Upload
others
View
3
Download
0
Embed Size (px)
Citation preview
1
June, 2010
Command Area Development of Small Dams
KNOWLEDGE FOR LIFE
CABI Ref.: FR/CABI-PK/DR10004/2022
CABI South Asia
Opposite 1-A, Satellite Town, Data Gunj Bakhsh Road Rawalpindi
Tele: 051-9290132, 9290332: Fax: 051-9290131
E-mail: [email protected]
2
Contents Fact sheet of the progress ...................................................................................................................................................................... 4 Acknowledgement .................................................................................................................................................................................. 5 Summary ................................................................................................................................................................................................ 6 Introduction............................................................................................................................................................................................. 7 Objectives .............................................................................................................................................................................................. 7 Methodology ........................................................................................................................................................................................... 8 Activities 2007-08 ................................................................................................................................................................................... 8 Activities 2008-09 ................................................................................................................................................................................. 22 Activities 2009-10 ................................................................................................................................................................................. 30
Annexure 1; ToF / FFS schedule for CAD Small Dam Project .......................................................................................................... 49 Annexure 2; TOF Participants ........................................................................................................................................................... 49 Annexure 3; Command areas under Small Dams ............................................................................................................................. 50 Annexure 4; Farmer Field School, Dungi Dam, Gujar Khan .............................................................................................................. 51 Annexure 5; Farmer Field School Varagujran, Jamergl Dam, Jehlum ............................................................................................... 53 Annexure 6; Farmer Field School Jammergal, Jammergal Dam Jehlum ........................................................................................... 55 Annexure 7; Farmer Field School Dhoke Jumma, Jammergal Dam, Jehlum .................................................................................... 57 Annexure 8; Farmer Field School Qibla Bandi, Qibla Bandi Dam, Attock .......................................................................................... 60 Annexure 9; Farmer Field School Barazai, Qibla Bandi Dam, Attock ................................................................................................ 62 Annexure 10; Farmer Field School Malik Mala, Qibla Bandi Dam, Attock ......................................................................................... 64 Annexure 11; Farmer Field School Dhoke Tahlian, Dhoke Tahlian Dam, Chakwal ........................................................................... 66 Annexure 12; Farmer Field School Kalan Wali, Dhoke Tahlian Dam, Chakwal ................................................................................. 68 Annexure 13; Farmer Field School Jhattla, Dhoke Tahlian Dam, Chakwal ....................................................................................... 70 Annexure 14; Varietals comparison of Spring Maize ......................................................................................................................... 72 Annexure 15; Cost of production of high plastic tunnel ..................................................................................................................... 72 Annexure 16; Resource persons visited to TOF ................................................................................................................................ 73 Annexure 17; Success Story 1 .......................................................................................................................................................... 74 Annexure 18; Success Story 2 .......................................................................................................................................................... 75 Annexure 19; Success Story 3 .......................................................................................................................................................... 76 Annexure 20; Success Story 4 .......................................................................................................................................................... 78 Annexure 21; Success Story 5 .......................................................................................................................................................... 80 Annexure 22; Success Story 6 .......................................................................................................................................................... 81 Annexure 23; Success Story 7 .......................................................................................................................................................... 82 Annexure 24; Success Story 8 .......................................................................................................................................................... 83 Annexure 25; Insect collection kit ...................................................................................................................................................... 84 Annexure 26; Farmers Field Schools visited for back stopping during 2008-09 ................................................................................ 85 Annexure 27; Organizational structure of Joint FFS session at each dam, 2000-10 ......................................................................... 85 Annexure 28; Total Sub FFS at Dungi Dam, 2000-10 ....................................................................................................................... 85 Annexure 29; Total Sub FFS at Qibla Bandi Dam, 2000-10 .............................................................................................................. 86 Annexure 30; Total Sub FFS at Jammergal Dam, 2000-10 ............................................................................................................... 87 Annexure 31; Total Sub FFS at Dhoke Tahlian Dam, 2000-10 ......................................................................................................... 88
3
Author: Dr. Kauser Khan Project Manager CABI South Asia
Rawalpindi,
Pakistan
Tel: +92 (0) 51 9090132
Email: [email protected]
4
Fact sheet of the progress Project Title: Project Duration; 4 Years
Total cost; £158,752 (Rs.18, 742,900)
S.# Target Achievements in %age
1 Field Assistant-TOF April, 2007 to December, 2007 100 %
2 Farmers-TOF January, 2008 to June, 2008 100 %
3 Community Based Research Activities 2008 (no. 10); 2009 (no. 15); 2010
(no. 20) 100 %
4 Farmer Field Schools 2007 (no. 10); 2008 (no. 20); 2009
(no. 30); 2010 (no. 40) 100 %
5 Inland Study Tours entire project period (no.2) 100 %
6 Curricula workshops 2007 (no.1); 2008 (no.2); 2009 (no.1) 100 %
7 Training workshop for Quality Assurance &
Monitoring of FFS processes and activities 2007 (no.1); 2008 (no.1); 2009 (no.1) 100 %
8 Enterprise development, quality control in
agricultural produce and marketing 2008 (no.1); 2009 (no.1) 100 %
9 Rural psychology and social issues 2008 (no.1) 100 %
10 Training workshops for skill enhancement
of Agriculture Officers 2007 (no.1); 2009(no.1) 100 %
11 Planning meetings/workshops 2007 (no.1); 2008 (no.1); 2009 (no.1) 100 %
12 Training workshop on Sanitary & Phyto-
sanitary 2009 (no.1) Additional
13 Training on Insect collection & reservation 2009 (no.1) Additional
14 Global Plant Health Clinic Training
Workshop 2009 (no.1) Additional
15 Effective Presentation Skills Workshop 2009 (no.1) Additional
5
Acknowledgement We are very thankful to Government of Punjab for the provision of the financial assistance to conduct the
Integrated Crop Management through FFS approach in Command areas of small dams of Rawalpindi division.
Special thanks to all the Project Staff.
Very special thanks and appreciations are extended for the very lovely farming community and farmer
trainees for their keen interest and active participation in the training sessions.
The efforts and technical assistance of CABI South Asia team also is greatly acknowledged.
6
Summary The Govt. of Punjab under the Irrigation and Power department initiated the project entitled Command
Area Development of Small Dams in Rawalpindi Division in close collaboration with CABI South Asia,
to build the capacity of staff and farming community of command areas of small dams of district
Rawalpindi, Attock, Jhelum and Chakwal.
Rawalpindi Division consists of Barani area dependent on rainfall for crop productivity. Farmers of the
area in which small dams are situated, needed intensive training so that they can make judicious use of
scarce source of water for the production of cash crops. The introduction of these cash crops certainly
enhanced the income of the poor farming community.
CABI South Asia has provided technical support for the implementation of Integrated Crop
Management (ICM) through capacity building of extension staff and farmers by effective execution of
Training of Facilitators (ToF) & Farmers Field School (FFS) approaches. CABI South Asia transferred
latest package of technology especially off-season vegetable production under plastic tunnel.
Farmer-led season long participatory training was conducted in Regional Office of CABI South Asia
from April 2007 to June 2008. ToF participants & trained farmers were in a position to follow activities in
the field and could easily produce commodities according to desirable standard.
With the help of ToF/FFS activities, farmers changed their cropping pattern. First time, spring maize,
sada behar chara (fodder) and potato crops were introduced by the project in the command areas.
Farmers become organized, motivated for collectively solving their problems.
CABI South Asia conducted a series of trainings workshops. Inland tours were also arranged for the
field staff of the project to learn of on going research and development activities of off-season
vegetables production under plastic tunnel technology.
The project provided an opportunity to:
• Produce fruits and vegetables in compliance with standards of WTO under environmentally
friendly situation
• Reduce poverty of rural population particularly small farmers and women
• Enhance their income and improve standard of living
• Support village level development and capital building, assistance and training
• Favorable environment for future projects
• Feedback process established with key partners
7
Introduction The Government of Punjab has initiated the programme for harvesting rain water by building small
dams in the area for providing irrigation water and thus creating vibrant agricultural activity, jobs and
better livelihoods for the poor. Availability of irrigation water has provided opportunity for growing new
cash-crops, and improving existing practices in the traditionally grown crops.
Since farmers had been doing the subsistence agriculture for centuries, there was a huge potential to
introduce new crops, advance technology, farmers’ training that can provide tremendous opportunity to
train them in a new system of produce management, post harvest management, and marketing.
Traditionally in Rawalpindi division, wheat, maize, millet, sorghum, and groundnut have been grown,
with animals being reared on low quality grazing pastures. Poverty is widespread in rural areas causing
adverse effects on the livelihoods of the people.
Apart from scarcity of water in the Rawalpindi division, several other factors are also contributing to
lowest return in agricultural production e.g. poor management practices, lack in farmer’s capacity to
manage the crop issues, time of sowing, poor quality of seeds, poor storage facilities and less
knowledge of grading, packaging and marketing etc
In this regard, CABI South Asia has trained initially, 17 Master trainers from the agriculture extension in
the first cycle of Training of Facilitator (ToF), while during the second phase 20 farmers were trained.
Total 100 Farmer Field Schools (FFS) were established to train farmers though “learning by doing”
approach over a full cropping season. These master trainers gained better understanding of the
problems relating to their crops and providing solutions through the mutual discussions and sharing of
experiences in participatory way. CABI SA helped to address these issues within the context of the
social and cultural climate of the local communities.
Objectives The overall objective of CABI component was to enhance the income of small farmers by helping them
to increase their production. The emphasis was on capacity building of extension staff and farmers by
effective execution of the Training of Facilitators /Farmer Field Schools (ToF/FFS) approaches in the
project area.
The specific objectives were: Facilitate season long ToF/FFS for the implementation of FPTDD-ICM activities in the project area
Facilitate all the training/curricula workshops/meetings/field day/graduation ceremonies etc as listed in
FPTDD-ICM component
Plan and provide all technical support for the implementation of follow up ToF/FFS activities throughout
the project period
8
Facilitate establishment of networking between FFS and service providers through the department
Methodology The Integrated Crop Management (ICM) using non-formal participatory training methodology has been
identified as a preferred approach to develop capacity of the project staff and farmers for better crop
management and reduce input use especially hazardous pesticides. During the course of project
implementation and due to broad scope of the participatory ICM approach the use of term Good
Agriculture Practices (GAP) has been identified to describe activities under the banner of ICM. The use
of quality seed/crop varieties, best planting time, suitable crop rotation, natural mortality factors, natural
resource management and biological control collectively form the basis for pest control decision-making
in integrated pest management systems. Confidence building and experiential learning by farmers used
to achieve capacity building of extension personnel and farmers using Farmer Field School (FFS)
methodology.
Activities 2007-08 ToF / FFS Schedule Followed The fortnightly schedule was followed during ToF & FFS sessions for Command Area Development of
Small Dam Project (CAD Small Dam) (Annexure 1).
Training of Facilitator (ToF) The project launched on ground a little late and hence ToF
session could start in April, 2007. There were two Training
of Facilitators (ToF) sessions held during the entire project
period i.e. Field Assistant- Training of Facilitators (FA ToF)
(April, 2007 to December 2008) and Farmers- Training of
Facilitators (F ToF) (January, 2008 to June, 2008) while
30 ToF sessions and 14 ToF sessions carried out as FA
ToF and F ToF respectively (Annexure 2). During the
Training of Facilitators different activities were carried out in the ToF as well as in the feed back session
with master trainers on fortnightly basis. All learning’s from ToF sessions then subsequently shared
with FFS participants and implemented in FFS. (Annexure 3)
11%3%
32%54%
Fig:1. Nature of Participation in TOF Sessions Agriculture
Officer
Agri. Reseach Officer Field Assistant
9
Agenda of Training of Facilitator (ToF) Both ToF sessions were held according to set agenda e.g. start from recitation of Holy Quran and
ended with vote of thanks. There was separate agenda for both ToF and Feed back session. Detail is
given below as example;
ToF Session:
• Recitation from Holy Quran
• Basic characteristics of FFS
• Visit to ToF plot regarding Agriculture Ecosystem Analysis (AESA)
• Tea Break
• Preparation of charts, presentation and discussion
• Prayer & Lunch Break
• Special topic
• Group dynamics
• Planning for next session
• Mood Meter
• Day analysis
Feedback Session of ToF
• Recitation of Holy Quran
• FFS feedback chart preparation
• Presentation of feedback and discussion
• Tea break
• Special topic
• Group dynamics
• Lunch & Prayer
• Recommendation & responsibilities sharing
• Mood Meter
• Day analysis
Training of Facilitator (ToF) Activities Following activities were covered during ToF sessions.
Participatory Situation Analysis (PSA) and Participatory Reflection & Action (PRA) ToF participants gone through exercises of PSA & PRA not only for bench mark survey but also having
command on quality establishment of Farmer Field Schools (FFS) (Annexure 4, 5,6,7,8,9,10,11,12,13)
10
Norms Setting For smooth running of the sessions, norms were set with participants. Norms strictly followed by
participants and nobody was excluded from the rules. The norms then set out were;
• Time management (9:30 am ToF session starting time)
• No whispering
• To take permission while saying some thing or asking question (raised hand) i.e. one person at
one time
• Respect each one idea
• Cellular phone should be on vibration
• Permission is must while going out side the session
• No irregular or asymmetrical movement in the vicinity of head office during working hours
• Loyalty with the work
• ToF hall is red zone for smoking
• Politics and irrelevant discussion is not allowed during session.
Hopes & fears of the ToF participants Hopes
• We will get education about facilitation and knowledge in simple
• We will get maximum knowledge about vegetables and other crops
• This will help the life standard of poor farmers
• Will be able to disseminate the gained knowledge to the farmers
• Create self confidence in participants
• Improve the production technology
• Helps in avoiding excessive use of pesticide
• Helps in team building
Fears
• If program will windup in the middle stage then
• Lack of farmers interest may be hinders the objective of the project
• Either farmer will adopt the new technology or not.
• Poor participation creates trouble
• Discussion & meetings may not be on regular basis.
11
Agro Ecosystem Analysis (AESA) AESA stand for Agro Ecosystem Analysis, which is principally based on critical observations of living
things (biotic factors) and non living things (abiotic factors) of crop environment. The ecosystem
analysis provides a method to integrate the many aspects of the crop ecosystem into one drawing that
can then be discussed and analyzed. On weekly basis said activity was carried out in the field and on
the basis of out come of this activity and than discussion through brainstorming on out come, crop
management decision (CMD) was taken for better crop production. Participants were then able to
recognize different stages of sown crops because of regular observation of field. They realized that
keen observation could solve any kind of problem, Conserve natural enemies.
