroscope for visible blue stain.
Molecular analysis of transformed shoots
Molecular confirmation of transformation events was carried in two ways. First by total
genomic DNA isolation of putatively transformed Kanamycinkanamycin resistant shoots
and WT plants, according to CTAB (cetyl dimethyl ethyl ammonium bromide). Doyle and
Materials and Methods Chapter 2
63
Doyle (1987) method was followed for DNA extraction. 0.5₋1.0 g leaf tissues were
harvested using forceps and scissors. Liquid nitrogen was poured immediately pestle and
mortar immerse the plant tissue. Samples were crushed to fine dust in liquid nitrogen. 800
µL of CTAB (2.0 % CTAB (w/v), 100 mM Tris HCl (pH 8.0), 1.4 M NaCl, 3.0 % PVP
(Polyvinyl pyrolidone), 20 mM EDTA, 0.2 % w/v mercaptoethanol solution was added.
Samples were placed in water bath at 65 °C for an hour with continuous shaking. Equal
amount chloroform and iso-amyl alcohol mixture (24:1) was added. The samples were
vortexed followed by centrifugation at 13000 rpm for 20 min. Supernatant was taken in
separate tubes and 500 µL ice cold isopropanol was added. Contents were mixed by
inversion, centrifuged at 13000 rpm for 10 min. Pellet was re-suspeneded in 70% ethanol,
and centrifuged at 3500 rpm for 2 min. Supernatant was discarded again and the tubes were
allowed to air dry. Pellet was re-suspended in 50 µL TE buffer containing RNase A. 2 µL
of RNase enzyme (Fermentas) was added to the DNA sample and incubated for 1 hour at
37°C to degrade RNA contamination. The quality and integrity of DNA was done by gel
electrophoresis stained by ethidium bromide and visualized under UV light.
Subsequently, RNA isolation was done from infected tomato explants and callus after 48
hr of co-cultivation using Invitrogen purelink RNA kit. 5 µg of total RNA was utilized for
cDNA synthesis using Revert Aid first strand cDNA synthesis kit. Both DNA and cDNAs
were subjected to PCR confirmation for presence of GFP, LUC & LJCCD7 genes.
Respective positive controls were also used with specific set of primers (Table 2.4). About
500 ng-1 µg of DNA/cDNA and 50-100 ng plasmid controls were utilized in a reaction
mixture 25 µL as explained in section 2.8.2 (Table 2.3 &2.4). The amplified fragments
were separated via 1.2% gel electrophoresis stained by ethidium bromide and visualized
under UV light.
Morphological phenotyping of transgenic plants
TransgenicT0 (OE0) Lines were selfed to produce (OE1) T1 and (OE2) T2 and their
morphological attributes were compared to wild type (WT) plants of same age.
Fruit/flower size, shape and color were observed. Overall plant architecture i.e. height,
stem diameter and numbero of secondary branches of transgenic plants were measured.
Meter rular was used to measure the height of plants in cm, while stem diameter and fruit
Formatted: Heading 2, Left, Indent: Left: 0", Adjust
space between Latin and Asian text, Adjust space
between Asian text and numbers
Materials and Methods Chapter 2
64
size were measured with the help of vernier caliper. Leaf morphology was compared by
variation in shape and serration. Leaf allometric expansion was measured as leaf area in
cm2. LA of distal leaflets were measured with the help of ImageJ software version 1.52a
(https://imagej.nih.gov/ij/)
Biochemical test for antioxidant enzyme potential under drought
stress
Dehydration response assay
In order to determine the potential abiotic stress resistance particularly water deficit , we
tested 3 months old CCD7 expressing (OE1) T1 lines of tomato for drought tolerance were
tested by exposing soil grown WT and transgenic plants to 21 days water challenge and
survival rate determination. The irrigation of plants was withheld for 14 days and
phenotypic changes were monitored. The leaves and stem cuttings were randomly selected
as sample for later biochemical analysis of both control and OE1 lines. Extreme water
deficit treatment was given to access the survival rate of transgenic and control plants for
21 days after which irrigation was resumed and plants were monitored for phenotypic
(height, stem diameter, leaf morphology, fruit size) as well as biochemical determinants of
drought stress.
Relative water content (RWC)
Follwing full vegetative growth of the transgenic line T0 (OE0) and T1 (OE1) plants grown
in plastic pots containing sterile soil, peat and vermiculite mixture (1:1:1) in plastic pots, 3
terminal full expanded leaves were harvested from stressed and non-stressed transgenic
and cotrol tomato plants. RWC was measured by taking fresh weight of detached leaves
(FW). The leaves were then soaked in distilled water filled deep petri dish for 48 h at 4 °C
and weighed again to get turgid weight (TW). Subsequently leaves were dried in dry heat
oven at 60 °C for 48 h for measurement of dry weight (DW). The RWC was calculated by
the equation followed by Kaya and Higgs (2003) as follows.
RWC % = ((FW–-DW)/ (TW–-DW)) × 100
Formatted: Font: (Default) Times New Roman, 12 pt
Formatted: Font: (Default) Times New Roman
Materials and Methods Chapter 2
65
Leaf water loss index
Transgenic and control tomato plants after 7 days dehydration treatment and non treatment
control were selected and terminal leaves were sampled randomly. Initial fresh weight of
the leaves were measured. Detached leaves were placed in closed petridish in growth
chamber under controlled environment at 23 2°C with 30–50% humidity and 70 µE m−2
s−1 incubated Post dehydration treatmet for 23 2°C with 30–50% humidity and 16/8 hr
Light/Dark photoperiod provided by 70 μmolm-2s-1 cool white fluorescent lights in a
growth room. Water loss was measured as percent decrease of initial fresh weight over 6
hr time at an interval of 30 min in subsequent readings (Raineri et al., 2015).
Enzyme extraction
For enzyme extraction 100 mg of leaf and stem cuttings from transgenic and WT plants
were harvested randomly and instantly frozen in liquid nitrogen. The frozen sample were
grounded to fine powder in pre chilled pastel and mortar in liquid nitrogen. 1.5 mL of
phosphate (100 mM, pH 7.2), containing 0.5% triton X-100 was added to the sample
powder followed by merceration. The homogenate was centrifuged at 15,000×g for 15 min
at 4°C. The supernatant was collected as enzyme extract and stored at -20°C for further
antioxidant enzyme analysis.
Nitroblue tetrazolium SOD assay
Superoxide dismutase (SOD, EC 1.15.1.1) activity was determined by method followed by
(Beauchamp and Fridovich, 1971) with some modifications. This method is based on the
measurement of the inhibition of photochemical reduction of nitro blue tetrazolium (NBT)
chloride dye. The reduction of NBT is followed by measure of absorbance increase
spectrophotometrically at 570 nm. The reaction mixture (3 mL) contained 75 µM NBT, 13
µM L-methionine, 0.1 mM EDTA, 0.05 M sodium carbonate and 500 µL of prepared
enzyme extract. 13 µM riboflavin was added in the last to start the reaction by irradiation
of samples under fluorescent lamps for 15 min at 25°C. The sample tubes were prepared
in duplets and marked as sample (light) and sample (dark). Appropriate blank controls were
also set up by addition of 500 µL of extraction buffer only and marked as blank (dark). The
absorbance of light sample and dark sample were measured at 560 nm by using dual beam
Analytik Jena Specord 50Plus Spectrophotometer 190(UV/Vis)-1100 nm, based on
Materials and Methods Chapter 2
66
Lambert–Beer’s law. Following Spectrophotometric analysis, the SOD activity was
calculated in units of SOD activity defined as the amount of enzyme required to inhibit
reduction of NBT by 50% by using formula given below.
% inhibition of NBT reduction by SOD = control A560- (A560sample (light) - A560sample
(dark)/ control A560x 100 =X% inhibition
SOD units per g fresh weight of sample = (SOD units)/ (fresh weight of sample in grams)
Guaiacol peroxidase (POD) activity
Peroxidase activity (POX, EC 1.11.1.7) was measured as increase in absorbance at 470 nm
due to oxidation of guaiacol to tetraguaiacol by modification of method followed by Lim
et al., (2016). Guaiacol was utilized as substrate for the estimation of peroxidase activity.
The rate at which guaiacol dehydrogenation product is formed due to oxidation is taken a
measure of the POD activity and can be assayed spectrophotometrically at 470 nm (Sofo
et al., 2015). The reaction mixture (3 mL) contains 2.5 mL of 50 mM phosphate buffer pH
5.0, 300 µL of 40 mM H2O2 and 100 µL of enzyme extract. The reaction was started by
addition of 100 µL 20 mM guaiacol to the reaction mixture. Changes in absorbance were
determined for 3 min at intervals of 20 seconds at 470 nm. The POD activity was measured
by using the extinction coefficient of tetraguaiacol product (26.6 mM-1cm-1) in the formula
as
Enzyme activity (m Mol UA/g FW) = change in A470/time taken (min) x 1/extinction
coefficient of enzyme x total reaction volume / volume of enzyme extract taken x total
volume of enzyme extract / Fresh wt of tissue (g)
Catalase (CAT) activity
CAT (EC. 1.11.1.6) activity was determined by rate of decomposition of H2O2 to give H2O
and O2. The decomposition rate was assayed spectrophotometrically by rate of
disappearance of H2O2 per unit time at 240 nm by modification of method followed by Ijaz
et al., (2017) for tomato. The reaction mixture (2 mL) consisted of 50 mM phosphate buffer
(pH 7.0), 10 mM H2O2 and 0.1 mL enzyme extract. The activity of CAT enzyme was
Materials and Methods Chapter 2
67
defined as unit change in absorbance by 0.1. Specific activity of enzyme was calculated as
milimoles by using H2O2 extinction coefficient of 39.4 mM-1cm-1 in the formula has given
below.
Enzyme activity (m Mol UA/g FW) = change in A240/ time taken (min) x 1/extinction
coefficient of enzyme x total reaction volume/ volume of enzyme extract taken x total
volume of enzyme extract/ Fresh wt of tissue (g).
Malondialdehyde (MDA) content analysis
The oxidative burst following stress encounter and lipid peroxidation level of water
stressed transgenic leaves and stem as compared to control plants was done by measuring
malondialdehyde (MDA) levels quantified by thiobarbituric acid (TBA) reaction modified
from (Sun et al., 2010). Measurement of MDA level which are by products of lipid
peroxidation activity due to oxidative stress are used extensively as an indicator of
oxidative burst. Approximately 0.1 g of leaf and stem was homogenized in 5 mL of 5%
trichloroaceticacid (TCA) with the help of liquid nitrogen. The homogenate was
centrifuged 10,000×g for 15 min at 25 °C. The supernatant was collected in separate tube
and equal amount of 0.5% thiobarbituric acid (TBA) was added to the supernatant. The
mixture was boiled at 95 °C for 25 min. The reaction was again centrifuged at 7500 ×g for
5 min. The clarified solution was this collected to measure absorbance at 532 nm and 600
nm. Absorbance at 600 nm was taken to subtract any nonspecific turbidity to calculate level
of MDA using extinction coefficient of 155 mM−1 cm in the formula given below.
Enzyme activity (m Mol UA/g FW) = OD 532-OD600 x 1/extinction coefficient of enzyme
x total reaction volume/ volume of enzyme extract taken x total volume of enzyme extract/
Fresh wt of tissue (g)
Ascorbate peroxidase activity (APX)
APX activity (EC 1.1.11.1) determines the H2O2 detoxification system in plants as a part
of ascorbate-glutathione cycle, in which APX serves as a key enzyme where ascorbic acid
act as specific electron donor for the reduction of H2O2. APX activity was measured by
following method of according to the method followed by Nakano and Asada (1981). The
reaction mixture consisted of 0.1 ml of enzyme extract, 50 mM potassium phosphate (pH
Materials and Methods Chapter 2
68
7.0), 0.2 mM EDTA, 0.5 mM ascorbic acid, 2% H2O2 in a total reaction of 2 mLl. The
oxidation of ascorbic acid per min was measured as decrease in absorbance at 290 nm.
Specific activity of enzyme was calculated as milimoles using extinction coefficient of
2.8 mM-1 APX. One unit of ascorbate oxidized was measured as 1 mmol ml-1cm-1 mg-
1 protein oxidized per min.
Chlorophyll content analysis
Transgenic and control plants grown in soil with drought stress treatment and without
treatment were collected randomly. 100 mg of sample was ground to fine powder in liquid
nitrogen and homogenized in 2 mL of dimethyl sulphoxide (DMSO). The chlorophyll
pigment was determined spectrophotometrically by modification of method used by
(Wellburn, 1994). The homogenate was incubated at 65° C for 30 min in a water bath. 3
mL of fresh DMSO is added to the tube and again incubated for 10 min at 60°C.
Supernatant was collected in separate tube and volume was marked upto 10 mL with
DMSO. The absorbance of chlorophyll extract was measured at 645 and 663 nm against
DMSO blank. Total chlorophyll content (a & b) was calculated by equations followed by
(Arnon, 1949) as shown below.
. ChlA (g l-1) = 0.0127 A663 – 0.00269 A645
ChlB (g l-1) = 0.0029 A663 – 0.00468 A645
Total Chl (g l-1) = 0.0202 A663 + 0.00802 A645
Total Phenols, Flavonoid and antioxidant estimation of transgenic
tomato plants
Phenolic content estimation
For The phenolic content estimation of tomato fruit and leaf extracts, Folin–Ciocalteu (F–
C) reagent assay was performed according to Ainsworth and Elizabeth (2007). Methanolic
extracts of fresh ripened fruit was prepared by merceration of 250 mg in liquid nitrogen.
The powder sample was dissolved in 5 mLl of pure methanol (Sigma). The sample was
subsequently centrifuged at 12000 rmp for 10 min at room temperature. The supernatant
was collected in separate tube and stored at -20°C until further use. The reaction mixture
is prepared by addition of 1 mLl of crude enzyme extract in 5 mLl of distilled water. 200
Formatted: Line spacing: 1.5 lines
Materials and Methods Chapter 2
69
µL of sample was mixed with 200 µL of F-C reagent (Sigma) and incubated at room
temperature for 5 min. 2 mL of 5% (w/v) Na2CO3 solution was added to the reaction tube
and total volume was marked to 5 mL with double distilled water. The reaction was
incubated for 30 min at room temperature. Phenolic content was measured at 765 nm from
calibration curve of gallic acid prepared at various concentration. Total phenolic content
was determined as mg of gallic acid equivalents GAE/g FW. The calibration curve was
prepared by mixing 1 mL of 12.5, 25, 50,100, 150 and 200 μg/mL of Gallic acid solution
with 5 mL of F-C reagent and 4.0 mL of 5% Na2CO3. The reactions were incubated at
room temperature for 30 min. The absorbance was measured at 765 nm. The calibration
curve was plotted as function of concentration of gallic acid.
The total phenolic content was calculated with the help of the graph of calibration curve
(Appendix IV) by using the formula given as
Total phenolic content in mg/g =
Fresh weight of smaple (g)
Flavonoid content
Aluminium chloride technique was used for estimation of total flavonoid content
determined by following method of Chen et al., (2014). 100 mg of mercerated tissue was
dissolved in 2 mL of absolute methanol. The sample was filtered and stored at 20°C until
further use. The reaction mixture of 1 mL contained 100 µL of enzyme extract mixed with
430 µL of 5% NaNO2. Tubes were incubated for 5 min at room temperature. Subsequently
30 µL of 10% AlCl3 and 440 µL of 1M NaOH was added and the reaction was incubated
again at room temperature for 30 min. The absorbance was read at 496 nm, using standard
curve of quercetin (Appendix V). The results were measured as mg of quercetin equivalents
(QE) per g fresh weight of the sample.
Total Flavonoid content in mg/g =
Volume of
extract in mL Concentration of Gallic acid
established from the calibration curve
curve in mg/ml
×
Concentration of quercetin Gallic acid
established from the calibration curve
in mg/ml
× Volume of
extract in mL
Fresh weight of smaple (g)
Concentration of Gallic acid
established from the calibration
curve in mg/ml
Formatted: Line spacing: 1.5 lines
Materials and Methods Chapter 2
70
DPPH radical scavenging assay
2,2-Diphenyl-1-picrylhydrazyl (DPPH) radical scavenging activity is based on reduction
of DPPH- Methanol solution assay due to presence of H+ donating activity of antioxidants.
The antiradical activity was estimated according to Nickavar et al., (2006). 0.1 mM
solution of DPPH was prepared in absolute methanol. 0.1 mL of methanolic extracts were
mixed vigorously with 1 ml of DPPH solution. The samples were incubated in dark for 30
min at room temperature and absorbance was measured at 517 nm against ascorbic acid as
refrence. The percent radical scavenging activity was calculated as follows. DPPH stock
solution was taken as control.
DPPH Scavenging % = [(A517 of control reaction- A517 of extract / A517 of control reaction)]
×100
The EC50 value, concentration of sample giving 50% reduction of initial DPPH
concentration was regarded as EC50 of sample and ascorbic acid (reference). The values
were obtained from the graphical plot of linear regression of average % antioxidant against
concentration (μg/mLl).
Statistical Analysis
All the experiments were repeated three times with 30 explants per treatment. Significance
of differences between results was estimated by one-way analysis of variance (ANOVA)
using generalized linear model. The percentage data was arcsine transformed (arcsine
[squareroot(X)]) and square root (for count) before analysis. The results were back
transformed and presented as mean± standard error. Variation among treatment means
were compared by Tukey’s procedure at P ≤ 0.05 & means were separated by Student’s t-
test (P < 0.05) using SPSS v. 23.0 (IBM, USA. Significant differences between means
are denoted by different lower-case letters or asterisks.
Development of Smart molecular tools STRItools
(STRIgolactone tools)
Synthesis of SL analogues
To elucidate the molecular events taking place in the ligand binding receptor D14, and
identification of new SL analogues that may behave as agonists or antagonists various
Materials and Methods Chapter 2
71
exclusive tools were developed and implemented. The reactivity of naturally occurring SLs
containing the active D-ring i.e. the site of nucleophilic attack for binding inside the ligand
binding pocket of receptor D14 was selectively modified by replacing butenolide D-ring
of natural SLs into a lactam functional group. The synthesis of analogues and mimics along
with their stability analysis as well as docking simulations were was perfomedcarried out
at Department of Chemistry, University of Turin Italy.
Based on D-lactam system series of SL analogues were prepared by ring closing metathesis
on suitable substituted amides under optimized conditions (Figure 2.11). We also prepared
the molecules ‘SL mimics’ which lacks normal ABC scaffold of SLs but retained D-ring
connected to an additional group by means of an ether or ester functionality were prepared
as well. Another SL mimic “CL” where D ring is conjugated to an easy leaving group was
also synthesizedprepared and BODIPY (BOron DIPYrromethens) fluorophore with
Sulfonamide functional group as “CL-BP”. These molecules were observed to mimic SL
activity and due to simple structure, they can prove to be potential candidates for
applications in agriculture (Fukui et al., 2011). To investigate the binding mode of GR24-
based lactams and SL mimics within the receptor, docking simulations were performed
within the ligand binding pocket of D14 (PDB code 5DJ5). In the next step a novel in
planta based quantitative assay was developed to access the biological activity of new
analogues. Synthetic procedures, characterization, and absolute configuration assignments
were performed according to previous work Lombardi et al., (2017). Ring closing
Metathesis (RCM) was utilized for synthesis of GR24-based D-lactams. The synthesis of
analogues and mimics was carried out at Department of Chemistry, University of Turin
Italy. We synthesized four compounds of the family of GR24 based four compounds , two
with the same configuration as Strigol and two as Orobanchol were synthesized. Either
tert-butyloxycarbonyl (N Boc) NH protected (rac 1-4) compounds were prepared. Boc
group protection is considered stable towards most nucleophilic attack. EGO10 are indolyl
SL analogues, alsocorrespondingly synthesized as NH and N Boc derivative [rac 5-6]
(Prandi et al., 2011). The last family of compounds are known as SL-mimics, also in this
case as NH and N Boc derivative [rac 7 and 8] was prepared (Fukui et al., 2011). All the
compounds were obtained and used as racemic mixture. Compound rac 9 lacks the enol
ether bridge and it is expected to be inactive (Figure 2.12)
Materials and Methods Chapter 2
72
Figure 2.112.11 Modification of GR24 to D-Lactams
Materials and Methods Chapter 2
73
Figure 2.122.12 D-Lactams analogues and mimics synthesized in this study
rac-1 and rac-2 are the N-Boc-protected GR24 D-lactam diastereoisomers. rac-3 and rac-4 are the NH
GR24 D-lactam diastereoisomers. rac-5 and rac-6 are NH and N-Boc D-lactam EGO10 derivatives,
respectively. rac-7 and rac-8 are mimic D-lactams for NH and N-Boc, respectively. rac-9 is an EGO10 derivative lacking the enol ether bridge. SL mimic CL where D ring is conjugated to an easy leaving
group, devoid of ABC rings. SL mimic CL-BP conjugated with fluorescent functional group BODIPY.
SL mimics
Materials and Methods Chapter 2
74
Stability analysis
Different naturally occurring and synthetic analogues of SLs depict variable reactivity, a
characteristic feature of SL. Thus, differences in activity of different analogues and mimics
may be accounted for their instability in aqueous environment. Aqueous solutions of the
compounds to be tested (200 μg mL–1) were incubated at 25°C in HPLC vials. The
compounds were first dissolved in methanol (30%) or acetonitrile (50%) and then diluted
to the final concentrations with water. The time-course of degradation was monitored by
HPLC using an Agilent Technologies HPLC chromatograph 1200 Series equipped with a
photo-diode array (PDA) detector, a binary-gradient high-pressure pump, and an automatic
sampler. The column used was a LiChroCART® 125- LiChrospher® 100 RP-18 (5 μm,
Merck Millipore) maintained at 25 °C. The solvents were (A) water + 0.1% formic acid
and (B) acetonitrile, and the flow rate was 0.8 mL min–1. The initial mobile phase, 95% A
/ 5% B, was held for 3 min and then ramped linearly to 100% B at 23 min and held for 5
min before resetting to the original conditions. The sample injection volume was 10 μL.
PDA detection was by absorbance in the 200–600 nm wavelength range. Peak detection
was at the optimum wavelength (254 nm) and peak areas were used for quantification.
Initial and subsequent measurements of peak area attributable to the tested compound were
used to fit exponential half-life curves and to calculate first-order rate constants. Stability
data allowed for calculation of the time in hours for half of the tested compound to be
hydrolysed (t1/2).
Germination assay
To monitor the biological activity of newly synthesized SL-D-lactams, their ability to
promote seed germination was investigated on seeds of P. aegyptiaca and compared to rac-
GR24, strigol, ST23b, EGO10, and EDOT as the reference standard. Seeds of Phelipanche
aegyptiaca were kindly provided by Department of Department of Chemistry, University
of Turin Italy. The biological assay on D-Lactams were carried out at Department of
Agriculture, Forest and Food Sciences (DISAFA), UNITO Italy.
chemistry, UNITO.IT. The seeds were stored in glass vials in the dark at room temperature
until their use in germination tests. For the preparation of test solutions, the compound to
be tested was weighed out very accurately, dissolved in acetone at 10–2 M and then diluted
Materials and Methods Chapter 2
75
with sterile distilled water to the desired concentrations. All solutions were prepared just
before use. Seeds were surface-sterilized and preconditioned as described by Bhattacharya
et al., (2009). Briefly, after exposure for 5 min to 50% (v/v) aqueous solutions of
commercial bleach (2% hypochlorite) seeds were rinsed with sterile distilled water. For
preconditioning, seeds were placed on glass fiber filter discs using a sterile toothpick
(approximately 50 seeds per disc); the glass fibre discs were placed on two filter paper
discs, wetted with sterile distilled water, and incubated at 25 °C in the dark for 6 d. The
preconditioned seeds were then allowed to dry completely in a laminar flow cabinet, after
which they were treated with each compound at five different concentrations: 10–5 M, 10–
6 M, 10–7 M, 10–8 M, and 10–9 M. Their germination rate was evaluated under a
stereomicroscope 7 d after the beginning of the treatment. For each concentration, at least
250 seeds were scored; synthetic SL rac-GR24 was included as a positive control across
the same range of concentrations, while a solution of 0.001% acetone in sterile distilled
water was included as a negative control. Seeds were scored as germinated if the radicle
protruded through the seed coat 1 week after treatment. Germination values were
normalized to those of rac-GR24 at 10–7 M.
Luminometer in planta assays
Seeds of transgenic Arabidopsis pD14::D14::LUC were obtained from NCB Madrid Spain.
A binary D14p::D14::LUC vector was obtained by LR-recombination (Invitrogen) of a
pDONOR207 carrying the D14 promoter fused to the D14 CDS (Chevalier et al., 2014).
Transgenic Arabidopsis seeds were surface sterilized with 8% house hold bleach (sodium
hypochlorite) for five min and rinsed 5 times with sterile distilled water. Sterile seeds were
plated on MS salts without sucrose solidified with 4% Phytagel and kept at 4°C in dark for
3 days for stratification. Seeds were then transferred to growth room at 25°C 16 h light/8 h
dark photoperiod for 7 days. SL analogues and mimics (Figure 2.12 ) were accurately
weighed and dissolved in acetone at 10–2 M. Five different concentrations (10–4 M, 10–5
M, 10–6 M, 10–7 M, 10–8 M) were prepared by 1:10 serial dilutions in liquid MS medium,
together with blank controls containing corresponding water and acetone volumes in the
medium. D-Luciferin (potassium salt Sigma) stock was prepared at 25 mg/mL in DMSO,
aliquoted and stored at –80 °C until use; all other solutions were prepared just before the
assay. Multiwell plates were prepared with 170 µL of standard MS liquid. 7 days old,
Materials and Methods Chapter 2
76
Arabidopsis seedlings were placed in each well with the help of tweezer their cotyledons
facing upward as shown in Figure 2.13. 15 µL (0.125 mg/mL, diluted 1:200 in MS from
stock=1.875 µg) of luciferin was added to each well. Plate was covered with transparent
sticker and two holes were made without disturbing the seedling. Measurements were
started in multimode reader (LB942 Tristar2 S, Berthold Technologies) and allowed to
stabilize for 2-3 hours in light before addition of any treatment. 15 µL treatment (different
SLs dissolved in standard MS solution) per well is added and measurement continued for
next 24 hours. Appropriate blank controls were added as well. Each treatment was applied
to a minimum of 16 wells (seedlings), each of which was measured individually over time.
The basic principle and plan of Luminometer assay is shown in Figure 2.14. The percentage
efficacy of each compound molecule was calculated 6 h after treatment as a function of the
decrease in D14::LUC-emitted luminescence with respect to (+)-GR24 1 µM (i.e.
GR245DS), assuming that the latter, minus the drift of the corresponding blank control, had
100% efficacy. Before testing any analogues the assay was calibrated by testing already
known synthetic SL analogues (+)-GR24 (i.e. GR245DS) racemic mixture and both of its
enantiomers, GR24 d1A, GR24 d1B & (±)-EGO10 were tested at variable concentration
range (Prandi et al., 2011). The half maximal-effective concentration (EC50) for (+)-GR24
was calculated by linear regression fitting of the data (n=5, with at least three individual
seedlings and values being pooled for each replicate) at the different concentrations, minus
the values for acetone-treated samples (negative controls) and normalized in relation to
(+)-GR24 0.01 μM, which was set to 0%. Confidence intervals at 95% were used to express
errors of the means.
Materials and Methods Chapter 2
77
Figure 2.132.13 Multimode Luminometer based quantitative in planta assay for
of SL and SL related compounds
(A-B) Multiwell plate setup. (C) Multimode Luminometer
Materials and Methods Chapter 2
78
When the mobile SL enter a cell, they are bound by D14, an α/β-hydrolase-fold protein. This binding induces a conformational switch in D14 for interactions with the F-box protein D3/MAX2–SCF–E2 complex, which tags
targets such as D53 by polyubiquitination. This tagging directs degradation of target genes via ubiquitin–
proteasome pathway in SL depenedent manner. A negative feedback loop is also triggered, in which D14 is
directed for degradation, and hence luciferase activity decreases in reporter plants.
pD14::D14::LUC
SL
Figure 2.142.14 Mode of SL-D14 interaction and real time monitoring of SL related activity
Materials and Methods Chapter 2
79
Docking analysis
Final analysis on activity of SL based D- Lactams analogues and subsequent binding inside
protein binding pocket of D14 receptor was done by in silico studies. Ligand scout platform
was used for docking of compounds. For comparison purpose, we performed molecular
docking was performed into rice D14 (PDB: 5DJ5) using Glide from the Schroedinger
Suite. The structure of rice D14 co-crystallized with GR24 [PDB code 5dj5] was selected
as template given its high similarity to the ligands under study and the high conservation
of the binding-site residues (Zhao et al., 2015). For each compound, 25 diverse poses were
generated and analyzed. A radius of 10 Å was used to define the pocket extension.
Automatic default parameters were set for the Genetic Algorithm. Shape constraints were
imposed using as template the structure of GR24 co- crystallized within the target.
ChemScore was used as the scoring function. All calculations were performed on a Dell
Precision workstation, having two Intel Xeon processors, twelve core 1TB 7.2K 6GBPS
SAS Hard Drive, NVidia GTX 980 graphic card, and a Linux operating system centos 7,
kernel version 3.10.0-514.10.2.el7.x86_64. Molecular interaction fields were calculated
using FLAP [Fingerprints for Ligands and Proteins], using the DRY probe to describe
potential hydrophobic interactions, and the sp2 carbonyl oxygen O and the amide N1
probes for hydrogen-bond donor and acceptor regions, respectively (Baroni et al., 2007;
Grossert et al., 2015).
Analysis of ABA dynamics using in planta luminescence
based assay
Once the D14 based quantitative assay to quantify SL dynamics in genetically encoded
model was done with fruitful proof of concept, same system was investigated for
quantitative insights to check the activity of different hormones and root exudates of tomato
that share same signaling mechanism or particularly SLs related activity.
Luminescence based assays
D14-LUC quenching based assays were performed as descried in section 2.8.4 using
Arabidopsis based reporter line containing D14 receptor under indigenous promoter
(Chevalier et al., 2014). Seed were grown as described above. Phytohormones (ABA, IAA,
KIN, and GA3) were dissolved in acetone to a final concentration of 10-2 M. Five different
Materials and Methods Chapter 2
80
concentration 10-4 M, 10-5 M, 10-6 M, 10–7 M, 10–8 M were prepared in MS liquid. Tomato
root exudates were obtained in purified form in HPLC vials of 2.4 mg. The purified
exudates were dissolved in acetone to final concentration of 10-2M from which five
different concentrations were made by serial dilution in MS liquid. Similar dilution of Rac-
GR24 and blank MS control containing approximate proportion of water and acetone
equivalent to treatments was also prepared. D-Luciferin (potassium salt) 25X stocks were
prepared in DMSO and 8 µL aliquots were stored at -80°C. All the treatments were
prepared just before starting assay. Multiwell plates were prepared with 170ul of standard
MS liquid. 7 days old Arabidopsis seedlings were placed in each well with the help of
tweezer their cotyledons facing upward. 15 µL (1 X) of luciferin was added to each well.
Plate was covered with transparent sticker and two holes were made without disturbing the
seedling. Measurements were started in multimode reader (Berthole technologies) and
allowed to stabilize for 2-3 hours. 15 µL treatment (Hormones dissolved in standard MS
solution) per well is added and measurement continued for next 24 hours. Appropriate
blank controls were added as well. Percent efficacy of each molecule (normalized to
appropriate controls) at T=3 hr after treatment was calculated assuming GR24 1 µM at 3
hr being 100% efficient (D14 receptor-SL complex). The proportional efficacy of each
molecule was calculated as a function of decrease in signal with respect to (100% signal)
GR24 1 µM. Residual fluorescence of all molecule were calculated for time span of 15 hr
with equivalent acetone control as well as MS control.
Gene expression by quantitative reverse-transcription PCR
(qRT-PCR)
Following luminometer assays ABA treated Arabidopsis seedlings were pooled out at 0 hr,
3 hr, 6 hr and 15 hr time from the 96 well plate. Another experiment was separately set up
on petri plate, 7 days old seedlings were incubated on MS medium containing 10 µM, 10
µM, 50 µM and 100 µM of ABA for 48 hr. Total RNA was extracted by using Spectrum™
Plant Total RNA Kit (catalog# STRN250) according to manufacturer’s instruction. RNA
integrity and quantity were confirmed by gel electrophoresis and NanoDrop ND-2000.
RNA samples displaying ratio of A260/A280 ranging from 1.9-2.2 was selected further for
RNA quality inspection and cDNA synthesis. To minimize the risk of genomic DNA
Materials and Methods Chapter 2
81
contamination, RNA samples were treated with RNase-free DNase I (NEB 2U
µL−1 catalog# M0303S). RNA integrity was again confirmed by gel electrophoresis. 1 %
agarose gel was used to separate RNA, where good quality samples were selected for
cDNA synthesis based on intact 28S and 18S ribosomal RNA having band intensities of
2:1 (Figure 3.16).
cDNA synthesis
For first-strand cDNA synthesized 5 µg of DNase I treated total RNA was used using the
High Capacity cDNA Reverse Transcription kit (Applied Biosystems) following the
suppliers manual as shown in Table 2.5. cDNA integrity and primer specificity was
confirmed by PCR and agarose gel electrophoresis. Freshly prepared cDNA was stored at
-80°C and later used for qPCR reactions.
Quantification of gene expression
qRT-PCR reactions were set up in triplicate for 10 µL volume using SYBR Green method
(Power SYBR® Green PCR Master Mix, Applied Biosystems) on StepOnePlusTM Real
time detection system (Applied Biosystems, USA). The sequence for two biosynthetic
genes for SL, namely the Carotenoid Cleavage Dioxygenases (CCD) 7 and, 9‐
cisepoxycarotenoid dioxygenase (NCED) 3 were retrieved from NCBI nucleotide
repository. Primers (Table 2.4) for specific gene targets were designed by using Snapgene
software (GSL Biotech LLC). The RT–qPCR was conducted following treatment of
seedling. A single sample contained atleast two pooled seedlings. Reaction was normalized
for each tragetted gene using house keeping gene ubiquitin (UBI) as internal control. SYBR
Green method (Power SYBR® Green PCR Master Mix, Applied Biosystems) was used and
threshold cycles (CT) numbers were obtained. Quantification of fold change in expression
of gene transcripts (2-ΔΔCT method) with reference to ubiquitin (UBI) as endogenous
standard. Each reaction of 10 µL final volume contained 5 µL of 2X SYBR Green mix, 0.5
µM of each primer and 1 µL of template cDNA (1/5 dilution).
Materials and Methods Chapter 2
82
Figure 2.152.15 qRT-PCR reaction conditions used in the study
Relative gene expression was calaculated for targeted genes by following 2-ΔΔCT method
as described by Livak method (Livak and Schmittgen, 2001). Average CT values for target
genes and reference housekeeping gene ubiquitin was obtained from data file of qPCR
reaction. The CT values were used for relative expression of each targeted gene by the
formula as follows.
Sample ΔCT = Target gene CT - UBI
ΔΔCT = Treated ΔCT– Untreated control ΔCT
Fold Change = 2-ΔΔCT
Relative gene expression = Fold change of target gene of treated samples/Fold change of
gene of control
While sample CT is threshold value, the point when fluorescence increases significantly
above the background fluorescence of target genes and reference gene (Ubiquitin).
In silico docking
The receptor protein AtD14 PDB ID: 4IH4 (Arabidopsis DWARF14 orthologue) for
molecular docking studies was retrieved from protein data bank (www.rcsb.org). The
Materials and Methods Chapter 2
83
receptor AtD14 was prepared by adding side chains and missing residues by Prime
modelling tool. The ligand preparation was carried out by using ligprep tool embedded in
Maestro interface of Schrodinger software (www.schrodinger.com). We performed
dockingDocking simulations were performed for of naturally occurring S-(+)-ABA in
AtD14 having rmsd < 0.85 Å. A radius of 10 Å was used to define the pocket extension.
The docking pose was generated by superimposition of only one active enantiomer of
(+)-GR24 within in the pocket superimposed S-(+)-ABA.
Results Chapter 3
84
Chapter 3
Results
Results Chapter 3
85
3. Results
This study was conducted in three phases. First of all, in vitro regeneration response of four
tomato cultivar(s) of Solanum lycopersicum via organogenesis through callus induction
and direct somatic embryogenesis (SE) was optimized. Various factors, which effect in
vitro morphogenesis response, were investigated for all experimental cultivars. Most
responsive variety was selected for Agrobacterium mediated transformation. Biosynthetic
genes in SLs pathway, carotenoid cleavage dioxygenases 7 (CCD7) and the receptor D14
were cloned in pGreen binary vector system for plant transformation. The putative
transgenics were then characterized. We then developed smartSmart tools were developed
to access the activity of SL and ligand-receptor dynamics by fluorescence-based bioassay
for quantification of natural and synthetic SLs. Various analogues and mimics were
synthesized and tested via bioassays in order to investigate Structure–activity relationship
(SAR). Later the assay was used to study the putative interaction of D14 receptor with
other phytohormones especially ABA in the context of cross talk between two prime
hormones involved in abiotic stress management i.e. SL–-ABA cross talk. Some of these
unexplored interactions were highlighted during preliminary studies done with extensive
literature available on SL dynamics in plants like tomato, rice and Arabidopsis.