Facilitation and Communication skills, types of communication, characteristics of good
communicator and problems with good communication were discussed in detail.
Practical work Useful practical work also carried out like germination test (use of gunny bags), soil sampling and its
laboratory test and maize seed treatment etc.
Group discussion During TOF sessions discussions were made according to the issues raised or special topics arranged.
Through brainstorming, participatory approach adopted where close attention and respect were given
to the opinions of the participants. At the end of discussion consolidated crop management decisions
(CMD) were made for better crop production.
Chart Preparation After taken AESA in the filed, charts were prepared accordingly. Chart preparation helped in record
keeping and comparison between presented data and previous data.
Presentation
To improve the presentation skills of the participants, presentation was one of the basic activities of
ToF. It developed the skills accordingly.
Land preparation for tunnel technology Clay loamy and well fertile land was selected for tunnel installation in ToF plot having length and width
i.e. 30 ft and 14 ft respectively. Before sowing and transplanting vegetables, land was well prepared.
Well rotten farm yard manure (FYM) was incorporated at the rate of one trolley or 8 tones / acre. Beds
were prepared having following dimensions;
Bed length = 30 ft,
Each bed width = 2 ft
Each ridge width = 2 ft.
12
There were total 3 beds in the tunnel, in which crops were sown according to ridges allocated to each
crop i.e. tomato and cucumber occupied 3 ridges each. All ridges were given light, irrigation until
moisture reached at the corners of beds where plants were to be transplanted
Tunnel installation High plastic tunnel structure having length of 30 ft, 14 ft
height and 12 ft width installed as ToF plot in side the CABI
office. Total 3 rows or beds and 6 ridges were prepared in
side the tunnel. Beds were prepared having dimension .i.e.
bed length = 30 ft, bed width = 2 ft while ridge width = 2 ft
Note: In FFS, size of tunnel was large than that of ToF. In
field high tunnel structure was kept like having length of
104 ft, 11 ft height and 30 ft width. There were 12 rows
having following dimensions
Bed length = 30 ft
Each bed width at corner on both sides = 1.5 ft
Each bed width in middle = 2 ft
Each ridge width = 2 ft
Nursery raising Just inside the tunnel area, one bed nursery was raised
having 6 ft length, 3 ft width and 9 inches height including
3 inches of silt layer. After bed preparation, seeds of
Tomato (Sahil verity), was sown at half inch depth in a zig-
zag manner at a distance of 4 inches in both P x P and R
x R. Mulching was than spread over beds after seeds
sowing to avoid weeds. Water was given with shower to
remain the sown seeds on the same line or place.
Avoiding hidden insects especially termites application of
chloropyriphos @ 2-3 ml/lit of water was given to the nursery. Nursery plants were planted according to
given following specifications; Tomato (P x P distance) = 15 inches and cucumber crop was sown
directly in the tunnel at a distance of 9 inches away to each other.
13
Transfer of nursery in tunnel Before transfer of nursery plants or seedlings to tunnel, heavy irrigation was given to nursery. Nursery
plants were uprooted in such a way that plants roots may not be damaged. After uprooting, roots of
nursery plants were dipped in 2-3 % fungicide solution for half an hour at least.
Temperature and humidity management in the tunnel
During severe and cold weather, management of tunnel acquires more attention because of low
temperature and high humidity, which ultimately provide suitable environment of fungal diseases. Inside
the tunnel, temperature must be kept between 15 and 30 C while humidity percentage must not be
exceeded from 70%. During the month of January, severe cold whether struck the area and hence
maintenance of temperature and humidity according to requirement was unable to manage and in a
result out break of downy mildew and chilling effect occurred. Safe fungicides like Redomil along with
mixture of backing soda, detergent and mustard oil were sprayed for the control of fungal diseases.
Crop management Field observed regularly on weekly basis. What ever needed for crop management, consensus
developed for that in TOF session and interventions made for crop management. Weeding,
fertilizations, control measurement, irrigation application etc were done regularly at need basis
Special topics This activity was linked to the stage of growth of the crop and specific local issues. Main objective was
to build the capacity of ToF participants (Annexure 16). With the help of these topics, participants were
able to understand the crop related issues and faced no difficulties during facilitation skills while sharing
with farmers in the field. Various special topics covered during the course of training are given below;
• Participatory Reflection & Action (PRA) and Participatory Situation Analysis (PSA)
• FFS formation
• AESA and conduction of AESA
• Integrated Pest Management (IPM) and Good Agricultural Practices (GAPs)
• Protocol of quality assurance of FFS
• Agronomic practices
• Bed preparation
• Weeds management
• Nursery establishment
• Tunnel Technology & production
• Effect of pesticides on insect pests and natural enemies
• Disease identification and management
14
• Insect Identification & Role of Natural Enemies
• Vegetables marketing
• Packaging
• Harvest and post harvest management
• Animal housing (Livestock)
• Feeds & Feeding of animal(livestock)
• Breeds & breeding (livestock)
• Day to day disease management (livestock)
• Livestock marketing
Group Dynamics This activity provides an opportunity to develop and enhance cohesion among the participants as a
learning group. Whether it is done as an unfreezing activity or structured learning exercise, group
dynamics highlight the importance and interdependence of individual group members’ performance in
the process of achieving a common goal. A number of exercises and activities were carried out to
achieve this objective while holding the ToF sessions. The list of the group dynamic exercises
undertaken during the ToF Cycle is given as under:
• Body Language
• Hot hot, Cold cold
• Water bridge
• Observing things
• Hopes & fears
• Name game
• How will be the leader
• Back to back and speak (Communication exercise)
• Nine dots
• Wearing the coat
Insect zoo This activity helped participants to increase their understanding of ecological principles in their agro-
ecosystems. With the help of this, participants were able to understand the interaction of pest &
beneficial organisms. in the execution of the ToF/FFS approach. In this regard, following insects, pest,
natural enemies and disease were observed with active involvement of the participants during the
training.
15
• Semilooper
• Army worm
• Cutworm
• Jassid
• Aphid
• Coccinelids (lady bird beetle)
• Spiders
Participants collected flying insect pests and natural enemies from the field and kept them with each
other in the cages (having leaves or fruits etc) for observation.
Participatory Trials Following participatory trials were developed during lay out of ToF plot:
• Raised bed verses flat beds.
• Chemical fertilizer vs farm yard manure (FYM).
• R X R and Pl X Pl distance in maize crop
• Different insect pest management trials like for the
control of cutworm in maize crop, Brain BAT,
mechanical control and release of natural enemies
etc were developed
• Use of plants extract like neem plant as pest
control
• Fertilizer + 6 inch Pl X Pl distance
• FYM + 6 inch Pl X Pl distance
• Fertilizer + 8 inch Pl X Pl distance + Flat bed
• Fertilizer + 8 inch Pl X Pl distance + Raised bed
• Fertilizer + 9 inch Pl X Pl distance
• Fertilizer + 6 inch Pl X Pl distance
• Raised beds for nursery establishment
• Establishment of tomato crop from out-shoots cutting
During AESA, it was observed that production wise trial (D) Fertilizer + 8 inch Pl X Pl + Raised bed
showed better result having 13 Kg production followed by (E) Fertilizer + 9 inch Pl X Pl distance having
11 Kg. While other trials (A, B, C) were almost same production i.e. 9 Kg.
16
Multiply 13 kg with 20 marlas to get production per kanal i.e. 13x20 = 260 Kg than multiply 260 Kg with
8 kanals to get production in acre. i.e.260 x 8 =2080 Kg. To get this production in mond than divide
2080 by 50, we will get production in mond i.e. 2080/50 = 42 mond per acre. This formula has been
followed for all trials and the result is given in figure below.
Insect pest management Field Trials for insect pest management designed during ToF sessions:
• BAT
• Insecticides
• Natural Enemies
• Plants in pest control
• Mechanical Control
1. Wheat Bran BAT Formula:
Wheat bran: 5 kg
Gurh: 1 kg
Water 10 litre
Insecticide 25ml
How to prepare:
Mix all these ingredients well. First solve the gurh through heating or grinding, then place the wheat
bran in a tub or drum. After this, mix insecticide with gurh and pore it on the wheat bran and mix all the
materials well.
How to apply:
Place the bran bat at one meter interval and at late afternoon, because the cutworm comes late at
night.
Result:
0
50
Trial (A)
Trial (B)
Trial C
Trial (D)
Trial (E)
29 29 2942
35M
ond
per A
cre
Trials Specification
Comparison of Production
17
Data of the first night shows that out of 17 cutworms larvae, 12 were found dead inside or near the
BAT, while the rest of 5 insects were inside the soil and escaped because they spend the night
underneath soil.
Insecticides At initial stage, the infestation of cutworms and Halicoverpa zea were found severe. At that stage the
ToF participants decided to spray chemicals due to severe infestation.
Plants in pest control For armyworm we carried out trials of plants extracts application. The detail of which is given below;
Neem oil Trial Neem oil at the ration of 2% was applied for the control of Armyworm. This trial was carried out on 1/3
part of a kanal in the TOF plot.
Chilli and Neem oil Trail Formula:
3.5 tsp of chilli
250ml of Neem oil
Mix it and left it overnight.
Mix 2 tsp of detergent with it and
Pure the solution in 21 litres of water for spray in the field.
This trial was carried out on 1.3 kanal of the TOF plot.
Garlic Trail Formula: 85gms of Garlic
50ml of Kerosene oil or vegetable oil
Left this solution overnight
Then mix 10 ml soap with it or 0.5 tsp detergent
950ml of water
Shake this mixture and place it in a bottle.
For spray in the field mix one part of the solution with 19 parts of water for spray.
Natural Enemies Trichogramma were released after ten days of the chemicals application for eggs parasitism.
Livestock management
18
Apart from vegetables and other crops, participants were also educated with livestock knowledge. CABI
SA livestock specialist Dr. Khalid Farooq shared knowledge & experiences with participants.
Thoroughly discussion was made in this regard and number of special topics delivered by specialist.
FFS Activities There were 10 Farmer Field Schools (FFS) associated with FA-TOF while 20 Farmer Field Schools
(FFS) were associated with F-TOF as practicing FFS. So whatever enlisted in that of TOF are the
activities of FFS.
Results and discussions Project played significant role in the agriculture based livelihood of the area. Farmers realized the
importance of the project. The farmer-led season long participatory training gave opportunity to the
farmers for extensive skill and knowledge gain.
Spring maize was introduced first time in the farming system of the command area as a cash crop.
Spring maize variety 6525 at all four dams gave highest yield (124.5 mounds/acre) as compared to
32w86. In this particular trail of spring maize both varieties were treated with same dose of fertilizer. i.e
2 bags of DAP + 2 bags of Potash + 2 bags of Zinc Sulphate (5 Kg each) + 4 bags of Urea. The main
reason is that Spring Maize Varieties have more heat unit requirement per day for vigorous plant
growth and almost maintaining 28000 plants per acre. More over the Variety 6525 has more tolerant to
heat as compared 32w86. This is a very critical factor because after the frost season when temperature
increases rapidly and almost at the time of flowering, if temperature rises beyond the limit of 25 0C, it
directly affects the pollen grains and abortion of ovaries will take place. The end result is poor seed
setting. The variety 6525 has high percentage of adoptability to this particular type of environment of
Potohar region.
Sada Behar Chara was also introduced first time in the cropping system of the command area. The
farmers of the command area become very happy with this versatile fodder which not only increased
the production of milk but also increased the fattening of the animals. It produced more yields in those
Dungi Dam, 25
Jammergal Dam,
89
Dhoke Tahlian Dam, 74
Qibla Bandi
Dam, 75
Farmers trained as practicing FFS in each Dam
19
days when scarcity of fodder could observe through out the Barani area. Due to its tremendous effect in
re-sprouting replaced the old traditional Sorghum, Bajra and Desi Maize in the command area. This
produced more than double production as compare to local one.
Along with spring maize and sada behar chara, potato crop was also introduced first time in the area to
minimize the old cropping system. Apart from these, different varieties of winter & summer vegetables and autumn maize were also sown and results were very encourging.
Off-season vegetables production under high plastic tunnel technology was relatively new idea for the
farming community of the command area. Tunnel technology offer not only early production of the
crops but also helps farmers to fetch more money from their commodities. This technology needs
proper attention to maintain the desire temperature and humidity otherwise fluctuation in temperature
and humidity can cause serious problems in terms of disease out break and chilling effect. Therefore, it
is very important to maintain the temperature and moisture level according to requirements i.e.
temperature level must be between 15 to 30 0C while humidity should not be exceeded from 70 %. In
situations, when humidity levels are above the desired level then it becomes necessary to have proper
ventilation for keeping the percentage of humidity down while for low temperature, plastic sheet from
tunnel may be removed after 9:30 am from sides when there is full sunny day. It was observed that due
to severe cold, low temperature and high moisture contents inside the tunnel could provide favorable
condition for the out break of fungal diseases (downy mildew, late blight etc). In addition, it was also
noted that low temperature causes chilling effect and due to this, stress condition were recorded on
crops. Less amount of water is required for Irrigation inside the tunnel as compare to open field. It was
proved that during the months of December, January and February, percentage of humidity level is
comparatively high inside the tunnel therefore controlled irrigation is needed at such time and hence
number of irrigation may reduce.
In over all circumstances it was noted that cucumber crop has shown insignificant or poor result in
both production and income wise. This is only as a consequence of downy mildew and fusarial wilt
(Fusarium specie) diseases. Unforgiving out break of downy mildew was observed at the time of harsh
& severe cold weather struck the area. i.e. from last week of the December till February. As a result,
fluctuation in weather in the shape of low temperature & high humidity occurred, which is favorable
condition for the growth of the downy mildew.
Cucumber Management includes proper temperature (between 15 to 30 Co) & moisture condition (must
not exceed from 70 %) inside the tunnel.
As far as tomato is concerned it is comparatively hard crop shown tolerance to some extend in above
situation. Attack of early blight (Alternaria solani) and late blight (Phytophthora infestants) was observed
20
at early stages of the crop. These diseases were coping with help of controlled irrigation, optimal
temperature & moisture level in side the tunnel and judicious use of fungicides.
Good Agricultural Practices (GAPs) Following were the GAPs being introduced during TOF &
FFS sessions:
• Before bed preparation, soil test was carried out.
Application of well rotten Farm Yard Manure (FYM) to
keep land soft and well fertile. Bed was then prepared
for sowing of desire crops
• First time Introduced spring maize, sada behar chara
as fodder and potato in the area
• Introduced new varieties of autumn maize, summer & winter
vegetables
• Good quality seed purchased from a well reputed company.
Seed treatment and proper seed placing were carried out
• Raised beds were kept in both nurseries as well as in field
• Proper Plant to Plant and Row to Row distance for good
plant health were kept
• Proper ventilation and judicious use of irrigation through out
the winter season for the appropriate maintenance of
temperature and humidity inside the tunnels
• Proper raised bed prepared along with well
drainage system in the tunnels
• Cucumber and tomato crops kept upward instead
of led on ground, threads were used as
supporting materials
• Maximum numbers of plants were sown in limited
area with the help of supporting materials
• Timely removal of off-shoots
• Nursery prepared from off-shoot cuttings of
tomato crop in small polythene bags and used as replacement or open field cropping
21
• Judicious use of proper fungicides along with local totka i.e. use of mixture of mustard oil
backing soda and detergent at required ratio for the control of fungus
• Used of micro nutrients as foliar spray
• Drenching
• Picking and harvesting with equipments
Cost Benefit Ratio Net income in the tunnel is far better than open field cropping. Average production per plant also had
shown better result. Technology proved that large number of plants can easily be sown in a confined
peace of land.
Economic analysis of tomato production under high plastic tunnel (104ft length x 11ft height x 30 ft
width) technology is as follows. There were total 6 rows in TOF plot while on each row 20 plants were
sown. After harvesting, each row has given approximately 105 Kg production. So 105 x 3.5 = 367.5 Kg
(104 ft length) and 367.5 x 12 rows = 4410 Kg (30 ft width) while average rate of tomato per Kg
recorded as Rs. 27. (Annexure 15)
Results show that there is significant gain from investment in this activity.
Workshops Arrangement and conduction of different workshop was one of the mandatory tasks of CABI South Asia
component of CAD Small Dam Project.
Interactive Workshop for Capacity Building of Agricultural Professionals
There were different short training/workshops topics encompassed in this interactive workshop. Detail
is given below;
Total Production (Kg)
Cost of Production (Rs)
Gross Income (Rs) Net Income (Rs)
Tomato 4410 65600 110250 44650
Total Production
(Kg)
Cost of Production
(Rs)
Gross Income (Rs)
Net Income (Rs)
Thou
sand
Cost Benefit Ratio at TOF Tunnel
22
• Rural psychology and social issues
• Facilitation, communication and presentation skills
• Enterprise development, quality control in agricultural produce and marketing
• Training for quality assurance and monitoring of FFS processes and activities
Curricula Development Workshop on Tunnel Vegetables A three days workshop on “Curricula Development of
vegetables production in tunnels was organized by CABI
South Asia in June, 2008. The purpose of the workshop
was to develop curricula on vegetable tunnel farming and
to find out solutions for all off season vegetable farming.
The participants were from different educational,
research, extension and development organizations.
Prior to workshop, Participatory Situation Workshop
(PSA) was carried out to chalk out related issues.
Training on Insect collection & preservation A comprehensive training on identification and collection
of insects in proper way was imparted to project staff and
an insect collection kit was provided to them for insect
collection and preservation. Each Insect collection kit
consisted of a set of materials (see annexure. )
Success Stories Most of the farmers expressed positive views about the
achievement of the project (Annexure 17,18,19, 20, 21, 22, 23, 24).
Activities 2008-09 Activities carried out by CABI South Asia component of CAD Small Dam Project, during the 2008-09
are given below;
Review/Feedback Session Target 11
Achieved 8
The purpose of feedback sessions was to liaison project activities among CABI and small dam project
staff to discuss and find solutions for the difficulties faced by farmers while running FFS sessions and
any other agenda which can improve the quality of FFS.
23
Back stopping of Farmer Field Schools (FFS) Farmers Field Schools (FFS) facilitated by the Agriculture Officer of each dam were visited by Expert
Field Facilitator of CABI South Asia for back stopping of the sessions. Technical know how was shared
with each FFS participant about low & high plastic tunnel activities. Two visits were made per month at
each dam.
Farmers were trained during backstopping of FFS visits practically about nursery establishing for
tomato crop through seeds & off-shoots, transplantation techniques, Pl x Pl and row x row distance,
fertilization, irrigation and disease management.
Trainings & Workshops During this period of the project, CABI South Asia
successfully organized and conducted a series of trainings
and workshops on different topics. The topics selected for
the workshops were according to the need of the project
staff and farmers. Objectives of the Training & Workshops
were:
• To build and enhance the capacity of agriculture
staff and farmers
• To address the weak areas being faced by the staff
and farmers while doing agriculture activities
• To formulate and develop training modules
• To provide forums for different stakeholders in order
to discuss and share their experiences with each
other
Targeted Trainings/Workshops
• Skill Enhancement training on situation handling
• Quality Assurance of FFS Workshop
• Curricula Development Workshop (Wheat & Maize)
Additional Trainings/Workshops
• Training workshop on Sanitary & Phyto-sanitary
• Training on Insect collection & reservation
• Global Plant Health Clinic Training Workshop
• Effective Presentation Skills Workshop
24
Skill Enhancement training on Situation handling & Quality Assurance of FFS This training/workshop held on 18th January, 2009
Curricula Development Workshop on Wheat & Maize Wheat and maize are major crops of the Potohar area.
Realizing the situation and need of the farmers, CABI-SA responded very timely to support them in this
context, developing comprehensive, all-inclusive and
wide-ranging curricula for wheat & maize crops
(Annexure 14). Before conducting the workshop, ground
work was done in the shape of participatory situation
analysis (PSA) to identify issues of wheat & maize crops.
Training Workshop on Sanitary & Phyto-sanitary The workshop was organized by CABI South Asia on
19th Jan, 2009 for introducing quality standards of
marketing according to WTO agreements to agricultural professionals about international sanitary and
phyto-sanitary standards.
Training’s Objectives were to:
• Enhance understanding about Sanitary and Phyto-Sanitary measures
• Analyze SPS measures affect on the Vegetable production
• Identify the measures to improve the SPS compliance of vegetables in Pakistan
• understand the International Compliances e.g. HACCP, BRC and Global GAP
• Identify the SPS constraints for Pakistan Horticulture Export
• Identify the hurdles for Horticulture Export from Pakistan
Training Workshop on Global Plant Health Clinic This 4 days unique training was organized by CABI South Asia from 21st to 24th April, 2009. The main
objective of the workshop was to find out diagnosing and remedy strategies of the plant diseases.
Inland Tour For capacity building of project staff CABI South Asia arranged inland study to Institute of Horticultural
Sciences, University of Agriculture, Sitara Chemicals Faisalabad, Shadi Farm, Mamokanjan, Sargodha
Citrus orchards, Tarnab Research Farm, Agricultural University Peshawar and farmers of low tunnels at
Akora Khatak.
Objective of the an Inland Tour was to:
25
• Experience sharing with farmers and different agricultural based institutions
• study and learn more about different agriculture activities with special emphasis on off-season
vegetables production under plastic technology
• Exposure to on-going research & development activities on fruits and vegetables
Special Topics This activity was linked to the stage of growth of the crop and
specific local issues. Main objective was to build the capacity of
TOF/feedback sessions participants. With the help of these
topics, participants were able to understand the crop related
issues and faced no difficulties during facilitation skills while
sharing with farmers in the field. During feedback sessions,
participants suggested for arranging special topic on the following topics;
• Vegetables disease management
• Insect Collection & Preservation
• Livestock & fodder management
Hence, as per their demand, above mentioned topics were
arranged for them during feedback session and resource
persons engaged accordingly.
Group Dynamics This activity provides an opportunity to develop and enhance
cohesion among the participants as a learning group. Whether it is done as an unfreezing activity or
structured learning exercise, group dynamics highlight the importance and interdependence of
individual group members’ performance in the process of achieving a common goal. A number of
exercises and activities were carried out to achieve this objective while holding the feedback sessions.
The list of the group dynamic exercises undertaken during the sessions is given as under:
• 16 dots Game
• Water bridge
• Big fish & small fish
Insect Zoo Conducting of the insect zoo using locally available material play an important role in helping farmers
gain a deeper understanding of insect pests and natural enemies in the area. This knowledge is useful
for them for informed decision making. The field management decisions through ecosystem analysis, of
26
which insects form a major part, is considered pivotal in the execution of the FFS approach. In this
regard, following insects, pest, natural enemies were observed with active involvement of the
participants during the FFS training.
• Lady bird beetle & aphids
• Lemon butterfly
Good Agricultural Practices (GAPs) During FFS sessions, agriculture officers and farmers were facilitated to use following good agricultural
practices:
• Before bed preparation for all high tunnels and low tunnels at each dam well rotten Farm Yard
Manure (FYM) applied to keep land soft and well fertile
• Good Quality and disease free Seeds of tomato (Sahil variety) and Squashes (Karizma)
purchased from a well reputed company
• Germination test of both varieties was held before sowing in the field to check the %age of
germination. In the result, more than 90 % germination occurred
• Proper plant X plant and line X line distance kept for tomato and squashes. Detail is as under;
o Tomato Crop: Plant X Plant = 1.5ft and Line X Line = 2 ft
o Squash Crop: Plant X Plant = 1.5 ft and Line X Line = 5ft
• At all dams, tomato nursery established on raised beds with suitable Pl X Pl (3 inch) and L X L
(3 inch) distance
• Proper look after held regarding water showering, hardening, and transplantation techniques
• Used proper raised beds along with well drainage system for tomato and squash crops in the
field
• Optimum used of fertilizers
• Judicious use of proper fungicides along with local totka i.e. use of mixture of mustard oil,
backing soda and detergent at required ratio for the control of fungus
• Chemicals Spray avoided at the time of picking and harvesting
• que lure were installed for the control of cucurbitae fruit fly Bactrocera cucurbitae) at Chakwal,
Jehlum, Attock and Gujar Khan
On-Farm Participatory Research Activities
Early production of vegetables under low plastic tunnels started as
on-farm participatory research activity at each dam i.e. Dungi,
27
Jamergal, Qibla and Dhoke Tahlian dams. The detail is given below;
At each dam, two plots of having one kanal area each were selected for early production of vegetable
(Squash or Tinda) under low plastic tunnel technology. Farmers were facilitated in the areas like bed
preparation, tunnels installation, method of seeds sowing, Pl x
Pl and L x L distance, fertilization, irrigation, weeding, pesticide
application and harvesting technology.
This activity shown better result in terms of production (average
1888 Kg/kanal) and cost benefit ratio i.e. 1: 1.5. Practicing
farmers were satisfied from the result and expressed
willingness to do such farming technology in future.
Installation of Fruit Fly monitoring Traps A number of population and symptoms of fruit fly were
observed on squash crop. Installation of fruit fly traps
containing Cue lure to attract the Bactrocera. Cucurbitae were
installed at each site.
Graphical representations of population dynamics of Bactrocera cucurbitae at various dams. Result
shows that population of Bactrocera cucurbitae started increasing from 1st week of April at Dhoke
Tahlian dam. It reached at peak in 2nd week of May and started decreasing onwards till end of report
period. Its population started in 1st week of April and reached at peak in 3rd & 4th weeks of this month
Population dynamics of Bactrocera cucurbitae at various dam
0
50
100
150
200
250
Apr,09(1)
Apr,09(2)
Apr,09(3)
Apr,09(4)
May,09(1)
May,09(2)
May,09(3)
May,09(4)
Jun,09(1)
Weeks
Adul
ts o
f Ba
ctro
cera
cuc
urbi
tae
28
in Dungi dam. It decreased up-to the end of report period. Similarly at Jamergal dam population of the
said specie started in 1st week of April while decreased in 2nd week of this month and then began to
boost and reached at peak in 3rd week of May. It decreased downward till the 1st week of June, 09. As
far as Qibla Bandi dam is concerned, it slightly decreased in 2nd week of April and then increased and
reached at peak in last week of May, 2009. It decreased onward to the end of reporting period.
Cost benefit ratio Cost of production of low plastic tunnel technology
S # Expenditure of mini tunnel Rs/kanal Total
2 30 Kg plastic sheet @ Rs.165/Kg = Rs. 4950/= but sheet can be
used for the next season hence this rate squeeze to half
2475 2475
3 240 Bamboo sticks having length of 6 ft @ Rs. 17/stick = Rs. 4080/=
but it can be used for 2 years hence rate should be counted as half
for first season
2040 2040
4 5 Kg Rope @ Rs. 75/Kg 375 375
5 320 Seeds @ Rs 1.8/Seed 576 576
6 Fertilizer (DAP 5 Kg @ 65/Kg + Urea 20 Kg @ 15/Kg + Potash 5 Kg
@ 28/Kg)
765 765
7 Pesticide 700 700
8 Labour Charges 3000 3000
9 Tractor 500 500
10 Irrigation 800 800
11 Miscellaneous 1000 1000
Total cost of production 12,231
29
Cost of Production
Average Production
Total IncomeNet Income
12231
1888
39887
27656
Average production, average rate, gross income and net income of squash under low plastic tunnel
technology/kanal at each dam
S #
Name of Farmer Dam Production in
Kg/kanal Average Rate/Kg
Total Income Net Income
1 Muhammad Asif Dungi(Gujar
Khan) 2000 22 44,000 31,769
2 Mukhtar Hussain do 1900 21 39,900 27,669
3 Waheed Qiblabandi
(Attock) 1800 20 36,000 23,769
4 Anwar Khan do 2100 22 46,200 33,969
5 Arshad
Mehmood
Jamergal
(Jehlum) 1950 19 37,050 24,819
6 Raja Nasir
Mehmood do 1700 22 37,400 25,169
7 Muhammad
Riasat
Dhoke
Tehlian
(Chakwal)
1850 23 42,550 30,319
8 Samad Khan do 1800 20 36,000 23,769
Average Production & Rate 1888 21 39,887 27,656
Cost Benefit Ratio of early production of vegetables under low plastic tunnel technology
Result shows that there is significant
difference between cost of production
(Rs. 12,231) and total income (Rs.
39,887) and hence average net income
(Total income – Cost of Production) in
above one kanal tunnel is recorded
much better i.e. Rs.27, 656/= while total
average production is 1888 Kg.
Therefore Cost Benefit Ratio =
39887/12231 = 3.26 = 1:3.26
In other words, for every one Rupee
spent as cost of production for low tunnel production, it returned Rs. 3.26
30
Activities 2009-10 Monthly Meetings For the smooth running of the activities and keep liaison with its partner CAD Small Dam office, CABI
South Asia started monthly meetings with the project staff of the CAD Small Dam Project held on
regularly basis on first Tuesday of every month.