Tomato cell culture
Seed germination and contamination control
Genetic variation exists within Solanum species for rapid seed germination and seedling
vigour and most commercial cultivars of tomato are sensitive to stress conditions during
early stages of seedling growth (Foolad et al., 2007). In this study, the effects of different
concentrations of commercial sodium hypochlorite with and without the surfactant tween
20 and household bleach on seed germination were evaluated and their efficiency to control
contamination was assessed for all four types of seeds of Solanum lycopersicum L. (see
Table 3.1). The addition of a 2% sucrose solution to the basal medium was tested during
the germination process; it was observed that seed germination was unaffected by the
inclusion or exclusion of sucrose during first week. Contamination free seed germination
without sucrose inclusion in germination media was achieved in these experiments (Table
3.1). Although sucrose is an important component for healthy tomato cell cultures, it was
Results Chapter 3
86
found that an absence of sucrose does not affect the rate of germination and seedling
emergence (Table 3.2). An increase in concentration of NaOCl beyond 10%, v/v was found
to negatively affect the seed germination and vigor. Tomato seeds of all varieties sterilized
with > 10% sodium hypochlorite exhibited complete loss of germination activity
irrespective of media composition. Lowest germination was observed at 15 and 20% v/v
NaOCl. While treatment with 6% sodium hypochlorite and 8% house hold bleach for 15
min and gentle agitation, followed by 2 days incubation in dark was found optimal for seed
germination on half strength and full-strength medium leading to ~90% seed germination.
Lower level of sodium hypochlorite (1–-2.5%) was found to induce early germination;
however, 50% of the cultured seeds were infected with fungal contamination. The use of
tween 20 in combination with NaOCl was found suboptimal. Tween 20, a non-ionic
surfactant was used as a wetting agent as it helps to penetrate aqueous NaOCl. When the
6% NaOCl solution was used alone, the germination index was lower. However, Tween
20 in combination with 6% NaOCl proved to be effective in controlling the contamination
of tomato cell cultures. The four type of seeds tested in this study showed slightly more but
not significantly different germination activity on half strength MS media as compared to
full strength (Figure 3.1). Seeds of cv. Riogrande and Roma showed 90–-80% germination
index on both media (P<0.05); however, Hybrid-17905 and cv. M82 were significantly
slower in germination response (Table 3.1).
It was observed that seed vigour depends on genotype as well as self-pollination
background. Light and dark incubation for 48 hr on medium vessels was found to induce
quick germination response. The growth in both conditions was good but germination rate
was 95% in dark and about 75–-80% in light. The seeds in dark conditions started
germinating in 3–-4 days while seeds in light germinated in 5-6 days suggesting that
stratification of seeds in dark period breaks the dormancy of seeds. Another factor that
affect germination rate assessed was the storage of seed. Seeds stored on room temperature
were found dormant and they start germination after 15 days and the germination rate was
also low. On the other hand, seeds stored in cold temperature germinated quickly after
stratification.
Results Chapter 3
87
Table 3.1 Effect of Clorox (NaOCl) concentration on sterilization of seeds of Solanum
lycopersicum L cvs. Riogrande, Roma, M82 and hybrid (17905) on full and ½MS medium
without sucrose
NaOCl (%
v/v)
House
Hold
bleach
(% v/v)
Tween 20
Treatment
duration
(min)
%Germination : %Contamination
Remarks
Rio Roma Hybrid M82
1 - - 15 60: 90 63:80 69:89 66:78 Contamination
2 - - 15 65:50 67:60 56:61 45:62.5 >50
contamination
3 - - 15 87:20 85:22 60:25 35:25 >50
contamination
5 - - 15 92:8 89:13 72:15 30:20 Optimal
germination
6 - - 15 95:5 93:7 82:12 30:5 maximum
germination
6 - 2 drops 15 85:20 76:20 66:25 25:2 Sub optimal
germination
10 - - 10 20:0 15:0 18:0 10:0 <20%
germination
15 - - 10 2:0 3:0 - - No germination
20 - - 10 0 0 - - No germination
- 8 - 15 72:20 74:23 60:15 10:25 Delayed
germination
Results Chapter 3
88
Figure 3.13.1 Germination of Solanum lycopersicum L. cvs. Riogrande, Roma, M82
hybrid (17905) on full and ½ strength MS medium without sucrose
(A) Germination on ½ strength MS media (B) Germination on full strength MS media
Results Chapter 3
89
In vitro callus formation is genotype-dependent
Various PGRs monitor in vitro morphogenesis response by modulating different
physiological processes in plants. In this study, different combinations of PGRs were tested
for callus induction and regeneration. The two types of explants (cotyledons and
hypocotyls) from one-week-old seedlings used for callus induction showed variable
responses to callus induction media treatments [CIM T0-T16] (Table 3.3). It was observed
that the effect of explant type was of little influence as compared to genotype and treatment
during the experiments. Maximum development of calli was achieved from young
cotyledons of the cv. Riogrande, having an efficiency of 82.08% from CIMT9, 85% from
CIMT12. CIMT9 was found to be the most suitable treatment leading to soft, fleshy green
callus from both cotyledons and hypocotyls, which quickly regenerates. cv. Roma showed
callus formation on CIMT12 and CIMT9 at 83.9% and 75 % respectively (Table 3.3).
However, the other two types i.e. hybrid (17905) and cv. M82 were comparatively less
responsive at above-mentioned hormonal treatments and thus took longer time. In
comparison, model cultivar M82 only exhibited callus induction activity with a
combination of treatments (CIMT9 & CIMT13/ CIMT14). Both CIMT9 and CIMT13 alone
were found ineffective in callus formation. In order from most effective to least, different
CI treatments viz; CIMT0–CIMT16 for efficient callus induction were as follows
CIMT12>CIMT9>CIMT10>CIMT13>CIMT11>CIMT15>CIMT14.
Results Chapter 3
90
Table 3.2 The effect of various combinations of PGRs on callogenesis in Solanum
lycopersicum cultivars irrespective of explant type.
Treatment (Callus induction Medium)
CIM
Rio Grande Roma Hybrid M82
CIMT0 =4.15g/L MS salts+
vitamins +2%Suc+0.8% plant agar
pH 5.8
0.001±0.13h 0.001±0.13h 0.001±0.13j 0.001±0.13h
CIMT1= 0.2 mg/L NAA (MS basal
medium)
0.001±0.13h 0.001±0.13h 0.001±0.13j 0.001±0.13h
CIMT2= 0.5 mg/L NAA (MS basal
medium)
0.001±0.13h 0.001±0.13h 0.001±0.13j 0.001±0.13h
CIMT3= 1 mg/L NAA (MS basal medium) 0.001±0.13h 0.001±0.13h 0.001±0.13j 0.001±0.13h
CIMT4= 2 mg/L NAA (MS basal medium) 1.91±0.15g 0.63±0.10h 0.01±0.97j 0.001±0h
CIMT5= 0.2 mg/L NAA+1 mg/L BAP (MS
basal medium)
13.7±0.04ef 17.83±0.042f
8.43±0.11h 0.001±0h
CIMT6=0.2 mg/L NAA+2 mg/L BAP (MS
basal medium)
10.26±0.03e
f
13.56±0.03f 10.06±0.21h 0.001±0h
CIMT7=0.2 mg/L NAA+3 mg/L BAP (MS
basal medium)
2.72±0.20g 2.47±0.13g 1.26±0.1i 0.001±0h
CIMT8=0.2 mg/L NAA+4 mg/L BAP (MS
basal medium)
1.5874±0.1g 2±0.1g 1±0i 0.0013±0h
CIMT9= 0.5 mg/L NAA+1 mg/L BAP (MS
basal medium)
82.8±0.01ab 75.15±0.16
ab
45.64±0.12
ab
30.27±0.17
c
CIMT10=1 mg/L NAA+1 mg/L BAP (MS
basal medium)
35.33±0.04d 65.40±0.06c 26.43±0.07e 4.30±0.17fg
CIMT11=1/0.5 mg/L IAA+1 mg/L BAP
(MS basal medium)
33.96±0.17d 28.84±0.8e 31.34±0.11d 25.45±0.09d
CIMT12=2 mg/L IAA+2 mg/L NAA+2
mg/L BAP+4 mg/L KIN (MS basal medium)
85.23±0.13a 83.93±0.11 a 63.65±0.07a 9.86±0.51e
CIMT13=2 mg/L IAA+2 mg/L NAA+2
mg/L BAP+4 mg/L ZEA (MS basal
medium)
46.26±0.03c 24.67±0.12e 17.5±0.21f 64.8±0.87s
CIMT14=0.5 mg/L IAA+2/0.5 mg/L
NAA+2 mg/L 2,4-D+0.2 mg/L ZEA (MS
basal medium)
27.05
±0.33d
20.32±0.27e 15.32±1.2fg 53 ±0.67b
CIMT15=0.5 mg/L BAP+0.5 mg/L NAA+2 mg/L GA3 (MS basal medium)
33.35±0.23d 35.33±0.06
d 40.90±0.36b
c 6.88±0.19fg
CIMT16=2 mg/L 2,4-D+0.5 mg/L BAP
(MS basal medium)
14.22±0.134e
5.31±0.23g 2.0±0.16i 4.71±0.26fg
Data represent the mean ± standard error S.E (n = 51) of three replications. Means followed by the same
letter within column are not significantly different as determined by a pairwise comparison using Tukey’s
test at p<0.05.
Results Chapter 3
91
Embryogenic calli derived from cotyledonary explants depicted a high shoot regeneration
potential in Rio and Roma while other two cultivars only developed pale white compact
callus (Figure 3.1). A hypocotyl-derived callus had many embryoids in Riogrande;
however, callus induction was slower, and calli were less totipotent as compared to those
from cotyledons (Figures 3.1 & 3.2). The callus induced from Riogrande was of massive
size as compared to other cultivars reaching upto 1 g measuring 7.2 mm. The response to
callogenesis was found highly dependent on genotype and was notably affected by the
reproductive background mode (self-pollination) of the cultivars. T0 was used as control
treatment with no plant growth hormones or regulators to compare the other treatments
having different PGRs. No callus formation was observed in plants with T0 suggesting that
combination of different auxins and cytokinins is necessary for callus induction in any of
plant part. Callus obtained from various treatments were sub-cultured every week on fresh
medium on shoot and root induction medium for the regeneration.
Effect of media pH & NAA concentrations on in vitro morphogenesis
Organogenesis via direct or in direct somatic embryogenesis (SE) in tomato through
complex signaling network leads to elicitation of regulation in gene expression that
influence totipotency in cell culture. Such regulations occur as a response to exogenous
PGRs or some stress stimuli such as low pH, osmotic shock or high temperature. We used
Low medium pH along with two auxins analogues NAA and 2,4-D at concentrations 0.5
mg/L and/or 2 mg/L were utilized to initiate SE in Riogrande cotyledons and hypocotyl
explants. In first set of experiment done with increasing concentration of NAA at pH 4.0
showed that at NAA concentration >2 mg/L favors callogenesis and minimum rhizoid
formation was observed (Table 3.3 & Figure 3.4). The initiation of direst SE occurred
without any remarkable callus formation from the edges of both explants after 2–-3 days
of incubation on rhizoid induction medium (RhIM) as thin rhizoid like structures different
from adventitious or true root structure measuring up to 1cm in length (Figure 3.5). Without
PGRs or dark conditions, no rhizoids were observed. The second set of experiment was
done with fixed concentration of NAA i.e. 2 mg/L but varying pH level (3.0–-7.0). The
results showed that out of pH ranging from 3.0–-7.0, only pH 4.0 supplemented with NAA
at 2 mg/L resulted in initiation of SE from one-week-old tomato cotyledons and hypocotyls
irrespective of explant type (Figure 3.6). In general 2,4-D is considered as most effective
Results Chapter 3
92
hormone for induction of primary and secondary somatic embryos in many plants species
(Sofiari et al., 1997). Different concentrations of both auxins analogues with all pH levels
tested in triplicate revealed that 2, 4–-D was not as effective as NAA [0.5 and 2 mg/L]
(Table 3.3). In fact, explants sub-cultured on a medium supplemented with 2, 4-D failed to
produce rhizoids. SE could be induced by use of combinations of auxins and/or cytokinins
that influence endogenous levels of auxins and polar auxins transport. However, this
process is largely species dependent. Both cotyledons and hypocotyl explants displayed
significant growth of rhizoids; however, the former took less time for initiation (Figure
3.5). After 3 weeks of inoculation, the average number of rhizoids induced from cotyledons
at pH 4.0 were 23.6±3.56 in a medium supplemented with 0.5 mg/L and 2 mg/L NAA.
Testing various levels of pH against range of concentrations of NAA (0.5 mg/L4.0 mg/L)
clearly showed that only at certain threshold concertation of NAA at pH 4.0 can effectively
induce SE. The sequence of effective media pH to exhibit a substantial number of rhizoids
and RTBs from both explants was 4.0 > 5.0 > 6.0 > 7.0 supplemented with NAA 0.5 or 2
mg/L (Table 3.3).
Results Chapter 3
93
Figure 3.23.2 Callus morphology of Solanum lycopersicum L. cvs. Riogrande, Roma, M82
and hybrid (17905) on optimized media
(A) Greenish soft calli induced from cotyledons of Rio. (B) Off white with green portions calli induced from
cotyledons of Roma. (C) Off white calli with green spots induced from cotyledons of hybrid 17905. (D) Pale
white calli induced from cotyledons of M82. Scale bars (A, B, C, D) 150 mm.
Results Chapter 3
94
Figure 3.33.3 Callus morphology of Solanum lycopersicum L. cvs. Riogrande, Roma,
and hybrid (17905) on optimized media
(A) White calli with green patches induced from hypocotyls of Rio. (B) Off white with green portions calli
induced from hypocotyls of Roma. (C) White calli induced from cotyledons of hybrid 17905. (D) Brownish
calli induced from hypocotyls of M82. Scale bars (A, B, C, D) 150 mm.
Results Chapter 3
95
Table 3.3 The EEffect of vVarious cConcentrations of NAA and pH values on rhizoid
in S. lycopersicum cv. Riogrande.
Data represent the mean ± standard error S.E (n = 40) of four replications. Means followed by the same letter
within column are not significantly different as determined by a pairwise comparison using Tukey’s test at p<0.05. (Saeed et al., 2019)
NAA
(mg/L)
pH
level
Mean No. of
rhizoids/
explant ± S.E
2,4-D
(mg/L)
pH
level
Mean No. of
rhizoids/
explant ±
S.E
NAA
(mg/L)
pH
level
Mean No. of
rhizoids/
explant ± S.E
0 4 00.00±0.00d 0 4 0.00±0.00 2 3 00.00±0.00d
0.5 4 23.6±3.56a 0.5 4 0.00±0.00 2 4 23.0±2.79a
1 4 15.21±2.34
ab
1 4 0.00±0.00 2 5 16.31±2.11ab
1.5 4 8.23±1.59bc 1.5 4 0.00±0.00 2 6 14.72±2.22c
2 4 21.69±3.4a 2 4 0.00±0.00 2 7 11.03±1.39c
3 4
11.31±1.74b 3 4 0.00±0.00 -- -- --
4 4 9.80±1.43bc 4 4 0.00±0.00 -- -- --
Results Chapter 3
96
Figure 3.43.4 Effect of increasing concentration of NAA at pH 4.0 on S.E from cotyledon
and hypocotyl of S. lycopersicum cv. Riogrande.
(A)Explants cultured on pH 4.0 + 0.5 mg/L NAA. (B) Explants cultured on pH 4.0 + 1 mg/L NAA (C-D)
Explants cultured on pH 4.0 + 2 mg/L NAA. (E) Explants cultured pH 4.0 + 3 mg/L NAA. (F) Explants
cultured on pH 4.0 + 4 mg/L NAA. Scale bars (A-F, 200 mm).
Results Chapter 3
97
Figure 3.53.5 The Eeffect of medium pH (4.0) on rhizoids production from cotyledon and
hypocotyl explants of S. lycopersicum cv. Riogrande.
(A-A2) Rhizoids induced on cotyledon explants after one-week incubation. (B-B2) Rhizoids induced on
hypocotyl explants after one-week incubation. (C) Primary and secondary somatic embryogenesis with many
proembryos after 2 weeks of incubation. Scale bars (A, A2, B, B2) 5 mm. Scale bars (C), 50 mm. (Saeed et al., 2019)
Results Chapter 3
98
Figure 3.63.6 Effect of pH 4.0 + 2 mg/L NAA vs pH 3, 5, 6 & 7
(A-C) Explants cultured on pH 4.0 + 2 mg/L NAA. (C) Enlarged view under box showing hair like rhizoid
extensions from explant edges. (D) Explants cultured on pH 3.0 + 2 mg/L NAA. (E) Explants cultured pH
5.0 + 2 mg/L NAA in dark conditions. (F) Explants cultured pH 6.0 + 2 mg/L NAA. (G) Explants cultured
pH 7.0 + 2 mg/L NAA in dark conditions. Scale bars (A, D, E, F, and G) 150 mm. Scale bar (B) 200 mm. Scale bar (C) 20 mm.
Results Chapter 3
99
Figure 3.73.7 Effect of NAA*pH level on RTBs formation
Data represent the mean ± standard error S.E calculated from 90 explants per treatment in 3 replicates. Error
bars represent S.E for three independent experiments. Significant differences are shown by asterisks ** P<
0.01 calculated by Student’s t test.
Secondary embryogenesis and novel structures “Rhizoid tubers”
(RTB) formation
The initiation phase of SE due to auxins and low pH media was followed by onset of
secondary embryogenesis. Thus, individual rhizoids, upon transfer to a medium containing
5 mg/L TDZ or BAP in light conditions, produced secondary embryogenesis and novel
structures – rhizoid tubers (RTBs) with many somatic embryoids. Rhizoids were allowed
to mature at pH 4.0 on same medium started callogenesis in light while, cluster of rhizoids
with many proembryos was shifted to MS media supplemented with 5, 10, 15 or 20 mg/L
TDZ and 5 mg BAP for RTBs induction at pH 4.0 (Tables 3.4 and 3.5). Primary embryoids
lead to secondary embryoids due to cytokinins in the medium.
-5
0
5
10
15
20
25
30
35
40
45
3 4 5 6 7
Me
an N
o. R
hiz
oid
s
pH Level
NAA
0.50
1.00
1.50
2.00
3.00
4.00
**
**
Results Chapter 3
100
Table 3.4 Effect of TDZ/BAP concentration on rhizoid tubers (RTBs) induction at low pH
in S. lycopersicum cv. Riogrande (no distinction of explant type).
Data represent the mean (no. of RTBs) ± standard error (S.E) calculated from 120 explants in four replicates
for each treatment. Means followed by the same letter within column are not significantly different as
determined by a pairwise comparison using Tukey’s (HSD) test at p<0.05. TDZ: N-phenyl-N′-1, 2, 3-thiadiazol-5-ylurea. (Saeed et al., 2019)
Table 3.5 Effect of pH values on development of rhizoid tubers (RTBs) irrespective of
explant type in S. lycopersicum cv. Riogrande supplemented with 5 mg/L of TDZ
Data represent the mean (no. of RTBs) ± standard error S.E calculated from 120 explants in four replicates
of each treatment. Means followed by the same letter within column are not significantly different as determined by a pairwise comparison using Tukey’s (HSD) test at p<0.05. (Saeed et al., 2019)
TDZ mg/L pH value Mean no. of RTBs /explant
±S.E
5 3.0 0.00±00e
5 4.0 46.35±0.05a
5 5.0 15.5±0.08b
5 6.0 7.94±0.02c
5 7.0 2.16±0.07d
TDZ
mg/L
pH Mean No. of RTBs
/explant ±S.E
BAP
mg/L
Mean No. of RTBs
/explant ±S.E
Induction time
5 4.0 45.75±1.25a 5 44.5± 3.41a 12 Days
10 4.0 30.50±3.22b -- -- 12 Days
15 4.0 18.25±1.97c -- -- 12 Days
20 4.0 14.00±2.08cd -- -- 12 Days
Results Chapter 3
101
After 12 days of inoculation on rhizoid tuber induction medium under light conditions
(16/8 h, light/dark, white fluorescent lights 80 μmolm-2s-1), individual hair like rhizoids
started formation of club shaped clusters termed as: rhizoid tubers (RTB) [Figure 3.8].
Contrary to photoperiod condition, the rhizoids left in dark lead to callus formation. It has
been found that RTBs were induced only on pH 4.0, while no such structures were
observed at pH 5.8. The result analysis indicated that pH 4.0 satisfies formation of both
rhizoids and RTBs. Effect of increasing concentration of TDZ (5-20 mg/L) while keeping
the pH of medium to 4.0 showed that number of RTBs decreases with increasing
concentration of TDZ (Table 3.4). Maximum number of RTBs were 46 that appeared on
medium with 5 mg/L of TDZ at pH 4.0. BAP at equal concentrations was also found
correspondingly effective in RTBs formation (44 RTBs). Addition of TDZ to primary
somatic embryos further enhanced the process of embryogenesis and many globular and
torpedo- and heart shaped somatic embryos became visible after 3 days of incubation
(Figure 3.8 A-D). While sequential incubation of primary embryos and rhizoid clusters on
TDZ and BAP 5 mg/L encouraged shift of somatic embryos to shoot organogenesis.
Figure 3.83.8 Origination of RTBs from rhizoids at pH 4.0.
(A) Induction of secondary embryogenesis as RTBs on media supplemented with 5 mg/L TDZ. Highlighted
portion and arrows show formation of novel structures RTBs (B) Individual RTBs excised and allowed to
mature for embryo germination. Scale bars (A & B, 200 mm).
Results Chapter 3
102
RTBs were seen on both ends of explants in contact with medium while, central parts
mainly showed progression through globular embryos, heart-torpedo and pre-cotyledonary
embryo at the tip: as prospective shoot tip. Former were excised and allowed for in vitro
shooting while, later formed well-developed shoot tip and in vivo germination of embryo
(Figures 3.9 & 3.10). Various level of medium pH tested against fixed concentration of
TDZ showed that with increasing pH levels, number of RTBs again started decreasing
much like the trend seen with increasing TDZ concentration (Table 3.5). With increasing
concentration of TDZ (20 mg/L) only somatic embryos were formed and number of pro-
tubers and mature rhizoid tubers declines at pH 4.0. Which means that somatic embryos
resulted due to cytokinins and low pH, rearranged their fate to germination and seedling
formation with elevated level of cytokinins i.e. TDZ.
Shoot organogenesis from RTBs and calli
Whole plantlet formation form RTBs
Use of cytokinins at low pH with normal photoperiod induced secondary embryogenesis
in tomato cell cultures having primary embryoids. Cytokinins dose and type has shown
differential response in development and maturation of secondary somatic embryos. When
different concentration of TDZ or BAP were supplemented in MS medium at pH 4.0,
secondary somatic embryos at the surface of explants appeared. With increasing
concentration of TDZ (20 mg/L), only somatic embryos were formed and number of pro-
tubers and mature rhizoid tubers declines at pH 4.0. However, when explants were
cultivated on medium with TDZ or BAP (5 mg/L) at pH 4.0, maximum number of RTBs
was formed in first week, whereas, globular and heart torpedo shaped became visible
(Figure 3.9 A, B and C). When further incubation occurs under light conditions all primary
embryos were converted to secondary embryos and shoot tip appeared at the top of explant
(Figure 3.9 D). These pre-cotyledonary embryos were distinctly different from primary
somatic embryos. The cluster of RTBs formed adventitious shoots directly when cultured
on TDZ or BAP (5 mg/L) at pH 5.8 (Figure 3.9 E). Whereas, different stages of somatic
embryos: globular and heart torpedo stages on the surface of explants were more prominent
at pH 4.0. These embryos germinated like typical SE, an apical shoot developed first and
Results Chapter 3
103
sequentially leaves appeared later (Figure 3.8 D and E). Induction of in vitro shoots was
exceptionally high on pH 5.8 in comparison to in vivo shoot morphogenesis, which was
found to be slow at a lower pH 4.0 (Figure 3.10). This suggests that a lower pH with auxins
(NAA) is required for rhizoid induction in the dark. Cytokinins (TDZ/BAP) addition in
media with lower pH under light conditions induced novel structures – rhizoid tubers
(RTBs) in S. lycopersicum cv. Riogrande. However, in vitro regeneration from RTBs was
more favourable at pH 5.8 (Figure 3.10). The low H+ concentration of growth media
remained ubiquitous in tomato tissue culture in this study for induction of rhizoids, somatic
embryos and RTBs formation. RTB embryoids were found to be novel structures consist
of embryonic cells that spontaneously develop to form multiple plantlets in 2 weeks (Figure
3.10). Thus, a new regeneration system for fast and efficient propagation was optimized.
Figure 3.93.9 Induction of RTBs from rhizoids on MS media supplemented with
(5 mg/L) at pH 4.0.
(A-B) Induction of RTBs in light conditions, arrows showing development of club shaped structures. (C-D) Maturation of RTBs to pre-cotyledonary stage embryo at the tip of rhizoid cluster. (E) In vivo germination
of somatic embryos to whole plantlet. Scale bars (A-E) 20 mm.(Saeed et al., 2019)
Results Chapter 3
104
Figure 3.103.10 Stages of whole plantlet development via in vitro shooting from excised
(A-C) Maturation of excised RTBs in light conditions at pH 4.0 with 5 mg/L TDZ arrows showing
development of club shaped structures. (D-F) Development in vitro shoots and roots directly from RTBs. (Saeed et al., 2019)
Shoot and root organogenesis form callus culture
The dose of cytokinins alone as well as their combination with auxins has been found
critical for shoot organogenesis in tomato. Therefore, in this study we evaluated explant
type, cultivar and treatment for regeneration of four tomato varieties were compared. BAP
alone at 3-5 mg/L induced more adventitious shoots and greater shooting percentage for
all four varieties. Statistically significant differences were observed among shoot
organogenesis between genotypes and explant types. The maximum numbers of shoots
Results Chapter 3
105
were induced on SIMT6 media with BAP (3 mg/L) and IAA (0.1 mg/L) with 45 shoots
produced per explant of cv. Riogrande Figure 1 G). BAP alone at 35 mg/L was found
second most effective medium (SIMT3) in shoot regeneration. cv. Riogrande showed
56.9% shoot induction frequency for cotyledon-derived explants at SIMT6. Significant
differences were observed among all treatments at (p<0.05); all four cultivars depicted
differential response to each treatment. The order of varietal shoot-induction frequency
from cotyledons was Rio>Roma>Hybrid>M82. The effect of treatment ×genotype was
found highly significant (Table 3.6). The time for morphogenesis of shoots ranged from
3.5 for SIMT6 and SIMT3 to 6 weeks for complete shoot organogenesis.
The newly regenerated shoots were excised from callus interface and cultivated on root
induction media (RIM), containing different hormones (Table 3.7). Rooting was observed
2 weeks post inoculation. RIM 5 with either NAA 0.1 mg/L or 0.5 mg/L and RIM 6
containing IBA 1 mg/L rendered a maximum number of roots. cv. Riogrande was most
profound in rooting response with 12 roots/shoot on RIM 5. Irrespective of treatment cv.
Riogrande and Roma showed 100 percent rooting frequency. However, differences in
number and extent of rooting were seen. Well-rooted plantlets were hardened by shifting
to soil substrate over a month before transferring them to natural environment. More than
90% of the plants survived with normal physiology with abilities to develop flowers and
fruit. The steps of complete in vitro regeneration of tomato are shown in Figure 3.11.
Results Chapter 3
106
Table 3.6 Effects of culture media and explant type on shoot regeneration in four S.
lycopersicum cultivars.
Treatment/
cv
Riogrande
BAP
(mg/L)
NAA
(mg/L)
IAA
(mg/L)
KIN
(mg/L)
Percentage of explants with
Shoots± S.E
Mean no. of
shoots± S.E
No distinction
of explant type
Cotyledon Hypocotyl
SIMT1 2 --- --- --- 37.65±0.71e 35.01±0.81c 1.00±0.81 ab
SIMT2 3 --- --- --- 43.66±0.83c 40.23±0.76b 1.51±0.34ab
SIMT3 5 --- --- --- 47.69±1.38ab 30.74±2.0b 3.48±0.21a
SIMT4 1 0.1 2 41.9348d 25.94±0.93d 1.05±0.61ab
SIMT5 3 0.1 --- --- 48.25±0.83ab 45.67±0.36a 2.50 ± 1.0a
SIMT6 3 --- 0.1 --- 56.18±1.28a 43.68±1.9a 5.55±1.0a
Treatment/
cv Roma
BAP
(mg/L)
NAA
(mg/L)
IAA
(mg/L)
KIN
(mg/L)
Percentage of explants with
Shoots ± S.E
Mean no. of
shoots± S.E
No distinction
of explant type
Cotyledon Hypocotyl
SIMT1 2 --- --- --- 35.05±0.93d 33.05±2.09c 0.55±1.0ab
SIMT2 3 --- --- --- 39.23±0.67c 30.98±0.72d 0.88±0.19ab
SIMT3 5 --- --- --- 52.74±1.04a 44.74±2.7ab 3.00±0.16 a
SIMT4 1 0.1 2 31.94±0.78e 34.94±0.73c 1.55±0.21ab
SIMT5 3 0.1 --- --- 47.67±0.83b 46.90±0.836a 2.00±1.03 a
SIMT6 3 --- 0.1 --- 47.68±1.49 b 44.67±1.49ab 4.34±0.51 a
Treatment/
cv hybrid
BAP
(mg/L)
NAA
(mg/L)
IAA
(mg/L)
KIN
(mg/L)
Percentage of explants with
Shoots ± S.E
Mean no. of
shoots± S.E
No distinction
of explant type Cotyledon Hypocotyl
SIMT1 2 --- --- --- 29.99±1.03d 30.05±2.09c 0.65±0.11a
Results Chapter 3
107
Data represent the mean (no. of explants with shoots /total no. of inoculated explants *100) ± standard error
S.E calculated from 200 explants. Means followed by the same letter within column are not significantly
different as determined by a pairwise comparison using Tukey’s (HSD) test at p<0.05. SIM: Shoot induction medium. (Saeed et al., 2019)
SIMT2 3 --- --- --- 39.22±0.6c 33.98±0.72b 1.10±0.51a
SIMT3 5 --- --- --- 40.20±1.08a 38.74±2.7 a 2.6±0.89 a
SIMT4 1 0.1 2 30.39±1.52d 30.94±0.73c 1.23±0.23a
SIMT5 3 0.1 --- --- 28.61±1.40de 30.90±0.83bc 1.8±0.16 a
SIMT6 3 --- 0.1 --- 34.61±1.80b 32.67±1.49bc 2.00±0.41 a
Treatment/
cv M82
BAP
(mg/L)
NAA
(mg/L)
IAA
(mg/L)
KIN
(mg/L)
Percentage of explants with
Shoots ± S.E
Mean No. of
shoots ± S.E
No distinction
of explant type
Cotyledon Hypocotyl
SIMT1 2 --- --- --- 17.70±0.63b 13.05±1.09c 0.33±0.21ab
SIMT2 3 --- --- --- 16.06±0.51c 13.28±1.72c 1.11±0.36 a
SIMT3 5 --- --- --- 21.39±2.10a 15.24±0.7b 1.5±0.18 a
SIMT4 1 0.1 2 13.13±0.81d 15.24±1.73b 1.07±0.19 a
SIMT5 3 0.1 --- --- 16.53±0.21c 18.20±0.836a 0.55±0.3 ab
SIMT6 3 --- 0.1 --- 13.67±0.50d 10.67±1.49e 0.72±0.16 a
Results Chapter 3
108
Table 3.7 Effect of auxins on rooting of in vitro regenerating shoots of four S. lycopersicum
cultivars after 8-10 weeks of incubation.
Data represent the mean (no. of roots developed from each shoot) ±standard error S.E of three replications
calculated from 200 explants for each treatment. Means followed by the same letter within column are not
significantly different as determined by a pairwise comparison using Tukey’s (HSD) test at p<0.05. (Saeed et al., 2019)
Treatment
IBA
(mg/
L)
NAA
(mg/L)
IAA
(mg/L)
Mean no.
of Roots±
S.E
cv
Riogrande
Mean no. of
Roots± S.E
cv Roma
Mean no.
of Roots±
S.E
cv Hybrid
Mean no.
of Roots±
S.E
cv M82
RIMT1
0.1 --- ---
6.16±0.7c 4.66±0.57c 3.33±0.57c 1.33±0.77
b
RIMT2
0.2 --- ---
4.66±2.08
c
5.33±1.15d 2.33±0.57d 0.33±0.57d
RIMT3
0.5 --- ---
8.0±0.50 ab 4.66±1.52c 4.0±1.00 b 1.66±1.5 b
RIMT4
1 --- ---
9.6±1.52 b 6.33±1.52 b 2.0±1.00 e 4.0±1.00 a
RIMT5
--- 0.5/0.1 ---
12.6±2.08a 10.33±1.52a 7.33±0.57a 1.0±1.00 c
RIMT6
--- --- 0.1
7.0±1.00ab 5.66±2.08c 4.66±1.52
b
1.33±1.52b
RIMT7
0.2
6.66±1.52c 4.66±2.08 c 2.33±0.57d 1.33±0.57
b
Results Chapter 3
109
Figure 3.113.11 Steps of complete in vitro regeneration in S. lycopersicum cv. Riogrande.
(A) In vitro grown one week seedlings of cv. Riogrande. (B) Cotyledonary explants. (C) Hypocotyls explants.
(D-E) Calli induced from cotyledons and hypocotyls. (F-G) shoot and root organogenesis. (H) Acclimitization of in vitro regenerated plantlets. Scale bars for (A, B, C, D, E and G), 150 mm. Scale bar for
(F) 20 mm. Scale bar for (H) 120 mm.
.
Results Chapter 3
110
Histological Analysis of RTBs
Microscopic observation of the transverse section of mature RTBs and calli containing
embryos stained with safranin showed an internal arrangement of embryonic cells and non-
embryonic cells. After 12 days, RTBs cultivation on tuber induction medium, rhizoid pro-
embryos accepted the dye and turned visibly dark pink, while non-embryonic tissues
remained unstained (Figure 3.12 A-D). The embryonic tissues were distinctly stained
pinkish red with globular, nodular, bi-lobed heart shaped and cotyledon shaped stages
(Figure 3.12 C, D, and E). Each tuber exhibited multiple embryoids at different stages of
development, hence progressing like typical somatic embryogenesis to a whole plantlet
(Fig 3.10 A, B). Cluster of pro-embryogenic masses (PEMs) and meristematic cells
surrounded the globular somatic embryos which was a pre-requisite for successful
proliferation and dedifferentiation somatic embryos. Most of the meristematic cells formed
callus at later stages with isodiametric cells while somatic embryos were often found
attached to these cells (Figures 3.12 A&C, 3.13 A, B, F&G). The secondary somatic
embryos were developed via regenerative process from primary ones. These somatic
embryos developed directly by cell division at epidermal and sub epidermal layers of
primary embryos (Figures. 3.13 F & 3.14 A-B). The RTBs are previously un-characterized
somatic embryos that were seen as agglomeration of somatic embryos of different stages
(globular, heart and bipolar/torpedo) after 12 days of incubation. These secondary embryos
particularly RTBs germinated by development of shoot apices.
Results Chapter 3
111
Figure 3.123.12 Light microscopic sections of rhizoid tubers (RTBs) stained with safranin
on tuber induction medium supplemented with 5 mg/L TDZ at pH 4.0 from cotyledon
explants of S. lycopersicum cv. Riogrande.
(A) Section of regenerating rhizoid tubers after 25 days of incubation showing globular and nodular embryos arising from aggregate of callus tissues, 40 X. (B) Enlarged view of T-section showing embryonic cells. (C)
Transverse section of mature RTB, 20X automatic scanning system [ASS]. (D) Enlarged view of section under box showing multiple embryoids. Scale bars (A, C) 200 μM. Scale bars (B, D) 50 μM. (Saeed et al.,
2019)
Results Chapter 3
112
Figure 3.133.13 Histology of somatic embryos developed via direct somatic
from cotyledons explants of S. lycopersicum cv. Riogrande.
Section of explants with various stages of somatic embryos showing abundance of globular stage embryos,
after one week on tuber induction medium. (B) Enlarged view of transverse section under red box. (C)
Globular shaped embryos [nucleus not stained] (D) Heart shaped embryos. (E) Torpedo-shaped cells. (F)
Longitudinal section of single RTB club shaped embryo attached to explant. (G) Safranin stained section
showing different stages of SE scale bars (A, G) 200 μM. Scale bars (C, D, and E) 200 μM. Scale bar (B, F)
50 μM. (Saeed et al., 2019)
Results Chapter 3
113
Figure 3.143.14 Histology of rhizoid cluster containing RTBs, globular and torpedo
embryos
Arrows showing globular and torpedo shaped secondary embryos. Scale bar (A) 20 mm. Scale bar (B) 50
μM
Results Chapter 3
114
Cloning of putative SL biosynthetic genes and transformation of S.
lycopersicum cv. Riogrande
During multi species, meta-analysis strigolactones (SL) and underpinnings of SL-ABA
cross-talk that has been increasingly spotlighted by research aimed at dissecting and
understanding abiotic stress tolerance. We evaluated tThehe genes involved in the
biosynthesis and signalling pathways of (SL) and their possible role in ABA mediated
stress physiology in plants particularly in tomato were investigated.. The findings
suggested various unexplored SLs cross talk with phytohormones particularly ABA at
biosynthetic level by substrate competition. Taking into account the data available on SL
synthesis and their pleiotropic role in stress physiology, We developed various pathways
for possible interactions between two hormones considering their shared carotenoid
basedorigion were proposed partially unexplored research (Figure 3.15). The systemic
analysis showed possible interaction of SL biosynthetic particularly CCD7, precursor for
SL synthesis with ABA biosynthetic gene at various level. It was also found one of the two
phytohormones is vital cause of stress induced cross talk between both hormones (Saeed
et al., 2017; Visentin et al., 2016). Based on systematic analysis, specific we designed our
strategy forbased on cloning and overexpression of SLCCD7/LJCCD7 and SLD14 in
pGreen based binary vector was adoptedplant expression vector. For this purpose in first
phase a reproducible and efficient in vitro regeneration system in tomato was developed.