Participants of the Monthly Meetings:
Mr. Sayed Aman Ullah Shah, Project Director CAD Small Dam Project
Dr. Kausar Iqbal Khan, Project Manager, CAD Small Dam Project CABI Component
Mr. Muhammad Zahir shah, Project Officer, CAD Small Dam Project CABI Component
Mr. Rai Muhammad Arshad Khan, Agriculture Officer Qibla Bandi Dam
Mr. Irfan Hafeez, Agriculture Officer Jammergal Dam
Mr. Hafiz Baksh Muhammad, Agriculture Officer Dhoke Tahlian Dam
Mr. Zahid Kiani, Agriculture Officer Dungi Dam
Mr. Sajjad Saeed, Assistant Research Officer, CAD Small Dam Project
Following decisions were made in the first monthly meeting;
• There will be eleven numbers of Farmers Field Schools (FFS) at each dam except Dungi dam
(Gujar Khan) where number of FFS will be seven. All FFSs of each dam will conduct a Joint
FFS session on monthly basis for training purpose.
• Number of farmers at each FFS will be at least five
• Session of each joint FFS would be conducted as per following schedule for four months i.e.
start from 1st November, 2009 till 28th February, 2010.
Dungi Dam: 1st Thursday of every month
Qibla Bandi Dam: 2nd Thursday of every month
Jammergal Dam: 3rd Thursday of every month
Dhoke Tahlian Dam: 4th Thursday of every month
• One member from each FFS will be selected for data collection of his tunnel on weekly basis for
the period of four months start from Nov, 2009 to February, 2010.
• Honoraria Rs. 100/- per week will be paid to the above mentioned FFS member on account of
his services regarding data collection. This fund will be given by CABI-South Asia.
• Amount for refreshment of each joint FFS session will be allocated by CABI SA on actual basis
but not more than Rs. 2500/-
31
• List of FFS members for Joint FFS session will be provided by concerned Agriculture Officer of
each dam on the 1st session.
• CABI South Asia will organize two trainings events for project staff (Four Agriculture Officer, one
Assistant Research Officer and Four Field Assistants) on the following topics.
• One day training on “Management of agriculture in Command Areas of Small Dams” Islamabad
tentatively in January, 2010.
• Five day training (Theory and exposure visit) on “Rain water harvesting & water conservation
techniques (Adoption of sprinkler & drip irrigation system” in Khushab, Bahawalpur and area
suitable for this activity.
• CABI South Asia will install low tunnel of one kanal area at each dam for community based
research activities.
• List of farmers and site selection for the low tunnel activity will be provided by concerned
Agriculture Officer of each dam not later than 10th Oct, 2009.
• CABI South Asia budget will be re-appropriated accordingly to accommodate additional
activities decided in the meeting held on 1st Oct, 2009.
• This monthly meeting will be held among small dam field staff and CABI staff on first Tuesday of
every month at 10:30 am sharply at Project Director Agriculture of CAD Small dam office.
• Research Officer of CAD small dam project will be responsible for planning and conducting at
least five community based research (CBR) activities per dam.
• Special topics on “tomato nursery raising establishment” and “Integrated Pest Management
(IPM) of vegetables” will be given by Project Officer of CABI South Asia in Joint FFS sessions at
all dams
Event based curricula developed for Joint FFS Session (See below in the summary of Joint FFS
Session).
Joint FFS Session
Joint FFS sessions started from 1st week of Oct, 2009 according
to agreed schedule. First of all organizational structure of Joint
FFS session made at each dam accordingly. (Annexure 26, 27,
28, 29, 30, 31)
Objectives of the Joint FFS sessions
• Formation & Registration for Joint FFS
• Name of Joint FFS
• Venue selection for the Joint FFS session
32
• Selection of Chairman & Deputy Chairman for Joint FFS
• Formation & name of sub FFS
• Selection of group leaders for each sub FFS
• Selection of members for data collection on weekly basis in their respective tunnels
• Handing over materials required for Joint FFS session like white charts, board & permanent
markers, writing pads, color pencils, scales, etc to concerned Agriculture Officer of each dam.
Event Based Sessions following curricula along with field observation was conducted in the monthly meeting in Joint FFS
session at each dam.
• Introduction & Organizational Structure of Joint FFS
• Objective of Joint FFS
• Organizational Structure of Joint FFS
• Formation of Sub FFS
• Venue selection for the meeting of Joint FFS
• Selection of Chairman & Deputy Chairman for Joint FFS
• Selection of Chairman & Deputy Chairman for Sub FFS
• Selection of logistic support members
• Selection of Farmers for weekly basis data collection/dam
• Who will do what & how? Responsibilities
• Distribution of materials among participants
• Registration & Receipt Form formation
• Process of data collection i.e Agro-ecosystem analysis (AESA)
• Nursery Raising establishment and Transplantation of seedlings methodologies and their pre-
requisites
• Seed source
• seed/variety selection
33
• seed treatment methods
• Seed screening test to check its viability
• Seed purity
• Germination Test
• Importance of nursery
• Site selection for nursery raising
• Soil Type
• Organic Matter
• Importance of Organic Matter
• Soil health and history of the site
• Soil treatment methods
• Calculation of nursery area for vegetable production
• Calculation of no. of plants in nursery
• Practical demonstration of nursery layout and design
• Ploughing and land leveling
• Nutrient management of nursery land
• Composting
• How to prepare good compost
• Structure of the polythene tunnel for the nursery raising
• Seed bed preparation
• Raised beds and Flat beds
• Drainage and its importance in nursery raising
• Mulching
• Irrigation
• Harding of the seedlings
• Nursery Uprooting/Transplanting
• Selection of Healthy seedlings
• Up rooting methodologies
• Seedling treatment with fungicide
• Tunnel Farming
• Why tunnel farming?
• Selection of vegetable crops for low tunnel, walk-in and high tunnel
34
• Land preparation for tunnels
• Use of green manure
• Fertilization for tunnel farming
• Pl X Pl and L X L distance
• Weeding
• Irrigation
• Effect of humidity & temperature
• Management inside the tunnel
• Cost benefit ratio. Cost of production for all kind of tunnels
• Net production & income
• Integrated Pest Management (IPM)
• Introduction to IPM
• What is pest?
• Types of pest
• Importance & benefits of IPM
• Principles of IPM
• Control of major insect pests through IPM
• Control of fruit borer, aphids, white fly, cut worm, pumpkin beetle etc by applying IPM strategy
• Control of major diseases through IPM
• Management of downy mildew, powdery mildew, root rot, late blight, early blight, wilting etc by
applying IPM strategy
• Weeds management through IPM strategy
• Marketing of yields produced inside the tunnels Tunnel
• Handling, packing, storage of harvest commodities
• Market Information appraisal
• Establishment of market channels
• 4 Ps of Marketing
• Cost benefit ratio
• Marketing of nursery plants
35
Grow Healthy Seeds
• Good seed health is the first step for better production. Therefore to enhance productivity and
having good health seeds, following characteristics must be addressed before purchasing &
sowing of seeds.
Seed Source
• Seeds should be certified from reliable source
• Well-matched with the weather of the cultivated area
Selection of Variety
• Use only those varieties which are suitable for the area
• Read carefully seed germination %age, name of variety, company, time of producing and time
of expiration on the seed packet before put in money.
• Purchased seeds should be free from seed born diseases
• They must have capability of resistant
• Seeds must be free from adulteration
• Ensure that germination test held before sowing of purchased seeds.
Seed Treatment
• Seed treatment through hot water
Steps:
• Take distill water and kept it on fire up to 50 C°
• Then put the desired seeds in a cloth and kept that cloth in the water up to 30 minutes.
• Then take the hot water treated seeds and placed them in fresh water for a while.
• Only use dried seeds for sowing
• Seed Treatment through Fungicide Application
• Seeds born diseases can also be controlled with the application of recommended fungicides like
Redomil, Mankozeb and Diathane M-45 etc @ 2-3 gm/Kg seeds.
Botanical Treatment Steps:
• Take garlic and grind it
• Then extract water from the grinded garlic
• Then treat the seeds with the solution of the garlic extracts
• How to know about the alive and dead seeds?
36
Steps:
• Pour water in an open mouth utensil
• Then put down seeds in the water
• See and wait for a while
• You will find that some seeds are floating in water while others do not and reach to the bottom
• It is obvious that those seeds which reached to the
bottom are alive while those floating in water are dead
• Separate dead seeds from the alive
Seeds Germination Test in %age
• Before sowing of seeds, it is very much important to
test the seeds with regard to germination capability of
seeds. Process of germination is given below;
Steps:
• Take a piece of soaked cloth (jute)
• Placed 100 numbers of seeds in line on soaked cloth
• Then cover seeds with another fold of jute cloth
• Now placed them in a shadow place at room
temperature.
• Showering water at least two time in twenty four hours
• After 4-6 days, germination occurs.
• Now count number of germinated seeds (say 80
numbers of seeds are germinated)
• This means that 80 seeds out of 100 are germinated
and hence %age is 80%
• Almost 80-85 % germination occurs which is required
germination %age rate
Nursery Raising & Establishment
• It is recommended that nursery should be raised & established for those crops/vegetables which
grow slowly during initial stages e.g. tomato, sweet pepper, hot pepper and brinjal etc
Importance of nursery
• Seeds grow fast due to proper environment
• Control use of seeds and hence cost of production minimized
37
• Management of seedlings of crops/vegetables is easy due to small beds
• Weeding is comparatively easy.
• Plants are more healthy and grow fast after transplantation
• Site selection for nursery raising
• Land should be evenly leveled
• Avoid saline soil
• Well drainage system
• Near to dwell
• Near to transplantation field
• Open place not under the shadows of trees
Soil Type
• Upper surface of the soil mostly up to 6-12 inch must be fertile as plants take nutrients & water
from this limited surface
• Soil must be soft as it helps in smooth growth of the roots
• Loamy soil gives good result
• Selected site for nursery raising should be free from soil born diseases
• Do not miss the soil test
• The remains of previous crops must be buried and destroyed
• How to control soil born diseases?
• In hot season, cover the selected area by plastic sheet up to 7-8 days and then remove the
plastic sheet and finally level the land
• If intensity of soil born diseases is high then apply Formalin for complete annihilation of
diseases and insects. After application of Formalin, cover the land by plastic sheet and left the
cover up to one week
• Remove the remains of the weeds and previous crop
• At least one month prior apply Furadon or Carbofuron @ 6-7 Kg/acre to selected area of the
nursery
Organic Matter
• It is decaying plant or animal materials, most commonly compost, green manure, animal
manure and micro organisms etc
Importance of Organic Matter
• It is an agent to improve soil structure, maintain tilth, and minimize erosion
38
• Serve as revolving nutrient bank account
• Enhance water absorbing capacity of the soil
• Provides nutrients to beneficial organisms of the soil
• With the help of organic matter, plants become resistant to the attack of diseases
• By use of organic matters, use of chemical fertilizers could be minimized to some extend.
• Ensure safe environment
• Over all soil is in good condition
Land Preparation and sowing methodology for Tomato Nursery Establishment
• Select fertile and loamy soil with good drainage system
• One month prior, level the land and use rotten Farm Yard Manure (FYM)
• Avoid fresh FYM during nursery raising
• At least three days before sowing, apply NPK according to land requirement.
• Now prepare at least 6 inch raised bed having dimension (20ft length and 3ft width)
• Then take silt and pass through mesh
• Now spread the meshed silt over bed and form layer up to 3 inch and then level the surface.
• Now take stick and press it on the surface of bed to draw lines for sowing. Line x Line distance
should be 3 inch
• Bed is ready for sowing
• Just sow tomato seeds with out any pressing on the line at a distance of 3 x 3 inch
• After sowing of seeds, apply mixture of well rotten FYM and silt with the help of mesh thoroughly
on bed
• To protect the seeds from birds and keep optimum moisture level, cover the bed with the help of
dried plant parts (Parali or sooka)
• At first showering, add insecticide (Chloropyriphos @ 3gm/lit) to protect seedlings from termites
and other hidden insects
• Irrigate the nursery at least two times during the 24 hours up to 3-4 days and after that water
should be given on need basis.
• Check regularly the nursery and remove the dried parts of the plants (Parali or sooka) very
carefully if germination occurs even of a single seed
• Stop irrigation after 2-3 weeks of germination for the purpose of Harding of the seedlings. This
will boost the resistant mechanism of the seedlings against unsavory condition like drought etc.
39
Nursery Uprooting/Transplantation of Seedlings
• Irrigate the nursery just 24 hours before transplantation to ensure easily up-rooting
• Use small spade (kurpa) for up-rooting. Avoid up-rooting through hand, it may cause injury to
the roots of the seedlings
• Always transfer healthy seedlings
• Do not delay transplantation after up-rooting, it may effect negatively on the health of the
seedlings
• Treat and dip properly up-rooted seedlings in a fungicide (Redomil, Mencozeb, Diathane M-45
etc @3 gm/lit) solution for at least 45 minutes
• Irrigate the ridges of the field before transplantation of the seedlings
• Make sure that seedlings are transplanted in that area of the ridges where moisture level
reached
• Stay away the stem and roots of the seedlings from direct contact of the water during
transplantation
Low Tunnel Activity As per activities planned for the fourth year of the project, off-season vegetables production under low
plastic tunnels activity has been completed by CABI South Asia well in time on one kanal area at each
dam. Detail is given below
S #
Dam Crop Variety Host
Farmer Remarks
1 Dungi Squash
(Tinda) Riano
Mukhtar
Hussain
-Tunnels installation completed up to 2nd
week of Dec, 2009 (Well in time)
- 90 % germination occurred
2 Qibla Bandi do Karishma Abdul
Waheed
Tunnels installation completed up to 2nd
week of Dec, 2009 (Well in time)
- 90 % germination occurred
3 Jammergal do Riano +
Karishma Ali Asghar
Tunnels installation completed up to 2nd
week of Dec, 2009 (Well in time)
- 85 % germination occurred
4 Dhoke
Tahlian do
Riano +
Karishma Masuood
Tunnels installation completed up to 2nd
week of Dec, 2009 (Well in time)
- 85 % germination occurred
40
Cost Benefit Ratio
0
5,000
10,000
15,000
20,000
25,000
QiblaBandidam,
Attock
Dhoktahlian,Ckakwal
DungiDam,
Gujar khan
Jamargaldam,
Jehlam
Total CostProfit per kanal
Cost benefit ratio
Cost benefit ratio of Vegetable production under low tunnels
Dam
Varie
ty
Are
a D
uration
Prod
uctio
n ( K
g)
Ave
rage
pric
e pe
r Kg.
Tota
l Ave
rage
Val
ue
(Rs.
)
Expenditure (Rs.)
Total Cost
Profit per
kanal
Land
pr
epar
atio
n
Irrig
atio
n
Seed
s
Fert
ilize
r
Com
post
, FYM
Fung
icid
es a
nd
Pest
icid
es
Plas
tic &
B
ambo
o st
icks
Tran
spor
tatio
n
Qibla Bandi dam,
Attock Car
ishm
a
! Kan
al
Mar
ch 2
, 201
0 to
Jun
e 10
, 20
10
1,840 20 36,800 500 1,000 450 2,000 300 1,000 500 3,000 13,250 23,550
Dhok tahlian, Ckakwal R
HIN
O
! Kan
al
Mar
ch 2
, 20
10 to
May
24
201
0
1,080 30 32,400 500 800 450 2,000 200 1,000 500 1,200 11,150 21,250
Dungi Dam, Gujar khan R
HIN
O +
C
aris
hma
10 M
arla
ea
ch
Mar
ch 2
, 20
10 to
Jun
e 30
201
0
1,200 28 33,600 600 1,000 450 2,000 400 1,000 500 0 10,450 23,150
Jamargal dam,
Jehlam RH
INO
+
Car
ishm
a
11 M
arla
eac
h Fe
brua
ry 2
1,
2010
to M
ay 2
5,
2010
1,100 30 33,000 800 900 450 2,000 200 1,000 500 0 10,350 22,650
41
Monitoring of Field activities
42
43
44
Identification of viral disease on Summer squash in small dam command area A survey for disease on cucurbits crops was conducted in Gogar khan and Jhelum small dam sites.
Virus-like symptoms were observed in all fields visited. A severe disease was observed on summer
squash (Curcubita pepo). Both aphids and whiteflies were present in the field. Symptoms of the disease
were found on the vegetative portion but not on the fruit. The disease started with leaf curling, mosaic
and with enations on the upper sides of leaves followed by stunting. In view of the symptoms of the
disease and prevalence of viruses in the area, both begmoviruses and RNA viruses were suspected.
DNA was extracted from leaf samples by the method described by Doyle and Doyle (1990). Each DNA
sample was diluted to a uniform concentration of 1μg. PCR was carried out using universal primers
which have the ability to amplify any begomoviruses. Primers were designed in a highly conserved
region of the C1 ORF (Briddon and Markham, 1995). The primers used in PCR were Begomo1
(CCGTGCTGCTGCCCCCATTGTCCGCGTCAC) and Begomo2
(CTGCCACAACCATGGATTCACGCACAGGG) that were expected to produce a PCR product of about
1.1 kb. Fragments of the expected size were amplified from nine samples out of twelve and products
were cloned in TA cloning vector pTZ57RT (Fermentas). Confirmation of clones was done by EcoRI
and PstI restrictions sites in plasmid vector and a fragment of 1.1 kb was released. Confirmed clones
were sequenced from Macrogen, Korea. Sequence analysis of the cloned product showed the highest
sequence identity (91%) to Tomato leaf curl new Delhi virus (ToLCNDV). ToLCNDV is a cosmopolitan
species that has frequently been identified in cucurbits (Maruthi et al., 2007; Tahir and Haider, 2005;
Guzman et al., 2000; Revill et al., 2003; Morales and Jones, 2004). However, Koch’s postulates for
ToLCNDV causing diseases of cucurbits have not been satisfied. DNA sequence data and to lesser
extent, biological characteristics are the currently accepted criteria for defining species of
geminiviruses. These findings suggest that the DNA virus associated with summer squash is
begomovirus already reported from different cucurbit species. Work for identification of RNA virus
associated with the disease is in progress.
45
Closing ceremony at each dam
46
Project Closing Ceremony
47
CAD Small dams Project Budget Utilization
Sr #
Description of account
Budget Re -
appropriated Budget
Mar-07 to June-07
July-07 to June-08
July-08 to June-09
July-09 to April-10
Unutilized Budget
PKR PKR PKR PKR PKR PKR PKR
1 Total
Establishment Cost 6,214,000 6,334,151 521,118 1,408,603 1,828,881 1,619,000 956,549
1
Senior Project
Manager (6 Month
Every Year)
1,536,000 1486,416 172,155 280,916 432,000 432,000 169,345
2 Expert Field Facilitator 1,500,000 1,569,304 90,000 360,360 449,304 430,560 239,080
3
Insect Bio Control
specialist (4 Month
every year )
1,040,000 1,016,334 80,000 200,000 288,000 264,000 184,334
4 Technical Resource
Person 190,000 210,000 60,000 60,000 58,000 0 32,000
5 Field /Lab. Assistant
(2 Nos) 1,084,000 1,158,340 50,000 275,088 350,736 254,976 227,540
6 Office Clerk/
Computer Operator 495,000 508,000 42,015 131,863 139,156 125,213 69,753
7 Drivers (01only) 369,000 385,757 26,948 100,376 111,685 112,251 34,497
2 Total
Operational Cost 5,505,000 3,935,278 154,558 908,676 1,014,389 1,398,953 458,702
1 Travelling &
Subsistence 900,000 569,583 3,620 120,292 167,926 306,007 -28,262
2
Mobility
Charges/Vehicle
Charges @ Rs 18 per
KM
3,000,000 1,970,928 15,516 468,522 556,500 626,885 303,505
3 Supplies & Materials 550,000 379,690 28,154 71,949 25,006 174,934 79,647
4 Chemicals 325,000 276,780
37,104 93,210 94,074 52,392
5 Communication 180,000 175,104 14,127 46,126 53,629 55,415 4,807
6 Utilities 150,000 177,283 25,821 46,590 52,587 41,927 10,358
7 Contingencies 400,000 385,910 67,320 118,093 65,531 98,711 36,255
48
Sr # Description of account
Budget Re -
appropriated Budget
Mar-07 to June-07
July-07 to June-08
July-08 to June-09
July-09 to April-10
Unutilized Budget
PKR PKR PKR PKR PKR PKR PKR
3 Total
Training Cost 4,980,000 6,521,371 501,400 3,060,203 1,774,662 926,428 258,678
1 Training
Workshops/Meeting 850,000 2,810,000 0 1,552,229 1,108,420 95,787 53,564
2 Inland study Tours 250,000 250,000 0 100,177 135,316 0 14,507
3
Training of Facilitator
For Master Farmer
(F-TOF)
1,000,000 1,026,482 501,400 524,951 0 0 131
4
Training of Facilitators
for Field Assistants
(FA-TOF)
590,000 415,889 0 413,037 0 0 2,852
5 Farmer Field School
(FFS) activities 2,290,000 2,019,000 0 469,809 530,926 830,641 187,624
4 Total
Capital Items 340,000 248,200 248,200 0 0 0 0
1 Computer With all
accessories 90,000 89,000 89,000 0 0 0 0
2 Microscope 120,000 99,800 99,800 0 0 0 0
3 Steel Cages 30,000 14,400 14,400 0 0 0 0
4 Steel Racks 100,000 45,000 45,000 0 0 0 0
Institutional charges 10% 1,703,900 1,703,900 142,528 537,748 461,793 394,438 167,393
Grand Total 18,742,900 18,742,900 1,567,804 5,915,230 5,079,725 4,338,819 1,841,322
49
Annexure 1; ToF / FFS schedule for CAD Small Dam Project Day Activity
Monday ToF Session with Master Trainer at Office of CABI SA
Tuesday Farmer Field Schools Sessions at each small dam
Wednesday Farmer Field Schools sessions at each small dam
Thursday Farmer Field Schools sessions at each small dam
Friday Feed Back session at Regional Office CABI SA
Annexure 2; TOF Participants
S # Name of Participants Rank Nature of TOF
Area
1 Muhammad Irfan
Agriculture
Officer
FA-TOF
Jammergal Dam (Jhelum)
2 Muhammad Zahid Kiani Dungi Dam (Rawalpindi)
3 Hafiz Muhammad Baksh Dhoke Tahlian (Chakwal)
4 Rai Muhammad Irshad Qibla Bandi (Attock)
5 Muhammad Sajjad Research
Officer Head Office (Islamabad)
6 Shakeel Asghar
Field Assistant
Dhoke Tahlian
7 Shaigan Waqas Jammergal
8 Ashraf Mehmood Qibla Bandi
9 Tamoor Zafar Dungi
10 Aftab Anwar Dhoke Tahlian
11 Irfan Haider Jammergal
12 Muhammad Ibrahim Qibla Bandi
13 Muhammad Iqbal Dungi
14 Khizar Usmani Dungi
15 Muhammad Afzal Qibla Bandi
16 Saifullah Jammergal
17 Muhammad Faisal Qibla Bandi
18 Khan Afsar
Farmer Qibla Bandi (Attock) 19 Abdil Waheed
20 Ashfaq Ahmad
50
21 Muhammad Altaf
Farmer F-TOF
Qibla Bandi (Attock) 22 Khalid Mehmood
23 Tariq Mehmood
24 Raja Nasir Mehmood
Jammergal (Jehlum)
25 Muhammad Akram
26 Imtiaz Ali
27 Haji Rehmat
28 Ishtiaq Ahmad
29 Mirza Mukhtiar Ahmad
Dungi (Rawalpindi) 30 Ch. Shabaz
31 Muhammad Nazir
32 Haji Jehangir
33 Mirza Khan
Dhoke Tahlian (Chakwal)
34 Jehangir Ahmad
35 Muhammad Aatif Malik
36 Ameer Sultan
37 Hamid Ashraf
Annexure 3; Command areas under Small Dams S # Name of Dam Command Area/Villages Responsibility
1 Qibla Bandi Dam (Attock) Qibla Bandi, Barazai, Kotkay
and Malik Mala
Mr. Rai Muhammad Irshad
(Agri. Officer)
2 Dungi Dam (Rawalpindi) Dungi, Duhray and Duhama Mr. Muhammad Zahid Kiani
(AO)
3 Dhoke Tahlian Dam (Chakwal) Dhor Tahlian, Jhatla and Kalan
Wali
Mr. Hafiz Muhammad Baksh
(AO)
4 Jammergal Dam (Jehlum)
Vara Gujran, Jammergal,
Dhoke Jumma and Chapri
Rajgan
Mr. Muhammad Irfan (AO)
51
Annexure 4; Farmer Field School, Dungi Dam, Gujar Khan
S. No
Name Village Acerage (kanals)
Area under cash crop
Owner / tenant
crops and vegetables grown
1 Muhammad Jahangir S/o
Muhammad Sharif Duray 22 12 Owner
Maize,
Wheat,
Summer &
winter
vegetables
2 M. Qasir S/o Abdul Rehman Duray 27 10 Owner
3 Haji Abdul Qudoos S/o
Hakeem Duray 20 20 Owner
4 M. Shahbaz S/o Abdul Sultan Dungi 30 20 Owner
5 M. Rasheed S/o Abdul
Rehman Dungi 40 30 Owner
6 Mamga Khans S/o Mehboob
Alam Dungi 70 8 Owner
7 M. Latief S/o M. Saddique Dungi 10 30 Owner
8 Nizakat Hussain S/o M.
saddique Dungi 40 8 Contractor
9 Fiyaz Ahmad S/o M. Yousif Dungi 15 30 Tenant Wheat,
Summer &
winter
vegetables
10 Mazhir Hussain S/o Barkat
Hussain Dungi 25 10 Owner
11 Mirza M.Mukhtar Ahmed S/o
farzand Ali Dungi 40 20
Owner/Co
ntractor
12 M. safir s/o Bagh Ali Duhamma 15 5 Owner
Wheat,
Summer &
winter
vegetables
13 M. shahzad S/o Adalat
Hussain Duhamma 15 5 Owner
14 M.Akbar S/o Mukar rab Khan Duhamma 10 10 Tenant
15 M. Banaras S/o F. Hussain Dungi 20 18 Owner
16 M. Iqbal S/ o Anwar Hussain Dungi 5 5 Tenant
17 Abdul Ghaffor S/ o Alam Din Dungi 20 20 Owner
18 Ch. Razaaaq S/ o Faiz Alam Dungi 10 10 Owner
19 M. S. Aalam S/ o M. Alam Dungi 5 5 Owner
20 Refaqat Hussain S/o Dungi 5 5 Owner
52
SowarHussain
21 Shabbir Hussain S/o Fazal
Hussain Duhamma 6 6 Owner
22 Ghulam yaheeya S/o
Munsibdar Duhamma 18 15 Owner
23 M.Fazal S/o Qurban Duhamma 5 5 Owner
24 Safdar Hussain S/o M. Alam Dungi 12 10 Owner
25 Shukat Hussain S/o M.
Saddique Dungi 25 14 owner
53
Annexure 5; Farmer Field School Varagujran, Jamergl Dam, Jehlum
S. No
Name Village Acerage (kanals)
Area under cash crop
Owner/ Tenant
Number of crop and vegetable grown
1 Fazal Ahmed S/o
Ahmed Khan V. Gujran 40 40 Owner
Maize, Wheat, Summer
& winter vegetables
2 Nasir Hussain S/o
Noor Ahmed V. Gujran 64 64 Owner
Maize, Wheat, Summer
& winter vegetables
3 Rehmat Khan S/o
Hakim Khan V. Gujran 64 64 Owner
Maize, Wheat, Summer
& winter vegetables
4 Ghulam Hussain
S/o Makkhan Khan V. Gujran 48 40 Owner
Maize, Wheat, Summer
& winter vegetables
5 Arshad Mehmood
S/o Hakim Ali V. Gujran 64 64 Owner
Maize, Wheat, Summer
& winter vegetables
6 Muhammad Ikram
S/o M. Akram V. Gujran 64 64 Owner
Maize, Wheat, Summer
& winter vegetables
7 Rehmat Khan S/o
Ghulam Hussain V. Gujran 96 88 Owner
Maize, Wheat, Summer
& winter vegetables
8 Muhammad Iqbal
S/o Sahib Din V. Gujran 40 40 Owner
Maize, Wheat, Summer
& winter vegetables
9 Qasim Abbas S/o
Bhader Khan V. Gujran 80 72 Owner
Wheat, Summer & winter
vegetables
10 Bagh Ali S/o Lal
Khan V. Gujran 40 40 Owner
Wheat, Summer & winter
vegetables
11 Shahid Mehmood
S/o Rehamat Khan V. Gujran 40 40 Owner
Wheat, Summer & winter
vegetables
12 Muhammad Siddiq
S/o Allah Din V. Gujran 48 48 Owner
Wheat, Summer & winter
vegetables
13
Ansar Mehmood
S/o
Rehmat Khan
V. Gujran 40 32 Owner Wheat, Summer & winter
vegetables
14 Nazar Muhammad V. Gujran 40 40 Owner Maize, Wheat,
54
S/o Fazal Ahmed
15 Ehsan Elahi S/o
Nawab Khan V. Gujran 40 40 Owner Maize, Wheat,
16 Rehmat Khan S/o
Muhammad Iqbal V. Gujran 40 40 Owner
Maize, Wheat, Summer
& winter vegetables
17 Muhammad Sabir
S/o Karam Ali V. Gujran 40 24 Owner
Maize, Wheat, Summer
& winter vegetables
18 Mangta Khan S/o
Bhader Khan V. Gujran 24 24 Owner Maize, Wheat,
19 Muhammad Akram
S/o Tajay Khan V. Gujran 120 104 Owner
Wheat, Summer & winter
vegetables
20 Ghulam Rasool S/o
Bhader Khan V. Gujran 80 80 Owner
Wheat, Summer & winter
vegetables
21 Ghulam Rasool S/o
Muhammad Ramzan V. Gujran 24 24 Owner
Wheat, Summer & winter
vegetables
22 Muhammad Zaman
S/o Khwaj Din V. Gujran 24 24 Owner
Summer & winter
vegetables
23 Muhammad Yaqoob
S/o Ahmed Khan V. Gujran 40 36 Owner
Wheat, Summer & winter
vegetables
24 Rehmat Khan S/o
Muhammad Alim V. Gujran 80 68 Owner
Summer & winter
vegetables
25 Ghulam Hussain
S/o Khushi Muhd. V. Gujran 40 40 Owner Maize, Wheat Fodder
26 Mazhar Iqbal S/o
Muhammad Bashir V. Gujran 40 40 Owner Maize, Wheat, Fodder
55
Annexure 6; Farmer Field School Jammergal, Jammergal Dam Jehlum
S.