The second phase consisted of vector construction, cloning and subsequent transformation
of tomato cv. Riogrande followed by characterization of transgenic plants and their
physiological assessment under stress conditions.
Results Chapter 3
115
Figure 3.153.15 Cross talk between SLs and abscisic acid (ABA) biosynthesis for the
adaptability of plants in response to challenging environmental.
Dotted lines represent the unexplored/ partially explored interactions (Saeed et al., 2017)
Results Chapter 3
116
Vector construction and functionality test
Isolation of CCD7 and D14 genes
CCD7 gene encoding carotenoid cleavage dioxygenases 7 (CCD7) and receptor protein of
SL signalling machinery α/β-fold hydrolase named (At) D14/DAD2/RMS3 sequences
were isolated from Solanum lycopersicum cv. M82 cDNA library coding sequence data
available from NCBI nucleotide repository: CCD7 (GI 262262693 & 100313501) D14 (GI
101258450/ XP_004253481.2).
PCR based amplification of CCD7 and D14 genes
The total RNA isolated from root and leaves of tomato M82 and its integrity was confirmed
by gel electrophoresis and nanospectrometer quantification. The RNA samples with
260/280 ratios ≥ 2.0 with good concentration as shown in Figure 3.16 were selected for
cDNA synthesis.
Figure 3.163.16 Total RNA quality and quantity from leaves and roots of tomato M82
(A) Dnase-1 treated RNA samples (B) Non treated RNA. Sample 1-4 (Lane 1-4) M82 leaves, Sample 5-8 (Lane
5-8) M82 roots. Right lane 9: 1kb DNA ladder (Viogene)
Results Chapter 3
117
Sequence analysis of SLD14 (GeneID:100313501) revealed that the start codon of open
reading frame was at extreme 5’end for which 5’ RACE PCR reactions were set up. The
confirmatory RACE PCR with gene specific primers of CCD7 gene was found negative
and needed extended 5’ RACE for full gene amplification. For the sake of convenience
insteadconvenience instead of SLCCD7, Lotus japonicas LjCCD7 cloned in
pGEX_LjCCD7 vector with glutathione S-transferase (GST) tag was used for positive
amplification kindly provided by Prof. Francesca Cardinale [Figure 3.17] (Liu et al.,
2013).
Figure 3.173.17 Vector map of pGEX-LjCCD7 (Liu et al., 2013)
Results Chapter 3
118
(A) PCR amplified fragments of LjCCD7 (B) Restriction map of amplified PCR product with XbaI-
HindIII full and partial double digestion. Lane 1 : 100 bp ladder (5PRIME, 100-1500 bp bands), Lane
2&4: Partially digested fragment with XbaI-HindIII giving 2 bands of 1560 bp & 322 bp. Lane 3,5&6:
fully digested fragment with XbaI-HindIII giving rise to one fragment of 1896bp. Lane 7: Partially
digested fragment with XbaI-HindIII giving 3 bands of 1870 bp,1560 bp & 322 bp.
The targeted gene was amplified with gene specific primers and a sequence of 1867 bp
corresponding to Lotus japonicus CCD7-like protein (CCD7) was obtained. Similarly
SLD14 was amplified and desired fragment of 817 bp was acquired (Figures 3.18 & 3.19).
The PCR products were purified using column based kit and cloning sites XbaI–-HindIII,
XmaI–- NotI and NcoI–- NotI were added to LjCCD7 and D14. The desired fragment was
confirmed via restriction mapping as shown in Figure 2.2. The restriction map shown in
Figure 2.2 showed that the LjCCD7 gene has 2 HindIII sites at 1577 bp and 1890 bp while
one XbaI site. On full digestion one band of 1570 bp and one band at 322 bp was generated
due to two restriction sites as seen from the shift in the band in lane 3 and 5. While partial
digestion with different incubation time returned mixed results of 1870 bp fragment, 1570
bp fragment and 322 bp fragment as shown in lane 7 of Figure 3.17. These results further
Figure 3.183.18 Amplified LjCCD7 fragment of 1899 bp and restriction map
created with XbaI-HindIII digestion.
Results Chapter 3
119
confirmed our targeted gene with cloning compatible restriction enzyme sites is the PCR
amplified product.
Lane 1, 7, 12: 1 kb ladder 5PRIME, Lane 2-6:2 kb CCD7 PCR amplified fragment, Lane 8-11: 817 bp
SLD14 PCR fragment
TA Cloning of LjCCD7 and SLD14
The gene of interest confirmed after PCR and restriction mapping was ligated with pGEMT
vector Promega linearized vector with a single 3´-terminal thymidine at both ends and PCR
products having A residues on 5’ or 3’ end ligate in two different orientation as shown in
Figure 3.19. Ligated products after transformation in highly competent cells gave positive
white colonies and negative colonies as blue due to presence of lacZ gene on vector
backbone (Figure 3.20). The positive colonies confirmed by colony PCR and plasmid
extraction through alkaline lysis showed 1870 & 817 base pair fragments corresponding to
targeted fragments (Figure 3.21). The final confirmation of the targeted gene was done by
sequencing of PCR amplified fragments ligated in pGEMT vectors. The sequence analysis
and alignment by chromas lite. The sequence homology with LjCCD7 was found 100 %
with the destination vector and reported sequence while SLD14 was found 99% similar to
Figure 3.193.19 PCR amplified LJCCD7 and SLD14 fragments
Results Chapter 3
120
reported sequence with one base change at 716 bp where Threonine (Thr/T) amino acid
codon ACT was replaced with ACC which was attributed to different cultivars of tomato
used in previous studies.
Figure 3.203.20 TA cloning of LjCCD7 & SLD14 in pGEMT vector
Figure 3.213.21 Blue white screening of TA clones in E. coli
Results Chapter 3
121
Figure 3.223.22 Colony PCR results showing desired gene from white positive clones
containing TA cloned gene of interest
(A) 1870 bp fragment corresponding to LjCCD7 gene from 50 white colonies. Lane 4, 6,7,8,9 &11 positive
amplified product. Lane 12: 100 bp ladder 5PRIME
(B) 817 bp SLD14 PCR fragment amplified from 50 colonies Lane 1: 1 Kb 5PRIME, Lane 2-10 positive
amplified product.
Sub-cloning of LjCCD7 and SLD14 in pGreenII0029 binary vector
system
LjCCD7 was subcloned to desination binary vector system for expression in plant under
MAS promoter and as 35S- TL-TEV: translational leader sequence from tobacco etch virus
promoter enhanncer (super promoter) with GFP fusion at C terminal via XbaI-HindIII &
XmaI- NotI cut out respectively. While, SLD14 was sub cloned, as N-C terminal fusion
(D14-GFP) via NcoI- NotI cut out. Both destination vector and insert after double digestion
were separated by gel electrophoresis to get fragments of desired size as shown in Figure
3.22. The XbaI-HindIII double digestion resulted in exclusion of GUS 1806 bp from
pGII0229MASgus/luc and linearized vector backbone of 7kb based on basic pGII0229
cassette having first cistron GUS under the control of P-MAS and second cistron (LUC)
under the control of tobacco mosaic virus (tmv) IRES element.
Results Chapter 3
122
For GFP fusion constructs assembly pGreenII0029-35S-TL-GFP XmaI- NotI & NcoI- NotI
resulted in 6180 bp linearized fragment shown in Figure 3.22. The fragment were of desired
size and gel purification of fragment was followed by ligation of targeted vector and insert
backbone to get advance expression vector system based on pGreen binary vector system
as shown in Figures 3.23, 3.24 and 3.25. The desired vector obtained showed presence of
genes confirmed via PCR with gene specific primers.
Figure 3.233.23 Restriction enzyme digestion of vector and insert
(A) Restriction fragmentation for sub cloning of SLD14. Lane 1: 1 kb gene ruler 5PRIME, Lane 2
NcoI- NotI digested SLD14. Lane 3: undigested SLD14. Lane 4-5: NcoI- NotI digested vector (pGreenII0029-
35S-TL-GFP). Lane 6:undigested vector (B) Restriction fragmentation for sub cloning of LjCCD7 gene. Lane 1: 100 bp gene ruler 5PRIME.
Lane 4: undigested vector 1. Lane 5: XbaI-HindIII digested vector (pGreenII0029-35S-TL-GFP). Lane 6:
undigested vector 2. Lane 7: XmaI- NotI digested vector 2. Lane 8: RE digested LjCCD7.
Results Chapter 3
123
Figure 3.243.24 Sub cloning of LjCCD7 in dicistronic vector in pGII0229
Figure 3.253.25 Sub-cloning of LjCCD7 fused with N terminal of GFP in pGII0229
Results Chapter 3
124
Figure 3.263.26 Sub-cloning of SLD14 fused with N terminal of GFP in pGII0229
Vector functionality in tomato by transient infiltration
The vector construct transformed in agrobacterium strains were evaluated for their
functionality in tomato leaves and fruits by GUS assays and GFP imaging. Efficiency
of transient expression was found dependent on various factors including type of
agrobacterium strain, infiltration medium, bacterial density, acetosyringone
Acetosyringone concentration and infection time.
Effect of bacterial density and infection time
Bacterial density showed significant effect on transient expression of GUS and GFP genes.
Once leaves were saturated with inoculum, increasing density leads to death of explants.
However, optical density was also found to depend on type Agrobacterium strain. For
Agrobacterium strains EHA105 & GV3101, lower bacterial density <0.3 resulted in mild
or no visible signal/stain and consequently low gene expression. Whereas, higher densities
Results Chapter 3
125
>1 lead to tissue necrosis and wilting. For EHA105 OD600 0.5-0.7 confers better
transformation efficiency ranging from 70-80 % (Table 3.8). GV3101 was found to be
virulent strain at the same density and most of the leaves died after 24 hr. Henceforth,
GV3101 harboring plasmids pGII0229MASCCD7-IRES-luc and pGII0029-35S-TL-
CCD7-GFP were found effective at OD600 0.3. The frequency of positive signal after
infiltration was found to be >80 % for EHA105. The efficiency of EHA105 can be
attributed to disarmed pTioB542 (Hood et al 1993) harboring Vir A and Vir G genes that
are required for efficient T-DNA transfer. The infiltrated samples incubated for 24, 48 and
72 hr investigated for development of signal showed that the transient expression was
maximum after 48 hr, while the intensity of signal/ colour decreases after 48 hr. 24 hr
incubation failed to produce desirable expression or too little signal was obtained.
Table 3.8 Effect of optical density on transient expression of T-DNA
Agrobacterium
strain
Optical
Density
(600 nm)
Incubation
time (hr)
Infiltration medium % Leaves
expression
EHA105 0.2-0.4 48 hr MS salt with vitamins, 2%
sucrose 200 µM
acetosyringoneAcetosyringone
2 mg/L NAA
32.80±0.9d
0.5-0.7 86.62±1.21a
0.8-1 44.01 ±2.2c
GV3101 0.2-0.4 48 hr MS salt with vitamins, 2%
sucrose 200 µM
acetosyringone
Acetosyringone 2 mg/L NAA
53.29 ±0.76b
0.5-0.7 17.3 ± 1.09e
0.8-1 8.2 ±2.0f
Data represent the mean ± standard error S.E calculated from 10 explants per treatment in there replicates.
Means followed by the same letter within column are not significantly different as determined by a pairwise
comparison using Tukey’s test at p<0.05.
Effect of infiltration medium and acetosyringoneAcetosyringone in
transient expression assay
Three different infiltration media (IFM) were used initially for transient assay along with
sterile water. The Infiltration medium influenced overall efficiency of agroinfection. The
level of acetosyringoneAcetosyringone was found prime factor to improve the transient
assay in expression of reporter genes (GUS, LUC, GFP). 0.9 % saline or dd H2O tested
Results Chapter 3
126
with various concentration of acetosyringoneAcetosyringone used as infiltration medium
gave <10% leaves with detectable signal. Our results showed that MS medium with sucrose
used as inoculation and suspension medium of bacterial pellet with 200 µM
acetosyringoneAcetosyringone was most suitable for infiltration and subsequent expression
of genes. Additions of auxins to IFM further enhanced the process of infection with >90
percent of leaves depicting GUS/GFP activity as evident form Table 3.8. Various
parameter tested for vector functionality test showed that Agrobacterium EHA105
harboring plasmids with optical density of 0.5-0.7 was most suitable when suspended in
NAA supplemented liquid MS medium after 48 hr of incubation as shown in Figure 3.27
& Table 3.9.
Table 3.9 Effect of acetosyringoneAcetosyringone concentration on transient expression
Infiltration medium
IFM
Aacetosyringonecetosyringone
concentration µM
% leaves with
Gus/GFP signal
0.9% Saline (IFM1) 0 0 ± 0k
100 6 ± 1.2gh
200 5.5 ±0.78gh
400 3.0 ± 0.5j
DdH2O (IFM2) 0 0 ± 0k
100 2.5 ±0.23i
200 8.9 ±0.65g
400 4.1 ±0.59i
MS salt with vitamins,
2% sucrose (IFM3)
0 0 ± 0k
100 63 ± 0.67e
200 75 ±0.33d
400 67 ± 1.9f
MS salt with vitamins,
2% sucrose + 2 mg/L
NAA (IFM4)
0 0 ±0k
100 78 ± 2.0c
200 96 ± 0.43a
400 88 ± 0.19b
Data represent the mean ± standard error S.E calculated from 10 explants per treatment in three replicates.
Means followed by the same letter within column are not significantly different as determined by a pairwise
comparison using Tukey’s test at p<0.05.
Results Chapter 3
127
Figure 3.273.27 Analysis of reporter gene expression in detached leaves and fruits of S.
lycopersicum cv. Riogrande
(A-A1) GUS gene expression in leaves of tomato. (B) GUS gene expression in pulp of mature fruit (C) In
planta penetration and GUS expression of individual seeds. (D) GFP imaging under direct UV irridation.
(E) GFP imaging under UV hand held lamp after transient infiltration of vector with CCD7/D14.
Results Chapter 3
128
Stable transformation of S. lycopersicum cv. Riogrande
After screening of favourable regeneration potential from four tomato cultivars, cv.
Riogrande with most prolific response towards organogenesis and somatic embryogenesis
was selected for Agrobacterium mediated transformation. Several factors were optimized
for transformation of cotyledons and hypocotyl explants including, age of explant, pre-
culture treatment, orientation of explant, optical density of agrobacterium, infection
duration, co-cultivation time, effect of wounding, selection antibiotics. The parameters
optimized for one variety may differ slightly for other cultivars due to differences in their
genotype.
Effect of age and orientation of explants
The age, size and orientation of explants influence overall response of explant towards cell
culture. In tomato, cell culture younger plants were found more responsive to in vitro
regeneration and somatic embryogenesis of all four cultivars used in the study. Young and
soft cotyledons were found more suitable in our study. The size of explant was also found
to affect the overall success of transformation procedures. During the preliminary
experiments of in vitro regeneration 7 days, old seedlings of Rio and Roma having vigorous
growth characteristics reached up to 1.5 cm cotyledons which were found ideal size for
transformation and regeneration. However, hybrid 17905 and model cultivar M82 were
slow in producing desired size cotyledons. Orientation of explant is found very critical for
rapid regeneration. It was found that explants with their physiological base away from
medium i.e. upside-down orientation was more favourable for somatic embryogenesis and
callus induction. During agrobacterium mediated infection process, it was found that
adaxial side of explants was more resilient to Agrobacterium infection and selection in later
stages.
Effect of pre-culture on regeneration of transformed shoots
We evaluated theThe effect of pre-culturing and wounding treatment on regeneration of
Kanamycinkanamycin resistant shoots of Riogrande was comaped. The explant pre
incubated on PCM (Table 2.2) in dark were found to remain more stable during the
Agrobacterium infection and subsequent washing post co-cultivation. Fresh wounded,
cotyledons wilted during co cultivation and were found more prone to contamination and
bacterial over growth. A statistically significant difference was observed between the
Results Chapter 3
129
wounded precultured and wounded fresh cotyledons (Figure 3.28). As shown in figure 3.28
precultured explants up to 5 days increased the percentage of kanamycin resistant shoots
as compared to fresh cotyledons. It was observed that pre-incubation of explants allowed
those to swell that assisted them to withstand infection, co cultivation and washing steps.
Infection and co cultivation duration
Time of bacterial infection and co-cultivation and bacterial density are important factors
that are dependent on each other. The results of our study indicated that too long co
cultivation time i.e. > 48 hr resulted in vigorous multiplication of bacteria which stemmed
regrowth of agrobacteria post washing and selection while too short co cultivation time
decreased the transformation efficiency. The time of co₋cultivation in turn has been
attributed to govern by bacterial density. As evident from preliminary vector functionality
assays, bacterial density ≥1 and <0.3 resulted in poor GUS expression while optical density
of 0.5₋0.7 at 600 nm gave 80% explants with detectable GUS expression. Consistent with
our previous results stable transformation frequency was found to be ~45% when co
cultivation for 48 hr was carried out with OD600 of 0.4–₋0.5 (Figure 3.28 & Table 3.10). In
the subsequent our experiments, we used infection time of 10, 15 & 20 min was utilized.
It was found from the pilot tests that 15 min infection time was best suited for infection of
Agrobacteria (Table 3.10).
Results Chapter 3
130
Table 3.10 Agrobacterium mediated stable transformation parameters optimized for S.
lycopersicum cv. Riogrande
Optical Density (600
nm)
Co-cultivation
time (hr)
Infection
time (min)
Regeneration efficiency (%)
on 50 mg/L
Kanamycinkanamycin
selection media
0.05-0.2
24 15 7.6 ± 0.29kl
20 9.0 ± 0.27j
48 15 10.0 ± 3.2hi
20 12.0 ± 1.29hi
72 15 15 ±0.78h
20 20 ± 0.89f
0.4-0.5 24 15 30 ± 1.7d
20 35 ± 2.67bc
48 15 45.4 ±2.23a
20 38.7 ± 1.09b
72 15 22.7±0.65f
20 19.6±0.86g
0.6-0.7 24 15 30.80 ± 1.0d
20 25.7 ± 0.45e
48 15 20.8 ± 1.37f
20 16.7 ± 3.09fg
72 15 19.7 ±0.25g
20 13.8 ± 1.82j
0.8-1 24 15 18.2 ±1.57fg
20 13.9 ± 1.0hi
48 15 10 ± 2.6hi
20 6.2 ± 0.55m
72 15 7.9 ± 0.43k
20 4.2± 1.03gh
Data represent the mean ± S.E calculated from 60 explants per treatment in there replicates. Means followed
by the same letter within column are not significantly different as determined by a pairwise comparison using
Tukey’s test at p<0.05.
Results Chapter 3
131
Figure 3.28 & 3.29 Data represent the mean values of three different experiments ± S.E. ** shows statistically
significantly difference (P < 0.01)
Figure 3.283.28 Effect of pre-culture treatment on transformation efficiency
Figure 3.293.29 Effect of bacterial density on transformation efficiency
Results Chapter 3
132
Figure 3.303.30 Effect of pre culture treatment Vs fresh cotyledons after co-cultivation
lycopersicum cv. Riogrande
(A-B) Pre culturing of explants for 2 days in dark conditions (C-E) Stages of recovery after co cultivation
and regeneration of explants. The explant showed clear sign of proliferation and callus development on
selection medium at the edges. (F-G) Fresh cotyledons after co cultivation showed obvious signs of necrosis
and browning when compared to pre conditioned explants. (H-I) Cell death and necrosis of explants without
pre culture treatment.
Results Chapter 3
133
Antibiotic sensitivity test
Elimination of Agrobacterium from the culture is an important pre requisite for successful
transformation after co cultivation. This was achieved by addition of antibiotics effective
against Agrobacterium. Various bacteriostatic antibiotics and their sensitivity towards
explants was tested. carbencillin and cefotaxime are mostly used in tomato cell culture.
100-300 mg/L of various antibiotics like carbencillin, cefotaxime, and 300-600 mg/L of
Timintin (ticarcillin disodium and clavulanate potassium) was tested alone. The result
showed that cefotaxime at 200 mg/L in combination with 100 mg/L carbencillin, and 300
mg/L timintin were most effective not only in limiting Agrobacterium after co cultivation
but also in survival of explant. Higher dose of antibiotics cefotaxime and carbencillin
resulted in necrosis of explant and lower dose lead to excessive contamination and death
of explants. We also tested Augmentin combination at 300 mg/L with lower dose of all
three antibiotics were also evaluated to in order to eliminate Agrobacteria post co-
result also showed that EHA105 was easiersy to remove from mediumlimit after co
with above mentioned treatments as compared to GV3101. Overall timentin which is β-
lactam antibiotic was found most effective that are active against Gram-negative bacteria
tumefaciens and tolerable for explants at high dose alone and at low dose in combination
as shown in Table 3.11.
Table 3.11 Antibiotic sensitivity screening for selection media optimized for S.
lycopersicum cv. Riogrande
Agrobacterium
strain
Cefotaxime
(mg/L)
Carbencillin
(mg/L)
Timentin
(mg/L)
Percentage of
survival
explants (based
on Kan resistant
shoots)
Appearance of
explants
EHA105 100 100 300 56.9 ±0.11.d Green healthy
200 100 300 61.3 ±1.21c Green healthy
300 - - 35.9±1.8g Necrosis
500 - - 43.7±1.2f Pale yellow
- - 600 75.0±2.0a Yellow green
GV3101 100 300 - 28.29 ±0.76c Necrosis
200 300 54.3 ± 1.09e Browning
300 - - 18.2 ±0.98i Bacterial growth
500 - - 23.0±1.29h Bacterial growth
- 600 69.0±1.0b Pale yellow
Results Chapter 3
134
Data represent the mean ± S.E calculated from 30 explants per treatment in three replicates. Means followed
by the same letter within column are not significantly different as determined by a pairwise comparison using
Tukey’s test at p<0.05.
Regeneration of putatively transformed explants and shooting
Following agrobacterium infection the cotyledonary explants and hypocotyls aplaced on
CIMT12= 2 mg/L IAA, 2 mg/L NAA, 2 mg/L BAP, 4mg/L KIN containing basal medium
with 50mg/L Kanamycinkanamycin and 600 mg/L Timentin for one week. The explants
turned green showing the successful event of transformation while non transformed
explants depicted necrosis and cell death following co cultivation as shown in Figure 3.30
(C-I). The growing calli were shifted to shoot inducing medium SIMT6 containing 3 mg/L
BAP and 0.1 mg/L IAA/NAA. After one week of incubation when shoot primordia
appeared the regenerating explant were sub cultured and selection antibiotic removed to
enhance shoot and root organogenesis. The Kanamycinkanamycin concentration was also
monitored in on/off manner during sub-culture passages. The shoot organogenesis time
was recorded as 3-5 week irrespective of explant type. Transformation efficiency was
calculated by the mean number of Kanamycinkanamycin regenerated putative transformed
shoots. After 4 weeks of incubation, on average 4 shoots appeared from cotyledons derived
explant and 2 shoots from hypocotyl explants with transformation efficacy range of 30-40
% as shown in table. There was a considerable decrease in survival of positively
transformed calli owing to subsequent contamination of explants with yeast due to which
transformation efficiency decreased. The shoots were excised and placed on root induction
media for individual plantlet formation. Thereafter, plentiful rooting was observed on
medium supplemented with 0.5 mg/L NAA.
Table 3.12 Regeneration efficiency of putatively transformed Kanamycinkanamycin
of S. lycopersicum cv. Riogrande
Data represent the mean ± S.E calculated from 90 explants per treatment in three replicates. Means followed
by different letters within column are significantly different from each other as determined by a pairwise
comparison using Tukey’s test at p<0.05
Explant type % reporter
gene
expression
Regeneration
frequency %
Shoots/explant Transformation
frequency
Hypocotyls 56.23±0.65b 23.18 ± 2.1b 2.34±0.38b 35±1.83b
Cotyledons 68.32±1.89a 35.12±1.24a 4.78±1.28a 44±2.2a
Results Chapter 3
135
Ex-vitro acclimatization of transformed plantlets
Following rooting of transformed shoots after 2.5 months of culture, the regenerated fully
grown plants were transplanted to peat moss in small plastic pots (W × D × H: 4 × 3 ×7
inches; 22 oz) and covered with plastic polythene bag with holes for adaptation of plantlets.
Plantlets were allowed to grow for 6 weeks under 23±2°C, 30–50% humidity and a 16/8 h
Light/Dark photoperiod. Each plantlet was given 1 mL of half strength MS with vitamins
twice in a week. Moreover, on a daily basis, they were exposed to an open-air environment
for hardening before being fully transferred to a glass house. Well-developed plantlets were
transferred to a 900 g of substrate composed of soil: peat: organic compost 1:1:1 (w/w/w)
in plastic pots (W × D × H, 4.72×3.9×5.9 inches). The plants were transferred to
greenhouse net conditions during winters. For morphological characteristics comparison
WT plants were included in the study. The plants transferred in the month of December
were unable to set flowers and subsequently died. However, plants were transplanted in
mid -Mmarch gave flowers in natural environment in May. The fruiting set occurred after
3-4 weeks.
Results Chapter 3
136
Figure 3.313.31 Regeneration of Agrobacterium infected transformed cotyledon explants
(A-D) Callus formation (E-J) Root and shoot organogenesis
Results Chapter 3
137
Figure 3.323.32 Acclimatization of CCD7 transformed regenerated plants and
flowers and fruits in S. lycopersicum cv. Riogrande
(A-D) Transfer and acclimitization of transgenic shoots (E) Green house accessment and maturation of
transgenic plants (F-G) Flower and Fruit development.
Molecular characterization of transformed shoots
T0 and T1 transgenic shoots of LUC+/GFP+/CCD7+ Kanamycinkanamycin resistant plants
were selected for PCR and RT-PCR confirmation. Putative transformed plants were
characterized for the presence of /LUC/GFP/ CCD7 genes by using PCR amplification
with gene specific primers (Figure 3.33). We utilized Modified (Doyle, 1991) method of
2XCTAB method was used to extract DNA from leaves of tomato. 10
Kanamycinkanamycin resistant tomato leaves were randomly selected from each line. All
the samples showed desired 817 bp LUC gene and positive control showed same size
product as well shown in Figure 3.33-A lane 10, 11. 405 bp of GFP was also confirmed in
8 leaf samples of transgenic tomto, corresponds to lane 1-8 in Figure 3.33-A. Multiplex
PCR showed amplification of both LUC gene 817 bp and 300 bp bar gene in over
expression line 1 (OE1).
Results Chapter 3
138
Figure 3.333.33 PCR confirmation of LUC, GFP and CCD7 genes in putative transformed
lines
(A) Lane 1-8 GFP integration in T1 shoots, Lane 9 positive control, Lane 10-11 LUC gene integration, Lane
12 positive control, Lane 13 &14 negative control, Lane 15 100 bp gene ruler (Viogene).
(B) Multiplex PCR amplification of transgenic shoots, Lane 2-5 300 bp bar gene amplification, Lane 6
negative control, Lane 7-10 simultaneous amplification of LUC 800 bp and bar 300 bp genes (C) Multiplex
amplification of 1900 bp CCD7 and LUC gene expression, Lane 6&14 100 bp ladder (5PRIME).
Results Chapter 3
139
Morphological assessment of T0 & T1 plants
Fruit quality, number, size, shape firmness and color are major areas of economic
importance in tomato breeding management. The phenotypic characteristics were
compared with wild counterparts at reproductive stages and apparently found no striking
difference in T0CCD7(OEO) transgenic plants as shown in Figure 3.34. However, when
T1(OE1) were used for phenotypic evaluation, more apparent diffrences in morphological
chatacters like plant height, no of nodes/internodes and branches were observed. There
were comparable but statistically insignificant differences in the germination percentage
and emergence rate. The transgenic plants showed comparively less height when compared
with WT during fall season. The number of branches were also less and plants were more
slenderer and less bushy as compared to wild type (For details see section discussion).
Transgenic plants flowerd later than wild type plants both in controlled and open
environment. Number of flowers as well as fruit was also fewer as compared to WT. Stem
diameter and leaf morphology was also affected (Table 3.13). Overall CCD7 gene was
found responsible for above ground changes in plant architecture characteristcs of most
natural and synthetic SLs and SL related compounds.
Results Chapter 3
140
Figure 3.343.34 Phenotypic evaluation of transgenic CCD7 lines in comparison to WT
Riogrande at reproductive age
(A) Leaves (B-C) Flowers (D-E) Fruits
Results Chapter 3
141
Physiological indices associated to dehydration resistance of
transgenic tomato plants
Dehydration response assay & relative water content (RWC) of mature transgenic plants
was measured under drought to access their stress tolerance due to overexpression of CCD7
gene and disclose the mechanism involved in SL related effects. Three months old soil
grown transgenic and WT tomato plants were exposed to dehydration response assay by
withdrawing water for 2 weeks to observe the phenotypic difference and drought resilience.
Considering tomato is extremely sensitive to irrigation, after 7 days WT tomato plants
started to show typical drought induced wilting symptoms whereas transgenic plants
showed no signs of drought stress. After 14 days of drought stress, WT plants withered
extremely with visual signs of tissue necrosis, yellowing, leaf rolling and loss of
chlorophyll as shown in Figure 3.35C. While transgenic plants at this level were less wilted,
minimal rolling and yellowing of leaves was evident. Most of leaves maintained normal
photosynthetic capacity and phenotypically still green and active as shown in Figure 3.35
C& D. Additionally when watering was resumed after 21 days after which less than 20 %
of WT plants survived while more than 80% transgenic plants recovered from drought
stress as shown in Figure 3.36. Relative water content estimation of control and transgenic
plants showed that during well irrigated and 7 days mild water deficit conditions, showed
thatdetached leaves of transgenic plant expressing LjCCD7 lost less water and over a longer
period as compared to control leaves. Tranegeic plants in general require significantly less
water and leaves are able to lose less weight over the time of 6 hr as compared to WT
(Figure 3.36 2-3).
Results Chapter 3
142
Figure 3.353.35 Drought tolerance response of LJCCD7 overexpressing Riogrande
(A-B) A water withholding survival assay was performed with 3 months old plants for 3 weeks time. Left
WT, Right Transgenic plants under irrigated conditions (C) Transgenic line on Left Vs WT on Right after 21
days of water deprivation (D) Transgenic plant after recovery
Results Chapter 3
143
Figure 3.363.36 (1-3) Drought tolerant attributes of transgenic LJCCD7 overexpressing
Riogrande plants
(1)Survival rate of drought induced LJCCD7 overexpressing Riogrande plants (A)Transgenic lines after recovery period and irrigation after 21 days water stress (B) Survival rate of OE1 line Vs WT. (C) Irrigation
resumed after 21 day stress (D) WT plant showing in severe damage and unable to recover from drought
stress.
Results Chapter 3
144
Figure 3.36 (1-3) Drought tolerant attributes of transgenic LJCCD7 overexpressing
Riogrande plants
(2) Percent leaf water loss in detached leaves of OE1 and and WT plants. 10 Weeks old plants under well
irrigated condition and under mild stress of 7 days water deprivation treatment. Data represents the means ±
S.E (n = 3).
0
20
40
60
80
100
120
0 30 60 90 120 150 200 250 300 360
We
igh
t o
f le
ave
s(%
in
itia
l we
igh
t)
T=min
ControlT1L(NS)
WT1L(NS)
0
20
40
60
80
100
120
0 30 60 90 120 150 200 250 300 360
We
igh
t o
f le
ave
s(%
in
itia
l we
igh
t)
T=min
Mild stressTL(S)
WTL(S)
Results Chapter 3
145
Figure 3.36 (1-3) Drought tolerant attributes of transgenic LJCCD7 overexpressing
Riogrande plants
(3) % Relative water content 10 Weeks old plants from detached terminal leaves of OE1 and and WT plants
measured after water deficit of 0,7,15 and 21 days drought treatment. Data represents the means ± S.E (n =
3). * indicates values that are significantly different from each other according to Tukey’s test at p<0.05.
DAS: Days after stress
0
10
20
30
40
50
60
70
80
90
100
0 DAS 7DAS 15 DAS 21 DAS
Rel
ativ
e w
ater
co
nte
nt
(%)
T=min
RWCT1
RWCWT*
Results Chapter 3
146
Estimation of antioxidant enzyme potential, MDA and chlorophyll
content analysis of drought stressed transgenic lines.
Plants exposed to abiotic stresses like drought, heat, salinity, mineral depletion result burst
of reactive oxygen species (ROS) which act as alarm system of plant when produced in
low quantities. However, the quenching activity in plant by antioxidant enzymes scavenge
these ROS to maintain normal physiological state of plant. The balance between ROS
production and their quenching is crucial aspect of abiotic stress resilience in plants. . We
evaluated the ROS quenching ability of transgenic plant stem as well as leaves at normal
physiological state and after 15-21 days of water deficit treatment was measured.
Thereafter oxidative burst during the dehydration stress was assessed by quantification of
enzyme activities like SOD, POD, CAT, APX and MDA content analysis transgenic as
compared to their wild type counterparts shown below.
Superoxide Dismutase (SOD) activity analysis
Superoxide radicals that are by products of stress response in plant tissue are converted to
hydrogen peroxide (H2O2) by SOD antioxidant enzyme. Our result showed that there has
been constitutive increase in SOD activity of CCD7 overexpression line as the water
depletion increased as compare to their wild counterparts. The transgenic leaves showed
10–-15 ₋fold increased SOD activity after 21 days of water depletion as compare to WT
leaves. For 15 days of drought stress, there was no statistically significant decrease in the
SOD contents of transgenic leaves and stem which shows their ability to scavenge active
ROS production, while WT plants had low activity at irrigated stage. WT tomato leaves
and stem did showed increase of SOD activity after 15 days of water stress; however, this
increase was not enough for survival of WT plants under dehydration stress. On the other
hand transgenic leaves and stem showed 2.1 and 2.2–₋fold increase in SOD contents as
compare to well irrigated conditions while at the same time WT leaves and stem
experienced >1.5–₋fold decrease in SOD activity (Figure 3.37). Our results showed that
over expression of CCD7 gene in tomato confers drought stress tolerance as cued by
increase amount of SOD contents i.e. superoxide radicals in mitochondria and chloroplast
are scavenged by increase SOD content in a bid to rescue water stress physiology in
transgenic plants.
Results Chapter 3
147
Figure 3.373.37 SOD content analysis of leaves and stem of CCD7 overexpressing lines
against WT
Data represents means of three replicates ± S.E. ** indicates values that are significantly different from each
other at p<0.01 according to tukey’s test. Enzyme extraction was carried out by randomly selecting 3 samples
(100mg) from each plant. DAS: Days after stress
Guaiacol Peroxidase (POD) activity
Dehydrogenation of organic compounds like guaiacol, pyrogallol, phenols and aromatic
amines are catalyzed by peroxidases (POD). POD are the enzymatic antioxidants that play
prime role in removal of ROS and H2O2 accumulation due to unfavorable environment in
plants. The dehydration response experiment showed that transgenic plants showed three₋fold
increase of POD activity after 21 days of water depletion over WT plants. The leaves and stem
of CCD7 overexpressed lines showed 2₋fold more POD activity even before the onset of
dehydration treatment showing that the transgenic line were stress tolerant with efficient
antioxidant response factors. When the stress level increased a 7.7–₋9.1 ₋fold, proportional
increase was seen as compared to WT leaves and stem as shown in Figure 3.38. Over all leaves
of OE1 line showed statistically in significant increase of POD activity as compared to stem
tissues.
0
50
100
150
200
250
300
OE1Leaf WTLeaf OE1stem WTstem
SOD
Act
ivit
y (
U/g
FW
0 DAS
15 DAS
21 DAS
**
**
Results Chapter 3
148
Figure 3.383.38 POD content analysis of leaves and stem of CCD7 overexpressing
lines against WT
Data represents means of three replicates ± S.E. ** indicates values that are significantly different from each
other at p<0.01 according to tukey’s test. DAS: Days after stress
Catalase (CAT) activity
Accumulation of ROS mediated oxidative stress and cell death in plants occur because of
excessive cellular H2O2 accumulation due to water deficit. Plants have developed their
defence mechanism to cope with oxidative burst by activation of CAT activity which is
generally considered as positive indicator of the degree of drought experienced by plants.
Increase in CAT activity in leaves of drought stressed leaves and stem of transgenic CCD7
overexpressing lines showed that these plants can withstand sever water deficit by removal
of photorespiratory H2O2. The leaves and stem of transgenic lines showed 2–fold increase
in CAT activity with increasing time of water deficit while opposite happened for WT
plants that showed 2–fold decrease in enzyme activity. It was interesting that at normal
irrigated conditions CAT activity of both transgenic and WT leaves increased until day 15
of water stress although the activity of OE1 lines were 2–3 fold higher at this point. When
0
10
20
30
40
50
60
70
OE1Leaf WTLeaf OE1stem WTstem
PO
D A
ctiv
ity
(m
M/m
in g
FW
0 DAS
15 DAS
21 DAS
** **
Results Chapter 3
149
extreme water stress occurred after 21 days the CAT activity of transgenic leaves and stem
further increased 1.2-1.6₋fold; however, WT tissue showed concomitant decline in activity
as shown in Figure 3.39.
Ascorate peroxidase (APX) activity
In plants, ascorbic acid is synthesized in the Smirnoff–Wheeler pathways resulting in
generation of electron donors having high capacity for detoxification of ROS by reduction
of H2O2 subsequently H2O generation through the APX reaction this preventing the
oxidative stress and celleular protection (Egea et al., 2018). The ascorbate estimation of
wild type and transgenic plants showed that during drought stress the APX increased 2
times as compared to WT plants when they encounterd water stress. Due to high affinity
of APX towards reduction of H2O2 increase in the activity is attributed to scavenging
activity of APX in removal of H2O2 due to drought stress. Wild type plants did showed
some non-significant increase after 15 days of water stress but due to stress sensitivity the
APX units decrease further 2₋fold after 21 days of water deficit as shown in Figure 3.39.