No Name Village
Acreage
(kanals)
Area under
cash crop/
vegetable
Owner/
Tenant
Number of crop and
vegetable grown
1 Muhammad Rafiq
S/o Baag Ali Jammergal 32 24 Owner
Wheat, Fodder
Summer & winter
vegetables
2 Kushi S/o Faqir
Muhammad Jammergal 16 16 Owner
Summer & winter
vegetables
3 Sub.Maj. S/o M.
Azam Jammergal 24 24 Owner
Maize, Wheat,
Summer & winter
vegetables
4 Muhammad Walayat
S/o Feroz Khan Jammergal 16 16
Owner,
Tenant
Wheat, Fodder, Millet
Mung, Mash
5 Muhammad Sharif
S/o Raaj Wali Jammergal 16 16 Owner
Wheat, Fodder, Millet
Mung, Mash
6 Mazhar Hussain S/o
Ghulam Rasool Jammergal 24 24 Owner
Summer & winter
vegetables
7 Sultan Ahmed S/o
Allah Ditta Jammergal 32 24 Owner
Wheat, Fodder, Millet
Mung, Mash
8 Hafiz Tahir S/o
Muhammad Ramzan Jammergal 32 32 Owner
Wheat, Fodder, Millet
Mung, Mash
9 Muhammad Akram
S/o Mehdi Khan Jammergal 24 24 Owner
Wheat, Fodder, Millet
Mung, Mash
10 Muhammad Iqbal S/o
Allah Ditta Jammergal 16 16 Owner
Summer & winter
vegetables
11 Farraq Hussain S/o
Makhan Khan Jammergal 24 24 Owner
Wheat, Fodder, Millet
Mung, Mash
12 Muhammad Rafiq
S/o Godar Khan Jammergal 64 64 Owner
Wheat, Fodder, Millet
Mung, Mash
13 Sub. Sheer Afzal S/o
Afzal Khan Jammergal 32 32 Owner
Wheat, Fodder, Millet
Mung, Mash
56
14 Abdul Rehman S/o
Nazim Ali Jammergal 40 32 Owner
Wheat, Fodder, Millet
Mung, Mash
15 Khadim Hussain S/o
Fazal Ahmed Jammergal 24 24 Owner
Wheat, Fodder, Millet
Mung, Mash
16 RASIB S/o Ghulam
Rasool Jammergal 16 16
Owner,
Tenant
Wheat, Fodder, Millet
Mung, Mash
17 Abdul Latif S/o
Ghulam Hassan Jammergal 16 16 Owner
Summer & winter
vegetables
18 Abdul Ghaffar S/o
Allah Ditta Jammergal 112 112 Owner
Wheat, Fodder, Millet
Mung, Mash
19 Munawar Hussain
S/o Feroz Khan Jammergal 240 240 Owner
Wheat, Fodder, Millet
Mung, Mash
20 Muhammad Yaqoob
S/o Jevan Khan Jammergal 16 16 Owner
Wheat, Fodder, Millet
Mung, Mash
21 Arshad S/o Fazal
Karim Jammergal 48 48 Owner
Wheat, Fodder, Millet
Mung, Mash
22 Haji Rehmet S/o
Ghulam Ali Jammergal 64 64 Owner
Wheat, Fodder, Millet
Mung, Mash
23 Imtiaz S/o Ghulam
Muhammad Jammergal 48 48 Owner
Wheat, Fodder, Millet
Mung, Mash
24 Abid S/o Rehmet
Khan Jammergal 56 48 Owner
Wheat, Fodder, Millet
Mung, Mash
57
Annexure 7; Farmer Field School Dhoke Jumma, Jammergal Dam, Jehlum
S. No Name Village Acerage (kanals)
Area under cash crop/ vegetable
Owner/ Tenant
Number of crop and vegetable grown
1
Nasir Mehmood
S/o Ghulam
Mustafa
Dhoke
Jumma 24 24 Owner
Maize, Wheat, Summer
& winter vegetables
2 Rehmet S/o
Karim Buskh
Dhoke
Jumma 96 88 Owner Wheat, Fodder
3 Zahoor Ahmed S/o
Abdul Ghafoor
Dhoke
Jumma 64 64 Owner
Maize, Wheat, Summer
& winter vegetables
4 Muhammad Rasib
S/o Rajib Ali
Dhoke
Jumma 24 24 Owner Wheat, Fodder
5
Mehmood Hussain
S/o
Muzafar Khan
Dhoke
Jumma 40 40 Owner Wheat, Fodder
6 Allah Dad S/o
Nawab Khan
Dhoke
Jumma 32 32 Owner Wheat, Fodder
7 Imtiaz S/o
Niaz Ali
Dhoke
Jumma 40 40 Owner
Maize, Wheat, Summer
& winter vegetables
8
Ghulam Sarwar
S/o
Nawab Khan
Dhoke
Jumma 400 368 Owner
Maize ,Wheat, Summer
& winter vegetables
9
Muhammad
Nawaz S/o
Ameer Alam
Dhoke
Jumma 40 40 Owner
Maize, Wheat, Summer
& winter vegetables
10 Safdar S/o
Abdul Karim
Dhoke
Jumma 24 24 Owner Wheat, Fodder
11 Karam Ali S/o
Pehalwan Khan
Dhoke
Jumma 480 464 Owner Wheat, Fodder
58
12 Raja Ilyas S/o
Bawar Khan
Dhoke
Jumma 280 280 Owner
Maize, Wheat, Summer
& winter vegetables
13
Imran Khan S/o
Muhammad
Safdar
Dhoke
Jumma 8 8 Owner
Wheat, Fodder, Millet
Mung and Mash
14 Zarayat S/o
Allah Dad
Dhoke
Jumma 16 16 Owner
Wheat, Fodder, Millet
Mung &Mash
15 Ghulam Nabi S/o
Muhammad Alam
Dhoke
Jumma 32 32 Owner
Maize, Wheat, Summer
& winter vegetables
16 Usman Ghani S/o
Rehmat Hussain
Dhoke
Jumma 40 40 Owner
Maize, Wheat, Summer
& winter vegetables
17 Javed Akhtar S/o
Ghulam Rasool
Dhoke
Jumma 24 24 Owner
Wheat, Fodder, Millet
Mung, Mash
18
Muhammad Akram
S/o
Adalat Khan
Dhoke Shadi 32 32 Owner Wheat, Fodder, Millet
Mung,Mash
19
Tariq Mehmood
S/o
Rehmet Khan
Dhoke Shadi 24 24 Owner Wheat, Fodder, Millet
Mung, Mash
20 Iftikhar Ahmed S/o
Arif Dhoke Shadi 16 16 Owner
Wheat, Fodder, Millet
Mung &Mash
21
Muhammad Arif
S/o
Rehmat Khan
Dhoke Shadi 24 24 Owner Wheat, Fodder, Millet
Mung &Mash
22
Tariq Mehmood
S/o
Rehmat Khan
Dhoke Shadi 40 40 Owner Wheat, Fodder, Millet
Mung &Mash
23
Choudary Khan
S/o
Imam Din
Dhoke Shadi 40 40 Owner Maize, Wheat, Summer
& winter vegetables
24 Iftikhar Ahemd S/o
Muhammad Ashraf Dhoke Shadi 16 16 Owner
Wheat, Fodder, Millet
Mung &Mash
25 Muhammad Arif Dhoke Shadi 24 24 Owner Wheat, Fodder, Millet
59
S/o
Rehmet Khan
Mung,Mash
26
Nusrat Mehmood
S/o
Rehmet Khan
VaraGujran 64 64 Owner Maize, Wheat, Summer
& winter vegetables
27
Muhammad Rafiq
S/o
Feroz Khan
VaraGujran 16 16 Owner Wheat, Fodder, Millet
Mung &Mash
28 Malik Basheer S/o
Malik Nazir DhokeJumma 24 20 Owner
Wheat, Fodder, Millet
Mung &Mash
29 Rasheed S/o
Mehmoob Alam Vara Gujran 64 64 Owner
Maize, Wheat ,Summer
& winter vegetables
30 Tariq S/o
Neik Alam Vara Gujran 32 32 Owner
Maize, Wheat, Summer
& winter vegetables
31 Arshad S/o
Ghulam Rasool Vara Gujran 160 152 Owner
Maize Wheat, Summer
& winter vegetables
60
Annexure 8; Farmer Field School Qibla Bandi, Qibla Bandi Dam, Attock
S. No
Name Village Acerage (kanals)
Area under cash crop
Owner/ Tenant Number of crop and vegetable grown
1
Muhammad
Ismael S/o
Mehtab Din
Qibla
Bandi 08 08 Owner
Summer & winter
vegetables
2
Muhammad
Ishfaq S/o M.
Ashraf
Qibla
Bandi 10 10 Owner
3
Muhammad
Refan S/o Umar
Khan
Qibla
Bandi 12 11 Owner
4 Sher Rehman S/o
Noor Muhammad
Qibla
Bandi 28 28 Owner
5
Muhammad
Saleem S/o Mian
Dad
Qibla
Bandi 16 16 Owner
6
Muhammad
Sheraz S/o Abdul
Ghafoor
Qibla
Bandi 08 08 Owner
7 Safdar Khan S/o
Abdul jabbar
Qibla
Bandi 16 16 Owner
8
Muhammad
Farman S/o Gul
Zaman
Qibla
Bandi 48 42 Owner
9 Muhammad Nisar
S/o Gulzar
Qibla
Bandi 20 20 Owner
10 Shaukat Ali S/o
Mian Dad
Qibla
Bandi 10 10 Owner
11 Hukam Khan S/o Qibla 10 10 Owner Wheat, Fodder,
61
Karam Dad Bandi Millet & Mash
12 Khalid Mehmood
S/o Abdul Malik
Qibla
Bandi 5 5 Owner/contractor
13
Muhammad
Anwar S/o Ahmad
Khan
Qibla
Bandi 80 76 Owner +cont.
14 Master Ghaus S/o
Fazal Elahi
Qibla
Bandi 12 12 Owner + Cont
15 Mushtaq Ahmed
S/o M. Asraf
Qibla
Bandi 16 16 Owner
Wheat, Fodder,
Maize, Mung &
Mash
16 Abdul Wahid S/o
Banaras Khan
Qibla
Bandi 50 50 contractor
17 Sadaqat Khan
S/o Makhan Khan
Qibla
Bandi 08 08 Owner
18 Safer Ahmed S/o
Sher Afsar
Qibla
Bandi 52 50 contractor
19
Sher Afsar S/o
Muhammad
Sadiq
Qibla
Bandi 20 20 Owner
20 Rafaqat S/o
Sheikh Farid
Qibla
Bandi 18 15 Owner
21
Muhammad
Maskeen S/o
Main Dad
Qibla
Bandi 16 16 Owner
22 M. Anwar S/o
Ahmad Khan
Qibla
Bandi 16 16 Owner
23 Azmat Khan S/o
Muzaffar Khan
Qibla
Bandi 24 24 Owner
24 Abdul Rasheed
S/o Abdul Aziz
Qibla
Bandi 20 18 Owner + cont.
25 Ayub Khan S/o
Muhammad Azad QiblaBandi 12 12 Owner + Cont
62
Annexure 9; Farmer Field School Barazai, Qibla Bandi Dam, Attock
S. No
Name Village Acerage (kanals)
Area under cash crop
Owner/ Tenant
Number of crop and vegetable grown
1 Muhammad Arshad
S/o Dilwar Khan Brazai 125 120 Owner
Summer & winter
vegetables
2 M. Sultan S/o
Muhammad Anwar Brazai 30 30 Owner
Summer & winter
vegetables
3 M. Refan S/o
Muhammad Zaman Brazai 10 10 Owner
Maize, Wheat, Summer
& winter vegetables
4 Muhammad Amin S/o
Muhammad Daud Brazai 12 12 Owner
Wheat, Fodder, Millet
& Mash
5 Muhammad Naeem
S/o Abdul Qadir Brazai 24 24 Owner
Wheat, Fodder &
vegetables
6 Muhammad Saleem
S/o Ghulam Mahmood Brazai 16 16 Owner
Summer & winter
vegetables & wheat
7 Mumraiz S/o Fazal
Dad Brazai 30 30 Owner
Wheat, Fodder, Maize
& vegetables
8 Muhammad Taj S/o
Abaid Ullah Brazai 48 42 Owner
Wheat, Fodder, Millet
Mung & Mash
9 Javed S/o Haji
Muhammad Khan Brazai 25 25 Owner Wheat, Fodder & Millet
10 Banaras Khan
S/o Waris Khan Brazai 40 40 Owner
Summer & winter
vegetables
11 Tariq Mehmood S/o
Muhammad Shafi Brazai 24 24 Owner
Summer & winter
vegetables & wheat
12 Abdul Rauf S/o Karim
Dad Brazai 10 10 Owner
Wheat, Fodder & Millet 13
Haji Tariq Khan S/o
Haji Abdul Aziz Brazai 80 80 Owner
14 Aslam Khan S/o Fazal Brazai 20 20 Owner
63
Dad
15 Muhammad Nawaz
S/o Abdul Khaliq Brazai 16 16 Owner
Wheat, Fodder, Millet &
Mung.
16 Ayub Khan S/o
Dilawar Khan Brazai 20 16 Owner
Wheat, Fodder, Maize
Mung & Mash
17 Muhammad Yamin
S/o Abdul Rahim Brazai 25 25 Owner
Maize, Summer &
winter vegetables
18 Muhammad Irshad
S/o Sohbat Khan Brazai 20 20 Owner Wheat & Fodder
19 M. Rafaqat S/o Fazal-
e-wodood Brazai 12 12 Owner
Wheat, Fodder, Maize
& Mash
20 M. Altaf S/o Abdul
Rauf Brazai 24 24 Owner
Wheat, vegetables &
Rice 21
Sajawal S/o Sami
Ullah Brazai 16 16 Owner
22 Ahsan S/o Sikandar Brazai 30 28 Owner Wheat, Fodder& Millet
23 Shabbir S/o M. Ashraf Brazai 30 30 Owner Wheat, summer &
winter vegetables
24 M. Daud S/o Bahadur Brazai 20 18 Owner Wheat, Millet, Maize,
Mung & Mash
25 M. Ashraf S/o
Shamroze Khan Brazai 12 12 Owner Wheat, Fodder & Maize
64
Annexure 10; Farmer Field School Malik Mala, Qibla Bandi Dam, Attock
S. No
Name Village Acerage (kanals)
Area under cash crop
Owner/ Tenant
Number of crop and vegetable grown
1 Azmat Khan S/o
Muhammad Nawaz Malik Mala 52 52 Owner
Wheat, Fodder
Summer & winter
vegetables
2 Haider Zaman S/o
Muhammad Sultan Malik Mala 40 40 Owner
Summer & winter
vegetables& wheat
3
Muhammad Zahir
S/o Muhammad
Taha
Malik Mala 10 10 Owner Maize, Wheat, Summer
& winter vegetables
4
Tariq Mehmood
Khan S/o Gohar
Rehman Khan
Malik Mala 54 54 Owner Wheat, Fodder &
Sugar-cane
5 Mushtaq Khan S/o
Fazal Khan Malik Mala 24 24 Owner
Wheat, Fodder, Millet &
Maize
6 Banaras Khan S/o
Dilawar Khan Malik Mala 16 16 Owner
Summer & winter
vegetables
7 Sarder Khan S/o
Ghafoor Khan Kotkay 16 16 Owner
Wheat, Fodder, Millet,
Mash & Maize
8 Haji Yamin s/o Abdul
Ghafoor Kotkay 24 24
Owner
+ Cont
Wheat, Fodder, Millet
Mung & Mash
9 Qasir Khan S/o
Mehdi Zaman Malik Mala 20 20 Owner Wheat, Fodder &Millet
10 Muhammad Shakil
S/o Abdul Wakil Malik Mala 10 10 Owner
Summer & winter
vegetables
11 Farid Khan S/o
Hashim Khan Malik Mala 14 13 Owner
Wheat, Fodder, Millet
& Mash
12 Ansar S/o Imam G. Malik Mala 08 08 Owner Wheat, Fodder & Millet
13 Muhammad Arif S/o Kotkay 48 40 Owner Wheat, Fodder,
65
Murrsaleen Summer & winter
vegetables
14 Qaiser Mehmood
S/o Yamin Khan Kotkay 12 12
Owner
+ Cont
Wheat, Fodder, Mung
& Mash
15
Khuram Shahzad
S/o Muhammad
Safdar
Kotkay 16 16 Owner Wheat, Fodder, Millet &
Mung.
16 Safdar Khan S/o
Dilawar Khan Kotkay 20 16 Owner
Wheat, Fodder &
vegetables
17 Akram Khan S/o
Ayub Khan Kotkay 25 25 Owner
Maize, Summer &
winter vegetables
18
Adrees
S/oMuhammad
Ishaq
Kotkay 20 20 Owner Wheat, Fodder, Maize,
Mung & Mash
19 Safder Khan S/o
Dilawar Khan Kotkay 12 12 Owner
Wheat, Fodder, Maize
& Mash
20 Sheraz s/o Maskeen Kotkay 18 15 Contrac
tor
Summer & winter
vegetables
21 Banaras Khan S/o
Muhammad Younis Kotkay 16 16 Owner
Wheat, Fodder, Millet
& Maize
22
Dil Nawaz S/o
Muhammad
Maskeen
Kotkay 40 40 Contrac
tor
Summer & winter
vegetables
23 Muhammad Amjad
S/o Fazal Dad Kotkay 16 16 Owner
Wheat, Millet, Maize,
Mung & Mash
24 Aman Khan S/o Sher
ur Rehman Kotkay 20 18 Owner
Wheat, Millet, Maize,
Mung & Mash
25 Bazid Khan S/o Mir
Dad Kotkay 12 12
Owner
+ Cont
Wheat, Fodder &
Maize,
66
Annexure 11; Farmer Field School Dhoke Tahlian, Dhoke Tahlian Dam, Chakwal
S. No
Name Village Acerage (kanals)
Area under cash crop
Owner/ Tenant
Number of crop and vegetable grown
1 Mirza Khan S/o Arab
Husain
Dhoke
Tahlian 130 70 Owner
Maize, Wheat, Summer
& Winter Vegetables.
2 Raja Gulbarg S/o
Ghazanfer Ali
Dhoke
Tahlian 200 110 Owner Maize, Wheat & Fodder
3 Ch. Fazal Husain
S/o Ghulam Husain
Dhoke
Tahlian 20 20 Owner
Wheat, Summer &
Winter Vegetables.
4 Anser Mehmood S/o
M. Yusaf
Dhoke
Tahlian 75 60
Owner+
Cont
Maize, Wheat, Summer
& Winter Vegetables
5 Tsawer Iqbal S/o
Sohnda Khan
Dhoke
Tahlian 20 20
Owner+
Cont
Maize, Wheat, Summer
& Winter Vegetables
6 Jahangir S/o Fazal
Dad
Dhoke
Tahlian 50 45
Owner+
Cont
Maize, Wheat, Summer
& Winter Vegetables
7 Habib Bakhsh S/o
Allah Bakhsh
Dhoke
Tahlian 75 70 Owner
Fodder, Maize, Wheat,
Summer &, Winter
Vegetables.
8 Nazim Afzal S/o
Bahadar Khan
Dhoke
Tahlian 25 25 Owner
Wheat, Fodder,
Summer & Winter
Vegetables.
9 Sbd. M. Ashraf S/o
Abdullah Khan
Dhoke
Tahlian 12 12 Owner
Wheat, Fodder,
Summer & Winter
Vegetables.
10 Raja M. Asghar S/o
Adalat Khan
Dhoke
Tahlian 80 80 Owner
Wheat, Fodder,
Summer & Winter
Vegetables.
11 Iftikhar Ahmad S/o
Gulab Din
Dhoke
Tahlian 24 20 Owner
Wheat, Fodder,
Summer & Winter
Vegetables.
67
12 M. Doraiz S/o
Nawab Ali
Dhoke
Tahlian 25 20 Owner
Wheat, Fodder,
Summer & Winter
Vegetables.
13 Muhammad Arif S/o
Murrsaleen Kotkay 48 40 Owner
Wheat, Fodder,
Summer & winter
vegetables
14 Qaiser Mehmood
S/o Yamin Khan Kotkay 12 12
Owner
+ Cont
Wheat, Fodder, Mung
& Mash
15
Khuram Shahzad
S/o Muhammad
Safdar
Kotkay 16 16 Owner Wheat, Fodder, Millet &
Mung.
16 Safdar Khan S/o
Dilawar Khan Kotkay 20 16 Owner
Wheat, Fodder &
vegetables
17 Akram Khan S/o
Ayub Khan Kotkay 25 25 Owner
Maize, Summer &
winter vegetables
18 Adrees S/o
Muhammad Ishaq Kotkay 20 20 Owner
Wheat, Fodder, Maize,
Mung & Mash
19 Safder Khan S/o
Dilawar Khan Kotkay 12 12 Owner
Wheat, Fodder, Maize
& Mash
20 Sheraz s/o Maskeen Kotkay 18 15 Contrac
tor
Summer & winter
vegetables
21 Banaras Khan S/o
Muhammad Younis Kotkay 16 16 Owner
Wheat, Fodder, Millet
& Maize
22
Dil Nawaz S/o
Muhammad
Maskeen
Kotkay 40 40 Contrac
tor
Summer & winter
vegetables
23 Muhammad Amjad
S/o Fazal Dad Kotkay 16 16 Owner
Wheat, Millet, Maize,
Mung & Mash
24 Aman Khan S/o Sher
ur Rehman Kotkay 20 18 Owner
Wheat, Millet, Maize,
Mung & Mash
68
Annexure 12; Farmer Field School Kalan Wali, Dhoke Tahlian Dam, Chakwal
S. No Name Village Acerage (kanals)
Area under cash crop
Owner/ Tenant
Number of crop and vegetable grown
1 Imtiaz Husain
S/o Khuda Dad Kalan Wali 12 12 Owner
Wheat, Fodder Summer
& winter vegetables
2 Mehboob Saqlain
S/o Sohnda Khan Kalan Wali 44 40 Owner
Wheat, Summer &
winter vegetables
3 Arab Husain S/o
Pasand Khan Kalan Wali 13 13 Owner
Wheat, Summer &
winter vegetables
4 Mazhar Husain S/o
Ghulam Husain Kalan Wali 05 05 Owner
Wheat, Fodder, Millet &
Mash
5
Muhammad Ashraf
S/o Ghulam
Muhamad
Kalan Wali 24 24 Owner Wheat, Fodder & Maize
6 Haji M. Azad S/o
Jahan Khan Kalan Wali 12 12 Owner
Summer & winter
vegetables.
7 Haji M. Jawaid S/o
Ashiq Husain Kalan Wali 06 06 Owner
Summer & winter
vegetables.
8 Abid Husain S/o
Muhammad Anayt Kalan Wali 20 16 Owner Wheat, Fodder & Millet
9
Maqbool Husain
S/o Ghulam
Muhamad
Kalan Wali 05 05 Owner Wheat, Fodder & Millet
10 Waseem Ilyas S/o
Sohnda Khan Kalan Wali 20 20 Owner
Maize, Summer & winter
vegetables
11 Imran Asif S/o
Munshi Khan Kalan Wali 07 07 Owner
Wheat, Fodder, Millet &
Maize
12
Muhamad Asghar
S/o Muhammad
Afsar
Kalan Wali 26 24 Owner Wheat, Fodder, Millet
&Maize
69
13 Haji Gulistan S/o
Hazer Muhammad Kalan Wali 45 40 Owner
Wheat, Fodder, Maize,
Summer & winter
vegetables
14
Muhammad Aslam
S/o Hazer
Muhammad
Kalan Wali 11 11 Owner Summer & winter
vegetables
15 Ghulam Abbas S/o
Shahra Khan Kalan Wali 10 10 Owner
Summer & winter
vegetables
16 Zahoor Ahmad S/o
Noor Khan Kalan Wali 30 25 Owner Wheat, Fodder & Maize
17 Samar Iqbal S/o
Pahnda Khan
Kalan Wali 10 10 Owner
Maize, Summer & winter
vegetables
18 Muhammad Afsar
S/o Shian Khan Kalan Wali 06 06 Owner
Wheat, Fodder, Maize
& Mash
19 Imdad Husain S/o
Khuda Dad
Kalan Wali 09 09 Owner
Wheat, Fodder, Maize &
Mung
20 Muhammad Zarayt
S/o Khuda Dad Kalan Wali 04 04 Owner
Summer & winter
vegetables
21
Mushtaq Husain
S/o Muhammad
Nawaz
Kalan Wali 05 05 Owner Summer & winter
vegetables
22
Musarrat Abbas
S/o Muhammad
Nawaz
Kalan Wali 16 16 Owner Summer & winter
vegetables
23
Mulazim Husain
S/o Muhammad
Sadiq
Kalan Wali 02 02 Owner Summer & winter
vegetables
24 Mirza M. Aslam S/o
Dhuman Khan Kalan Wali 04 04 Owner
Summer & winter
vegetables
25 Adeel Akhtar S/o
Muhammad Afsar Kalan Wali 05 05 Owner
Summer & winter
vegetables
70
Annexure 13; Farmer Field School Jhattla, Dhoke Tahlian Dam, Chakwal
S. No
Name Village Acerage (kanals)
Area under cash crop
Owner/ Tenant
Number of crop and vegetable grown
1 Fazal Muhammad
S/o Sultan Khan Jhattla 32 26 Owner
Wheat, Fodder Summer &
winter vegetables
2 M. Anayt S/o
Sultan Khan Jhattla 16 16 Owner
Summer & winter
vegetables
3 Muhammad Aslam
S/o Sattar Ali Jhattla 10 10 Owner
Maize, Wheat, Summer &
winter vegetables
4 Muhammad Abbas
S/o Fazal Elahi
Dhoke
Dadu 30 28 Owner
Wheat, Fodder, Millet &
Mash
5 Abid Husain S/o
Muhammad Ashraf
Dhoke
Dadu 24 24 Owner
Wheat, Fodder, Millet &
Maize
6 Hasan Akhtar S/o
Dost Muhammad
Jhattla 16 16 Owner
Summer & winter
vegetables
7 Muhammad Nawaz
S/o Ata Muhammad
Jhattla 16 16 Owner
Wheat, Fodder, Millet,
Mash & Maize
8 Toraiz S/o Karam
Elahi
Jhattla 48 42
Owner
+ Cont
Wheat, Fodder, Millet
Mung & Mash
9 Haroon Rasheed S/o
Mawaz Khan
Jhattla 25 25 Owner Wheat, Fodder & Millet
10 Khuda Dad S/o
Hazer Muhamad
Jhattla 10 10 Owner
Summer & winter
vegetables
11 Muhammad Ashraf
S/o Maula Bakhsh
Jhattla 14 13 Owner
Wheat, Fodder, Millet &
Mash
12 Haji Afsar Khan S/o
Lal Khan
Jhattla 4.5 4.5 Owner Wheat, Fodder & Millet
13 Tanweer Ahmad S/o
Muhamad Afsar
Jhattla 48 40 Owner
Wheat, Fodder, Summer
& winter vegetables
14 Naveed Ahmad S/o
Ahmad Khan
Jhattla 56 50
Owner
+ Cont
Wheat, Fodder, Mung &
Mash
71
15 Saleem Akhtar S/o
Nazar Muhamad
Jhattla 16 16 Owner
Wheat, Fodder, Millet &
Mung.