Results Chapter 3
150
Figure 3.393.39 Effect of drought stress on H2O2 scavenging acticity due to CAT and
leaves and stem of CCD7 overexpressing Riogrande lines against WT
Data represents means of three replicates ± S.E. ** indicates values that are significantly different from each other at p<0.01 according to Tukey’s test.
0
0.05
0.1
0.15
0.2
0.25
0.3
OE1Leaf WTLeaf OE1stem WTstem
CA
T A
ctiv
ity
(m
M/m
in-g
FW
0 DAS
15 DAS
21 DAS
**
0
1
2
3
4
5
6
OE1Leaf WTLeaf
AP
X A
ctiv
ity
(U
/min
-mg
FW
0 DAS
15 DAS
21 DAS
**
**
Results Chapter 3
151
Estimation of Malondialdehyde (MDA)
Malondialdehyde is on one of the key product of lipid peroxidation. The decomposition of
polyunsaturated fatty acids produce MDA that has been utilized as biomarker in stress
induced lipid peroxidation. MDA content has been determined in transormed and WT
control plants as an indicator of degree of damage under water stress. Before water stress,
both transgenic plants showed similar MDA levels. However, after 2 weeks of water stress
the transgenic plants accumulated significantly less MDA contents as compared to the
control WT plants (Figure 3.40). Further WT leaf and stem tissues accumulated 2.89-3.1
₋fold higher MDA levels after 21 days of drought stress. Thus it could be inferred that
transgenic tomato plants experience minimal lipid peroxidation of membranes owing to
active antioxidant enzyme activity that scavenge oxidative burst produced as result of water
deficit. Higher MDA content in case of control WT plants are the prime cues for oxidative
damage to lipids, cell membrane damage, loss of enzyme activity as well as protein- protein
linking that lead to severe necrosis and cell death shown in survival assay Figure 3.36 B.
Figure 3.403.40 Malondialdehyde (MDA) levels in the transgenic OE1 tomato after 21
of drought stress treatment
Data represents means of three replicates ± S.E. ** indicates values that are significantly different from each
other at p<0.01 according to Tukey’s test.
1
4
7
10
13
16
19
22
25
28
31
34
OE1Leaf WTLeaf OE1stem WTstem
MD
A (
µM
/g F
W
0 DAS
15 DAS
21 DAS
**
**
Results Chapter 3
152
.
Total chlorophyll content analysis
Total chlorophyll content of leaves is considered as direct measure of physiological state
of plants. Loss of chlorophyll during water stress is an indicator of malfunctions in
photosynthetic ability of plant. In this study chlorophyll, content of control and transgenic
line were determined at normal physiological state and after 14 & 21 days water deficit.
Before water stress the basal level of total chlorophyll content of both control and CCD7
overexpression lines were found similar. As the water deficit increased the total chlorophyll
content of transgenic plants showed some damping of chlorophyll content from initial
value; however, when the water deficit reached the maximum level i.e. 21 days of water
stress, transgenic leaves interestingly showed about 15 % increase of chlorophyll content
as compared to non-stressed conditions as shown in Figure 3.41. While control plants
showed 2₋fold decrease in the total chlorophyll content when water deficit occurred. Thus,
indicating limited photosynthetic potential under water stress. Hence, it could be deduced
that CCD7 overexpressing tomato plants can withstand severe drought and water deficit.
Results Chapter 3
153
Figure 3.413.41 Leaf chlorophyll content analysis of CCD7 overexpressing Riogrande
tomato
Data represents means of three replicates ± S.E. * indicates values that are significantly different from each
other at p<0.05 ** p<0.01 according to Tukey’s test.
Phenolic, Flavonoid, and antioxidant Composition
Tomato is considered as rich source of phenolic derivatives that contribute not only to
nutritional profile of tomato fruits but also substantial role for plant’s physiochemical
performance. Additionally, phenolic compounds and flavonols are natural antioxidants
that are indicators of plant adaptive reponse to abiotic and biotic stress. To compare
transgenic tomato fruits with wild type, and the possible impact of CCD7overexpression
on nutritional content of tomato, phtochemical analysis were performed. The results
showed that the transgenic fruit skin showed 50 % increase in flavonols and phenolic
content as mg QU 100 g−1 and mg GAE 100 g−1 respectively as shown in Table 3.13.
0
0.5
1
1.5
2
2.5
3
3.5
OE1Leaf WTLeaf
Ch
loro
ph
yll (
mg/
gFW
)
0 DAS 15 DAS 21 DAS
*
** 8 8
Results Chapter 3
154
Studies have shown accumulation of phenols, flavanol and antioxidants due to heat stress
(Junglee et al., 2014). Quercetin was one of most abundant flavonoid found in transgenic
tomato with a range of 129–-255 mg/100g fresh weight against 76 mg/100g fresh weight.
It is evident from the results that secondry metabolite production that increase in the
transgenic plant tissues as compared to wild type. It was found that plant expressing
LjCCD7 gene showed enhanced production of flavonoids, phenols. Ascorbic acid and
total antioxidant potential as shown Table 3.13.
Table 3.13 Physiochemical characteristics of T1 transgenic plants
Sample
ID
Plant
Height
(cm)
Stem
Diameter
(cm)
No. of
branches
Total
phenolic
content (mg
GAE /
g) ± S.E
Flavonoid
content (mg
QU/ g) ± S.E
DPPH radical
scavenging
activity
IC 50Value
(μg/mL)
WT1 120a 3a 28 b 32.3 ± 0.44f 76.65 ± 3.56e 39.8± 1.44d
WT2 100c 2.8 ab 25bc
WT3 67g 2.5c 23c
T1.1 45.6h 2cd 11f 56.5± 1.45 d 129.99 ± 5.47d 51.02±4.25bc
T1.2 71.9e 1.98d 13e 48.8± 1.67 e 127.99 ± 4.67d 39.7± 3.98d
T1.3 72.0ef 1.5e 9g 61.1± 1.56 c 187.99 ± 6.17b 60.06± 7.65a
T1.4 90.5d 2cd 14d 69.9± 2.56 a 255.99 ± 6.65a 54.7± 4.44abc
T1.5 110ab 2.87 ab 30 a 64.7± b 0.34 160.99 ± 9.17c 47.8± 5.0 bc Data represents means of three replicates ± S.E. Different letters in the columns indicate
significant differences between treatments according to Tukeys test (p ≤ 0.05). T= Transgenic,
WT= Wild type
Results Chapter 3
155
Development of STRI Tools: SL analogues and in planta
quantitative assay to study SL binding mode
Synthesis of new molecules
The models designed for predicting the strigolactone hormonal roles in plants were
used for the rational development of new SL candidate(s) and of selective D14 inhibitor(s)
with optimized properties. In particular, lactam based strigolactone analogues and mimics
were predicted to effectively bind D14. Specific SL analogues mimics were prepared
according to methodologies previously done by (Lombardi et al., 2017) at Department of
Chemistry, University of Turin. General strategy followed to prepare D–-Lactams is shown
in scheme 1 (Figure 3.42). Moving backwards, the final step involves a SN2 reaction
between an enolate, generated from the lactone C of the ABC core (TYPE 1), and the
bromo lactams type 2 (Scheme 1). These latter intermediates were obtained as a result of
allylic bromination of lactams 1.
Scheme 1. General synthetic approach
A range of molecules were considered and used in bioassays to check their activity as
compared to (+)-GR24 used as the reference compound. Strigol was included as being
representative of natural SLs. ST23b, EGO10, and EDOT were selected for their reported
high activity in inducing germination and hyphal branching in P. aegyptiaca seeds and the
AM fungus Gigaspora margarita, respectively, along with their ability to affect root
architecture (Prandi et al., 2011; Cohen et al., 2013; Mayzlish-Gati et al., 2015). N-tert-
butyloxycarbonylation (N-Boc) protected derivatives of GR24-D-lactam were prepared as
racemic mixture (rac- 1 and rac-2, Figure. 2.11) to modulate the molecular accommodation
of Boc group inside the receptor pocket and respective H-bonding interactions with
catalytic triads of important amino acids of the receptor pocket. Similarly, unprotected
Results Chapter 3
156
derivatives were obtained (rac-3 and rac- 4 Figure 2.11). The stereochemistry of rac-1 and
rac-3 corresponded to the strigol family, while that of rac-2 and rac-4 corresponded to the
orobanchol family of natural SLs. Rac-5 and its N-Boc precursor rac-6, corresponds to
EGO10 backbone (Figure 2.11). In order to investigate the effect of a lactone-to-lactam
modification two SL mimics, rac-7 and rac-8, as NH D-lactam and N-Boc were also
prepared. rac-9 was designed derived EGO10-D-lactams but devoid of enol ether bridge
connecting the ABC core to the D-ring. It was We hypothesized that bioactivity of rac-9
inside receptor pocket will be effected by its non hydrolysability due to lack of enol ether
bridge.
Figure 3.423.42 Synthesis module of GR24-D-Lactams
Stability of newly synthesized compounds
Differential activity of SL analogues was presumed due to their instability in aqueous
medium. In order to investigate this point, stability of newly synthesized SL-D-lactams
was tested in aqueous solution, and compared to the (+)-GR24 standard. Two different
conditions were considered, a 30% solution of MeOH in water and a 1:1 solution of ace-
tonitrile in water. As expected, stability in MeOH was highly compromised for all
compounds, but to a greater extent for analogues showing both the Michael acceptor
function (enol ether bridge) and an unprotected N in the D-lactam ring, as for rac-3, rac-4,
rac-5, and rac-7 (Table 3.14): after a few hours 50% of the compounds were degraded. This
was not surprising from a chemical point of view, as the functional group in SL-D-lactams
Results Chapter 3
157
is an amine, which is more prone to hydrolysis than the acetal of the natural SL skeleton.
By contrast, rac-9, in which the enol ether bridge was missing and the lactone C–-ring was
directly connected to the lactam D-ring, showed high stability in both solvents. All
compounds with an N-Boc-protected function showed higher stability (rac-1, rac-2, rac-6,
rac-8) compared to their unprotected (NH) versions. For the GR24-family compounds,
both NH (rac-3) and N-Boc (rac-4) lactams showed very low stability values, as the half-
life time was estimated to be around 3 h. For rac-5, the NH compound in the EGO10 family,
the half-life dropped to 2 h. These data should be taken into account when considering the
results of both bioassays (parasitic seed germination and D14 degradation tests).
Table 3.14 Chemical stability of lactams, named as described in Fig. 2.11, in 30% MeOH
or 1:1 acetonitrile (ACN): water at 21 °C and pH 6.7.
Compound Half-life (t1/2, h)
30% MeOH ACN:Water, 1:1
(+)-GR24 rac-1 80 3375
rac-1 110 720
rac-2 21 140
rac-3 3 3.8
rac-4 3.3 4.4
rac-5 2 24
rac-6 190 528
rac-7 11 17
rac-8 230 1080
rac-9 1100 2900
*t1/2 values were extrapolated from the plots of peak area versus time (Annexure III).
Results Chapter 3
158
Germination activity of new SL- Analogues
The effect of synthesized SLs analogues on the induction of parasitic weed seed
germination was investigated. The newly synthesized SL–-D–-lactams were applied in
acetone dissolved form on seeds of P. aegyptiaca and compared to rac-GR24 as the
reference standard. Appropriate acetone control was included as negative control and
strigol as positive control. Analogues ST23b, EGO10, and EDOT (Prandi et al., 2011) were
also tested for comparison. Maximum activity of rac-GR24 was found to be induced at
concentration of greater than 10-5 M concentration according to dose response curve of (+)-
GR24 & EGO10 as shown in Figure (3.44)
The result showed in Figure 3.43 illustrates that the D-lactams rac-1–9 were all less
effective in comparison with (+)-GR24 germination assay. rac-1, 3, and 7 showed high
activity only at concentrations equal to 10 μM, thus indicating ~100₋fold lower potency
than rac-GR24. The GR24-D-lactams rac-2 and rac-4 were the most active compounds of
the series, as some germination activity could be detected even at 1 μM; all other
compounds were inactive throughout the whole range of concentrations. Surprisingly, rac-
2 and 4 showed overlapping activity profiles, as if the presence of the Boc group on N was
not affecting the perception by parasitic seeds. The same trend could be observed for all
other compounds, for which a substantial difference between cognate NH and N-Boc
derivatives could not be detected.
Results Chapter 3
159
rac-1–9, strigol, ST23b, EGO10, and EDOT at different concentrations, compared to rac-GR24 0.1 μM as a
positive control and to acetone as a negative control Data are means (±S.E) of n>250 seeds. Confidence intervals at 95% are used to express errors of the means. (Sanchez et al., 2018)
Luminometer based D14 degradation assay
D14 is a target for proteasome-dependent destruction upon interaction with its ligand(s),
which explains why fluorescence of D14::GFP fusion proteins is quenched upon SL
treatment in transgenic Arabidopsis (Chevalier et al., 2014). To use this as proof of concept
exploited this molecular network in transgenic Arabidopsis expressing D14::LUC under
the control of the D14 endogenous promoter in a quantitative activity assay that inversely
correlated luminescence to perception of SL-related molecules. The assay was first
calibrated by using (+)-GR24 & EGO10 over a range of concentrations (Figure 3.44), and
0
20
40
60
80
100
120
140
GR24 0.1 µm 10 µM 1 µM 0.1 µM 0.01 µM 0.001 µM acetone
Rel
ativ
e ge
rmin
atio
n %
Strigol ST23b EGO10 EDOT rac-1 rac-2 rac-3 rac-4 rac-5 rac-6 rac-7 rac-8 rac-9
D-lactamsD-lactams
D-lactams
D-lactams D-lactams
Figure 3.433.43 Germination-inducing activity of D-Lactams on Phelipanche aegyptiaca seeds
Results Chapter 3
160
the calculated EC50 value was found to be 1.62 μM. Later We then used the assay was
utilized to test various SLs in the same range, namely strigol as an example of natural SLs:
ST23b, EGO10, & EDOT as rac mixture and all the SL-D-lactams of natural SLs. The dose
response curve of (+)-GR24 & EGO10 as shown in Figure 3.44. As shown Figure 3.45
strigol, ST23b, EGO10, and EDOT induced high levels of D14 degradation although pure
enantiomer (+)-GR24 was most active in degradation of D14. All D-Lactams tested in the
range of 0.01–100 µM were ploted for 15 hr and their efficacy was calculated at 6 hr time
when 50% D14 signal has been decreased after addition of (+)-GR24 1 µM corresponding
to EC50 value of 1.62 μM. However, most of D-lactam analogs were less efficient with
some detectable activity shown in the range of 10–100 μM only as shown in Figure 3.45
& 3.46. The comparative efficacy analysis showed rac-6 was most active at 10 µM
concentration followed by rac-1, rac-7, rac-5, rac-2, rac-3, rac-4 while rac-8 & rac-9 were
found inactive even after 15 hr of incubation (Figures 3.47 & 3.49 A-B). At highest
concentration i.e 100 µM of all D-Lactams, rac-1 and rac-6 showed maximum activity
(Figures 3.47). As rac-9 was inactive in both bioassays at 10 µM, it was we then tested
whether it could behave as an antagonist in a luminometer based competition assay. For
this purpose, rac-9 was kept constant at the highest inactive concentration (10 µM), while
concentrations of (+)-GR24 were varied in the range 0.01–100 µM. The efficacy values
were calculated at 6 hr time after addition considering 100 % efficacy of (+)-GR24 alone
as positive control. As shown in Figure 3.48 the results indicated no antagonistic behavior
for rac-9 under our experimental conditions.
Results Chapter 3
161
Figure 3.443.44 Dose response assay with (+)-GR24 & EGO10 normalized to acetone
Data was generated from means of relative luminescence values of atleast 12 individual plants at each time
point. The original values were normalized with appropriate acetone control and represented as percent
activity. Confidence intervals at 95% were used to express errors of the means.
0%
20%
40%
60%
80%
100%
120%
0.00 3.00 6.00 9.00 12.00 15.00
%Lu
cife
rase
act
ivit
y R
.L.U
T(h)
EGO10 1uM EGO10 5uM EGO10 10uM
EGO10 20uM EGO10 100nM GR241uM
GR240.5uM MS Acetone
0%
20%
40%
60%
80%
100%
120%
0.00 3.00 6.00 9.00 12.00 15.00
%Lu
cife
rase
act
ivit
y R
.L.U
T(h)
ContH MS GR2420uM GR245uM
GR241uM GR24 0.5uM GR24100nM GR2410nM
GR241nM GR2410uM
Results Chapter 3
162
Data are means (±S.E) of n=5 replicates, where each replicate consists of at least three pooled individual seedlings and readings. The EC50 curve for (+)-GR24 obtained using GraphPad Prism 7.00. The curve was calculated by linear
regression fitting of the data at different concentrations, minus values for acetone-treated samples (negative controls)
and normalized to GR24 at 0.01 μM, which was set to 0%. Confidence intervals at 95% are used to express errors of
the means.
Figure 3.453.45 Luciferase assay with D-Lactam based SL analogues series
Results Chapter 3
163
Figure 3.46 A- Percent efficacy of D-Lactams (rac1, rac2, rac6 & rac8) in comparison
with at 1 μM (+)-GR24
-20
0
20
40
60
80
100
120
%Ef
fica
cy
T=6hrs
GR241uM
Control
rac-6 100uM
rac-6 10uM
rac-6 1uM
rac-6 0.1uM
rac-6 0.01uM
-60
-40
-20
0
20
40
60
80
100
120
%Ef
fica
cy
T=6hrs
GR241uM
Control
rac-8 100uM
rac-8 10uM
rac-8 1uM
rac-8 0.1uM
rac-8 0.01uM
A
Results Chapter 3
164
Data are means (±S.E) of n=5 replicates, where each replicate consists of at least three pooled individual seedlings
and readings minus values for acetone-treated samples (negative controls) and normalized to GR24 at 1 μM,
which was set to 100%. Confidence intervals at 95% are used to express errors of the means. 6hrs time was
selected after addition of treatment when 50% luminesense signal due to D14 degradation went down for GR24.
-40
-20
0
20
40
60
80
100
120
%Ef
fica
cy
T=6hrs
GR241uM
Control
rac-2 100uM
rac-2 10uM
rac-2 1uM
rac-2 0.1uM
rac-2 0.01uM
-20
0
20
40
60
80
100
120
%Ef
fuca
cy
T=6hrs
GR241uM
Control
rac-1 100uM
rac-1 10uM
rac-1 1uM
rac-1 0.1uM
rac-1 0.01uM
B
Figure 3.463.46 A-B Percent efficacy of D-Lactams (rac1, rac2, rac6 & rac8) in
comparison with at 1 μM (+)-GR24
Results Chapter 3
165
Figure 3.473.47 Highest concentrationn (100 μM) of D-Lactam analogues in
(+)-GR24
Results Chapter 3
166
Figure 3.483.48 Luciferase competition test between rac-9 and (+)-GR24
Efficacy values for (+)-GR24 from left across a range of concentrations normalized to the value at 1 μM, which was set to 100%. Data are means (±S.E) of n=5 replicates
Results Chapter 3
167
Fig
ure 3
.49
3.4
9 (A
-B) L
uciferase D
14 d
egrad
ation activ
ity o
ver 1
5 h
r treatmen
t again
st 1µ
M (+
)-GR
24
Results Chapter 3
168
Data are means (±S.E) of n=5 replicates, where each replicate consists of at least three pooled individual seedlings and readings. Confidence intervals at 95% are used to express errors of the means.
Fig
ure 3
.49 B
Lu
ciferase D14
deg
radatio
n a
ctivity
ov
er 15
hr treatm
ent ag
ainst 1
µM
(+)-G
R2
4
Results Chapter 3
169
Data are means (±S.E) of n=5 replicates, where each replicate consists of at least three pooled individual
seedlings and readings. Confidence intervals at 95% are used to express errors of the means
Figure 3.503.50 Luciferase D14 degradation assay with SL mimics across a range of concentrations
(0.01–100 μM).
Results Chapter 3
170
Similarly, SL mimics CL and CL-BP conjugated with fluorescent functional group
BODIPY during D14 degradation assay showed the two mimics were only slightly active
at very high concentration (10-4M) and the response was found statistically similar to 10-
7M racGR24 activity as shown in Figure 3.50. Both molecules were found completely
inactive at 10 µM which provide indications about their inhibitory effects that need further
insights on their SAR studies.
nDocking of D-Lactams
Validation of the compounds tested through germination and luminmeter assay was done
by docking analysis of analogues to decipher their binding mode within receptor pocket.
We performed Docking simulations of three SL-D-lactam compounds within the binding
pocket of D14 were executed. In thisour studies, the structure of rice D14 co-crystallized
with GR24 was selectedwe selected as a template the structure of rice D14 co-crystallized
with GR24 [PDB code 5DJ5] (Zhou F et al., 2015). We used the Same approach was
utilized to investigate the pose of the new D-lactams rac-3, rac-4 and rac-9 in the D14
pocket. Rac-3 is the GR24-D-lactam whose configuration is “strigol-type” while rac-4 is
the correspondent “orobanchol-type”. Both enantiomers for rac-3 and rac-4 were docked
in the enzyme pocket. As expected, the most reasonable pose was obtained for the
enantiomer of rac-3 possessing absolute configuration (SSR), having the same
stereochemistry of the (+) GR24 co-crystallized with D14 (Figure 3.51 A), and showing a
very similar orientation. The ligand is able to interact with the catalytic Ser97 and His247,
with Ser220 and also with Trp155, lining the upper part of the binding site. Hydrophobic
moieties properly fit the pocket hydrophobic region lined by Phe28, Phe126, Phe136 and
Val144. Located and stabilized through hydrophobic and electrostatic interactions in the
binding site, the molecule could then be easily hydrolysed by Ser97 and thus mimic SL
activity. A less favourable pose was obtained for the enantiomer (RRS) (ent-strigol
configuration, Figure 3.51 B), which maintains the contact with Ser97 but, because of the
different stereochemistry, moves the hydrophobic condensed ring towards Trp155 and
loses the contact with Ser220 and His247. Additional interactions are made with Tyr159,
as shown in Figure 3.51 B. Similarly, to rac-3, also rac-4 showed less reliable poses than
the co-crystallized GR24, again in agreement with poor activity data in the D14: LUC
degradation bioassay. In particular, both enantiomers maintain the interaction with the
Results Chapter 3
171
catalytic Ser97 and with Tyr159 and both experience an adjustment of the pyrrolone ring
and of the indeno-furan system. Rac-1 and rac-2 did not give any reasonable pose when
docked in D14, because of the presence of the Boc group.
Figure 3.513.51 Docking model of rac-3 and rac-4 in the binding site of rice D14
(A) Rac-3, (SSR, strigol configuration). (B) rac-3 (RRS ent-strigol configuration). (C) rac-4 (RRR,
orobanchol configuration). (D) rac-4 (SSS, ent-orobanchol configuration). The ligand and the residues
lining the pocket are shown as capped sticks. For each racemic mixture, both enantiomers were modelled.
Hydrogen bonds are represented as black dashed lines. The protein is represented as cartoon. Residues 158-
166 were removed for clarity. Tyr159 is shown only when relevant for the complex stabilization. Only
closest residues to the ligand are labelled.
Results Chapter 3
172
Rac-9 was also docked in D14 (Figure. 3.52 a); only the enantiomer (SS) that gave the best
pose is shown in the Figure 3.52. When located in the pocket, the pyrrolone ring of rac-9
maintained the interaction with Ser97 but no other H-bond was formed. Hydrophobic and
polar groups both superimposed quite well with the corresponding Molecular Interaction
Fields, with the exception of the indolone methyl group, which was probably too close to
Trp155. Nevertheless, due to the reduced number of hydrogen bonds, the presence of
negative hydrophobic– polar contacts, and the higher rigidity of the molecule, the D14
complex with rac-9 was likely to be far less stable than the one with (+)-GR24
Figure 3.523.52 Docking model of rac-9 in the binding site of rice D14
Only enantiomer SS is reported. (A) Crystallographic pose. The ligand and the residues lining the pocket are
shown as capped sticks. Hydrogen bonds are represented as black dashed lines. The protein is represented as cartoon. Residues 158-166 were removed for clarity and only closest residues are labelled. (B) Molecular
Interaction Fields calculated by FLAP. Red, blue and yellow contours identify the H-bond acceptor, H-bond
donor and hydrophobic Molecular Interaction Fields, respectively.
Results Chapter 3
173
Luminometer assay based dynamic of other phytohormones
Although yet ambiguous, improved understanding of complex hormone signaling and
perception networks lead to permissible comparisons between hormones. The post
translation modification of receptor protein via ubiquitination mechanism of SL signal
transduction is similar to signaling pathways of abscisic acid (ABA), auxins, jasmonic acid
(JA) and gibberellic acid (GA) and ethylene (ET). The degradation of receptor via
ubiquitin/26S proteasome pathway remain fundamental aspect of signal transduction in all
above mentioned phytohormones. Our meta-analysis data also showed that SLs act via
cross linking of various phytohormonal pathways to employ their effects as shown in
Figure 3.53 (Saeed et al., 2017).
Figure 3.533.53 SL cross talk with various phytohormones during abiotic stresses (Saeed et
2017)
Results Chapter 3
174
We utilized same transgenicTransgenic Arabidopsis based quantitative assay was
employed to check D14 degradation. The residual fluorescence of phytohormones and
relative efficiency in D14 florescence quenching at varying concentration as compared to
acetone control and rac GR24 are shown in Figures 3.54 & 3.55. It was evident from the
percent residual luminescence that all the phytohormones (ABA, GA3, KIN, and IAA)
when compared to 1µM rac GR24 showed only detectable activity to quench the LUC
signal at very high concentration of 50-100µM. Even at high concentration the molecules
remained inactive over the time of 15-24 hr. ABA at 50 & 100µM was most effective of
all the tested hormones as shown in Figure 3.55a. Interestingly ABA treatment unfolded
an exceptional increase in luminescence signal starting from time 0 hr with maximum
florescence detected at 3 hr highlight with yellow arrow (Figure 3.54). Whilst at the same
time 1µM rac GR24 degradation of D14::LUC based florescence reduced to half.
Seedlings treated with ABA 10µM depicted an increase starting from time 0 hr and
continued >100% luciferin signal for 15 hr. In order to extrapolate the unusual behavior of
ABA, we performed competitive luminometerLuminometer based assay was tested to see
if it act as antagonist to (+)-GR24. Both hormones were added in same quantity to see if
the D14 degradation is promoted or not. As evident from Figure 3.54 (red highlighted bar)
even when (+)-GR24 was increased to 5 µM, no inhibitory effect of ABA was seen in
luminometer setup.
This kind of extraordinary luciferin based fluorescence signal solely obtained with ABA
treatment of pD14::D14::LUC Arabidopsis seedlings suggested the binding affinity of (±)-
ABA within the receptor binding pocket of D14. ABA treated seedlings were pooled out
at 0, 3, 6, 15 hr showed an increasing trend in expression of SL biosynthetic genes CCD7
and CCD8 and NCED3 essential for ABA biosynthesis during drought stress. The change
in relative expression of all the genes normalized to ubiquitin transcripts was noticeably
higher when treated with ABA as compared to non-treated seedlings (Figures 3.56 & 3.57).
Increase in CCD7 expression was most eminent when 10 µM ABA treatment was given
that show gradual increase with increasing treatment time. This point corresponds to the
time where luminometer data showed increase in signal more than control seedlings as
shown in Figure 3.52. There was no difference in relative expression of CCD8 gene while
NCED3 showed somewhat elevated relative expression only after long time of exposure to
Results Chapter 3
175
10 µM ABA treatment (Figure 3.56). Our results showed that transcript abundance of all
three genes increased with increase in treatment concentration of ABA. While NCED3
showed differential expression pattern when ABA treatment was increased to 50-100 µM
and the difference became more pronounced when treatment time increased. Unlike CCD7
and NCED3, CCD8 expression doesn’t change with remarkably until a threshold treatment
of 100 µM ABA treatment as shown in Figure 3.57. Which explains that at this point the
plant has perceived ABA in media as a stress signal as evident from differential expression
of all three genes.
Figure 3.543.54 Luminometer based D14 degradation assay with phytohormones at T=3
(a) ABA (b) GA3 (c) KIN (d) IAA. Data are means (±S.E) of n=5 replicates, where each replicate consists
of at least three pooled individual seedlings and readings. Confidence intervals at 95% are used to express
errors of the means
Results Chapter 3
176
Figure 3.553.55 Luminometer based D14 degradation assay with phytohormones over
Results Chapter 3
177
Figure 3.563.56 Transcript accumulation of genes involved SL & ABA metabolism
ABA treatment
Relative expression of CCD7, CCD8 and NCED3 normalized to ubiquitin in transgenic Arabisopsis. Data
are means (±S.E) of n=3 replicates, where each treatment of replicate consists of at least five pooled
individual seedlings from which total RNA was isolated. qRT-PCR was performed on total RNA using gene-specific primers listed. Transcript level were normalized to internal reference gene (UBI). Confidence
intervals at 95% are used to express errors of the means.
0.0
2.0
4.0
6.0
8.0
10.0
12.0
14.0
16.0
18.0
20.0
22.0
24.0
26.0
UB
Q10
no
rm
ali
zed
tr
an
scrip
ts
ABA 10µM
0hr 3hrs 6hrs 15hrs
-2.0
0.0
2.0
4.0
6.0
8.0
10.0
12.0
14.0
16.0
18.0
UB
Q10
norm
ali
zed
tr
an
scrip
ts ABA 50µM
0hr 3hr 6hr 15hr
Results Chapter 3
178
Figure 3.573.57 Transcript accumulation of genes involved SL & ABA metabolism
following 100 µM ABA treatment
Relative expression of CCD7, CCD8 and NCED3 normalized to ubiquitin in transgenic Arabisopsis. Data
are means (±S.E) of n=3 replicates, where each treatment of replicate consists of at least five pooled
individual seedlings from which total RNA was isolated. qRT-PCR was performed on total RNA using gene-specific primers listed. Transcript level were normalized to internal reference gene (UBI). Confidence
intervals at 95% are used to express errors of the means.
Docking simulation of ABA in At-D14
In order to interpret the extraordinary cross talk at various level throughout the
experimental work and explain the possible competitive binding affinity during ligand
based degradation of receptor, docking simulations of ABA were we performed docking
simulations of ABA within orthologue of rice D14 receptor. The docking pose showed
only one enantiomer of GR24 in the pocket with superimposed ABA within the binding
pocket thus suggesting that ABA may bind in the same space of ligand binding pocket
(Figure 3.58). The crystal structure ABA inside receptor pocket shows that the molecule is
H-bonded to Trp 155 while Phe 195 & 126 are also involved in hydrophobic interactions
-5.0
0.0
5.0
10.0
15.0
20.0
25.0
UBQ10
no
rmal
ized
tra
nsc
rip
ts
ABA 100µM
0hr 3hr 6hr 15hr
Results Chapter 3
179
as shown in Figure 3.59. The docking pose showed that ABA and GR24 superimpose each
other at ligand binding pocket. The favourable pose generated in Figure 3.60 depicts that
despite being structurally different ABA is able to occupy the D14 receptor-binding pocket
and may occupy the catalytic site via H-bonding of Trp-55 residues close to ligand binding
moiety. This notion requires further confirmation through hydrolysis and competitive
simulations.
Figure 3.583.58 Plausible binding mode of (+)-GR24 (cyan-a) in AtD14 (green) binding
The ligand and the residues lining the pocket are shown as capped sticks. For each racemic mixture, both
enantiomers were modelled however only active enantiomers is shown. Hydrogen bonds are represented
as magenta dashed lines. The protein is represented as cartoon. Only closest residues to the ligand are
labelled.
Results Chapter 3
180
Figure 3.593.59 Plausible binding mode of S-(+)-ABA (yellow-b) in AtD14 (green)
The ligand and the residues lining the pocket are shown as capped sticks. For each racemic mixture, both
enantiomers were modelled however only active enantiomers is shown. Hydrogen bonds are represented as
magenta dashed lines. The protein is represented as cartoon. Only closest residues to the ligand are labelled.
Results Chapter 3
181
Figure 3.603.60 Superimposed pose of (+)-GR24 (cyan) & S-(+)-ABA (yellow) in
(green) binding pocket
The ligand and the residues lining the pocket are shown as capped sticks. For each racemic mixture, both
enantiomers were modelled however only active enantiomers is shown. Hydrogen bonds are represented as
magenta dashed lines. The protein is represented as cartoon. Only closest residues to the ligand are labelled .
Discussion Chapter 4
182
Chapter 4
Discussion
Formatted: Right: 0"
Discussion Chapter 4
183
4. Discussion Plant growth regulators and their complex integrated molecular dialogue is the main source
of morphological plasticity and adaptability of plants in response to changing
environmental conditions. Under abiotic stresses, sessile plants modulate their growth by
alteration of synthesis, signaling and transport of stress related hormones. Although ABA
is the most studied stress-responsive hormone, the individual role of ethylene, CKs, BRs,
and auxins during environmental stress is emerging, as is the impact of their mutual cross-
talk (Fujita et al., 2011; Arc et al., 2013; Fahad et al., 2015; Wani et al., 2016). SLs as
well, were recently shown to play a prominent role in response to abiotic stresses, responses
and thus we have thus entered into a new phase in which their interaction with other
phytohormones in the frame of abiotic stress resistance is being targeted experimentally.
The characterization of the molecular mechanisms regulating hormone synthesis and
signaling are facilitating the modification of hormone biosynthetic pathways for the
generation of transgenic plants with enhanced abiotic stress tolerance (Saeed et al., 2017).
The bBiosynthetic and developmental interactions also suggest the underlying role of ABA
on production or regulation of SLs. Therefore, SLs focused research has entered into new
phase of attempts to reveal the molecular level interaction with ABA in monitoring stress
resilience in plants, which is comparatively new and of utmost importance. Some of these
subtle interactions are highlighted in the figure 3.15. It is tempting to speculate that both
hormones interact with each other at the biosynthetic level, and that induction of ABA
biosynthesis influences SLs formation and vice versa (Figure 4.1). Therefore, prime
objective of the study was to overexpress SL biosynthetic gene CCD7 in a bid to explore
its role in abiotic stress resilience in tomato and to investigate SL-ABA possible cross
linking in transgenic Arabidopsis. Theis discussion deals with the hypotheses followed in
this dissertation is divded into 3 chapters. and 3 parts of the work has already been
published as:
Discussion Chapter 4
184
Figure 4.14.1 Organ level dynamics of strigolactones during abiotic stresses encountered
plants
Strigolactone (SL) mediated signal transduction and changes in physiological response due to Pi depletion
and abiotic stresses encountered by the plant. Blue arrows represent the process promoted by the SLs and
capped blue lines represents repression
Discussion Chapter 4
185
Tomato cell culture, somatic embryogenesis and Agrobacterium
mediated transformation studies
In vitro morphogenesis response of various tomato cultivars rely on number of factors such
as genotype, type/size/age of explant, media formulations and growth room conditions
(humidity, temperature, photoperiod) due to which tomato transformation is not reliable
nor straightforward (Bhatia et al., 2005). Although considerable efforts have been made in
tomato cell cultures, but the techniques of morphogenesis have not been well established
to implement in multiplication of in vitro grown plantlets for commercial cultivars.
Additionally most of the established protocols for transformation are laborious, time
consuming and cumbersome involving preculture on feeder layers of tobacco and/or
petunia and that is also exceedingly genotype dependent (Hamza and Chupeau, 1993;
Plastira and Perdikaris, 1997). For this reason, we optimization ofed the in vitro
regeneration potential of four tomato varieties two cultivated commercial varieties, a
hybrid and one model cultivar was done. Comparison was done among four varieties by
optimization of seed sterilization, germination and then regeneration. Most prolific variety
was selected for investigation on regeneration potential via somatic embryogenesis and
Agrobacteroim mediated transformation. Development of above-mentioned system will be
of great value in germplasm conservation, somatic embryogenesis, clonal propagation and
genetic engineering of otherwise recalcitrant tomato varieties.
Seed sterilization and storage conditions affect the general process of in vitro
morphogenesis and overall seedling vigor. Containment of various type of fungal or
bacterial contamination during in vitro micropropagation is one of the prime prerequisite
for successful tissue culture and regeneration process. In this study, the effect of
concentration range NaOCl (1-20%) on germination index of four tomato varieties was
evaluated which were grown on MS medium with and without sucrose. Different
combination of disinfectants were tested and the result showed that 6% NaOCl with or
without surfactant was most proficient in controlling bacterial and fungal contamination of
tomato cell culture. More than 90% seed germination was achieved in RioGrande and
Roma with 5-7% contamination rate. Whereas, moderate germination activity was
observed for hybrid 17905 (>80%). We found that Model cultivar cv. M82 was severely
affected by various sterilization treatments. Higher concentration of NaOCl, although
Discussion Chapter 4
186
decreased the contamination rate, but seed germination frequency was adversely reduced.
70% ethanol and 3–-8% NaOCl has been reported to induce 90% germination in tomato
seeds, while Gubis et al., (2003) indicated 4 % NaOCl for sterilization of seeds. In our
experiments <3% NaOCl resulted in fungal contamination of seeds and > 8% was
inhibitory for all four varieties. The varietal differences in rate of seed germination against
same concentration of disinfectant explains the genotype specific response in tomato
cultivars M82 and hybrid [17905] that has been previously reported by Park et al., 2011.