16 Malik M. Asghar S/o
Muhamad Bakhsh
Jhattla 20 16 Owner
Wheat, Fodder, Maize
Mung &Mash
17 Hamid Ashraf S/o M.
Ashraf
Jhattla 25 25 Owner
Maize, Summer & winter
vegetables
18
Capt. Hazer
S/o Muhamad
Bakhsh
Jhattla 20 20 Owner
Wheat, Fodder, Maize,
Mung & Mash
19 Muhamad Shehzad
S/o Haq Nawaz
Jhattla 12 12 Owner
Wheat, Fodder, Maize &
Mash
20
Malik Ashiq Husain
S/o Muhamad
Husain
Jhattla 18 15 Owner Wheat, Fodder & Maize,
21 Muhammad Aazad
S/o Hazer Muhamad
Jhattla 16 16 Owner
Wheat, Fodder, Millet &
Maize
22 Malik M. Aslam S/o
Chaudhry Khan
Dhoke
Dadu
100 84 Owner Wheat, Fodder, Millet,
Maize, Mung & Mash
23 Sakhi Muhammad
S/o Sultan Khan
Jhattla 16 16 Owner
Wheat, Millet, Maize,
Mung & Mash
24
Muhammad Ajayb
S/o Muhammad
Zaman
Jhattla 20 18 Owner
Wheat, Millet, Maize,
Mung &Mash
25 Qamar Abbas S/o
Feroz Khan Jhattla 12 12
Owner
+ Cont Wheat, Fodder &Maize,
72
Annexure 14; Varietals comparison of Spring Maize
Annexure 15; Cost of production of high plastic tunnel Items or Inputs Tomato at (104 ft x 11ft x 30 ft)
Annual Expenditure of tunnel structure (if tunnel life consider as 15
years)
12,000
Plastic Sheet & ropes 17,000
Farm Yard & Green Manures 2400
Bed Preparation 600
Seeds 3000
Fertilizers 4000
Micro nutrients 700
Pesticides 1,200
Mini tunnel for nursery 3,000
Irrigation 700
Labor 17,000
Miscellaneous 4,000
Total 65,600
Sr No
Name of Dam
Area (acre)
Row to Row Distance
Plant to Plant Distance
Varieties of Spring Maize
Variety
Yield Mounds/ Acre
Yield Mounds/ Acre
Variety
Yield Mounds/ Acre
Yield Mounds/ Acre
1 Dungi ½ 21/2′ 8″ 6525 116
124.5
32w8
6 101
103
2 Jammer
gal ½ 21/2′ 8″ 6525 124
32w8
6 116
3 Qibla
Bandi ½ 21/2′ 8″ 6525 131
32w8
6 103
4 Dhoke
Tahlian ½ 21/2′ 8″ 6525 127
32w8
6 92
5 Total 498 412
73
Annexure 16; Resource persons visited to TOF
No. Name, Designation & Organization
Topic Number of Visits
Remarks
1
Dr. Arif Mehmood,
Assistant Director (Tech),
DIU Rawalpindi
Tunnel technology &
production and
Installation &
Structure
1 Detail information about
tunnel shared
2
Dr. Kauser Niazi, Quality
Assurance Specialist,
CABI SA
Quality Assurance of
FFS 2
Protocol of quality assurance
discussed in detail regarding
FFS
3
Dr. Farooq Nasir Higher
Scientific Officer, CABI,
SA
Classification of
Insects, Morphology,
Preservation and life
cycle
3 Insect identification & and role
of natural enemies discussed.
4
Mr. Shakeel, Senior
Scientific Officer, CABI
SA
Composting 2
Discussion & knowledge
sharing on making of
compost.
5 Mr. Muhammad Zahir
Shah
Nursery
establishment and
transplantation
4 Practical work done
6
Mr. Abdul Rehman, Insect
Biological Control
Specialist, CABI SA
AESA and IPM 4 Practical work done
7 Dr. Khalid Farooq, Live
stock Specialist, CABI SA
Animal housing, feeds
& feeding, breeds &
breeding, day to day
disease management
and livestock
marketing
3 Experience shared and detail
discussion held
74
Annexure 17; Success Story 1
75
Annexure 18; Success Story 2
76
Annexure 19; Success Story 3
77
78
Annexure 20; Success Story 4
79
80
Annexure 21; Success Story 5
81
Annexure 22; Success Story 6
82
Annexure 23; Success Story 7
83
Annexure 24; Success Story 8
84
Annexure 25; Insect collection kit Sr. No Items Quantity
2 Stretching Board 2
3 Aspirator 1
4 Killing Jar 1
5 Ethyl acetate 250ml
6 Forceps 2
7 Knife small 1
8 Small paint brush 1
9 Fine brushes ( No 2,4,6 local); Sable Hair Brush (1) 1
10 Plastic vials with sieve(large, Small) 20
11 Glass vials with alcohol 75 % 10
12 Hand lens small (10x) 1
13 Open tubes 20
14 Sieve 1
15 Insect pins(Small, Medium, Large) 100
16 Small plastic Jar 12
17 Note book 1
18 Rubber band 250 gms
19 Pencil 1 Pack
20 Rubber 1
21 Sharpener 1
23 Scissor small and fine 1
24 Collecting Net(Large, Small) 2
25 Capsules 1 Pack
26 Tissue role 1 Pack
27 Alcohol (95 %) 250ml
28 Disposable Plastic Gloves 1 Pack
29 Mask 1 Pack
30 Bottle 2
31 Petri Dish Plastic (Small, Large, with mesh) 10
85
Annexure 26; Farmers Field Schools visited for back stopping during 2008-09 No. of FFS Visited
FFS Visited Target Achieved
80 74
Chakri, Dhoke Juma, Imtiaz Ali (Dhoke Juma, Ikram (Wala Gujra), Molvi
Rehmat (Wala Gujra), Jhatla (Hamid Ashraf), Dhoke Gulmahi (Amir Sultan),
Dhoke Tahlian (Mirza Khan), Dhoke Tahlian (Jehangir Ahmad), Jang Saida
(M. Abas Shah), Dungi (Ch.Shabaz), Dungi (Muhammad Nazir), Dungi
(Nazakat Hussain), Qibla Bandi (Waheed Khan), Qibla Bandi (Asfaq),
Barazai (Khalid Mehmood), Barazai (Tariq Mehmood), Ghourghushti
(Anwar Khan), and Kotkay (Haji M. Yamin)
Annexure 27; Organizational structure of Joint FFS session at each dam, 2000-10
S # Dam Name of Joint
FFS Chairman
Deputy Chairman
Total Number of
Participants
Total Sub FFS
1 Dungi Potohar Kissan
School
Mr. Ghulam
Safdar
Mehraban
Khan 36 7
2 Qibla Bandi Mushtarka FFS Haider Zaman Aurangzeb 55 11
3 Jammergal Makki Madni Nusrat Mehmood
Bhatti
Haji Rehmat
Khan 55 11
4 Dhoke
Tahlian FFS Mirza khan Hamid Ashraf 55 11
Annexure 28; Total Sub FFS at Dungi Dam, 2000-10 S # Sub FFS Group Leader Group Member
1 FFS Number (1) Mirza Muhktar M. Shahid, M. Zamir, M. Waqar and Ch. Safdar
2 FFS Number (2) Muhammad Nazakat Ghafoor, M. Shaukat, Mazhar Hussain and Shabir
3 FFS Number (3) Muhammad Nazeer M. Aslam, M. Kamran, M. Sharif and M. Latif
4 FFS Number (4) Ch. Manga Khan M. Fazal, M.Iftikhar, M. amen and Abdul Hameed
5 FFS Number (5) Mehraban Khan M. Ramzan, M. Ikram, M. Abbas and M. Akram
6 FFS Number (6) Mukhtar Hussain M. Zahid, M. Asif, Pervaiz Hussain and M. Mushtaq
7 FFS Number (7) M. Jahangir Qaisar Rehman, M. Afzal, M. Saddiq and M.
Shafique
86
Annexure 29; Total Sub FFS at Qibla Bandi Dam, 2000-10 S # Sub FFS Group Leader Group Member
1 FFS Number (1) Sultan Afsar Bazid Khan, Farid Khan, Muhammad Yamin and
Auragzeb Khan
2 FFS Number (2) Muhammad Banaras Muhammad Anwar, Muhammad Rafiq, Ahmad
Hussain and Muhammad Asif
3 FFS Number (3) Sher Afsar Muhammad Mushtaq, Abdul Waheed (Low
Tunnel), Rafaqat and M. Akram
4 FFS Number (4) Muhammad Sultan Muhammad Abid, Ahmad Zai, Haider Zaman and
Mehmood
5 FFS Number (5) Khalid Mehmood Muhammad Riaz, Muhammad Shafique,
Muhammad Azam and M. Iqbal
6 FFS Number (6) Qaisar Mehmood Khuram Shezad, Arshad Mehmood, M. Arif and
Muhammad Zaman
7 FFS Number (7) Muhammad Waqas Safeer Ahmad, Muhammad Asif, Naseer Ahmad
and Hukam Khan
8 FFS Number (8) Muhammad Razaq Muhammad Asif, Muhammad Shoukat, M. Tahir
and Muhammad Imran
9 FFS Number (9) Muhammad Altaf Abdur Rauf, Muhammad Naeem, Nisar Ahmad and
Ali Asghar
10 FFS Number (10) Noor Zaman Lattif Mushtaq, Ehsan Elahi, Muhammad Nawaz
and Muhammad Ramazan
11 FFS Number (11) Muhammad Anwar Yasir Hussain, Atif Mehmood, Manzoor Hussain
and Muhammad Sulaiman
87
Annexure 30; Total Sub FFS at Jammergal Dam, 2000-10 S # Sub FFS Group Leader Group Member
1 FFS Number (1) Sobaidar Fazal
Ahmad
Muhammad Yaqub, Qadar Dan, Muhammad anar and
Mangtha Khan
2 FFS Number (2) Raja Nasir
Mehmood
Muhammad Bilal, Sikandar Hayat, Sher Bahadar and
Ehsan Elahi
3 FFS Number (3) Ansar Mehmood Muhammad Akram, Arshad, Yasir Mehmood and
Sagheer Abbas
4 FFS Number (4) Imtiaz Ali Raja Amir, Hasnat Ahmad, Javed Akhtar and Younas
Yasir
5 FFS Number (5) Shaukat Mehmood Ghulam Rasool, Ghulam Hussain, Khalid Mehmood
and Liakat
6 FFS Number (6) Abid Hussain Afzaal Mehandi, Jehangir Ahmad, Qamar Zaman and
Muthali Khan
7 FFS Number (7) Nasir Hussain Lattif Mushtaq, Ehsan Elahi, Muhammad Nawaz and
Muhammad Ramazan
8 FFS Number (8) Naveed Hussain Yasir Hussain, Atif Mehmood, Manzoor Hussain and
Muhammad Sulaiman
9 FFS Number (9) Nusrat Mehmood Sobaidar M. Sadiq, Muhammad Rasheed, Tariq
Mehmood and Jamroz Khan
10 FFS Number (10) Haji Rehmat Khan Rajwali, Muhammad Aslam, Rehmat Khan and Talib
Hussain
11 FFS Number (11) Ali Asghar Sayed Qurban Shah, Tasaduq Hussain, Tamraz
Shezad and M. Nawaz
88
Annexure 31; Total Sub FFS at Dhoke Tahlian Dam, 2000-10 S #
Sub FFS Group Leader Group Member
1 FFS Number (1) Mirza khan Riasat Hussain. Sajid Hussain, Azam
Abbas, Safdar Mehmood
2 FFS Number (2) Amir Sultan s/o M. Noor Mukhtar Hussain, Rizwan Ahmad,
Sajid Hussain, Asif mehmood
3 FFS Number (3) Jahangir Ahmad Mubashar Lal Khan, Khuda Baksh,
Habib Bakhsh, Waheed Ahmad
4 FFS Number (4) Raja Hamid Ashraf Raja Gulburg, Raja Ashraf, Tasawar,
Ghulam Abbas
5 FFS Number (5) Shahzad Afzal Javaid Ahmad, Nazeer Ahmad, Sajad
Ahmad, Shah Saqlain
6 FFS Number (6) Amir Sultan s/o M. Khan M. Duraiz, Tanveer Ahmad, Abass,
Liaqat hussain
7 FFS Number (7) Habib Sultan Haji Ahmad, Naqeeb Sultan, Sabir
Shah, Rafaqat
8 FFS Number (8) Ahmad Shah Iftikhar Shah, Qurban Shah, Ali
Hassan, Nazim Shah
9 FFS Number (9) Samad Khan M. Hasnain, M. Zarat, M. Iqbal, Akhtar
mehmood
10 FFS Number (10) M. Asghar Raja Faisal, Raja mussadiq, Mazhar
Iqbal, Nazim Afzal
11 FFS Number (11) M. Masood Ghulam Muhammad, Tasawar
Hussain, Ikram, Abid Naseer
contact CABI
europe
CABI Head Office
Nosworthy Way, Wallingford, Oxfordshire, OX10 8DE, UK
T: +44 (0) 1491 832111, E: [email protected] CABI Europe - UK
Bakeham Lane, Egham, Surrey, TW20 9TY, UK
T: +44 (0) 1491 829080 CABI Europe - Switzerland
Rue des Grillons 1, CH-2800 Del mont, Switzerland
T: +41 (0) 32 4214870 asia
CABI South Asia
Opposite 1-A, Data Gunj Baksh Road, Satellite Town, PO Box 8, Rawalpindi-Pakistan
T: +92 (0) 51 9290132 CABI Southeast and East Asia
PO Box 210, 43400 UPM Serdang, Selangor, Malaysia
T: +60 (0) 3 89432921 CABI South Asia - India
2nd Floor, CG Block, NASC Complex, DP Shastri Marg, Opp. Todapur Village, PUSA,
New Delhi - 110012, India
T: +91 (0) 11 25841906 CABI Southeast and East Asia - China
C/o CAAS-CABI Project Office
C/o Internal Post Box 56, Chinese Academy of Agricultural Sciences,
12 Zhongguancun Nandajie, Beijing 100081, China
T: +86 (0) 10 62112118 africa
CABI Africa
ICRAF Complex, United Nations Avenue, Gigiri, PO Box 633-00621, Nairobi, Kenya
T: +254 (0) 20 7224450/62 americas
CABI Caribbean & Latin America
Gordon Street, Curepe, Trinidad and Tobago
T: +1 868 6457628 CABI North America
875 Massachusetts Avenue, 7th Floor, Cambridge, MA 02139, USA
T: +1 617 3954051