Moreover, the results are in agreement with (Shah et al., 2015; Sun et al., 2006) where
similar disinfection in vitro germination of tomato seeds was reported. Both half strength
and full-strength MS medium (with vitamins) without addition of sucrose was evaluated
for seed germination. Although sucrose is incorporated as universal carbon source for in
vitro morphogenesis, optimal concentration for growth is genotype dependent (Chen et al.,
1999; Compton and Veilleux, 1991; Gubiš et al., 2005). We achieved
contaminationContamination free seed germination without sucrose was achieved in our
experiments. Even though, sucrose is an important component required for tomato cell
cultures; however, seedling emergence can be achieved without sucrose as well. For
example, inclusion of 3% sucrose have been reported by various cell culture experiments
(Cano and Moreno, 1990; Costa, 2007; Gubiš et al., 2018). However, sucrose addition for
optimal seeed germination wasn’t found necessary in this study. we couldn’t verify
mandatory sucrose addition for optimal seeed germination. Thus, the results may
suggestrecommend that sucrose is required only during later stages of morphogenesis,
while seedling and cotyledon emergence can be achieved without any carbon source in the
medium.
As previously mentioned organogenesis in tomato is greatly influenced by nutrients
components particularly combination and concentration of plant PGRs. Genotypic
variation imposes one of the most paramount constraint for the success of in vitro
morphogenic response (Bhatia et al., 2004, 2005; Cano and Moreno, 1990). Therefore,
development of callus cultures and their subsequent morphogenesis with right PGRs was
essential for cell cultures. Different concentrations of PGRs were used alone and in
combination to evaluate in vitro regeneration response. Explants (one week old cotyledons
and hypocotyls) were used for callus induction on 16 different media compositions.
Discussion Chapter 4
187
Highest callus induction was observed from the MS basal medium containing 2 mg/L IAA,
2 mg/L NAA, 2 mg/LBAP, 4 mg/L KIN (CIMT12) in both young cotyledons and hypocotyls
of Riogrande and Roma where callus induction index was >80%. While, M82 and hybrid
17905, responded to a completely different set of PGRs owing to genotypic differences.
Both hybrid and M82 showed poor regenerating calli (Figures 3.2 & 3.3). M82 lead to
callus formation only when zeatin was added in the callus induction media. Many
researchers have reported preferential regeneration by using zeatin (Gubiš et al., 2004).
Such observations are in line with previous reports, where various combinations of PGRs
were found cultivar-dependent and accounted as a trivial cause of slow in vitro
regeneration.
Our results are consistent with (Durzan, 1984; Hamza and Chupeau, 1993; Hu and Phillips,
2001; Moghaieb et al., 1999) where the regeneration capacity of juvenile explants was
reported found enhanced as compare to adult explants. Cotyledons and hypocotyls have
been shown apparently good source of explant for organogenesis during this study.
Generally, cotyledons have been indicted to acquire better callogenesis response in less
time as compare to hypocotyl and high regeneration potential (Schuetze and Wieczorrek,
1987). However, cotyledons have also been used for transformation and morphogenesis in
literature (Hamza and Chupeau, 1993; Fillatti et al., 1987; Frary and Van Eck, 2005).
Embryogenic calli derived from cotyledon explants depicted a high-shoot regeneration
potential in Riogrande and Roma whereas, the other two cultivars had pale white compact
calli indicative of slow organogenesis. Hypocotyl derived calli have many embryoids in
Riogrande; however, callus induction was slower and calli were less totipotent as compared
to cotyledons.
Various shoot induction treatments containing BAP at high concentration with or without
low dose of auxins were evaluated for in vitro shoot formation and number of shoot
primordia per calli. Regenerating calli led to multiple shoot formations in a 3-week time
period on SIMT6 containing 3 mg/L BAP and 0.1 mg/L IAA. On an average, 4-5 shoots
were induced on SIM in case of Riogrande with 56% shooting frequency followed by
Roma, hybrid 17905 and M82. BAP alone at 5 mg/L was found second most effective
treatment in terms of shoot organogenesis. These findings corroborates with reports of
using high cytokinins particularly BAP for short-time shoot multiplication in different
Discussion Chapter 4
188
tomato cultivars (Botau, D., 2002; Kartha et al., 1976). The data presented here showed
that cv. Riogrande and Roma have better regenerating potential as compared to hybrid
17905 and cv. M82 (Tables 3.6 & 3.7).
Individual regenerated shoots (3-4 cm) were excised and subsequently cultured on rooting
medium containing different levels of IAA, NAA, and IBA. Thereafter, highest number of
roots (~12) were observed from shoots of cv. Riogrande with 0.1 or 0.5 mg/L of NAA in
basal medium followed by cv. Roma (~10). IBA concentration 1 mg/L was found second
most effective rooting hormone. These findings could be explained by positive effect of
exogenous auxins on root development (Klerk et al., 1999). Our results strengthens
previous findings on use of IBA and IAA for more than 10 roots/shoot in tomato (Osman
et al., 2010). Whole organogenesis process was completed in less than 2.5 months for cv.
Riogrande with 3 weeks of callogenesis, 3 weeks for shoot multiplication, and 12 days of
rooting. This high frequency standardized procedure yields acclimatized plantlets in 2-3
months. Regeneration of the explants in the in vitro conditions remarkably changes the
physiology of regenerated plants when they were acclimatized to natural environment.
These alterations in growth characteristics could be attributed to elimination of exogenous
PGRs. Thus, in vitro regenerated plant showed some variation in growth characteristics
like reduced height, fruits and flowers as compare to greenhouse grown plants. The fruit
size and number also decreased; however, no genetic aberrations were observed. These
somaclonal variations are common in cell culture of many plants. Nevertheless, subtle
changes can pose serious drawback to micro propagation of true to type plants (Larkin and
Scowcroft, 1981). Other than shape changes in fruit and reduced numbers, no obvious
difference were seen in in vitro grown plants which could be indorsed to cell culture stress
and exogenous PGRs as reported by Morrison, Whitaker, and Evans, (1988).
To further, shorten the time of in vitro plantlet regeneration, organogenesis via Somatic
embryogenesis (SE) of most responsive variety in cell culture cv. Riogrande was
developed. SE represents a complex model of totipotency regulated by cascade of signaling
pathways to reprogram the fate of cell dedifferentiation and proceed to embryogenesis.
Such reprogramming is often initiated by external cues such as cytokinins and auxins or
stress conditions (Méndez-Hernández et al., 2019). The effect of growth media pH on SE
is reported here as a novel aspect of tomato regeneration which influences the overall
Discussion Chapter 4
189
progress of clonal propagation and cell cultures. SE in tomato was achieved in two steps
by induction of rhizoid and rhizoid tubers. In the first step, rhizoids were induced form a
week-old cotyledons and hypocotyls by using two auxin analogues at various concentration
(NAA & 2, 4-D) in dark conditions at pH 4.0. NAA concentration at 0.5 or 2 mg/L
promoted substantial rhizoid induction while 2, 4-D failed to induce these structures. The
role of auxin to promote induction phase in SE is well documented. In particular, the
embryogenic cultures are induced by the little quantity of auxins in the culture medium
while increase in concentration of auxins favors callus formation (Nic-Can et al., 2013;
Nic-Can and Loyola-Vargas, 2016). Embryogenesis primarily rely on manipulation of
PGRs irrespective of plant species; however, competence of particular type of explant
towards exogenous hormones is largely dependent on genotype makeup and is more like a
serendipitous process (Victor M. Jiménez, 2005). Unlike many previous reports of using
2, 4-D for initiation of SE, the result showed that in tomato Riogrande, no embryogenesis
was observed when explants were exposed to varying concentration of 2, 4-D at pH 4.0 as
evident from data shown in Table 3.3. It is noteworthy to mention here that various levels
of pH 3.0-7.0 tested with same concentration of NAA revealed that pH×NAA correlation
is vital in induction of SE as shown in Figure 3.7. Without low pH (4.0) or NAA no rhizoids
were seen which shows genotypic specificity for dedifferentiation. In a previous report on
sweet potato, treatment of calli with 5 µM 2, 4-D and polar auxins transport inhibitor 2,
3,5-triiodobenzoic acid restricted the development of embryo promoting only callus
morphogenesis. This shows that exogenous phytohormones particularly auxins, influence
endogenous polar IAA transport to facilitate or inhabit embryo development (Chée and
Cantliffe, 1989). Due to presence of particular type of auxins in the culture medium, NAA
in our study, pro-embryogenic masses already present in the culture were primed to
undergo primary SE and initiation of cell polarity occurs. Thus, initiation phase began by
one of two auxins. Once the auxins were removed from the culture, embryogenesis
proceeded rapidly. Such observations have been verified in many plant species (Jiménez,
2001). Individual rhizoids, upon transfer to a medium containing 5 mg/L TDZ or BAP in
light conditions, produced secondary embryogenesis and novel structures – rhizoid tubers
(RTBs) with many somatic embryoids (Figure 3.9 A). Unlike, many reports of continuous
Discussion Chapter 4
190
dark regime, it is noteworthy that induction of SE was initiated in dark conditions while
maturation of RTBs was more prominent in light photoperiod (Gow et al., 2009).
Sequential dark and light impulses are reported here for quick embryogenesis response at
pH 4.0. Different novel structures like RTBs, frog- egg-, and bulbil-like bodies were
already reported through SE recently (Ning and Bao, 2007; Xu et al., 2014, 2016) and our
findings are in agreement with the previous literature (Xu et al., 2015). TDZ at high
concentration not only induced RTBs but also germination of embryos to cotyledonary
nodes on top of explants. When TDZ has been used for in vitro plantlet regeneration of
excised RTBs, they spontaneously germinated to shoot primordia without any intermediate
stages. TDZ have been known as potent inducer of de-differentiation in diverse plant
species where it mimics cytokinins like activity and change the level of endogenous auxins
(M. J. Hutchinson, Murch, and Saxena, 1996). The morphogenetic responses were
modulated by high concentration of TDZ that may constitute inductive signal for
embryogenic expression. The results are in line with (Victor et al., 1999; Yang et al., 2012)
where combination of TDZ and BAP at high concentration resulted in somatic embryos,
while sequential incubation on BAP followed by TDZ, shoot organogenesis occurred. By
simply changing or alternating two cytokinins, shift from somatic embryos to shoot
formation could be achieved for RTBs. TDZ and BAP at 5 mg/L in light not only favored
formation of RTBs but also in vivo shoot organogenesis occurred when RTBs from TDZ
were transferred to medium with BAP (Figure 3.9). Additionally, we excised individual
RTBs were excised to investigate in vitro regeneration potential. This was done to
determine if RTBs if they are typical secondary embryos and germinate to whole plantlet
like other somatic embryos. It was an interesting property of novel RTBs, that even when
separated from cluster of rhizoids and incubated on media containing TDZ/BAP 5 mg/L,
shoot and root organogenesis occurred simultaneously as shown in figure 3.10-D. Thus,
confirming RTBs are previously unknown secondary somatic embryos that can be used
independently to generate true to type plants.
Further confirmation was done with microscopic investigations to determine the ontogeny
of RTBs. Originated as secondary somatic embryos from primary ones, RTBs consisted of
multiple embryonic cells and hence, multiple embryo formation within RTBs occured.
Discussion Chapter 4
191
Histological studies of RTBs demonstrated their composition of embryogenic cells with
multiple embryonic stages (Figure 3.13 and 3.14-B). These embryos sprout from epidermis
of rhizoids and then develop into whole plantlets through various stages of embryogenesis.
The whole procedure of embryogenesis was completed in initiation phase (6 days),
maturation and secondary embryogenesis (6 days), shoot and root morphogenesis (15
days), shoot proliferation and acclimatization of plantlets (12 days). Thus, the process
following germination of one-week old seedling, initiation of embryogenesis and
subsequent germination of cotyledonary embryos to whole plantlet was completed in 45
days. Eventually these embryos germinate spontaneously and are capable of high
frequency in vitro shoot formation. These results demonstrate the uniqueness of novel
structures - RTBs for complete organogenesis in less time and labor over routinely used
explants sources.
To our knowledge, there is no report of in vitro regeneration in tomato at pH 4.0. However,
low pH has been used to initiate cell cultures of other plants. An increased number of
regenerated shoots at lower pH (4.5) in Bacopa monnieri has been reported (Naik et al.,
2010). pH range (3-7) was used to evaluate the regeneration capacity in pine buds showing
that initially low pH of media is more suitable for in vitro morphogenesis (Andersone and
Ievinsh, 2008). Consistent with this idea low medium pH also impose tissue culture
impulses and may be perceived as a stress signal, thus forcing the reprogramming of cell
dedifferentiation to embryogenesis in cv. Riogrande. Such notion has been supported by
(Wilkinson, 1999) where increase in xylem pH has been associated with elevated ABA
concentration in the apoplastic region adjacent to guard cell of leaf epidermis. The medium
pH tend to affect nutrient availability as well as enzymatic and hormonal activities in
tomato thus increasing shoot biomass in cv. Redcoat (Bhatia and Ashwath, 2005).
However, contrary to previous observation, pH 4.0 in our study with specific auxins at low
concentration favours rapid somatic embryogenesis by formation of rhizoids and RTBs,
while higher concentration of auxins at pH 4.0 led to callogenesis. Here low pH is reported
as novel aspect of embryogenesis competency in cv. Riogrande, not established previously.
The result shown above validated the optimal response of cv. Riogrande in terms of in vitro
cell culture experiments. So, it was designated as seamless source for Agrobacterium
Discussion Chapter 4
192
mediated integration of SL biosynthetic pathway genes. Prior to infection of explants with
Agrobacterium, the vector designed during cloning steps were checked for their
functionality in tomato.
EHA105::pGII0229MAS-CCD7-cp148-LUC and EHA105::pGreenII0029-35S-TL-
GFPCCD7/D14 transient expression was accessed in leaves and fruits of tomato.
Fluctuating levels of GUS/GFP/LUC activity irrespective of transient or stable expression
were detected in leaves depending on incubation time post infiltration. The efficiency of
transient assay has been found to be dependent on compatibility between plant and the
strain of Agrobacterium being used. In our experiment for EHA105 OD600 0.5-0.7 gave
>80% GUS expression in leaves and fruits, GV3101 harboring dicistronic vector resulted
in tissue necrosis and wilting of plants. This could be attributed to virulence of
Agrobacterium strains towards particular plant species and physiological state of the host
plant. Similar observation were put forward by (Wroblewski et al., 2005). In the light of
results obtained, infiltration media, optical density of Agrobacterium and incubation time
have been regarded as three important factors that affect transient expression of pGreen
based binary vectors. The optical density of the bacterial suspension was optimized for
infiltration experiments as shown in Table 3.8. It was observed during our course of
experiments that OD600<0.1 failed to give any desirable expression even after 72 hr of
incubation while OD600>1 resulted in tissue necrosis. Effect of addition of Acetrosyringone
in superior amount to increase the transient and stable transformation efficiency (0-400
µM) was tested. The data is in agreement with Cortina and Culi, (2004) that addition of
200 µM Acetrosyringone to the infiltration or co-cultivation medium gave desirable
transgene expression. Results of transient expression pattern of GUS staining and GFP
imaging were also in compliance with Jefferson et al., (1987) and Chalfie et al., (1994).
For stable transformation, factors that are pertinent for maximum transformation efficiency
were secreened. Different factors reported previously such as preculture treatment (Ahsan
et al., 2007), optical density and Acetrosyringone (Murray et al., 1998), co cultivation
duration and selection antibiotics (Hu and Phillips, 2001) were established for development
of efficient transformation system. Our data showed that one week old cotyledons of cv.
Riogrande when precultured on PCM1 (1 mg/L NAA, 1 mg/L BAP) for 2-5 days were
Discussion Chapter 4
193
swollen and they could endure the steps of Agrobacterium infection and co-cultivation, as
compared to fresh explants shown in Figure 3.30. Effect of preculture in dark was found
significant on transformation frequency giving >60 percent regeneration of
Kanamycinkanamycin resistant shoots. Fresh explants without preculture treatment were
more prone to necrosis and wilting occurred after 2 days of inoculation (Figure 3.30 F-I).
Preculture treatment of young explants before Agrobacterium mediated infection has also
been recommended by (Ellul et al., 2003; McCormick, 1991; Park et al., 2011). Optical
density of 0.4-0.5 for EHA105 and 0.2-0.4 for GV3101 and 15 min of infection time
followed by 48 hr of co cultivation at 19C. Along with these optimized parameters 200
uM Acetrosyringone has been used to enhance the transfer of T-DNA. Previously, Roy et
al., (2006) has also reported co-cultivation of 2 days for successful regeneration of
Kanamycinkanamycin resistant shoots. Time of infection of Agrobacterium strains to
adhere with cell wall of explant has been indicated as detrimental factor in recovery of
explants post co-cultivation (Rai et al., 2012). Consistent with Gao et al., (2009) increase
in incubation period beyond 15-20 min resulted in decrease in transformation efficiency in
all the tested varieties during our experiments. Further the data of transformation related
parameters for cv. Riogrande are similar to previous work (Yasmeen, 2009). Variable
bacterial densities ranging from 0.1-1 have been utilized for tomato transformation in past
(Chyi and Phillips, 1987; Anne Frary and Earle, 1996; Gao et al., 2009). For example,
optical density of 0.5-0.6 was used for maximum transformation efficiency in tomato
(Costa and Nogueira, 2000; Hu and Phillips, 2001). Thereafter, 90% GUS expression was
achieved and subsequently >40% transformation rate in Riogrande with O.D600 of 0.4-0.6.
Different antibiotics were tested against EHA105 and GV3101 to get rid of excessive
growth is inevitable for regeneration of cotyledon and hypocotyl explants. High
concentrations of Agrobacterium can result in over-growth problems and explants death
during stable transformation (Dan et al., 2006). Therefore, elimination of excessive
bacterial growth from regeneration media following co-cultivation is vital for successful
recovery of transgenics. It was We have found that GV3101 is harder to eliminate from
cell culture even at higher concentration of antibiotic (600 mg/L Augmentin, 600 mg/L
timentin and/or 300 mg/L cefotaxime), while EHA105 was more acquiescent to 300-600
Discussion Chapter 4
194
mg/L Timentin in combination with 300 mg/L cefotaxime and/or 600 mg/L augmentin. Out
of all bacteriostatic antibiotics tested Timentin (mixture of ticarcillin and clavulanic acid)
at 300-600 mg/L alone was found significantly effective as compare to cefotaxime,
carbencillin and/or augementin as evident from data shown in Table 3.11. Nauerby et al.,
(1997) have also confirmed vitality of Timentin as compared to other routinely used
antibiotics to restrict growth of Agrobacterium post co cultivation with minimal phytotoxic
effects on explants. Following co-cultivation and selection steps explants were cultivated
on callus induction medium CIMT12 with 50 mg/L Kanamycinkanamycin. After one week
of incubation callus formation started from the cut surface of the explants. The regenerating
calli were chimera of transformed and non-transformed areas, which eventually turned
brown due to necrosis and susceptibility to Kanamycinkanamycin in the regeneration
medium. Proliferating calli were sub-cultured after one week of incubation. Regeneration
started after 4 weeks of culture on CIM, followed by transfer to shoot induction media
containing high concentration of BAP and low quantity of auxins NAA/IAA. The data
showed that juvenile explants lead to better transformation efficiency, while increase in
bacterial concentration and infection time lead to poor transformation efficiency as
reported previously (Hamza and Chupeau, 1993; Hu and Phillips, 2001). The role of BAP
2-5 mg/L in shoot induction is also well documented (Devi et al., 2008; Gubis, et al., 2003;
Otroshy et al., 2013). The putative transformed shoots were rooted on medium with 50
mg/L Kanamycinkanamycin on medium supplemented medium. Transformation
efficiency was calculated based on number of Kanamycinkanamycin resistant shoots
produced from an independent transformation event after 10 weeks of culture. Highest
transformation efficiency was achieved by using one-week-old cotyledons with 35%
regeneration frequency and 44 % transformation frequency. The result presented
superiority of cotyledons as explant material, which, has been reported previously by many
researchers (Anne Frary and Elizabeth D. Earle, 1996; Fillatti et al., 1987; Hamza and
Chupeau, 1993). Such differential response can be attributed to genotypic variations.
Different genotypes of WT and cultivated tomato behave uniquely to combination of PGRs
(Kurtz, S.M. Lineberger, 1983). Hence, choice of explant as well as age is critical and
dependent on genotype. 35-44 % transformation efficiency as achieved with both types of
explants used in our study. Similar results have been reported previously with 40%
Discussion Chapter 4
195
transformation efficiency obtained in cv. Hezuo 908 (Chyi and Phillips, 1987; Sun et al.,
2015). While, many published transformation experiments claimed 60-70 % of achievable
efficiency (Hu and Phillips., 2001; Mathews et al., (2003). Such reports; however, were
found ambiguous about how transformation rates were confirmed and also lack essential
experimental procedure.
The transgenic shoots were confirmed for the presence of CCD7, LUC, GFP and D14 genes
via PCR amplification. The rooted plants were shifted in peat and soil mixture and
acclimatized before transferring them to Green house, where they were evaluated for
morphological parameters.
Putative transformed plants T0 were self-fertilized to get T1 fruits and seed. The
morphological parameters were analyzed for both T0 and T1 leaves, flower and fruits due
to shoot morphology regulating role of SLs. The morphological and biochemical
determinants for overexpression of CCD7 gene and possible resilience to drought stress
was also assessed in T0 &T1. As shown in Figure 3.34, 4.2 & 4.3, the tomato plants over
expressing CCD7 showed some morphological deviation from normal physiology of WT
plants which could be seen as 2-3 lobed true leaves, abnormal plant height and 4 different
shapes of fruit as persimmon, bilobed and oval shaped (Figure 4.2 A-G). As previously
reported by Liu et al., (2013), in Lotus knockout lines of LjCCD7 showed stunded and
bushy phenotype. Such observation could be attributed to the role of SLs in controlling
shoot architecture. Consequently, upregulation of SLs at bisosynthetic level sould have
opposite effect. Our data showed that the LjCCD7 over expressing lines were less bushy
with 50% reduced number of branches, and reduced height (Table 3.13). After 10 weeks,
number of branches and internode were reduced remarkably in T1 as compared to T0.
Transgenic tomato plants showed fewer cotyledonary, primary, and secondary aerial
branches (9) in T1.3 plant as compared to wild type (23–-25). Similarly, stem diameter was
and height also showed reduction in T1 lines. Most of the transgenic plants were
significantly shorter except anamolously behaving T1.5 which showed height and
branching approximately equivalent to WT plants. The LjCCD7 expressing tomato plants
had smaller less serated leaved which are more oval and bilobed as compared to wild type
plants in T0 lines as shown in Figure 4.2. The leaves were less serrated in T1
plants after 4
Discussion Chapter 4
196
weeks, but attained normal physiology towards full vegetative growth (Figure 4.3). Mild
wrinked leaves were also observed. Flowers were of normal shape but fewer in number
(data not shown). Apparently, fruit size and number was also affected; however, the
difference was insignificant.
In conclusion, the results unanimously proved that cv. Riogrande is promising cutivar for
in vitro morphogenesis, somatic embryogenesis and Agrobacterium mediated gene
transfer as compared to other cultivar(s). The protocol described above is efficient and
reproducible without involving feeder layers. Number of factors governs the in vitro
regeneration response synergistically; however, effect of genotype was more profound.
Discussion Chapter 4
197
Figure 4.24.2 Morphological assessment of T0 Transgenic plants of cv. Riogrande
Discussion Chapter 4
198
Figure 4.34.3 Morphological features of T1 transgenic plants Vs WT plants
Discussion Chapter 4
199
Overexpression of LjCCD7 gene enhances drought stress tolerance
in tomato by ROS scavenging mechanism
The juvenile explants of tomato cv. Riogrande were utilized for over expression of LjCCD7
gene by Agrobacterium mediated transformation. The gene has been previously
characterized in osmotic stress tolerance due to dehydration in SL deficient lotus plants
[Ljccd7 knocked out lines] (Liu et al., 2015). The transgenic lines (OE1) confirmed for
presence of LjCCD7 were greenhouse acclimatized, where they were challenged for 21
days dehydration survival assay against corresponding WT plants. After 7 days of water
deficit transgenic CCD7 overexpressing leaves showed minimal signs of wilting,
yellowing and leaf rolling as compared to WT plants. Subsequently 21 days of extreme
water stress was given and resumption of irrigation lead to 80% survival of transgenic
CCD7 lines while, WT plants wilted due to extreme necrosis, accumulation of reactive
oxygen species (ROS) and associated oxidative damage caused by extreme drought and
drought induced osmotic stress. The results obtained here are in line with Liu et al., (2015)
whereby, SL depleted LjCCD7 silenced lotus plants showed reduced level of total ABA
content as well as ABA hyposensitivity in leaves under combined phosphate deficiency
and osmotic stress due to absence of SL synthesis. The precocious wilting of WT stressed
leaves of tomato versus OE1 lines after drought stress explicates why CCD7 lotus plants
were more susceptible to drought stress reported by Liu et al., (2015). The results
apparently showed that transgenic OE1 lines were more heighted and bushier than WT
plants. CCD7 and CCD8 are required for inhibition of shoot branching and suppression of
bud outgrowth in plants which regulates above ground architecture of land plants (Gomez-
Roldan et al., 2008; Matusova et al., 2005; Umehara et al., 2008). Being rhizosphere
derived signals; more SLs are produced during abiotic stresses in shoots. This increase
serves as messengers of stress indication and diverse physiological activities are regulated
coherently in plant development besides shoot branching (Zhang et al., 2015; Zhang and
Haider, 2013). Abnormal height of the transgenic OE1 lines in our experiment is in
agreement with Liu et al., (2013); Vogel et al., (2010); Waters et al., (2012).
Discussion Chapter 4
200
SLs regulate plant development and growth via close cross-talk with auxin and represses
shoot branching largely due to depletion of PIN1 (PIN- FORMED PIN proteins) from
plasma membrane. Conversely, cytokinins are promoter of bud outgrowth and SLs interact
with them antagonistically in the presence of auxins to control bud outgrowth (Dun et al.,
2012). However, surprisingly inhibition of shoot branching which is the character
attributed to SL expression is not observed in T0 tomato lines in thisour experiment.
Instead, the transgenic plants were found long but bushy. This effect could be attributed to
the fact that cv. Riogrande is heirloom determinate variety used in thisour study and it has
natural tendency to form bushes with lot of branches. It could be established that
overexpression of LjCCD7, which was reported to be responsible for branching phenotype
and stunted height in mutant lines of lotus and SlCCD7 in M82 was not very distinctive in
CCD7 overexpression lines T0 due to genotypic differences. This notion can only be
confirmed with further characterization of T1 and T2 plants. Phenotypic evaluation of T1
plants at their reproductive age showed that CCD7 expression decreased the branching
phenotype due to deficiency or absence of SLs initially resported in Lotus plants (Liu et
al., 2013). The transgenic plants were less bushy as compared to wild type plants due to
fewer (9-11) primary and secondary branches (Figure 4.4). These phenotypic characters
could be due to above ground effects of naturally occurring indignous SLs and SL like
compounds due to over expression of CCD7 gene. Moreover, CCD7 transcripts also
decreased the stem diameter and height of transgenic lines, although the difference was
non-significant. For fruit and flower development even though there is no obvious role for
a branching hormone reported uptil now; nonetheless there may be unidentified
interactions of CCD7 derived apocarotenoids for fruit development or flavour attributes as
CCD7 clevage products i.e beta-ionone contribute in tomato flavour (Vogel et al.,2010).
Discussion Chapter 4
201
Figure 4.44 Morphological assessmet of T1 transgenic plants
Data represent the mean values of three randomly selected plants/leaves of each line under
well irrigated conditions ± S.E. Means followed by the different letters are significantly
different as determined by a pairwise comparison using Tukey’s test at p<0.05
Discussion Chapter 4
202
It could be established that overexpression of LjCCD7, which was reported to be
responsible for branching phenotype and stunted height in mutant lines of lotus and
SlCCD7 in M82 was not very distinctive in CCD7 overexpression lines T0 due to
genotypic differences. This notion can only be confirmed with further characterization of
T1 and T2 plants. Phenotypic evaluation of T1 plants at their reproductive age showed that
CCD7 expression decreased the branching phenotype due to deficiency or absence of SLs
initially resported in Lotus plants (Liu et al., 2013). The transgenic plants were less bushy
as compared to wild type plants due to fewer (9-11) primary and secondary branches.
These phenotypic characters could be due to above ground effects of naturally occurring
indignous SLs and SL like compounds due to over expression of CCD7 gene. Moreover,
CCD7 transcripts also decreased the stem diameter and height of transgenic lines,
although the difference was non-significant. For fruit and flower development even
though there is no obvious role for a branching hormone reported uptil now; nonetheless
there may be unidentified interactions of CCD7 derived apocarotenoids for fruit
development or flavour attributes as CCD7 clevage products i.e beta-ionone contribute in
tomato flavour (Vogel et al.,2010).
To respond and resist, water deficit, plants have evolved various strategies enabling them
to integrate activities at the whole-plant level. These strategies may involve drought
avoidance and/or the development of drought tolerance mechanisms. Constitutively
overexpression of LjCDD7 gene in tomato resulted in significant reduction of growth
parameters during well irrigated conditions and extreme water defict with reduced leaf
area, less serration of leaves, reduced number of branches and height as well as less wilting
and yellowing of leaf as compared to wild type plants. All these phenotypes depict the
‘drought avoidance’ properties of the transgenic lines forexample, through reduced leaf
area to evaporate less water from surface and high survival rate than wild type by reducing
water loss during drought. Hence, LjCCD7 gene employs stress avoidance and resilience
mechanisms to cope with water stress in OE0 and OE1.
Thus, involvement of SLs and abiotic stress resilience is juxtaposed concept in higher
plants now and is confirmed in past by Ha et al., (2014) that Arabidopsis plant deficient in
SL synthesis were found to be sensitive to dehydration due to less endogenous
Discussion Chapter 4
203
strigolactones level. Hence, our results showed that over expression of CCD7 gene which
is differentially expressed in shoots and roots of plants exposed to drought or osmotic stress
synthesize higher level of precursor apocarotenoids, hence more SL or SL related
compounds were produced, to create a physiological state that is similar to stress
encountered plants. Elevated level of SLs or its precursor may have facilitated the ABA
hypersensitivity that requires either exogenous SL treatment or local increase in SL
synthesis observed in tomato, Lotus and Arabidopsis. This indicated a persuasive proof that
SL increase or synthesis is required for proper ABA functioning at guard cell level for
stress regulation. The high antixodidant enzymes activity in transgenic OE1 tomato plants
also confirmed our hypothesis. These datasets certainly show that high level of SLs give
an important positive contribution to stress resistance by increasing ABA sensitivity.
Exposure to drought and osmotic stress cause oxidative damage in plants due to free
radicals and reactive oxygen species (ROS) in land plants (Munné-Bosch and Alegre,
2000). However, the quenching activity in plant by antioxidant enzymes scavenge these
ROS to maintain normal physiological state of plant (Ren et al., 2016). The balance
between ROS production and their quenching is crucial aspect of abiotic stress resilience
in plants. Evaluation of the ROS quenching ability of transgenic plants (stem and leaves)
at normal physiological state and after 15 & 21 days of water stress treatment was done.
In order to test if CCD7 gene overexpression regulated the ROS level, H2O2 and O2
radicals in response to 21 days drought challenge vs non- stressed conditions., we assayed
antioxidantAntioxidant enzymes specifically peroxidases viz: . Superoxide dismutase
(SOD), Peroxidase (POD), Catalase (CAT) Ascorbate peroxidase (APX) and
Malondialdehyde (MDA) content of transgenic and WT leaves and stem tissues were
investigated after 0, 15 and 21 days of water deficit. The data generated indicates that
enzyme activities of transgenic lines OE1 increased as the stress increased when compared
to basal level of enzyme activity in WT tissues. The dataset indicated that transgenic lines
have enhanced antioxidant defense enzyme system that scavenges ROS production due
drought stress and maintained the physiological homeostasis of plants. While, WT plant
facing similar conditions showed not only lower basal level of antioxidant enzymes but
also, signs of tissue necrosis, cell death and deformed photosynthetic ability as shown in
Discussion Chapter 4
204
Figure 3.36. Maintenance of higher level of CAT, SOD, POD and APX activities in
drought stressed leaves of transgenic plants allowed the removal of H2O2 and superoxide
radicals, especially under severe drought stress. These observations are in agreement with
stress physiology of tolerant plant species widely reported in literature (Cruz de Carvalho,
2008; Ren et al., 2016; Yuan et al., 2010; Zhu et al., 2015). Foliar concentration of these
antioxidant enzymes have been reported to increase during drought stress which supports
our results (Lim et al., 2016; Wujeska, Bossinger, and Tausz, 2013). It is important to
mention here that the without stress the indigenous level of antioxidant activities were
significantly higher in leaves and stem of transgenic lines. Nevertheless, with increasing
time of drought stress treatment, these antioxidant enzymes increased 4-6₋fold as
compared to stressed WT counter parts. This may indicate that even before the onset of
stress, transgenic OE1 plants were in drought avoidance physiology possibly due to high
level of SLs or SL related molecules. The level of MDA contents that are end products of
lipid peroxidation of biological membranes due to oxidative burst in extreme drought
stress were also found to be significantly lower in CCD7 overexpressing leaves and stem
tissue as compare to WT plants under stress. These results are in line with (Ijaz et al.,
2017; Lim et al., 2016; Mittova et al., 2002) whereby enhanced antioxidant system,
minimal MDA level and enhanced photosynthetic and chlorophyll contents were reported
in response to abiotic stresses. Together it could be deduced that CCD7 gene
overexpression in tomato Riogrande created drought hyposensitivity and exhibited
significant increase in antioxidant enzyme activity with low MDA level, less chlorophyll
pigment loss and with higher survival rates under drought stress. Amplified level of
carotenoid cleavage enzyme precursor has primed transgenic plants with enhanced stress
responsive network due to cross talk with other phytohormones particularly ABA. The
phytochemical analysis of tomato fruit skin and pulp of transgenic plants showed
enhanced antioxidant properties with 2-3₋fold increase in phenolic and flavonoid
compounds. Periago et al., (2002) demonstrated increase in bioactive compounds in
tomato cultivars subjected to abiotic stress. The increase in the antioxidant enzyme system
and impoved phenolic and flavonoid properties in tissue of tomato, reaffirms the
conclusion drawn by many reports that ROS scavenging and enzymatic antioxidant
Discussion Chapter 4
205
system are most employed mechanism in tomato to avoid abiotic stress (Dewanto et al.,
2002; Kumar et al., 2014; Li et al., 2008; Pal et al., 2016).
Improvement in water use efficiency and development of drought resistant crops are
considered as needful innovations nowadays. Drought adaptation and tolerance regulating
pathways in plants are increasingly targeted for manipulation of drought resistance (Egea
et al., 2018). SLs are documented as new stress players and they promote drought
tolerance in Arabidopsis thaliana, Lotus japonicus, and Solanum lycopersicum by cross
talking and regulation of ABA-dependent and ABA-independent pathways (Ha et al.,
2014; Liu et al., 2015; Visentin et al., 2016; Vogel et al., 2010). It can be concluded that
overexpression of one or more genes of SL pathway like CCD7 will open meticulous
strategies to engineer plants for enhance water use efficiency.
Structure and activity relationships (SARs) in natural and
synthetic analogues decoded via quantitative in planta assay and
docking simulations
Plants produce diverse canonical and non-canonical SLs that differ structurally and
stereochemically under different physiological conditions within single plant species (Al-
Babili and Bouwmeester, 2015). However, due to lack of targeted tools for investigation
of structure and function relationships (SARs) and the fact that SLs are produced in
minimal quantities (pM), there is a niche in the idiosyncrasies and localization events.
Development of smart molecular tools for investigation of these specificities in SL
signaling and perception will be great innovation for understanding of specie-based SL
dynamics. Therefore, genetically encoded model as plant-based bioassay in A. thaliana
was developed. In last few years stereochemistry of SLs have been extensively explored
and its relevance in discovery and design of SLs mimics and analogues have been clearly
demonstrated (Lombardi et al., 2017; Mwakaboko and Zwanenburg, 2016; Zwanenburg et
al., 2013). The SAR studies and synthesis of new analogues offer valuable tool to explicate
molecular basis of receptor-ligand interactions and discovery of new SL analogues or
antagonist. Additionally, real time monitoring of SLs related activity in root exudates was
also missing. The assay was developed to associate florescence quenching of LUC fused
to D14 receptor under the control of indigenous promoter. GR24 racemic mixture was used
Discussion Chapter 4
206
to calibrate assay in the dynamic range of (100 nM-20 µM). The D ring of the synthetic
and natural SLs are susceptible to nucleophilic attack in aqueous environment that leads to
hydrolysis product (Boyer et al., 2012). X-ray analysis and enzymatic assays have
underpinned that D14 receptor contains conserved residues as catalytic triad of Ser-His-
Asp at the bottom of ligand binding pocket. These residues attack and cleaves enol ether
moieties of C and D rings in SLs (Yao et al., 2016). It is evident that the D-ring is amenable
to various substitutions and derivations with similar physical and chemical properties to
study structure and activity (SAR) relationships of strigolactones (Artuso et al., 2015;
Sanchez et al., 2018). Based on selective modification of D ring series of analogues by
replacing butenolide moiety with lactam functional group termed, as D-lactams were
prepared. Considering the involvement of an easy leaving group for activity of SL along
with D ring, we designed SL mimics were designed lacking ABC ring moiety and enol-
ether bridge and BODIPY derivatives as florescent analogues suitable to study localization
of SLs receptor-ligand complex. To further analyse whether SL-D-lactams are active as
plant hormones, the assay was tested with 6-7 days old Arabidopsis transgenic lines
expressing AtD14 fused to the firefly luciferase (LUC) (Chevalier et al., 2014) in a D14
degradation based quantitative assay and confirmed by germination assay on seeds of
parasitic weed Peliphanche aegyptiaca and compared to GR24, used as reference standard.
The obtained results have been rationalized by in silico modeling.
Natural and synthetic SLs are rapidily decomposable through cleavage of D-ring at pH
9.38 as reported by and are sensitive to hydrolysis at pH 7 (Vurro et al., 2016) . The stability
of designed analogues as a function of their activity in aqueous medium and in methanol
was investigated. The results showed that higher activity of SL analogues is proportional
to their instability in aqueous medium due to nucleophilic attack on D ring as compared to
GR24 as standard. The activity differences between SL analogues may be attributed to their
instability in aqueous medium (Halouzka et al., 2018; Kannan and Zwanenburg, 2014). As
expected, the stability in the presence of MeOH was highly compromised for all the
compounds used in the study. Not surprisingly, the presence of the N-tert-
butyloxycarbonylation (N-protecting group Boc) slows down the hydrolysis rate in all the
analyzed compounds. Next, all the analogues were screened for germination activity
against seeds of P. aegyptiaca. The test itself is trivial, but it is very sensitive and widely
Discussion Chapter 4
207
used to obtain preliminary clues about the germination-inducing activity of new
compounds. The dose-response curves of the D-lactams are all shifted to right (higher
concentration) thus complying a lower activity in comparison to GR24. Diastereoisomers
D2 of GR24-D lactam (rac-2 and rac-4, Figure 3.43) depicted the same profile thus
meaning that the presence of the Boc group on N is not affecting the perception. All the
SL-D-lactams proved to be less potent inducers of germination than rac-GR24, with rac-1,
rac-2, and rac-4 showing the highest activity; at 10 μM SL-D-lactams were comparable to
rac-GR24 at 0.1 μM, i.e. ~100₋fold lower activity. rac-3 and rac-1 and the mimic
derivatives rac-7 and rac-8 do not reach a plateau at concentration below 10 μM.
Surprisingly, N-Boc-derivatives (rac-1, rac-2, rac-6, and rac-8) were as active as the
corresponding NH structures. This was unexpected as, in principle, the bulking-group Boc
can barely be accommodated in the receptor pocket, as confirmed by the docking
simulations. However, our results might be explained by the active pocket in the D14-like
receptor(s) of the parasitic plants being larger than in D14 (Toh et al., 2015), and/or with
the Boc group being lost just before the molecule reaches the active site. It was We assumed
that the removal of the Boc group, results in an unprotected compound, occurs at some
point along the pathway that leads to the target site, and probably is due to other sources
of catalysis present in vivo (De Groot et al., 2000)
To overcome these inherent uncertainties, and to obtain SAR data for the D14–-dependent
hormonal activity of SLs, this novel in planta bioassay: luminescence based was utilized
for the measurement of the decrease in luminescence of transgenic Arabidopsis expressing
a translational D14::LUC fusion. For example, like other plant hormones, SLs act as
interfacial molecules, promoting and stabilizing protein-protein interactions; in this case,
between the ligand-binding moiety of the SL receptor complex (the α/β hydrolase D14)
and the co-receptor moiety (the F-box MAX2). Such interaction promotes further binding
between MAX2 and its target(s), leading to ubiquitination and degradation of the latter by
the proteasome machinery (Saeed et al., 2017; Zhao et al., 2015). D14 itself is a target for
proteasome-dependent destruction, which explains why fluorescence of D14::GFP fusion
proteins quenches upon SL treatment in transgenic Arabidopsis (Chevalier et al., 2014).
This molecular network was exploited to implement a quantitative activity assay, inversely
correlating luminescence to perception of SL-related molecules in transgenic Arabidopsis
Discussion Chapter 4
208
expressing D14::LUC under the control of D14 endogenous promoter. Our initial results
showed that though indirect, the bioassay has an acceptable dynamic range, is relatively
simple to execute, up-scalable and robust enough to be exploitable for SAR studies
determined through variable concentration range of known synthetic strigolactones like
GR24 and EGO10. The reporter lines have been tested in a concentration range of various
SL-D-lactams as reported in Figure 3.45. Our results suggested that this molecular assay
could be applied to test and compare the hormonal activity of SL analogs, particularly
molecules with relatively low stability. The data indicates that most of the analogues,
mimics and various phytohormones tested for their SL like activity are based on SL–-
triggered D14 degradation that is required for minimal turnover signaling in D14 type
receptors at a ratio of one SL like ligand molecule to one receptor. Thus without specific
level of ligands to interact with the receptor, and signal amplification would typically fail
(McCourt et al., 2017).
This could be accounted for low activity of D-Lactams, mimics and phytohormones at 10-
50 µM based on D14 degradation signal as shown in Figure 3.46 & 3.47. However, the
EC50 value of GR24 was in the μM range, i.e. within the range for GR24 to induce
physiological responses, and within that commonly adopted for exogenous treatments. D14
degradation based assay is reported recently as StrigoQuant (Samodelov et al., 2016) and
the tests is more sensitive to luminescence based assay due to expression of D14 under
strong constitutive promoter as compare to endogenous promoter in our case. Additionally,
the above mentioned assay treatments were delivered to protoplasts rather than to intact
plants, which are needed to absorb the compounds being tested through their roots and to
translocate them systemically before a signal can start to be recorded (taking several min
for very active compounds in the micromolar range). However, for the same reasons, the
test reported here is less laborious, expensive, and technically demanding than
StrigoQuant; it is also a true whole-plant bioassay in which the (reporter-tagged) receptor
is expressed according to its native physiological level and profile. The assay calibrated for
SAR studies of range of analogues and most of the D lactams and phytohormones showed
only detectable activity at 100 μM (Figure 3.47). Rac–- 9 and CL–-BP smallest and most
bulky derivative respectively were also found in active at low concentrations. On the other
hand, strigol, ST23b, EGO10, and EDOT, rac GR24 mixture and each enantiomer showed
Discussion Chapter 4
209
better response. Implementation of a quantitative assay demands real time quantification
of SL related activity not only with purified SL derivatives, analogues and antagonist but
also in root exudates containing SLs. To test the dynamic range of assay, we extracted the
root exudates of tomato with enhanced SLs synthesis were extracted following protocol
developed by (Visentin et al., 2016). The extracted root exudates were purified from
hydroponics and further diluted in liquid MS. The dilutions were checked for SL related
activity for the first time. Interestingly the highest dilution of exudates were more or less
active like 10-7 µM GR24 racemic mixture as shown in the Figure 4.54
Figure 4.5 SLs quantification based on LUC luminisence degradation activity of tomato
normalized to mock and acetone control
Root exudates were extracted by using three plants from each line by following method of (Visentin et al.,
2016). Crude exudates were concentrated and purified with solid phase extraction assembly (SPE manifold
CNW) by using C18 cartridges.
In our quest to investigate the variable dynamic range and to check the activity of different
hormones that share same signaling mechanism with SL particularly to elucidate the
underpinnings of SL-ABA cross talk, we checked different hormones like IAA, KIN, GA3,
and ABA at 100 nM–-100 µM concentration range were tested. The result showed that
similar to D-Lactam derivatives, these hormones were only active at very high
concentration i.e. 50-100 µM concentration. Which could be attributed to non-availability
of detectable ligand signal or catalytic pocket size constraints. However, ABA treatment
0%
20%
40%
60%
80%
100%
120%
0.00 3.00 6.00 9.00 12.00 15.00
%R
.L.U
T(h)
MS
Acetone
10-1dilution
10-2dilution
10-1dilution
10-3dilution
GR2410-6
GR2410-7
Discussion Chapter 4
210
of 1–-100 µM, instead of gradual decrease of luminescence, started increase in D14 based
luminescence and showed maximum of 30% increase in the signal over control treatment.
Such anomalous behavior of ABA when compared with other tested molecules particularly
3 hr post treatment as shown in Figure 3.54a & 3.55a is both surprising and insightful to
decipher the SL-ABA dynamics. It could be proposed that somehow ABA blocked or
occupied the ligand-binding pocket of D14. We performed Competitive binding assay of
GR24 and ABA together were studied and found no such signal as with ABA or GR24
alone. Further analysis of ABA treated seedling for transcript quantification revealed that
treated Arabidopsis seedlings showed time and concentration dependent response to
exogenous application of ABA. 10 µM ABA treatment increased the expression of CCD7
gene 3₋fold more when compared with non-treated seedlings. Recent studies have
established the link between ABA and SLs in organ specific stress (Saeed et al, 2017).
Exogenous application of ABA has shown to induce accumulation of SLs in shoots in
tomato and Arabidopsis (López-Ráez, 2016; López-Ráez et al., 2010); however, the
possible synergistic effects of ABA-SL mediated stress response still remain; elusive.
Although SL biosynthetic mutants of tomato were found defective in ABA biosynthesis,
which showed involvement of ABA in regulation SL biosynthesis; however, their mode of
cross talk is still ambiguous. The change in expression pattern of SL biosynthetic genes in
transgenic Arabidopsis seedling are in line with (Ha et al., 2014) where ABA was shown
to induce MAX3(CCD7) and MAX4(CCD8) transcript accumulation in Arabidopsis.
Osmotic stress and nutrient starvation together repressed ABA level in SL depleted shoots
of Lotus as compared to WT, while in root this effect was found missing. Many reports
have also explained that CCD7 mutants were found hyposenstive to exogenous application
of ABA at 5–-20 µM response (Liu et al., 2015; Visentin et al., 2016). Hence, differential
expression of SL and ABA metabolic enzyme was most predicted outcome following ABA
treatment, which further strengthen SL–-ABA cross talk in Arabidopsis. It was unclear if
SLs exerts their role in abiotic stresses due to ABA or latter regulate SLs when stress is
perceived. It could be presumed that both phytohormones target some shared protein and
/or genes which are stress responsive and presence of both hormones in stress resilience is
inevitable.
Discussion Chapter 4
211
The structure activity relationships of various synthetic SLs and validation of data obtained
after quantitative D14 assay, prompted for more detailed knowledge of receptor- ligand
binding mode. To validate the results docking analysis of D lactam analogues and ABA
was done to elucidate their binding mode within D14 receptor.
Molecular docking allows the identification of the low-energy binding modes of a ligand
within the active site of a macromolecule. It predicts substrate conformation and
orientation, revealing key groups or atoms for binding that are closest to the catalytic
residue, for instance. Ideally, it allow us to characterize the behavior of small molecules in
the binding site of target proteins as well as to elucidate fundamental biochemical processes
(Meng et al., 2011). The docking process consists in repeatedly posing and ranking the
molecules inside the binding pocket. The prediction of the ligand conformation as well as
its position and orientation is usually referred to as pose. Ranking is calculated by a scoring
function, which orders the preferred ligand conformations using force field, empirical, or
knowledge-based approaches, by evaluating the energy of interaction of the ligand-protein
complex. To assess whether the lack of activity of the D-lactam compounds was
exclusively attributable to the reduced reactivity of the D-lactam versus the D-lactone ring,
or whether it was the result of poor accommodation of the molecule into the receptor
pocket, docking simulations were undertaken for rac-3, rac-4, and rac-9. The results
showed that, albeit with slight differences, NH derivatives of the SL-D-lactams series could
dock favorably in the receptor pocket, while the N-Boc derivatives could not. This finding
supports our contention that in order for the germination and D14::LUC degradation data
to be explained, the Boc group must be lost before the ligands reach the catalytic pockets.
On the other hand, the fact that rac-3 was almost inactive can be explained by the high
intrinsic instability of the compound, the half-life time of which (<4 h) is shorter than the
measurement time, independent of the bioassay. Similarly, rac-4 also showed less reliable
poses in D14 than the co-crystallized GR24, again in agreement with its weak activity in
the luciferase bioassay. As a germination inducer; however, rac-4 at 1 μM could attain an
efficiency comparable to GR24, even if its potency was ~10₋fold lower, which was
possibly because of its instability. The enhanced sensitivity towards SLs and their
analogues in the parasitic versus producing host plants (in the picomolar versus micromolar
range) (Toh et al., 2015) could possibly explain this apparent discrepancy. Among the D-
Discussion Chapter 4
212
lactams, rac-9 was designed to resist hydrolysis and this was confirmed by the high stability
of the compound in strong nucleophilic solvents (t1/2 in the range 1000–3000 h, depending
on the solvent). Due to its having very little activity in both the bioassays used, it was we
initially suspected that rac-9 was possibly acting as a SL antagonist. However, a
competition experiment with (+)-GR24 at various concentrations indicated that it did not
possess antagonistic activity, at least under our experimental conditions, although at very
high concentration (100 μM) it behaved as a partial agonist. The docking results for this
compound indicated, as a possible explanation, that the rac-9–D14 complex could be not
stable enough for rac-9 to act as a competitive inhibitor of (+)-GR24.
Docking simulations were done with (+)-GR24 and S-(+)-ABA inside D14 orthologue of
rice D14, AtD14 having rmsd < 0.85 Å. (+)-ABA) is indispensable for many structure
activity based processes in plants like stomatal closure, response to abiotic stresses, seed
dormancy and maturation as reported by (Zhang et al., 2013). Signaling and binding of
ABA in its canonical kinase PYL/PYR receptors follow binding mechanisms that differs
from SLs strikingly (Miyazono et al., 2009). Nonetheless, ABA analogues containing
sulfonamide group have been reported as potential ABA mimics such as pyrabactin and
quinabactin, both are capable to bind with ABA receptors and elicit ABA like responses
(Okamoto et al., 2013). Sulfonamide mimics have also been utilized as SL mimics with
modification of D ring. Thus, it could be inferred that AtD14 though unconventional
receptor, binds ABA within pocket with direct and occasional water meditated H-bonding
with TRP155 residue of catalytic site. The binding poses though less stable, perfectly
superimposed with GR24 and S-(+)-ABA molecule docked well in the catalytic pocket of
AtD14. Currently we are unclear about the possible implications of ABA competitive
binding inside AtD14 pocket are largely unclear. Provided the fact that rice d14 (PDB code
5dj5) is conventionally utilized ins docking studies and that exact structure & activity
mechanism of orthologue AtD14 is not yet confirmed, except that later can hydrolyzed
GR24 but with reduced reactivity as compared to OsD14 (Zhao et al., 2013). More subtle
docking studies will be needed in future to rationalize the concept. These prospective
dynamics of ABA binding with D14 receptor require further validation in the field of in
silico modelling to reveal downstream signaling and cross talk with SLs at receptor level
that could endure results, which could be both exciting and promising.
Discussion Chapter 4
213
Conclusion
In this work, we have presented various methodologies wereare adopted to optimize and
characterize role of SLs as new players in abiotic stress tolerance because of wide focus on
possibility of phytohormones engineering. Our growing knowledge of SLs definitely
require deep insights into SL–-ABA dilemma before it’s possible for improvement of crops
under natural stress conditions. These interactions are key regulators of plant adaptation to
diverse range of stress levels conferred by the plant and are mostly sought to understand
how SLs biosynthesis and regulation is linked to other factors for SL–-regulated
developmental processes. Similarly, plant response to changing environment provides
clues for the adaptation of SL biosynthetic machinery. Overall, still plentitude of
challenges left, to be uncovered. We developed optimized protocols for In Vitro
regeneration protocol was developed for the efficient and reproducible Agrobacterium
mediated gene transformation of tomato cultivar(s) with carotenoid cleavage oxygenase
CCD7 isolated from L. japonicas roots. Genotype, explant type and PGRs were three main
factors that were found critical for regeneration of tomato. Significant differences were
found in regeneration capacity among different cultivars, explant types, callus morphology
and number of shoo primordia. cv. Riogrande was found to have maximum regeneration
capacity (cotyledons & hypocotyls) further selected for somatic embryogenesis to reduce
the regeneration time and frequency. Thereafter, low pH of medium (4.0) and NAA
(2mg/L) was found to induce primary somatic embryogenesis in dark conditions by
formation of rhizoids. For induction of secondary somatic embryos, auxins were removed
from the media and cytokinins TDZ/BAP at various concentration were tested at pH 4.0.
Secondary somatic embryos were induced as novel structures rhizoid tubers which were
evaluated for their embryonic nature and regeneration potential. Unlike typical
organogenesis from callus, these rhizoid tubers (RTBs) spontaneously germinate to new
seedling without any sub culture procedure. Thus, the procedure is not only efficient and
quick but also lot less laborious as compared to conventional organogenesis. Following
Agrobacterium mediated gene transfer; different factors were optimized for CCD7 gene
expression. 2 days precultured cotyledons of one-week-old seedlings were infected with
bacteria having optical density of 0.4–-0.6 at 600 nm, followed by co cultivation of
Agrobacterium in presence of 200 μM acetosyringoneAcetosyringone for 48 hr.
Discussion Chapter 4
214
Transformation frequencies ranged from 35–-44 % in hypocotyls and cotyledons explants
respectively. The event of successful transformation was confirmed via PCR amplification
of CCD7, GFP & LUC genes from regenerated Kanamycinkanamycin resistant leaves of
cv. Riogrande. The transgenic plants were tested for their morphological and
physiochemical performance under drought stress. The phenotypic as well as biochemical
determinants showed that overexpression of CCD7 was responsible for drought stress
hyposensitivity in transgenic tomato. T0 and T1 plants followed Mendelian segregation of
3:1 and found tolerant to water deficit with an enhanced antioxidant enzyme system. In this
study, in vitro regeneration protocols for efficient transfer of traits in tomato wereas We
developed and up scaled novel in vitro regeneration protocol for efficient transfer of traits
in tomato. More focused research on CCD7 mediated abiotic stress response in tomato
under environmental constraints and possible overlap with other regulatory pathways likely
ABA and miRNAs would shed light on spatial and temporal distribution of stress related
hormones in combined and individual stresses. A novel in planta bioassay in Arabidopsis
was developed which is more indirect than a biochemical interaction assay, conveys a
biologically meaningful output, with an acceptable dynamic range, relatively simple to
execute, up-scalable, and robust enough to be exploitable for SAR studies. The assay was
employed to evaluate the biological activity of a class of novel SL analogues,
phytohormones, tomato root exudates and stress hormone ABA. Docking studies
demonstrated that the synthetic molecules fitted perfectly into the D14 receptor pocket
establishing almost the same interactions with the catalytic triad as active SLs. Assuming
that the mode of action of SLs relies on a nucleophilic reaction occurring inside the receptor
onto the butenolide D-ring, the reasons for inactivity of SL-D-lactams can be then ascribed
to the change of the lactone functional group to a lactam, and to the lower reactivity of the
latter to nucleophiles.
SL-ABA dynamics Arabidopsis were also quantified by expression analysis of SLs
biosynthetic genes and ABA stress inducible NCED3 and as expected exogenous
application, significantly upregulated the SL genes with increase in time of exposure to
exogenous ABA as stress signal. The strategies adapted in this work have provided
convincing missing links in the far from complete picture of SL-ABA dynamics in model
Discussion Chapter 4
215
plants tomato and Arabidopsis. Several unanswered gaps and missing links of course
persist, to understand fully the role and cross talk of SL & ABA during combined stress.
In this scenario SL activity readouts via sensitive and quantitative methods, preferably at
single cell level and temporal localization of these complexes through fluorimetery is much
needed to fully acquire knowledge of SL mediated crop management strategies.
Future prospects
1- Evaluation of T1 transgenic plants and seeds with for stable integration events via real time
quantitative PCR and determination of copy number. Screening of phenotypic and
molecular determinants of CCD7 overexpression in T1 plants.
2- Grafting studies on CCD7 overexpressing shoot stock and WT roots to create organ
specific dynamics and evaluation of differential expression of abiotic stress related genes,
transcription factors and specially miRNA155 &156 during quasi state stress conditions.
3- Use of RTBs as explant source for stable transformation procedures and comparison of
transformation and regeneration potential to our conventional procedure.
4- Development of fluorescent read out assay using GFP-D14 complex in tomato for SAR
studies.
References Chapter 5
216
Chapter 5
References
Formatted: Left: 1.56", Right: 1", Width: 8.5", Height:
11"
References Chapter 5
217
References Chapter 5
218
5. References
Abe, S., Sado, A., Tanaka, K., Kisugi, T., Asami, K., Ota, S., Nomura, T. (2014).
Carlactone is converted to carlactonoic acid by MAX1 in Arabidopsis and its methyl
ester can directly interact with AtD14 in vitro. Proceedings of the National Academy
of Sciences of the United States of America. 111(50), 18084–18089.
Abu-El-Heba, G.A., Hussein, G. M., & Abdalla, N.A. (2008). A rapid and efficient tomato
regeneration and transformation system. Landbauforschung Volkenrode. 58(1–2),
103–110.
Aflitos, S., Schijlen, E., de Jong, H., de Ridder, D., Smit, S., Finkers, R., Peters, S. (2014).
Exploring genetic variation in the tomato (Solanum section Lycopersicon) clade by
whole-genome sequencing. The Plant Journal. 80(1), 136–148.
Afroz, A., Chaudhry, Z., Khan, R., Rashid, H., & Khan, S. A. (2009). Effect of GA3 on
regeneration response of three tomato cultivars (Lycopersicon esculentum). Pakistan
Journal of Botany. 41(1), 143–151.
Agusti, J., Herold, S., Schwarz, M., Sanchez, P., Ljung, K., Dun, E. A., Greb, T. (2012).
Strigolactone signaling is required for auxin-dependent stimulation of secondary
growth in plants. Proceedings of the National Academy of Sciences U S A. 109(35),
14277.
Ahsan, N., Lee, S.-H. H., Lee, D.-G. G., Anisuzzaman, M., Alam, M. F., Yoon, H.-S. S.,
Lee, B.-H. H. (2007). The effects of wounding type, preculture, infection method and
cocultivation temperature on the Agrobacterium-mediated gene transfer in tomatoes.
Annals of Applied Biology. 151(3), 363–372.
Ahuja, I., de Vos, R. C. H., Bones, A. M., & Hall, R. D. (2010). Plant molecular stress
responses face climate change. Trends in Plant Science. 15(12), 664–674.
Formatted: Font:
References Chapter 5
219
Formatted: Font: Italic
Ainsworth, E. A., & Gillespie, K. M. (2007). Estimation of total phenolic content and
other oxidation substrates in plant tissues using Folin-Ciocalteu reagent. Nature
Protocols. 2(4), 875–877.
Akin-Idowu, E., P., Ibitoye, O., D., Ademoyegun, & T., O. (2009). Tissue culture as a
plant production technique for horticultural crops. African Journal of Biotechnology.
8(16), 3782–3788.
Al-Babili, S., & Bouwmeester, H. J. (2015a). Strigolactones, a Novel Carotenoid-Derived
Plant Hormone. Annual Review of Plant Biology. 66(1), 161–186.
Aldemita, R., & Hodges, T. (1996). Agrobacterium tumefaciens-mediated transformation
of japonica and indica rice varieties. Planta. 199(4), 612–617.
Alder, A., Jamil, M., Marzorati, M., Bruno, M., Vermathen, M., Bigler, P., Al-Babili, S.
(2012). The Path from β-Carotene to Carlactone, a Strigolactone-Like Plant
Hormone. Science. 335(6074).
Ali, Z., Schumacher, H. M., Heine-Dobbernack, E., El-Banna, A., Hafeez, F. Y.,
Jacobsen, H. J., & Kiesecker, H. (2010). Dicistronic binary vector system-A versatile
tool for gene expression studies in cell cultures and plants. Journal of Biotechnology.
145(1), 9–16.
Andersone, U., & Ievinsh, G. (2008). Medium pH affects regeneration capacity and
oxidative enzyme activity of Pinus sylvestris in tissue culture. Acta Universitatis
Latviensis. 745, 25–35.
Anjum, S.A., Xie, X.Y., Wang, L.C., Saleem, M.F., Chen, M & Wang, L. (2011).
Morphological, physiological and biochemical responses of plants to drought stress.
African Journal of Agricultural Research. .6(9), 2026-2032.
Anne Frary and Elizabeth D. Earle. (1996). An examination of factors affecting the
efficiency of agrobacterium-mediated transformation of tomato. Plant Cell Reports.,
16, 235-240.
References Chapter 5
220
Formatted: Font: Italic
Arc, E., Sechet, J., Corbineau, F., Rajjou, L., & Marion-Poll, A. (2013). ABA crosstalk
with ethylene and nitric oxide in seed dormancy and germination. Frontiers in Plant
Science., 4, 63.
Arite, T., Iwata, H., Ohshima, K., Maekawa, M., Nakajima, M., Kojima, M. Kyozuka, J.
(2007). DWARF10, an RMS1/MAX4/DAD1 ortholog, controls lateral bud
outgrowth in rice. The Plant Journal for Cell and Molecular Biology. , 51(6), 1019–
1029.
Arite, T., Umehara, M., Ishikawa, S., Hanada, A., Maekawa, M., Yamaguchi, S., &
Kyozuka, J. (2009). d14, a strigolactone-insensitive mutant of rice, shows an
accelerated outgrowth of tillers. Plant & Cell Physiology., 50(8), 1416–1424.
Arnon, D. I. (1949). Copper enzymes in isolated chloroplasts. Polyphenoloxidase in beta
vulgaris. Plant Physiology., 24(1), 1–15.
Arshad, W., Haq, I.-U., Waheed, M. T., Mysore, K. S., & Mirza, B. (2014).
Agrobacterium-mediated transformation of tomato with rolB gene results in
enhancement of fruit quality and foliar resistance against fungal pathogens. PLoS
ONE., 9(5), e96979.
Artuso, E., Ghibaudi, E., Lace, B., Marabello, D., Vinciguerra, D., Lombardi, C., Prandi,
C. (2015). Stereochemical Assignment of Strigolactone Analogues Confirms Their
Selective Biological Activity. Journal of Natural Products., 78(11), 2624–2633.
Auldridge, M. E., McCarty, D. R., & Klee, H. J. (2006). Plant carotenoid cleavage
oxygenases and their apocarotenoid products. Current Opinion in Plant Biology. ,
9(3), 315–321.
Baroni, M., Cruciani, G., Sciabola, S., Perruccio, F., & Mason, J. S. (2007). A Common
Reference Framework for Analyzing/Comparing Proteins and Ligands. Fingerprints
for Ligands and Proteins (FLAP): Theory and Application. Journal of Chemical
Information and Modeling., 47(2), 279–294.
References Chapter 5
221
Formatted: Font: Italic
Beauchamp, C., & Fridovich, I. (1971). Superoxide dismutase: Improved assays and an
assay applicable to acrylamide gels. Analytical Biochemistry., 44(1), 276–287.
Behki, R. M., & Lesley, S. M. (1980). Shoot Regeneration from Leaf Callus of
Lycopersicon esculentum. Zeitschrift Für Pflanzenphysiologie., 98(1), 83–87.
Bhatia, P., & Ashwath, N. (2005). Effect of medium pH on shoot regeneration from the
cotyledonary explants of tomato. Biotechnology., 4(1), 7–10.
Bhatia, P., Ashwath, N., & Midmore, D. J. (2005). Effects of genotype, explant
orientation, and wounding on shoot regeneration in tomato. In Vitro Cellular &
Developmental Biology -– Plant., 41(4), 457–464.
Bhatia, P., Ashwath, N., Senaratna, T., & Midmore, D. (2004). Tissue culture studies of
tomato (Lycopersicon esculentum). Plant Cell, Tissue and Organ Culture., 78(1), 1–
21.
Bhattacharya, C., Bonfante, P., Deagostino, A., Kapulnik, Y., Larini, P., Occhiato, E. G.,
Venturello, P. (2009). A new class of conjugated strigolactone analogues with
fluorescent properties: synthesis and biological activity. Organic & Biomolecular
Chemistry. , 7(17), 3413–3420.
Bhau, B. S., & Wakhlu, A. K. (2001). Effect of genotype, explant type and growth
regulators on organogenesis in morus alba. Plant Cell, Tissue and Organ Culture, .
66(1), 25–29.
Birch, R. G. (1997). Plant Transformation: Problems and strategies for practical
application, Annual Review Of Plant Physiology and Plant Molecular BiologyAnnu.
Rev. Plant Physiol. Plant Mol. Biol., 48, 297–326.
Bonneau, L., Huguet, S., Wipf, D., Pauly, N., & Truong, H.-N. (2013). Combined
Phosphate and Nitrogen Limitation Generate A Nutrient Stress Transcriptome
Favorable For Arbuscular Mycorrhizal Symbiosis In Medicago Truncatula. New
Phytologist., 199(1), 188–202.
References Chapter 5
222
Formatted: Font: Italic
Booker, J., Auldridge, M., Wills, S., McCarty, D., Klee, H., & Leyser, O. (2004).
Max3/ccd7 is a carotenoid cleavage dioxygenase required for the synthesis of a novel
plant-signaling molecule. Current Biology., 14(14), 1232–1238.
Booker, J., Sieberer, T., Wright, W., Williamson, L., Willett, B., Stirnberg, P., Leyser, O.
(2005). MAX1 Encodes a Cytochrome P450 Family Member that Acts Downstream
of MAX3/4 to Produce a Carotenoid-Derived Branch-Inhibiting Hormone.
Developmental Cell., 8, 443–449.
Botau, D., Frantescu & A. Darlea M. F. (2002). Indirect regeneration on Lycopersicon
esculentum. Biodiversitate., 10, 57–62.
Boursiac, Y., Léran, S., Corratgé-Faillie, C., Gojon, A., Krouk, G., & Lacombe, B. (2013).
ABA transport and transporters. Trends in Plant Science., 18(6), 325–333.
Boyer, F.-D., de Saint Germain, A., Pillot, J.-P., Pouvreau, J.-B., Chen, V. X., Ramos, S.,
Rameau, C. (2012). Structure-Activity Relationship Studies of Strigolactone-Related
Molecules for Branching Inhibition in Garden Pea: Molecule Design for Shoot
Branching. Plant Physiology., 159(4), 1524–1544.
Brasileiro, A. C. R., Willadino, L., Carvalheira, G. G., & Guerra, M. (1999). Callus
induction and plant regeneration of tomato (Lycopersicon esculentum cv. IPA 5) via
anther culture. Ciência Rural., 29(4), 619–623.
Brewer, P. B., Dun, E. A., Gui, R., Mason, M. G., & Beveridge, C. A. (2015).
Strigolactone Inhibition of Branching Independent of Polar Auxin Transport. Plant
Physiology., 168(4), 1820–1829.
Brewer, P. B., Koltai, H., & Beveridge, C. A. (2013). Diverse Roles of Strigolactones in
Plant Development. Molecular Plant., 6(1), 18–28.
Brewer, P. B., Yoneyama, K., Filardo, F., Meyers, E., Scaffidi, A., Frickey, T., Beveridge,
C. A. (2016). LATERAL BRANCHING OXIDOREDUCTASE acts in the final
References Chapter 5
223
Formatted: Font: Italic
stages of strigolactone biosynthesis in Arabidopsis. Proceedings of the National
Academy of Sciences., 113(22), 6301–6306.
Brothaerts, W., Mitchell, H. J., Weir, B., Kaines, S., Smith, L. M. A., Yang, W., Jefferson,
R. A. (2005). Gene transfer to plants by diverse species of bacteria. Nature.,
433(7026), 629–633.
Bu, Q., Lv, T., Shen, H., Luong, P., Wang, J., Wang, Z., Huq, E. (2014). Regulation of
drought tolerance by the F-box protein MAX2 in arabidopsis. Plant Physiology., 164,
424–439.
Cano, E., & Moreno, V. M. R. (1990). The role of culture medium, explant source and
genotype on callus growth in cultivated and wild tomato species and interspecific
hybrids. Proceedings of the XIth Eucarpia Meeting on Tomato Genetics., 167–172.
Chalfie, M., Tu, Y., Euskirchen, G., Ward, W. W., & Prasher, D. C. (1994). Green
fluorescent protein as a marker for gene expression. Science. , 263(5148), 802–805.
Challis, R. J., Hepworth, J., Mouchel, C., Waites, R., & Leyser, O. (2013). A role for more
axillary growth1 (MAX1) in evolutionary diversity in strigolactone signaling
upstream of MAX2. Plant Physiology., 161(4), 1885–1902.
Chaudhry, Z., Abbas, S., Yasmin, A., Rashid, H., Ahmed, H., & Anjum, M. A. (2010).
Tissue Culture Studies in Tomato (Lycopersicon Esculentum) Var. Moneymaker.
Pakistan Journal of Botany., 42(1), 155–163.
Chaudhry, Z., Afroz, A., & Rashid, H. (2007). Effect of variety and plant growth
regulators on callus proliferation and regeneration response of three tomato cultivars
(Lycopersicon esculentum). Pakistan Journal of Botany., 39(3), 857–869.
Chen, H., Zhang, J., Zhuang, T., Xuebao, G. Z. (1999). Studies on optimum hormone
levels for tomato plant regeneration from hypocotyl explants cultured in vitro, Acta
Agriculturae Shanghai., 15(2), 26–29.
References Chapter 5
224
Formatted: Font: Italic
Chen, L., Xin, X., Yuan, Q., Su, D., & Liu, W. (2014). Phytochemical properties and
antioxidant capacities of various colored berries. Journal of the Science of Food and
Agriculture., 94(2), 180–188.
Cheng, M., Hsi, D. C. H., & Phillips, G. C. (1994). Recovery of Primary Transformants
of Valencia-type Peanut Using Agrobacterium tumefaciens 1. Peanut Science.,
21(2), 84–88.
Chevalier, F., Nieminen, K., Sánchez-Ferrero, J. C., Rodríguez, M. L., Chagoyen, M.,
Hardtke, C. S., & Cubas, P. (2014). Strigolactone promotes degradation of
DWARF14, an α/β hydrolase essential for strigolactone signaling in Arabidopsis.
The Plant Cell., 26(3), 1134–1150.
Chyi, Y. S., & Phillips, G. C. (1987). High efficiency Agrobacterium-mediated
transformation of Lycopersicon based on conditions favorable for regeneration.
Plant Cell Reports., 6(2), 105–108.
Cohen, M., Prandi, C., Occhiato, E. G., Tabasso, S., Wininger, S., Resnick, N., Kapulnik,
Y. (2013). Structure–Function Relations of Strigolactone Analogs: Activity as Plant
Hormones and Plant Interactions. Molecular Plant., 6(1), 141–152.
Compton, M. E., & Veilleux, R. E. (1991). Shoot, root and flower morphogenesis on
tomato inflorescence explants. Plant Cell, Tissue and Organ Culture., 24(3), 223–
231.
Cortina, C., & Culi, F. A. (2004). Tomato Transformation and Transgenic Plant
Production. Plant Cell, Tissue and Organ Culture., 76, 269–275.
Costa, G. M., Nogueira, F. T. S., Agrotecnologia, W. C. O. (2000). In vitro regeneration
of processing tomato (Lycopersicon esculentum Mill.)’IPA-5’and’IPA-6’. Cienc. e
Agrotecnologia., 24, 671–678.
Costa, Miguel; Huevelink, E. (2007). Today’s worldwide tomato production.
International Suppliers Guide., (January), 2006–2008.
References Chapter 5
225
Formatted: Font: Italic
Crossway, A., Oakes, J. V., Irvine, J. M., Ward, B., Knauf, V. C., & Shewmaker, C. K.
(1986). Integration of foreign DNA following microinjection of tobacco mesophyll
protoplasts. MGG Molecular & General Genetics., 202(2), 179–185.
Cruz de Carvalho, M. H. (2008). Drought stress and reactive oxygen species. Plant
Signaling & Behavior., 3(3), 156–165.
da Silva, G. J., & Costa de Oliveira, A. (2014). Genes Acting on Transcriptional Control
during Abiotic Stress Responses. Advances in Agriculture., 2014, 1–7.
Davies, W. J., Wilkinson, S., & Loveys, B. (2002). Stomatal control by chemical
signalling and the exploitation of this mechanism to increase water use efficiency in
agriculture. New Phytologist., 153(3), 449–460.
De Cuyper, C., Fromentin, J., Yocgo, R. E., De Keyser, A., Guillotin, B., Kunert, K., …
Goormachtig, S. (2015). From lateral root density to nodule number, the
strigolactone analogue GR24 shapes the root architecture of Medicago truncatula.
Journal of Experimental Botany., 66(1), 137–146.
De Groot, F. M. H., Van Berkom, L. W. A., & Scheeren, H. W. (2000). Synthesis and
biological evaluation of 2’-carbamate-linked and 2’-carbonate-linked prodrugs of
paclitaxel selective activation by the tumor-associated protease plasmin. Journal of
Medicinal Chemistry., 43(16), 3093–3102.
Devi, R., Dhaliwal, M. S., Kaur, A., & Gosal, S. S. (2008). Effect of growth regulators on
in vitro morphogenic response of tomato. Indian Journal of Biotechnology., 7(4),
526–530.
Dewanto, V., Wu, X., Adom, K. K., & Liu, R. H. (2002). Thermal processing enhances
the nutritional value of tomatoes by increasing total antioxidant activity. Journal of
Agricultural and Food Chemistry., 50(10), 3010–3014.
Dor, E., Yoneyama, K., Wininger, S., Kapulnik, Y., Yoneyama, K., Koltai, H.,
Hershenhorn, J. (2011). Strigolactone deficiency confers resistance in tomato line
References Chapter 5
226
Formatted: Font: Italic
SL-ORT1 to the parasitic weeds Phelipanche and Orobanche spp. Phytopathology.,
101(2), 213–222.
Doyle, J. (1991). DNA Protocols for Plants. In Molecular Techniques in Taxonomy (pp.
283–293). Berlin, Heidelberg: Springer Berlin Heidelberg.
Dubois, T., Guedira, M., Dubois, J., & Vasseur, J. (1990). Direct Somatic Embryogenesis
in Roots of Cichorium: Is Callose an Early Marker, Annals of BotanyAnn. Bot. ,
65(5), 539–545.
Dun, E. A., Brewer, P. B., & Beveridge, C. A. (2009). Strigolactones: discovery of the
elusive shoot branching hormone. Trends in Plant Science., 14(7), 364–372.
Durzan, D. (1984). Special problems: Adult vs juvenile explants. Handbook of Plant Cell
Culture, Vol. 2. W. R. Sharp, D. A. Evans, P. V. Ammirato, and Y. Yamada (Eds.).
MacMillan Publ. Co., NY., 2, 471–503.
Egea, I., Albaladejo, I., Meco, V., Morales, B., Sevilla, A., Bolarin, M. C., & Flores, F.
B. (2018). The drought-tolerant Solanum pennellii regulates leaf water loss and
induces genes involved in amino acid and ethylene/jasmonate metabolism under
dehydration. Scientific Reports., 8(1), 2791.
Egea, I., Albaladejo, I., Meco, V., Morales, B., Sevilla, A., Bolarin, M. C., & Flores, F.
B. (2018). The drought-tolerant Solanum pennellii regulates leaf water loss and
induces genes involved in amino acid and ethylene/jasmonate metabolism under
dehydration. Scientific Reports., 8(1), 2791.
Ellul, P., Garcia-Sogo, B., Pineda, B., Ríos, G., Roig, L., & Moreno, V. (2003). The ploidy
level of transgenic plants in Agrobacterium-mediated transformation of tomato
cotyledons (Lycopersicon esculentum L.Mill.) is genotype and procedure dependent.
Theoretical and Applied Genetics., 106(2), 231–238.
References Chapter 5
227
Formatted: Font: Italic
Khan, N. A., Nazar, R., Iqbal, N., and Anjum, N. A. (2012). Phytohormones and abiotic
stress tolerance in plants. Springer-Verlag Berlin Heidelberg.Springer
642-25829-9
Eyidogan, F., Oz, M. T., Yucel, M., & Oktem, H. a. (2012). Phytohormones and Abiotic
Stress Tolerance in Plants. Phytohormones and Abiotic Stress Tolerance in Plants.
Springer. https://doi.org/10.1007/978-3-642-25829-9
Fillatti, J. J., Kiser, J., Rose, R., & Comai, L. (1987). Efficient Transfer of a Glyphosate
Tolerance Gene into Tomato Using a Binary Agrobacterium Tumefaciens Vector.
Nature Biotechnology., 5, 726–730.
Fischlin, A., Midgley, G., Price, J., Leemans, R., Gopal, B., Turley, C., Velichko, A.
(2007). Ecosystems their properties goods and services. Climate Change 2007:
Impacts Adaptation and Vulnerability. Contribution of Working Group II to the
Fourth Assessment Report of the Intergovernmental Panel on Climate Change M.L.
Parry O.F. Canziani J.P. Palutikof P.J. van der Linden and C.E. Hanson Eds.
Cambridge University Press Cambridge.
Flematti, G. G. R., Scaffidi, A., Waters, M. T. M., & Smith, S. S. M. (2016).
Stereospecificity in strigolactone biosynthesis and perception. Planta., 243(6), 1361–
1373.
Fontanelli, M., Raffaelli, M., Martelloni, L., Frasconi, C., Ginanni, M., & Peruzzi, A.
(2013). The influence of non-living mulch, mechanical and thermal treatments on
weed population and yield of rainfed fresh-market tomato (Solanum lycopersicum
L.). Spanish Journal of Agricultural Research., 11(3), 593.
Foo, E., Ferguson, B. J., & Reid, J. B. (2014). The potential roles of strigolactones and
brassinosteroids in the autoregulation of nodulation pathway. Annals of Botany.,
113(6), 1037–1045.
References Chapter 5
228
Formatted: Font: Italic
Foolad, M. R., Subbiah, P., & Zhang, L. (2007). Common QTL affect the rate of tomato
seed germination under different stress and nonstress conditions. International
Journal of Plant Genomics., 2007, 97386.
Frary, A, Nesbitt, T. C., Grandillo, S., Knaap, E., Cong, B., Liu, J., Tanksley, S. D. (2000).
fw2.2: a quantitative trait locus key to the evolution of tomato fruit size. Science
(New York, N.Y.)., 289(5476), 85–88.
Frary, Anne, & Van Eck, J. (2005). Organogenesis from Transformed Tomato Explants.
In Transgenic Plants (pp. 141–150). New Jersey: Humana Press.
https://doi.org/10.1385/1-59259-827-7:141
Fujita, Y., Fujita, M., Shinozaki, K., & Yamaguchi-Shinozaki, K. (2011). ABA-mediated
transcriptional regulation in response to osmotic stress in plants. Journal of Plant
Research., 124(4), 509–525.
Fukui, K., Ito, S., Ueno, K., Yamaguchi, S., Kyozuka, J., & Asami, T. (2011). New
branching inhibitors and their potential as strigolactone mimics in rice. Bioorganic
and Medicinal Chemistry Letters., 21(16), 4905–4908.
Gao, N., Shen, W., Cao, Y., Su, Y., & Shi, W. (2009). Influence of bacterial density during
preculture on Agrobacterium-mediated transformation of tomato. Plant Cell, Tissue
and Organ Culture (PCTOC)., 98(3), 321–330.
Gelvin, S. B. (2010). Plant Proteins Involved in Agrobacterium -Mediated Genetic
Transformation. Annual Review of Phytopathology., 48(1), 45–68.
Gomez-Roldan, V., Fermas, S., Brewer, P. B., Puech-Pagès, V., Dun, E. A., Pillot, J. P.,
Rochange, S. F. (2008). Strigolactone inhibition of shoot branching. Nature.,
455(7210), 189–194.
Gonzalez-Perez, S., Gutierrez, J., Garcia-Garcia, F., Osuna, D., Dopazo, J., Lorenzo, O.,
Arellano, J. B. (2011). Early Transcriptional Defense Responses in Arabidopsis Cell
References Chapter 5
229
Formatted: Font: Italic
Suspension Culture under High-Light Conditions. Plant Physiology., 156(3), 1439–
1456.
Gow, W. P., Chen, J. T., & Chang, W. C. (2009). Effects of genotype, light regime, explant
position and orientation on direct somatic embryogenesis from leaf explants of
Phalaenopsis orchids. Acta Physiologiae Plantarum., 31(2), 363–369.
Grossert, J. S., Pippione, A. C., Boschi, D., Lolli, M. L., & White, R. L. (2015).
Heterocyclic ring cleavage upon collision-induced dissociation of deprotonated 3-
hydroxy-1,2,5-oxadiazoles (3-hydroxyfurazans). Journal of Mass Spectrometry.,
50(12), 1433–1437.
Gubis, J. Lajchova, Z. Farago, J. Jurekova, Z. (2003). Effect of Genotype and Explant
Type on Shoot Regeneration in Tomato (Lycopersicon esculentum Mill ). In Vitro.,
(1), 9–14.
Gubiš, J., Lajchová, Z., & Klčová, L. (2018). The effect of carbon source on plant
regeneration in tomato. Horticultural Science., 32(No. 1), 6–8.
Gubiš, J., Lajchová, Z., Faragó, J., & Jureková, Z. (2004). Effect of growth regulators on
shoot induction and plant regeneration in tomato (Lycopersicon esculentum Mill.).
Biologia - Section Cellular and Molecular Biology., 59(3), 405–408.
Guo, M., Zhang, Y. L., Meng, Z. J., & Jiang, J. (2012). Optimization of factors affecting
Agrobacterium-mediated transformation of Micro-Tom tomatoes. Genetics and
Molecular Research: GMR., 11(1), 661–671.
H D Sherkar and A M Chavan. (2014). Studies on callus induction and shoot regeneration
in Tomato. Science Research Reporter., 4(1), 89–93.
Ha, C. Van, Leyva-González, M. A., Osakabe, Y., Tran, U. T., Nishiyama, R., Watanabe,
Y., Tran, L.-S. P. (2014). Positive regulatory role of strigolactone in plant responses
to drought and salt stress. Proceedings of the National Academy of Sciences of the
United States of America., 111(2), 851–856.
References Chapter 5
230
Formatted: Font: Italic
Halouzka, R., Tarkowski, P., Zwanenburg, B., & Ćavar Zeljković, S. (2018). Stability of
strigolactone analog GR24 toward nucleophiles. Pest Management Science., 74(4),
896–904.
Hamiaux, C., Drummond, R. S. M., Janssen, B. J., Ledger, S. E., Cooney, J. M.,
Newcomb, R. D., & Snowden, K. C. (2012). DAD2 Is an α/β Hydrolase Likely to Be
Involved in the Perception of the Plant Branching Hormone, Strigolactone. Current
Biology (Vol. 22).
Hamza, S, & Chupeau, Y. (1993). Re-evaluation of conditions for plant regeneration and
Agrobacterium -mediated transformation from tomato (Lycopersicum esculentum ).
Journal of Experimental Botany., 44(269), 1837–1845.
Hanafy Ahmed A. H, Mahmoud M. S. & Doaa. H. A. (2015). Agrobacterium-Mediated
Transformation of Super Strain B and Rio Grande Tomato Cultivars Using Gv3101
Binary Vector Harboring Ptdins-Plc2 Gene. International Journal of Bio-Technology
and Research (IJBTR)., 5(1), 11–22.
Hellens, R. P., Edwards, E. A., Leyland, N. R., Bean, S., & Mullineaux, P. M. (2000).
pGreen: a versatile and flexible binary Ti vector for Agrobacterium-mediated plant
transformation. Plant Molecular Biology., 42(6), 819–832.
Hood, E. E., Gelvin, S. B., Melchers, L. S., and Hoekema, A. (1993). New Agrobacterium
helper plasmids for gene transfer to plants. Transgenic Research., 2: 208-218
Hooykaas, P. J. J. (2010). Plant Transformation. Encyclopedia of Life Sciences, 286, 1–6.
Horsch, R. B., Fry, J. E., Hoffmann, N. L., Eichholtz, D., Rogers, S. G., & Fraley, R. T.
(1985). A Simple and General Method for Transferring Genes into Plants. Science.,
227(4691), 1229–1231.
Hu, W., & Phillips, G. C. (2001). A combination of overgrowth-control antibiotics
improves Agrobacterium tumefaciens-mediated transformation efficiency for
References Chapter 5
231
Formatted: Font: Italic
cultivated tomato (L. esculentum). In Vitro Cellular & Developmental Biology-
Plant., 37(1), 12–18.
Hutchinson, M. J., Murch, S. J., & Saxena, P. K. (1996). Morphoregulatory role of
thidiazuron: Evidence of the involvement of endogenous auxin in thidiazuron-
induced somatic embryogenesis of geranium (Pelargonium x hortorum Bailey).
Journal of Plant Physiology., 149(5), 573–579.
Hutchinson, Margaret J., & Saxena, P. K. (1996). Acetylsalicylic acid enhances and
synchronizes thidiazuron-induced somatic embryogenesis in geranium (Pelargonium
× hortorum Bailey) tissue cultures. Plant Cell Reports., 15(7), 512–515.
Ijaz, R., Ejaz, J., Gao, S., Liu, T., Imtiaz, M., Ye, Z., & Wang, T. (2017). Overexpression
of annexin gene AnnSp2, enhances drought and salt tolerance through modulation of
ABA synthesis and scavenging ROS in tomato. Scientific Reports., 7(1), 12087.
Ishfaq, M., Nasir, I. A., Mahmood, N., & Saleem, M. (2012). In vitro induction of
mutation in tomato (Lycopersicon esculentum L.) cv. Roma by using chemical
mutagens. Pakistan Journal of Botany., 44(SPL.ISS.1), 311–314.
Jabeen, N., Mirza, B., Chaudhary, Z., Rashid, H., & Gulfraz, M. (2009). Study of the
factors affecting Agrobacterium mediated gene transformation in tomato
(Lycopersicon esculentum Mill.) cv. Riogrande using rice chitinase (cht-3) gene.
Pakistan Journal of Botany., 41(5), 2605–2614.
Jamil, M., Kountche, B. A., Haider, I., Guo, X., Ntui, V. O., Jia, K.-P., Al-Babili, S.
(2018). Methyl phenlactonoates are efficient strigolactone analogs with simple
structure. Journal of Experimental Botany., 69(9), 2319–2331.
Janssen, B. J., & Snowden, K. C. (2012). Strigolactone and karrikin signal perception:
receptors, enzymes, or both. Frontiers in Plant Science., 3, 296.
References Chapter 5
232
Formatted: Font: Italic
Jefferson, R. A., Kavanagh, T. A., & Bevan, M. W. (1987). GUS fusions: beta-
glucuronidase as a sensitive and versatile gene fusion marker in higher plants. The
EMBO Journal., 6(13), 3901–3907.
Jehan, S., & Hassanein, A. M. (2013). Hormonal Requirements Trigger Different
Organogenic Pathways on Tomato Nodal Explants. American Journal of Plant
Sciences., 04(11), 2118–2125.
Jia, K.-P., Luo, Q., He, S.-B., Lu, X.-D., & Yang, H.-Q. (2014). Strigolactone-Regulated
Hypocotyl Elongation Is Dependent on Cryptochrome and Phytochrome Signaling
Pathways in Arabidopsis. Molecular Plant., 7(3), 528–540.
Jiang, L., Liu, X., Xiong, G., Liu, H., Chen, F., Wang, L., Li, J. (2013). DWARF 53 acts
as a repressor of strigolactone signalling in rice. Nature., 504(7480), 401–405.
Jiménez, V. M. (2001). Regulation of in vitro somatic embryogenesis with emphasis on
the role of endogenous hormones. Revista Brasileira de Fisiologia Vegetal., 13(2),
196–223.
Jiménez-Antaño, J. M., Pérez-Vargas, J., Ariza-Castolo, A., Guzmán, O. G., & Calva, G.
C. (2018). An efficient heat-shock protocol for transformation of Agrobacterium
rhizogenes without spontaneous generation to antibiotic resistance. Plant OMICS.,
11(1), 20–29.
Juan, J. X., Yu, X. H., Jiang, X. M., Gao, Z., Zhang, Y., Li, W., Yang, G. (2015).
Agrobacterium-mediated transformation of tomato with the ICE1 transcription factor
gene. Genetics and Molecular Research., 14(1), 597–608.
Junglee, S., Urban, L., Sallanon, H., & Lopez-Lauri, F. (2014). Optimized Assay for
Hydrogen Peroxide Determination in Plant Tissue Using Potassium Iodide.
American Journal of Analytical Chemistry., 05(11), 730–736.
Kagiyama, M., Hirano, Y., Mori, T., Kim, S.-Y., Kyozuka, J., Seto, Y., Hakoshima, T.
(2013). Structures of D14 and D14L in the strigolactone and karrikin signaling
References Chapter 5
233
Formatted: Font: Italic
pathways. Genes to Cells Devoted to Molecular & Cellular Mechanisms., 18(2),
147–160.
Kannan, C., & Zwanenburg, B. (2014). A novel concept for the control of parasitic weeds
by decomposing germination stimulants prior to action. Crop Protection., 61, 11–15.
Kapulnik, Y., Resnick, N., Mayzlish-Gati, E., Kaplan, Y., Wininger, S., Hershenhorn, J.,
& Koltai, H. (2011). Strigolactones interact with ethylene and auxin in regulating
root-hair elongation in Arabidopsis. Journal of Experimental Botany., 62(8), 2915–
2924.
Kartha, K. K., Gamborg, O. L., Shyluk, J. P., & Constabel, F. (1976). Morphogenetic
Investigations on in vitro Leaf Culture of Tomato (Lycopersicon esculentum Mill.
cv. Starfire) and high Frequency Plant Regeneration. Zeitschrift Für
Pflanzenphysiologie., 77(4), 292–301.
Kaya, C., & Higgs, D. (2003). Supplementary potassium nitrate improves salt tolerance
in bell pepper plants. Journal of Plant Nutrition., 26(7), 1367–1382.
Khokhar, K. M., & HRI, N. (2013). Present status and prospects of tomatoes in Pakistan.
Agricultural Corner-Farmers to Global Market. Repot, 1–21. /
Kissoudis, C., Sunarti, S., van de Wiel, C., Visser, R. G. F., van der Linden, C. G., & Bai,
Y. (2016). Responses to combined abiotic and biotic stress in tomato are governed
by stress intensity and resistance mechanism. Journal of Experimental Botany.,
67(17), 5119–5132.
Klein, T. M., Wolf, E. D., Wu, R., & Sanford, J. C. (1987). High-velocity microprojectiles
for delivering nucleic acids into living cells. Nature., 327(6117), 70–73.
Klerk, G. J. De, Krieken, W. M. Van Der, & Jong, J. C. De. (1999). The formation of
adventitious roots; new concepts, new possibilities. In Vitro Cellular and
Developmental Biology -– Plant., 35, 189–199.
References Chapter 5
234
Formatted: Font: Italic
Kobayashi, M., Nagasaki, H., Garcia, V., Just, D., Bres, C., Mauxion, J.-P., Aoki, K.
(2014). Genome-Wide Analysis of Intraspecific DNA Polymorphism in ‘Micro-
Tom’, a Model Cultivar of Tomato (Solanum lycopersicum). Plant and Cell
Physiology., 55(2), 445–454.
Koenig, D., Jimenez-Gomez, J. M., Kimura, S., Fulop, D., Chitwood, D. H., Headland, L.
R., Maloof, J. N. (2013). Comparative transcriptomics reveals patterns of selection
in domesticated and wild tomato. Proceedings of the National Academy of Sciences.,
110(28), E2655–E2662.
Kohlen, W., Charnikhova, T., Bours, R., López-Ráez, J. A., & Bouwmeester, H. (2013).
Tomato strigolactones: a more detailed look. Plant Signaling & Behavior., 8(1),
e22785.
Ku, Y. S., Sintaha, M., Cheung, M. Y., & Lam, H. M. (2018). Plant hormone signaling
crosstalks between biotic and abiotic stress responses. International Journal of
Molecular Sciences., 19(10).
Kumar, S., Sandhir, R., & Ojha, S. (2014). Evaluation of antioxidant activity and total
phenol in different varieties of Lantana camara leaves. BMC Research Notes., 7(1),
560.
Kurtz, S.M. Lineberger, R. D. (1983). Genotypic differences in morphogenic capacity of
cultured leaf explants of tomato [Lycopersicon esculentum]. American Society for
Horticultural Science (USA)., 108:710–714.
Lace, B., & Prandi, C. (2016). Shaping Small Bioactive Molecules to Untangle Their
Biological Function: A Focus on Fluorescent Plant Hormones. Molecular Plant. ,
9(8), 1099–1118.
Larkin, P. J., & Scowcroft, W. R. (1981). Somaclonal variation — a novel source of
variability from cell cultures for plant improvement. Theoretical and Applied
Genetics., 60(4), 197–214.
References Chapter 5
235
Formatted: Font: Italic
Lee, L.-Y., & Gelvin, S. B. (2008). T-DNA binary vectors and systems. Plant Physiology.,
146(2), 325–332.
Li, S. M., Hua, G. G., Liu, H. X., & Guo, J. H. (2008). Analysis of defence enzymes
induced by antagonistic bacterium Bacillus subtilis strain AR12 towards Ralstonia
solanacearum in tomato. Annals of Microbiology., 58(4), 573–578.
Li, S. M., Hua, G. G., Liu, H. X., & Guo, J. H. (2008). Analysis of defence enzymes
induced by antagonistic bacterium Bacillus subtilis strain AR12 towards Ralstonia
solanacearum in tomato. Annals of Microbiology., 58(4), 573–578.
Li, W., Tran, L.-S. S. P. (2015). Are karrikins involved in plant abiotic stress responses?
Trends in Plant Science., 20(9), 535–538.
Lim, M. Y., Jeong, B. R., Jung, M., & Harn, C. H. (2016). Transgenic tomato plants
expressing strawberry d-galacturonic acid reductase gene display enhanced tolerance
to abiotic stresses. Plant Biotechnology Reports. Plant Biotechnol. Rep, 10(2), 105–
116.
Lin, T., Zhu, G., Zhang, J., Xu, X., Yu, Q., Zheng, Z., Huang, S. (2014). Genomic analyses
provide insights into the history of tomato breeding. Nature Genetics., 46(11), 1220–
1226.
Ling, H. Q., Kriseleit, D., & Ganal, M. W. (1998). Effect of ticarcillin/potassium
clavulanate on callus growth and shoot regeneration in Agrobacterium-mediated
transformation of tomato (Lycopersicon esculentum Mill.). Plant Cell Reports.,
17(11), 843–847.
Liu, J., He, H., Vitali, M., Visentin, I., Charnikhova, T., Haider, I., Cardinale, F. (2015).
Osmotic stress represses strigolactone biosynthesis in Lotus japonicus roots:
exploring the interaction between strigolactones and ABA under abiotic stress.
Planta., 241(6), 1435–1451.
References Chapter 5
236
Formatted: Font: Italic
Liu, J., Lovisolo, C., Schubert, A., & Cardinale, F. (2013). Signaling role of Strigolactones
at the interface between plants, (micro)organisms, and a changing environment.
Journal of Plant Interactions., 8(1), 17–33.
Liu, J., Novero, M., Charnikhova, T., Ferrandino, A., Schubert, A., Ruyter-Spira, C.,
Cardinale, F. (2013). Carotenoid cleavage dioxygenase 7 modulates plant growth,
reproduction, senescence, and determinate nodulation in the model legume Lotus
japonicus. Journal of Experimental Botany., 64(7), 1967–1981.
Livak, K. J., & Schmittgen, T. D. (2001). Analysis of relative gene expression data using
real-time quantitative PCR and the 2-ΔΔCT method. Methods., 25(4), 402–408.
Liza, L. N., Zinnah, K.M.A., Chowdhury Md. Al Nayem., & Ashrafuzzaman, M. (2013).
In Vitro Growth Media Effect for Regeneration of Tomato (Lycopersicon
esculentum ) and Evaluation of the Salt Tolerance Activity of Callus. Journal of
Agriculture and Sustainability., 3(2), 132–143.
Lobell, D. B., Schlenker, W., & Costa-Roberts, J. (2011). Climate trends and global crop
production since 1980 - Supporting Online Material. Science., 333(6042), 616–620.
Lombardi, C., Artuso, E., Grandi, E., Lolli, M., Spirakys, F., Priola, E., & Prandi, C.
(2017). Recent advances in the synthesis of analogues of phytohormones
strigolactones with ring-closing metathesis as a key step. Organic & Biomolecular
Chemistry., 15(38), 8218–8231.
Lombardi, C., Artuso, E., Grandi, E., Lolli, M., Spyrakis, F., Priola, E., & Prandi, C.
(2017). Recent advances in the synthesis of analogues of phytohormones
strigolactones with ring-closing metathesis as a key step. Organic & Biomolecular
Chemistry, 15(38), 8218–8231.
López, J. R., Moreno, C. R., Cruz-mendı, A., Rivera-lo, J., Lo, M., & Herna, S. (2011). A
Simple and Efficient Protocol for Plant Regeneration and Genetic Transformation of
Tomato cv. Micro-Tom from Leaf Explants. HortScience., 46(12), 1655–1660.
References Chapter 5
237
Formatted: Font: Italic
López-Ráez, Juan A. (2016). How drought and salinity affect arbuscular mycorrhizal
symbiosis and strigolactone biosynthesis? Planta., 243(6), 1375–1385.
López-Ráez, Juan A., Kohlen, W., Charnikhova, T., Mulder, P., Undas, A. K., Sergeant,
M. J., Bouwmeester, H. (2010). Does abscisic acid affect strigolactone biosynthesis?
New Phytologist., 187(2), 343–354.
López-Ráez, Juan Antonio, & Bouwmeester, H. (2008). Fine-tuning regulation of
strigolactone biosynthesis under phosphate starvation. Plant Signaling & Behavior.,
3(11), 963–965.
López-Ráez, Juan Antonio, Charnikhova, T., Gómez-Roldán, V., Matusova, R., Kohlen,
W., De Vos, R., Bouwmeester, H. (2008). Tomato strigolactones are derived from
carotenoids and their biosynthesis is promoted by phosphate starvation. New
Phytologist., 178(4), 863–874.
Lumba, S., Holbrook-Smith, D., & McCourt, P. (2017). The perception of strigolactones
in vascular plants. Nature Chemical Biology., 13(6), 599–606.
Ma, J., Liu, T., & Qiu, D. (2015). Optimization of Agrobacterium-mediated
transformation conditions for tomato (Solanum lycopersicum L.). Plant OMICS.,
8(6), 529–536.
Manzi, M., Lado, J., Rodrigo, M. J., Zacarías, L., Arbona, V., & Gómez-Cadenas, A.
(2015). Root ABA Accumulation in Long-Term Water-Stressed Plants is Sustained
by Hormone Transport from Aerial Organs. Plant and Cell Physiology., 56(12),
2457–2466.
Marzec, M. (2016). Perception and Signaling of Strigolactones. Frontiers in Plant
Science., 7, 1260.
Marzec, M., Muszynska, A., & Gruszka, D. (2013). The role of strigolactones in nutrient-
stress responses in plants. International Journal of Molecular Sciences., 14(5), 9286–
9304.
References Chapter 5
238
Formatted: Font: Italic
Mathews, H., Clendennen, S. K., Caldwell, C. G., Liu, X. L., Connors, K., Matheis, N.,
Wagner, D. R. (2003). Activation tagging in tomato identifies a transcriptional
regulator of anthocyanin biosynthesis, modification, and transport. The Plant Cell.,
15 (8), 689–1703.
Matsukura, C., Aoki, K., Fukuda, N., Mizoguchi, T., Asamizu, E., Saito, T., Ezura, H.
(2008). Comprehensive Resources for Tomato Functional Genomics Based on the
Miniature Model Tomato Micro-Tom. Current Genomics., 9(7), 436–443.
Matusova, R., Rani, K., Verstappen, F. W. A., Franssen, M. C. R., Beale, M. H., &
Bouwmeester, H. J. (2005). The strigolactone germination stimulants of the plant-
parasitic Striga and Orobanche spp. are derived from the carotenoid pathway. Plant
Physiology., 139(2), 920–934.
Mayzlish-Gati, E., Laufer, D., Grivas, C. F., Shaknof, J., Sananes, A., Bier, A., Koltai, H.
(2015). Strigolactone analogs act as new anti-cancer agents in inhibition of breast
cancer in xenograft model. Cancer Biology and Therapy., 16(11), 1682–1688.
McCormick, Sheila, Niedermeyer, J., Fry, J., Barnason, A., Horsch, R., & Fraley, R.
(1986). Leaf disc transformation of cultivated tomato (L. esculentum) using
Agrobacterium tumefaciens. Plant Cell Reports., 5(2), 81–84.
McCormick, Shiela. (1991). Transformation of tomato with Agrobacterium tumifaciens.
In Plant Tissue Culture Manual., b6, 311-319.
McCourt, P., Lumba, S., & Bunsick, M. (2017). Chemical genetics and strigolactone
perception. F1000Research., 6, 975.
Méndez-Hernández, H. A., Ledezma-Rodríguez, M., Avilez-Montalvo, R. N., Juárez-
Gómez, Y. L., Skeete, A., Avilez-Montalvo, J., Loyola-Vargas, V. M. (2019).
Signaling Overview of Plant Somatic Embryogenesis. Frontiers in Plant Science.,
10, 77.
References Chapter 5
239
Formatted: Font: Italic
Meng, X.-Y., Zhang, H.-X., Mezei, M., & Cui, M. (2011). Molecular docking: a powerful
approach for structure-based drug discovery. Current Computer-Aided Drug
Design., 7(2), 146–157.
Min, Z., Li, R., Chen, L., Zhang, Y., Li, Z., Liu, M., Fang, Y. (2019). Alleviation of
drought stress in grapevine by foliar-applied strigolactones. Plant Physiology and
Biochemistry., 135, 99–110.
Mirghis, E., Mirghis, R., & Lãcãtus, V. (1995). Analysis of tomato cultivares and hybrids
for in vitro calus formation and regeneration. Acta Horticulturae., 412, 111–116.
Mitchell, J. P., Shennan, C., & Grattan, S. R. (1991). Developmental changes in tomato
fruit composition in response to water deficit and salinity. Physiologia Plantarum.,
83(1), 177–185.
Mittler, R. (2006). Abiotic stress, the field environment and stress combination. Trends in
Plant Science., 11(1), 15–19.
Mittova, V., Tal, M., Volokita, M., & Guy, M. (2002). Salt stress induces up-regulation
of an efficient chloroplast antioxidant system in the salt-tolerant wild tomato species
Lycopersicon pennellii but not in the cultivated species. Physiologia Plantarum.,
115(3), 393–400.
Miyazono, K., Miyakawa, T., Sawano, Y., Kubota, K., Kang, H.-J., Asano, A., Tanokura,
M. (2009). Structural basis of abscisic acid signalling. Nature., 462(7273), 609–614.
Moghaieb, R. E. A., Saneoka, H., & Fujita, K. (1999). Plant regeneration from hypocotyl
and cotyledon explant of tomato (Lycopersicon esculentum Mill.). Soil Science and
Plant Nutrition., 45(3), 639–646.
Morris, S. E., Turnbull, C. G., Murfet, I. C., & Beveridge, C. A. (2001). Mutational
analysis of branching in pea. Evidence that Rms1 and Rms5 regulate the same novel
signal. Plant Physiology., 126(3), 1205–1213.
References Chapter 5
240
Formatted: Font: Italic
Morrison, R. A., Whitaker, R. J., & Evans, D. A. Somaclonal Variation: Its Genetic Basis
and Prospects for Crop Improvement. In, Opportunities for Phytochemistry in Plant
Biotechnology. Recent Advances in Phytochemistry (Proceedings of the
Phytochemical Society of North America), Conn E.E. (eds). Springer, Boston, MA.,
pp. 1-18 (1988).
Mouchel, C. F., & Leyser, O. (2007). Novel phytohormones involved in long-range
signaling. Current Opinion in Plant Biology., 10(5), 473–476.
Munné-Bosch, S., & Alegre, L. (2000). Changes in carotenoids, tocopherols and
diterpenes during drought and recovery, and the biological significance of
chlorophyll loss in Rosmarinus officinalis plants. Planta., 210(6), 925–931.
Murashige, T., & Skoog, F. (1962). A Revised Medium for Rapid Growth and Bioassays
with Tobacco Tissue Cultures. Physiologia Plantarum. , 15(3), 473–497.
Murray, S.L., R. Janse van Vuuren and D.K. Berger, R. (1998). Tomato transformation is
influenced by acetosyringone and Agrobacterium tumefaciens cell density. Journal
of the Southern African Society for Horticultural Sciences.J. Southern Afr. Soc.
Hortic. Sci., 8, 60–64.
Mwakaboko, A. S., & Zwanenburg, B. (2016). Strigolactone Analogues with a D-Ring
Modified at C-2. European Journal of Organic Chemistry., 21, 3495–3499.
Nahar, K., & Gretzmacher, R. (2011). Response of Shoot and Root Development of Seven
Tomato Cultivars in Hydrophonic System under Water Stress. Academic Journal of
Plant Sciences., 4(2), 57–63.
Naik, P. M., Manohar, S. H., Praveen, N., & Murthy, H. N. (2010). Effects of sucrose and
pH levels on in vitro shoot regeneration from leaf explants of Bacopa monnieri and
accumulation of bacoside A in regenerated shoots. Plant Cell, Tissue Organ Culture.,
100(2), 235–239.
References Chapter 5
241
Formatted: Font: Italic
Najeebullah, M. (2014). Annual abridge report pertaining to vegetable research institute,
faisalabad. Faisalabad.
Nakamura, H., Xue, Y.-L., Miyakawa, T., Hou, F., Qin, H.-M., Fukui, K., Fukui, K.
(2013). Molecular mechanism of strigolactone perception by DWARF14. Nature
Communications., 4(2613),1-10.
Nakano, Y., & Physiology, K. A. (1981). Hydrogen Peroxide is scavenged by Ascorbate-
specific Peroxidase in Spinach Chloroplasts. Plant and Cell Physiology., 22(5),867-
880.
Nauerby, B., Billing, K., & Wyndaele, R. (1997). Influence of the antibiotic timentin on
plant regeneration compared to carbenicillin and cefotaxime in concentrations
suitable for elimination of Agrobacterium tumefaciens. Plant Science., 123(1–2),
169–177.
Nefkens, G. H. L., Thuring, J. W. J. F., Beenakkers, M. F. M., & Zwanenburg, B. (1997).
Synthesis of a Phthaloylglycine-Derived Strigol Analogue and Its Germination
Stimulatory Activity toward Seeds of the Parasitic Weeds Striga hermonthica and
Orobanche crenata. Journal of Agricultural and Food Chemistry., 45(6), 2273–2277.
Nelson, D. C., Scaffidi, A., Dun, E. A., Waters, M. T., Flematti, G. R., Dixon, K. W.,
Smith, S. M. (2011). F-box protein MAX2 has dual roles in karrikin and strigolactone
signaling in Arabidopsis thaliana. Proceedings of the National Academy of Sciences
of the United States of America., 108(21), 8897–8902.
Nic-Can, G. I., & Loyola-Vargas, V. M. The Role of the Auxins During Somatic
Embryogenesis. In Somatic Embryogenesis: Fundamental Aspects and Applications.
Ochoa-Alejo (eds). Springer, International Publishing Switzerland . , 121-170
(2016)
Nic-Can, G. I., López-Torres, A., Barredo-Pool, F., Wrobel, K., Loyola-Vargas, V. M.,
Rojas-Herrera, R., & De-la-Peña, C. (2013). New Insights into Somatic
References Chapter 5
242
Formatted: Font: Italic
Embryogenesis: leafy cotyledon1, baby boom1 and wuschel-related homeobox4 Are
Epigenetically Regulated in Coffea canephora. PLoS ONE., 8(8).
Nickavar, B., Kamalinejad, M., & Mohandesi, S. (2006). Comparison of the components
of the essential oils from leaves and fruits of Grammosciadium platycarpum.
Chemistry of Natural Compounds., 42(6), 686–688.
Ning, G. G., & Bao, M. Z. (2007). Plant regeneration from callus derived from immature
embryo cotyledons of Prunusmume. HortScience., 42(3), 744–747.
Nomura, S., Nakashima, H., Mizutani, M., Takikawa, H., & Sugimoto, Y. (2013).
Structural requirements of strigolactones for germination induction and inhibition of
Striga gesnerioides seeds. Plant Cell Reports., 32(6), 829–838.
Nover, L., Kranz, E., & Scharf, K. D. (1982). Growth Cycle of Suspension Cultures of
Lycopersicon esculentum and L. peruvianum. Biochemie Und Physiologie Der
Pflanzen., 177(6), 483–499.
Oerke, E.C. (2006). Crop losses to pests. The Journal of Agricultural Science., 144(01),
31.
Okamoto, M., Peterson, F. C., Defries, A., Park, S.-Y., Endo, A., Nambara, E., Cutler, S.
R. (2013). Activation of dimeric ABA receptors elicits guard cell closure, ABA-
regulated gene expression, and drought tolerance. Proceedings of the National
Academy of Sciences., 110(29), 12132–12137.
Osakabe, Y., Kajita, S., & Osakabe, K. (2011). Genetic engineering of woody plants:
current and future targets in a stressful environment. Physiologia Plantarum., 142(2),
105–117.
Osman, M., Elhadi, E., & Khalafalla, M. (2010). Callus formation and organogenesis of
tomato (Lycopersicon esculentum Mill, C.V. Omdurman) induced by thidiazuron.
African Journal of Biotechnology., 9(28), 4407–4413.
References Chapter 5
243
Formatted: Font: Italic
Otroshy, M., Khalili, Z., Ebrahimi, M. A., Nekoui, M. K., & Moradi, K. (2013). Effect of
growth regulators and explant on plant regeneration of Solanum lycopersicum L. var.
cerasiforme. Russian Agricultural Sciences., 39(3), 226–235.
Pal, S., Zhao, J., Khan, A., Yadav, N. S., Batushansky, A., Barak, S.,Rachmilevitch, S.
(2016). Paclobutrazol induces tolerance in tomato to deficit irrigation through
diversified effects on plant morphology, physiology and metabolism. Scientific
Reports., 6.
Park, J., & Yi, BY CK, L. (2011). Growth Regulators, Bud Length, Donor Plant Age, Low
Temperature Treatment and Glucose Concentration on Callus Induction and Plant
Regeneration. Journal of the Korean Society for Horticultural Science., 42(1), 32–
37.
Periago, M. J., Martínez-Valverde, I., Chesson, A., & Provan, G. (2002). Phenolic
compounds, lycopene and antioxidant activity in commercial varieties of tomato
(Lycopersicum esculentum). Journal of the Science of Food and Agriculture., 82(3),
323–330.
Plastira, V. A., & Perdikaris, A. K. (1997). Effect of genotype and explant type in
regeneration frequency of tomato in vitro. Acta Horticulturae., (447), 231–234.
Prandi, C., Ghigo, G., Occhiato, E. G., Scarpi, D., Begliomini, S., Lace, B., Noordik, J.
H. (2014). Tailoring fluorescent strigolactones for in vivo investigations: a
computational and experimental study. Organic & Biomolecular Chemistry., 12(18),
2960–2968.
Prandi, C., Occhiato, E. G., Tabasso, S., Bonfante, P., Novero, M., Scarpi, D., Miletto, I.
(2011). New Potent Fluorescent Analogues of Strigolactones: Synthesis and
Biological Activity in Parasitic Weed Germination and Fungal Branching. European
Journal of Organic Chemistry., (20–21), 3781–3793.
References Chapter 5
244
Formatted: Font: Italic
Qiu, D., Diretto, G., Tavarza, R., & Giuliano, G. (2007). Improved protocol for
Agrobacterium mediated transformation of tomato and production of transgenic
plants containing carotenoid biosynthetic gene CsZCD. Scientia Horticulturae.,
112(2), 172–175.
Rai, G. K., Rai, N. P., Kumar, S., Yadav, A., Rathaur, S., & Singh, M. (2012). Effects of
explant age, germination medium, pre-culture parameters, inoculation medium, pH,
washing medium, and selection regime on Agrobacterium-mediated transformation
of tomato. In Vitro Cellular & Developmental Biology -– Plant., 48(5), 565–578.
Raineri, J., Ribichich, K. F., & Chan, R. L. (2015). The sunflower transcription factor
HaWRKY76 confers drought and flood tolerance to Arabidopsis thaliana plants
without yield penalty. Plant Cell Reports., 34(12), 2065–2080.
Rakha, M., Scott, J., Hutton, S., & Smith, H. (2011). Identification of trichomes, loci and
chemical compounds derived from Solanum habrochaites accession LA1777 that are
associated with resistance to the sweetpotato whitefly, Bemisia tabaci in tomato, S.
lycopersicum. 43rd Tomato Breeders Roundtable Meeting.
Rani, K., Zwanenburg, B., Sugimoto, Y., Yoneyama, K., & Bouwmeester, H. J. (2008).
Biosynthetic considerations could assist the structure elucidation of host plant
produced rhizosphere signalling compounds (strigolactones) for arbuscular
mycorrhizal fungi and parasitic plants. Plant Physiology and Biochemistry., 46(7),
617–626.
Rao, A. Q., Bakhsh, A., Kiani, S., Shahzad, K., Shahid, A. A., Husnain, T., & Riazuddin,
S. (2009). The myth of plant transformation. Biotechnology Advances., 27(6), 753–
763.
Rasmussen, A., Depuydt, S., Goormachtig, S., & Geelen, D. (2013). Strigolactones fine-
tune the root system. Planta., 238(4), 615–626.
References Chapter 5
245
Formatted: Font: Italic
Rasmussen, A., Mason, M. G., De Cuyper, C., Brewer, P. B., Herold, S., Agusti, J.,
Beveridge, C. A. (2012). Strigolactones Suppress Adventitious Rooting in
Arabidopsis and Pea. Plant Physiology., 158(4), 1976–1987.
Ren, J., Sun, L. N., Zhang, Q. Y., & Song, X. S. (2016). Drought Tolerance Is Correlated
with the Activity of Antioxidant Enzymes in Cerasus humilis Seedlings. BioMed
Research International., 2016, 1–9.
Roy, R., Purty, R. S., Agrawal, V., & Gupta, S. C. (2006). Transformation of tomato
cultivar ‘Pusa Ruby’ with bspA gene from Populus tremula for drought tolerance.
Plant Cell, Tissue and Organ Culture., 84(1), 56–68.
Ruyter-Spira, C., Al-Babili, S., van der Krol, S., & Bouwmeester, H. (2013). The biology
of strigolactones. Trends in Plant Science,, 18(2), 72–83.
Ruyter-Spira, C., Kohlen, W., Charnikhova, T., van Zeijl, A., van Bezouwen, L., de
Ruijter, N., Bouwmeester, H. (2011). Physiological effects of the synthetic
strigolactone analog GR24 on root system architecture in Arabidopsis: another
belowground role for strigolactones? Plant Physiology., 155(2), 721–734.
Saeed, W., Naseem, S., & Ali, Z. (2017). Strigolactones Biosynthesis and Their Role in
Abiotic Stress Resilience in Plants: A Critical Review. Frontiers in Plant Science.,
8, 1487.
Saeed, W., Naseem, S., Gohar, D., & Ali, Z. (2019). Efficient and reproducible somatic
embryogenesis and micropropagation in tomato via novel structures - Rhizoid
Tubers. PLOS ONE., 14(5), e0215929.
Saker, M. M., Salama, H. S., Salama, M., El-Banna, A., & Abdel Ghany, N. M. (2011).
Production of transgenic tomato plants expressing Cry 2Ab gene for the control of
some lepidopterous insects endemic in Egypt. Journal of Genetic Engineering and
Biotechnology., 9(2), 149–155.
References Chapter 5
246
Formatted: Font: Italic
Sambrook, J., & Russell, D. W. (2001). Molecular cloning: a laboratory manual. Cold
Spring Harbor Laboratory Press.
Sambrook, J., & Russell, D. W. (2006). Preparation of Plasmid DNA by Alkaline Lysis
with SDS: Maxipreparation. 3rd ed. Cold Spring Harbor Protocols., 2006(1).
Samodelov, S. L., Beyer, H. M., Guo, X., Augustin, M., Jia, K. P., Baz, L., Zurbriggen,
M. D. (2016). Strigoquant: A genetically encoded biosensor for quantifying
Strigolactone activity and specificity. Science Advances., 2(11).
Sanchez, E., Artuso, E., Lombardi, C., Visentin, I., Lace, B., Saeed, W., Prandi, C. (2018).
Structure–activity relationships of strigolactones via a novel, quantitative in planta
bioassay. Journal of Experimental Botany., 69(9), 2333–2343.
Scaffidi, A., Waters, M. T., Bond, C. S., Dixon, K. W., Smith, S. M., Ghisalberti, E. L.,
& Flematti, G. R. (2012). Exploring the molecular mechanism of karrikins and
strigolactones. Bioorganic & Medicinal Chemistry Letters. (Vol. 22).
Schöb, H., Kunz, C., & Meins, F. (1997). Silencing of transgenes introduced into leaves
by agroinfiltration: a simple, rapid method for investigating sequence requirements
for gene silencing. Molecular & General Genetics. , 256(5), 581–585.
Schuetze, R., & Wieczorrek, G. (1987). Investigations into tomato tissue cultures, 1: Shoot
regeneration in primary explants of tomato. Archive for Breeding Research (German
DR)., 17,117-126
Serrano, R., Mulet, J. M., Rios, G., Marquez, J. A., Larrinoa, I. igo F. de, Leube, M. P.,
Montesinos, C. (2012). A glimpse of the mechanisms of ion homeostasis during salt
stress. Journal of Experimental Botany., 50(Special_Issue), 1023–1036.
Shah, S H, Ali, S., Jan, S. A., Din, J., & Ali, G. M. (2015). Callus Induction, In Vitro
Shoot Regeneration and Hairy Root Formation By The Assessment Of Various Plant
Growth Regulators In Tomato (Solanum lycopersicum Mill.). Journal of Animal and
Plant Sciences., 25(2).
References Chapter 5
247
Formatted: Font: Italic
Shah, Sabir Hussain, Ali, S., Hussain, Z., Jan, S. A., Jalal-ud-Din, & Ali, G. M. (2016).
Genetic improvement of tomato (Solanum lycopersicum) with AtDREB1A gene for
cold stress tolerance using optimized agrobacterium-mediated transformation
system. International Journal of Agriculture & Biology., 18(3), 471–482.
Shakoor, A., Sabri, M., Afzal, M., & Bashir, M. (2010). Role of plant morphological
characters towards resistance of some cultivars of tomato against phytophagous
mites (Acari) under greenhouse conditions. Pakistan Journal of Life and Social
SciencesPak J Life Soc Sci., 8(2), 131–136.
Sheeja, T. E., & Mandal, A. B. (2003). In vitro flowering and fruiting in tomato
(Lycopersicon esculentum Mill.). Asia-Pacific Journal of Molecular Biology and
Biotechnology. , 11(1), 37–42.
Shinozaki, K., & Yamaguchi-Shinozaki, K. (2006). Gene networks involved in drought
stress response and tolerance. Journal of Experimental Botany,, 58(2), 221–227.
Shinozaki, Kazuo, & Yamaguchi-Shinozaki, K. (2007). Gene networks involved in
drought stress response and tolerance. Journal of Experimental Botany. , 58(2), 221–
227.
Simons, J. L., Napoli, C. A., Janssen, B. J., Plummer, K. M., & Snowden, K. C. (2007).
Analysis of the DECREASED APICAL DOMINANCE Genes of Petunia in the
Control of Axillary Branching. Plant Physiology. , 143(2), 697–706.
Snowden, K. C., Simkin, A. J., Janssen, B. J., Templeton, K. R., Loucas, H. M., Simons,
J. L., Klee, H. J. (2005). The Decreased apical dominance1/Petunia hybrida
Carotenoid Cleavage Dioxygenase8 gene affects branch production and plays a role
in leaf senescence, root growth, and flower development. The Plant Cell., 17(3),
746–759.
References Chapter 5
248
Formatted: Font: Italic
Sofiari, E., Raemakers, C. J. J. M., Kanju, E., Danso, K., van Lammeren, A. M., Jacobsen,
E., & Visser, R. G. F. (1997). Comparison of NAA and 2,4-D induced somatic
embryogenesis in Cassava. Plant Cell, Tissue and Organ Culture., 50(1), 45–56.
Sofo, A., Scopa, A., Nuzzaci, M., & Vitti, A. (2015). Ascorbate peroxidase and catalase
activities and their genetic regulation in plants subjected to drought and salinity
stresses. International Journal of Molecular Sciences., 16(6), 13561–13578.
Sorefan, K., Booker, J., Haurogné, K., Goussot, M., Bainbridge, K., Foo, E., Leyser, O.
(2003). MAX4 and RMS1 are orthologous dioxygenase-like genes that regulate
shoot branching in Arabidopsis and pea. Genes & Development., 17(12), 1469–1474.
Soto, M. J., Fernández-Aparicio, M., Castellanos-Morales, V., García-Garrido, J. M.,
Ocampo, J. A., Delgado, M. J., & Vierheilig, H. (2010). First indications for the
involvement of strigolactones on nodule formation in alfalfa (Medicago sativa). Soil
Biology and Biochemistry., 2(42), 383-385
Sreenivasulu, N., Harshavardhan, V. T., Govind, G., Seiler, C., & Kohli, A. (2012).
Contrapuntal role of ABA: Does it mediate stress tolerance or plant growth
retardation under long-term drought stress? Gene., 506(2), 265–273.
Stirnberg, P., Furner, I. J., & Ottoline Leyser, H. M. (2007). MAX2 participates in an SCF
complex which acts locally at the node to suppress shoot branching. The Plant
Journal., 50(1), 80–94.
Stirnberg, P., van De Sande, K., & Leyser, H. M. O. (2002). MAX1 and MAX2 control
shoot lateral branching in Arabidopsis. Development (Cambridge, England)., 129(5),
1131–1141.
Sun, H. J., Uchii, S., Watanabe, S., & Ezura, H. (2006). A highly efficient transformation
protocol for Micro-Tom, a model cultivar for tomato functional genomics. Plant Cell
Physiol. , 47(3), 426–431.
References Chapter 5
249
Formatted: Font: Italic
Sun, S., Kang, X. P., Xing, X. J., Xu, X. Y., Cheng, J., Zheng, S. W., & Xing, G. M.
(2015). Agrobacterium-mediated transformation of tomato (Lycopersicon
esculentum L. cv. Hezuo 908) with improved efficiency. Biotechnology and
Biotechnological Equipment., 29(5), 861–868.
Sun, W.-H., Duan, M., Li, F., Shu, D.-F., Yang, S., & Meng, Q.-W. (2010).
Overexpression of tomato tAPX gene in tobacco improves tolerance to high or low
temperature stress. Biologia Plantarum., 54(4), 614–620.
Tai, Z., Yin, X., Fang, Z., Shi, G., Lou, L., & Cai, Q. (2017). Exogenous GR24 Alleviates
Cadmium Toxicity by Reducing Cadmium Uptake in Switchgrass (Panicum
virgatum) Seedlings. International Journal of Environmental Research and Public
Health., 14(852).
Toh, S., Holbrook-Smith, D., Stogios, P. J., Onopriyenko, O., Lumba, S., Tsuchiya, Y.,
McCourt, P. (2015). Structure-function analysis identifies highly sensitive
strigolactone receptors in Striga. Science., 350(6257), 203–207.
Tomato Genome Consortium, S., Albiero, A., Aoki, K., Asamizu, E., Bogden, R.,
Bombarely, A., Xu, X. (2012). The tomato genome sequence provides insights into
fleshy fruit evolution. Nature., 485(7400), 635–641.
Tomato Genome Consortium. (2012). The tomato genome sequence provides insights into
fleshy fruit evolution. Nature., 485(7400), 635–641.
Torres-Vera, R., García, J. M., Pozo, M. J., & López-Ráez, J. A. (2014). Do strigolactones
contribute to plant defence? Molecular Plant Pathology., 15(2), 211–216.
Trujillo-Moya, C., Peiró, R., & Gisbert, C. (2014). Leaf morphology and shoot
regeneration of in vitro cultured explants from species of the solanum peruvianum
s.l. complex. Turkish Journal of Botany., 38(3), 465–476.
References Chapter 5
250
Formatted: Font: Italic
Tsuchiya, Y., Vidaurre, D., Toh, S., Hanada, A., Nambara, E., Kamiya, Y., McCourt, P.
(2010). A small-molecule screen identifies new functions for the plant hormone
strigolactone. Nature Chemical Biology., 6(10), 741–749.
Umehara, M., Hanada, A., Magome, H., Takeda-Kamiya, N., & Yamaguchi, S. (2010).
Contribution of strigolactones to the inhibition of tiller bud outgrowth under
phosphate deficiency in rice. Plant and Cell Physiology. , 51(7), 1118–1126.
Umehara, M., Hanada, A., Yoshida, S., Akiyama, K., Arite, T., Takeda-Kamiya, N.,
Yamaguchi, S. (2008). Inhibition of shoot branching by new terpenoid plant
hormones. Nature , 455(7210), 195–200.
Umezawa, T., Fujita, M., Fujita, Y., Yamaguchi-Shinozaki, K., & Shinozaki, K. (2006).
Engineering drought tolerance in plants: discovering and tailoring genes to unlock
the future. Current Opinion in Biotechnology., 17(2), 113–122.
Velcheva, M., Faltin, Z., Flaishman, M., Eshdat, Y., & Perl, A. (2005). A liquid culture
system for Agrobacterium-mediated transformation of tomato (Lycopersicon
esculentum L. Mill.). Plant Science., 168(1), 121–130.
Verslues, P. E., & Zhu, J.-K. (2005). Before and beyond ABA: upstream sensing and
internal signals that determine ABA accumulation and response under abiotic stress.
Biochemical Society Transactions., 33(2).
Victor, J. M. R., Murthy, B. N. S., Murch, S. J., KrishnaRaj, S., & Saxena, P. K. (1999).
Role of endogenous purine metabolism in thidiazuron-induced somatic
embryogenesis of peanut (Arachis hypogaea L.). Plant Growth Regulation., 28(1),
41–47.
Visentin, I., Vitali, M., Ferrero, M., Zhang, Y., Ruyter-Spira, C., Novák, O., Cardinale, F.
(2016). Low levels of strigolactones in roots as a component of the systemic signal
of drought stress in tomato. New Phytologist., 212(4), 954–963.
References Chapter 5
251
Formatted: Font: Italic
Vogel, J. T., Walter, M. H., Giavalisco, P., Lytovchenko, A., Kohlen, W., Charnikhova,
T., Klee, H. J. (2010). SlCCD7 controls strigolactone biosynthesis, shoot branching
and mycorrhiza-induced apocarotenoid formation in tomato. Plant Journal., 61(2),
300–311.
Vurro, M., Prandi, C., & Baroccio, F. (2016). Strigolactones: how far is their commercial
use for agricultural purposes? Pest Management Science., 72(11), 2026–2034.
Wang, W., Vinocur, B., & Altman, A. (2003b). Plant responses to drought, salinity and
extreme temperatures: towards genetic engineering for stress tolerance. Planta.,
218(1), 1–14.
Wang, Y., Sun, S., Zhu, W., Jia, K., Yang, H., & Wang, X. (2013). Strigolactone/MAX2-
induced degradation of brassinosteroid transcriptional effector BES1 regulates shoot
branching. Developmental Cell., 27(6), 681–688.
Wani, S. H., Kumar, V., Shriram, V., & Sah, S. K. (2016). Phytohormones and their
metabolic engineering for abiotic stress tolerance in crop plants. The Crop Journal.,
4(3), 162–176.
Waters, M. T., Nelson, D. C., Scaffidi, A., Flematti, G. R., Sun, Y. K., Dixon, K. W., &
Smith, S. M. (2012). Specialisation within the DWARF14 protein family confers
distinct responses to karrikins and strigolactones in Arabidopsis. Development.,
139(7), 1285–1295.
Waters, Mark T., Scaffidi, A., Flematti, G. R., & Smith, S. M. (2012). Karrikins force a
rethink of strigolactone mode of action. Plant Signaling & Behavior., 7(8), 969–972.
Wayase, U. R., & Shitole, M. G. (2014). Effect of Plant Growth Regulators on
Organogenesis in Tomato (Lycopersicon esculentum Mill .) cv . Dhanashri, Int. J.
Pure Appl. Sci. Technol., 20(2), 65–71.
References Chapter 5
252
Formatted: Font: Italic
Wei, T., Deng, K., Zhang, Q., Gao, Y., Liu, Y., Yang, M., Zhang, Y. (2017). Modulating
AtDREB1C Expression Improves Drought Tolerance in Salvia miltiorrhiza.
Frontiers in Plant Science., 8.
Weigel, D., & Glazebrook, J. (2006). Transformation of agrobacterium using the freeze-
thaw method. Cold Spring Harbor ProtocolsCSH Protocols., 2006(7).
Wellburn, A. R. (1994). The Spectral Determination of Chlorophylls a and b, as well as
Total Carotenoids, Using Various Solvents with Spectrophotometers of Different
Resolution. Journal of Plant Physiology., 144(3), 307–313.
Wilkinson, S., & Davies, W. J. (2002). ABA-based chemical signalling: the co-ordination
of responses to stress in plants. Plant, Cell and Environment., 25(2), 195–210.
Wilkinson, Sally. (1999). PH as a stress signal. Journal of Plant Growth RegulationJ.
Plant Growth Regul., 28, 87–99.
Wimmer, E. A. (2003). Innovations: Applications of insect transgenesis. Nature Reviews
Genetics. 4(3), 225–232.
Wing, R., Zhang, H.-B., & Tanksley, S. (1994). Map-based cloning in crop plants. Tomato
as a model system: I. Genetic and physical mapping of jointless. MGG Molecular &
General Genetics. 242(6), 681–688.
Wroblewski, T., Tomczak, A., & Michelmore, R. (2005). Optimization of Agrobacterium-
mediated transient assays of gene expression in lettuce, tomato and Arabidopsis.
Plant Biotechnology Journal. 3(2), 259–273.
Wu, Y. F., Chen, Y., Liang, X. M., & Wang, X. Z. (2006). An experimental assessment
of the factors influencing Agrobacterium-mediated transformation in tomato.
Russian Journal of Plant Physiology. 53(2), 252–256.
References Chapter 5
253
Formatted: Font: Italic
Wujeska, A., Bossinger, G., & Tausz, M. (2013). Responses of foliar antioxidative and
photoprotective defence systems of trees to drought: a meta-analysis. Tree
Physiology. 33(10), 1018–1029.
Xie, X., Yoneyama, K. K., & Yoneyama, K. K. (2010). The Strigolactone Story. Annual
Review of Phytopathology, 48(1), 93–117.
Xie, X., Yoneyama, K., Kisugi, T., Uchida, K., Ito, S., Akiyama, K., Yoneyama, K.
(2013). Confirming stereochemical structures of strigolactones produced by rice and
tobacco. Molecular Plant. 6(1), 153–163.
Xiong, L., Schumaker, K. S., & Zhu, J.-K. (2002). Cell Signaling during Cold, Drought,
and Salt Stress. PLANT CELL. 14(suppl_1), S165-183.
Xu, Kedong, Chang, Y., Liu, K., Wang, F., Liu, Z., Zhang, T., Li, C. (2014). Regeneration
of Solanum nigrum by Somatic Embryogenesis, Involving Frog Egg-Like Body, a
Novel Structure. PLoS ONE. 9(6), e98672.
Xu, Ke-dong, Chang, Y., Zhang, J., Wang, P., Wu, J., Li, Y., Li, C. (2015). A Lower pH
Value Benefits Regeneration of Trichosanthes kirilowii by Somatic Embryogenesis,
Involving Rhizoid Tubers (RTBs), a Novel Structure. Scientific Reports. 5(1), 8823.
Xu, Kedong, Chang, Y., Zhang, Y., Liu, K., Zhang, J., Wang, W., Li, C. (2016). Rorippa
indica Regeneration via Somatic Embryogenesis Involving Frog Egg-like Bodies
Efficiently Induced by the Synergy of Salt and Drought Stresses. Scientific Reports.
6, 19811.
Yang, L., Li, Y., & Shen, H. (2012). Somatic embryogenesis and plant regeneration from
immature zygotic embryo cultures of mountain ash (Sorbus pohuashanensis). Plant
Cell, Tissue and Organ Culture. 109(3), 547–556.
Yang, X., Lü, J., da Silva, J. A. T., & Ma, G. (2012). Somatic embryogenesis and shoot
organogenesis from leaf explants of Primulina tabacum. Plant Cell, Tissue and
Organ Culture (PCTOC). 109(2), 213–221.
References Chapter 5
254
Formatted: Font: Italic
Yao, R., Ming, Z., Yan, L., Li, S., Wang, F., Ma, S., Xie, D. (2016). DWARF14 is a non-
canonical hormone receptor for strigolactone. Nature. 536(7617), 469–473.
Yasmeen, A. (2009). An improved protocol for the regeneration and transformation of
tomato (cv Rio Grande). Acta Physiologiae Plantarum. 31(6), 1271–1277.
Yoneyama, K. K., Xie, X., Kim, H. Il, Kisugi, T., Nomura, T., Sekimoto, H., Yoneyama,
K. K. (2012). How do nitrogen and phosphorus deficiencies affect strigolactone
production and exudation? Planta. 235(6).
Yoneyama, K., Xie, X., Kisugi, T., Nomura, T., & Yoneyama, K. (2013). Nitrogen and
phosphorus fertilization negatively affect strigolactone production and exudation in
sorghum. Planta. 238(5), 885–894.
Yuan, G.-F., Jia, C.-G., Li, Z., Sun, B., Zhang, L.-P., Liu, N., & Wang, Q.-M. (2010).
Effect of brassinosteroids on drought resistance and abscisic acid concentration in
tomato under water stress. Scientia Horticulturae. 126(2), 103–108.
Zamir, Dani. (2001). Improving plant breeding with exotic genetic libraries. Nature
Reviews Genetics. 2(12), 983–989.
Zamir, Daniel, Jones, R. A., & Kedar, N. (1980). Anther culture of male-sterile tomato
(Lycopersicon esculentum mill.) mutants. Plant Science Letters. 17(3), 353–361.
Zeevaart, J. A. D., & Creelman, R. A. (1988). Metabolism and Physiology of Abscisic
Acid. Annual Review of Plant Physiology and Plant Molecular Biology. 39(1), 439–
473.
Zhang, H.-X. X., & Blumwald, E. (2001). Transgenic salt-tolerant tomato plants
accumulate salt in foliage but not in fruit. Nature Biotechnology. 19(8), 765–768.
Zhang, Xiaohui, Zou, Z., Gong, P., Zhang, J., Ziaf, K., Li, H., Ye, Z. (2011). Over-
expression of microRNA169 confers enhanced drought tolerance to tomato.
Biotechnology Letters. 33(2), 403–409.
References Chapter 5
255
Formatted: Font: Italic
Zhang, Xingliang, Jiang, L., Wang, G., Yu, L., Zhang, Q., Xin, Q., Chen, Z. (2013).
Structural Insights into the Abscisic Acid Stereospecificity by the ABA Receptors
PYR/PYL/RCAR. PLoS ONE. 8(7), e67477.
Zhang, Y., Haider, I., Ruyter-Spira, C., & Bouwmeester, H. J. (2013). Strigolactone
Biosynthesis and Biology. Molecular Microbial Ecology of the Rhizosphere. 1, 355–
371.
Zhang, Y., Ruyter-Spira, C., & Bouwmeester, H. J. (2015). Engineering the plant
rhizosphere. Current Opinion in Biotechnology. 32, 136–142.
Zhao, J., Wang, T., Wang, M., Liu, Y., Yuan, S., Gao, Y., Li, X. (2014). DWARF3
participates in an SCF complex and associates with DWARF14 to suppress rice shoot
branching. Plant & Cell Physiology. 55(6), 1096–1109.
Zhao, L.-H., Zhou, X. E., Wu, Z.-S., Yi, W., Xu, Y., Li, S., Xu, H. E. (2013). Crystal
structures of two phytohormone signal-transducing α/β hydrolases: karrikin-
signaling KAI2 and strigolactone-signaling DWARF14. Cell Research. 23(3), 436–
439. 9
Zhao, L.-H., Zhou, X. E., Yi, W., Wu, Z., Liu, Y., Kang, Y., Xu, H. E. (2015).
Destabilization of strigolactone receptor DWARF14 by binding of ligand and E3-
ligase signaling effector DWARF3. Cell Research. 25(11), 1219–1236.
Zheng, K., Wang, X., Weighill, D. A., Guo, H. B., Xie, M., Yang, Y., Chen, J. G. (2016).
Characterization of DWARF14 Genes in Populus. Scientific Reports. 6, 21593.
Zhou, F., Lin, Q., Zhu, L., Ren, Y., Zhou, K., Shabek, N., Wan, J. (2013). D14–SCFD3-
dependent degradation of D53 regulates strigolactone signalling. Nature. 504(7480),
406–410.
Zhu, M., Chen, G., Dong, T., Wang, L., Zhang, J., Zhao, Z., & Hu, Z. (2015). SlDEAD31,
a Putative DEAD-Box RNA Helicase Gene, Regulates Salt and Drought Tolerance
and Stress-Related Genes in Tomato. PLOS ONE. 10(8), e0133849.
References Chapter 5
256
Formatted: Font: Italic
Ziska, L. H., Tomecek, M. B., & Gealy, D. R. (2010). Competitive Interactions between
Cultivated and Red Rice as a Function of Recent and Projected Increases in
Atmospheric Carbon Dioxide. Agronomy Journal. 102(1), 118.
Zwanenburg, B., & Mwakaboko, A. S. (2011). Strigolactone analogues and mimics
derived from phthalimide, saccharine, p-tolylmalondialdehyde, benzoic and salicylic
acid as scaffolds. Bioorganic & Medicinal Chemistry. 19(24), 7394–7400.
Zwanenburg, B., & Pospíšil, T. (2013). Structure and Activity of Strigolactones: New
Plant Hormones with a Rich Future. Molecular Plant. 6(1), 38–62.
Zwanenburg, B., Mwakaboko, A. S., Reizelman, A., Anilkumar, G., & Sethumadhavan,
D. (2009). Structure and function of natural and synthetic signallingmolecules in
parasitic weed germination. Pest Management Science. 65(5), 478–491.
Zwanenburg, B., Nayak, S. K., Charnikhova, T. V, & Bouwmeester, H. J. (2013). New
strigolactone mimics: structure-activity relationship and mode of action as
germinating stimulants for parasitic weeds. Bioorganic & Medicinal Chemistry
Letters. 23(18), 5182–5186.
Appendices
257
APPENDIX- I
Media formulations
Shoot Elongation media (SEM)
Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L.
Sucrose= (20 g/L).
Plant agar= (8 g/L).
NAA=0.1 mg/L.
BAP=3 mg/L
pH before autoclaving=5.8.
Autoclaved=121oC for 40 min
Co-cultivation media
Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L
Sucrose= 20 g/L
Plant agar= 8 g/L
Acetosyringone=200 Mm.
IAA=2 mg/L.
NAA=2 mg/L.
BAP=2 mg/L.
Kin=4 mg/L.
pH before autoclaving=5.8.
Autoclaved=121oC for 40 min
Selection and shoot induction Media Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L
Sucrose= 20 g/L
Plant agar= 8 g/L
BAP=3 mg/L.
NAA=2 mg/L
pH before autoclaving=5.8.
Autoclaved=121oC for 40 min
Cooled to Room Temperature and add .Kanamycinkanamycin 50mg/L and Ticarcillin 600
mg/L
Root Induction Media (RIM) Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L
Sucrose= 20 g/L Plant agar= 8 g/L
NAA=0.2 mg/L.
pH before autoclaving=5.8.
Formatted: Left: 1.56", Right: 1", Width: 8.5", Height:
11"
Appendices
258
Autoclaved=121oC for 40 min
Rhizoids induction medium Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L
Sucrose= (20 g/L).
Plant agar= (8 g/L)
NAA=2 mg/L.
pH before autoclaving=4.0.
Autoclaved=121oC for 40 min
Rhizoid Tubers induction Medium Murashige and Skoog (MS) micro and macro nutrients supplemented with vitamins =4.15 g/L
Sucrose= (20 g/L).
Plant agar= (8 g/L).
TDZ=5 mg/L.
pH before autoclaving=4.0
Autoclaved=121oC for 40 min
LB (Luria-Bertani) medium/plates (E. coli) Bacto-tryptone=10 g/L
Bacto-yeast extract= 5 g/L
Sodium chloride=10 g/L
pH = 7.0 ± 0.2
Agar = 15 g/L for plates only
LB (Luria-Bertani) medium (Agrobacterium) Bacto-tryptone
=10 g/L
Bacto-yeast extract= 5 g/L
Sodium chloride=5 g/L
pH = 7.0 ± 0.2
Yeast Extract Peptone solid medium (YEP-selection)
Bacto-yeast extract =10 g/L
Bacto peptone= 10g/L
NaCl= 5g/L
Bacto agar= 15g/L dissolved in distilled water.
pH = 7.0 ± 0.2
Supplemented with Kan=50 mg/L.
rRifampicin (Rif) = 25 mg/L
SOC medium
Appendices
259
Bacto Tryptone= 20 g/L
Bacto Yeast extract = 5 g/L
NaCl = 0.5 g/L
KCL =10Ml (250mM)
pH before autoclaving=7.0
Autoclaved=121oC for 40 min
Post autoclave 20 mM of filter sterilized glucose and 10 Mm MgCl2 is added.
IPTG/XGAL/Amp plates
20 mg/ml X-Gal solution was dissolved in DMSO and aliquots were stored at -20°C. 100
stock of IPTG solution in dH2O. LB agar was made with Bacto-tryptone=10 g/L, Bacto-
yeast extract= 5 g/L, Sodium chloride=5 g/L and 15g/L Bacto-agar. Media is autoclaved
and cooled to 60 °C. 50 mg/L ampicillin was added and about 25 mL poured into sterile
plastic plates. 40 μL of the X-Gal Solution (20 mg/mL) and 40 μL of 100 mM IPTG
Solution was added. Spread evenly on the plate with a sterile spatula.
Appendices
260
APPENDIX- II
Plant Growth Regulators Stock Preparation
Hormone MW Milligram in
1 µM
Milligram in
2 µM
Milligram in 4
µM
1 mg in
µM
BAP 225 0.225 0.45 0.9 4.44
KINETIN 215 0.215 0.43 0.86 4.65
TDZ 220 0.22 0.44 0.88 4.55
Zeatin 219 0.219 0.44 0.88 4.55
IAA 175 0.175 0.35 0.7 5.71
IBA 203 0.203 0.4 0.8 4.92
NAA 186 0.186 0.37 0.74 5.37
2,4 D 221 0.221 0.44 0.88 4.55
GA3 346 0.346 0.73 1.46 2.89
Equivalent molar concentrations of PGRs used in the study
Benzyl aminopurine (BAP)
A stock of 1000 ppm (1mg/mL) Benzyl aminopurine (BAP) was prepared by weighing
0.025 g BAP and first dissolved it in few drops of NaOH then the final volume was
adjusted to 25 mL with autoclaved distilled water. 0.2 µm syringe filter were used and
aliquots were made in 1.5 mL Eppendorf stored at 4oC.
Kinetin
A stock of 1000 ppm (1mg/mL) Kinetin (Kin) was prepared by weighing 0.025 g KIN
powder and first dissolved it in few drops of NaOH then the final volume was adjusted to
25 mL with autoclaved distilled water. 0.2 µm syringe filter were used and aliquots were
made in 1.5 mL Eppendorf stored at 4oC.
Indole Acetic Acid (IAA)
A stock of 1000 ppm (1mg/mL) Indole Acetic Acid (IAA) was prepared by weighing
0.025 g IAA and first dissolving it in few drops of NaOH then the final volume was
adjusted to 25 mL with autoclaved distilled water..0.2 µm syringe filter were used and
aliquots were made in 1.5 mL Eppendorf. Stored at 4oC.
Naphthalene Acetic Acid (NAA)
Appendices
261
A stock of 1000 ppm ppm (1mg/mL) Naphthalene Acetic Acid (NAA) was prepared by
dissolving 0.025g of NAA powder in few drops of NaOH then the final volume was
adjusted to 25 mL with autoclaved distilled water. 0.2 µm syringe filter were used and
aliquots were made in 1.5 mL Eppendorf. Stored at 4oC.
Gibberelic Acid (GA3)
A stock of 1000ppm Gibberellic Acid was prepared by dissolving 0.05 g GA3 powder in
few drops of NaOH then the final volume was adjusted to 50 mL with autoclaved distilled
water. 0.2 µm syringe filter were used and aliquots were made in 1.5 mL Eppendorf.
Stored at 4oC.
Acetosyringone A stock of 200 mM acetosyringoneAcetosyringone (Mw. 196.20 g/mol) was prepared by
dissolving 0.784 g of 3',5'-Dimethoxy-4'-hydroxyacetophenone in 12 ml 95% ethanol,
then add 8 ml of sterile milli-Q water to equal 20 ml. Filter Sterilize and store at -20°C.
Stocks for vitamins and antibiotics.
KanamycinKanamycin Stock Solution
A stock of 50 mg/L Kanamycinkanamycin was made by weighing 0.5 g of
Kanamycinkanamycin and dissolved it in autoclaved distilled water to make the final
volume of 10 mL. The solution was then aliquoted in 1.5 mL tubes after filter sterilization
with 0.2 µm syringe filter 0.2 µm stored at 4C.
Rifampicin Stock Solution
A stock of 25 mg/L rifampicin (rif) was made by weighing 0.25 g of rifampicin and
dissolved it in 5 mL DMSO (Dimethyl Sulfoxide). Final volume of solution was adjusted
to 10 mL. The solution was then aliquoted in 1.5 mL tubes after filter sterilization with
syringe and 0.2µm filter and stored at -20°C.
Ampicillin Stock solution
A stock of 100 mg/L ampicillin (Amp) was made by weighing 0.5 g antibiotic powder in
5 ml of milli-Q water. The solution was then aliquoted in 1.5 mL tubes after filter
sterilization with 0.2 µm syringe filter 0.2 µm stored at 4C.
Cefotaxime/ Timentin/Augmentin
A stock of 600 mg/L cefotaxime was prepared by weighing 1.2 g of
cefotaxime/timentin/augmentin powder salt and dissolved it in 2 mL of autoclaved
distilled water with 2 drops of pure ethanol. The solution was then aliquoted in 1.5 mL
tubes after filter sterilization with 0.2 µm syringe filter 0.2 µm stored at 4C.
GUS staining solutions
Sodium Phosphate buffer
Appendices
262
A stock of 5 mM sodium phosphate buffer was prepared by weighing 81.97 mg and
dissolving it in distilled water. The pH of solution was adjusted to 7.0 before autoclaving
then stored at 4oC.
Ethylene-diamine-tetra-acetic Acid (EDTA)
A stock of 0.5 M EDTA was prepared by weighing 186.1 g of EDTA and dissolving it in
800 mL of distilled water by stirring vigorously on magnetic stirrer. 5 g of NaOH pellets
were added while dissolving the salt. Once pH reaches 8.0 solution becomes clear and
subsequently autoclaved.
10% Triton X
A stock of 10% triton X was prepared by dissolving 45 mL autoclaved distilled water into
5 mL of absolute triton X.
5-Bromo-4-chloro-3-indolyl-β-D-glucuronic acid (X-Gluc)
A stock of 25 mg/ mL (2 mM) was prepared by weighing 25mg of X-gluc salt and
dissolving it in 1 mL of Dimethyl Sulfoxide (DMSO). The solution was then filter sterilize
and aliquoted in in 1.5 mL Eppendorf tube.
Ethidium bromide staining solution
Concentrated stock of 10 mg/ml was prepared by dissolving 0.2 g ethidium bromide in 20
ml miliQ H2O. Mixed well and store at 4°C in dark or in a foil-wrapped bottle. Do not
sterilize.
TE (Tris/EDTA) buffer
10 mM Tris⋅Cl, pH 8.0
1 mM EDTA, pH 8.0
Store up to 6 months at room temperature
Tris⋅Cl, 1 M
1M stock was prepared by dissolving 121 g Tris base in 800 ml H2O. Adjust to desired pH with
concentrated HCl and adjust volume to 1 liter with H2O
Appendices
263
APPENDIX- III
Chemical stability of lactams as described in Figure 2, in MeOH and Acetonitrile/water
respectively 21˚C (pH 6.7).
640
650
660
670
680
690
700
710
720
730
740
0 5 10 15 20 25 30 35 40
Pea
k ar
ea a
t 25
4 n
m
Time (hours)
Chemical stability of rac Mimic-D-Lactam NBoc
30% MeOH Acetonile/water 1/1
Appendices
264
APPENDIX- IV
Gallic acid solution (100 μg/ml): 10 mg of gallic acid was dissolved in 100 ml of methanol in
volumetric flask.
y = 0.0096x + 0.3751
R² = 0.9316
0
0.5
1
1.5
2
2.5
0 50 100 150 200 250
Ab
sorb
ance
(nm
)
Concentration GA (ug/ml)
Appendices
265
APPENDIX- V
Standard curve of Quercetin solution (1000 μg/ml): 1000 μg/ml stock solution was prepared
by dissolving 100 mg of quercetin in 100 ml of absolute methanol.
Appendices
266
APPENDIX- VI
Standard curve of Ascorbic acid stock solution 1000μg/ml: Ascorbic acid was prepared in
distilled water of different concentration such as 60, 120, 180, 240, 300, 360, 420, 480 μg/ml.
y = 0.0016x + 0.0023
R² = 0.9905
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
0 100 200 300 400 500 600
Ab
sorb
ance
(nm
)
Concentration (ug/ml)
Appendices
i
Formatted: Left: 1.56", Right: 1", Section start: New
page, Width: 8.5", Height: 11"
Appendices
2
Formatted: Left: 1.56", Right: 1"