Combination Therapy for Treating Advanced Drug-Resistant ... · TGFb was a negative regulator of CD16 expression and, thus, NK cell ADCC function. After coincubation with ALL cells,

Research Article

Combination Therapy for Treating AdvancedDrug-Resistant Acute Lymphoblastic LeukemiaYorleny Vicioso1, Hermann Gram2, Rose Beck1,3, Abhishek Asthana4,Keman Zhang4, Derek P.Wong1, John Letterio5,6, and Reshmi Parameswaran4,5

Abstract

Drug-resistant acute lymphoblastic leukemia (ALL) patientsdo not respond to standard chemotherapy, and an urgentneed exists to develop new treatment strategies. Our studyexploited the presence of B-cell activating factor receptor(BAFF-R) on the surface of drug-resistant B-ALL cells as atherapeutic target.We used anti–BAFF-R (VAY736), optimizedfor natural killer (NK) cell–mediated antibody-dependentcellular cytotoxicity (ADCC), to kill drug-resistant ALL cells.VAY736 antibody and NK cell treatments significantly

decreased ALL disease burden and provided survival benefitin vivo. However, if the disease was advanced, the ADCCefficacy of NK cells was inhibited by microenvironmentaltransforming growth factor-beta (TGFb). Inhibiting TGFbsignaling in NK cells using the TGFb receptor 1 (R1) inhib-itor (EW-7197) significantly enhanced VAY736-induced NKcell–mediated ALL killing. Our results highlight the potentialof using a combination of VAY736 antibody with EW-7197to treat advance-stage, drug-resistant B-ALL patients.

IntroductionAcute lymphoblastic leukemia (ALL) accounts for 80% of all

leukemias in childhood, making it the most common pediatricleukemia. It also accounts for about 20%of adult leukemias (1, 2).Although CD19-mediated chimeric antigen receptor (CAR) T-cellimmunotherapy has shown promise in B-ALL therapy, relapsedue to loss of CD19 expression still remains as a challenge (3).Disease relapse and drug resistance are two major challenges inALL therapy. Presence of Philadelphia chromosome (Ph) trans-location, which encodes a constitutively active tyrosinekinase (4–8), and the tumor microenvironment are two majorfactors that play an important role in the development of ALLdrugresistance (7, 8). Tumor cells themselves or/and other cells in thetumor microenvironment produce cytokines, chemokines, orgrowth factors which support the development and survival ofdrug-resistant cells. B-cell activating factor (BAFF) is one suchfactor, belonging to the TNF superfamily and is expressed bystromal cells, macrophages, and dendritic cells (9, 10). BAFF hasthree receptors, TACI, BCMA, and BAFF-R, out of which BAFF-R is

the only specific receptor for BAFF (10). APRIL, a homologousligand, also binds to TACI and BCMA (10, 11). BAFF-R isexpressed mainly on mature B cells and mature B-cell malignan-cies such as chronic lymphocytic leukemia (CLL), multiple mye-loma, and B-cell lymphomas (11). BAFF- and BAFF-R–deficientmice lack a mature B-cell compartment, demonstrating theinvolvement of BAFF signaling in survival of mature Bcells (10–12).

We and others have previously shown that B-ALL cells expresssurface BAFF-R, making it an attractive antigen for therapeutictargeting (13, 14), and also report potential therapeuticapproaches targeting BAFF-R, which include the fusion toxinrGel/BLyS and an antibody-dependent cellular cytotoxicity(ADCC) optimized anti–BAFF-R, B1239 (15–17). Antibody toa tumor-specific antigen can be used to target cancer cells throughADCC and is mediated mainly by CD16 (FcRgIII), a majortriggering receptor on natural killer (NK) cells. There are manyADCC-optimized antibodies used in clinic, including anti-CD20rituximab (Rituxan), anti–TNFa infliximab (Remicade), and anti-Her2 trastuzumab (Herceptin) (18–22). Rituximab is routinelyused in therapy for treatment of adult B- ALL and CLL (21, 22).Monoclonal antibodies including ofatumumab, alemtuzumab,and epratuzumab are currently under investigation for B-ALLtherapy (22–24).

Here, we showed that drug-resistant and relapsed ALL cellsretain BAFF-R expression and that anti-BAFF-R mediates signifi-cant in vitro and in vivoNKcell–mediatedADCCagainst these cells.B1239, anti–BAFF-R, is renamed officially as VAY736. Becausemost of the in vivo preclinical studies use very early disease as astarting point for therapy, the effect of cytokines or growth factorsproduced by the tumor itself or tumor microenvironment onthese treatment strategies are lacking. We showed that four injec-tions of VAY736 lead to enhanced NK cell–mediated killing ofALL cells in vivo, provided the treatments are started early. Ifthe treatments are started late, ADCC efficacy was inhibited bytumor microenvironmental factors. As reported previously byothers (25), we confirmed that transforming growth factor-beta(TGFb) was produced by ALL cells, and we demonstrated that

1Department of pathology, Case Western Reserve University, Cleveland, Ohio.2Novartis Institutes for BioMedical Research, Basel, Switzerland. 3Department ofPathology, University Hospitals, Cleveland, Ohio. 4Division of Hematology/Oncology, Department of Medicine, Case Western Reserve University, Cleve-land, Ohio. 5The Case Comprehensive Cancer Center, Case Western ReserveUniversity School of Medicine, Cleveland, Ohio. 6Pediatric Hematology andOncology, The Angie Fowler Adolescent and Young Adult Cancer Institute,University Hospitals Rainbow Babies and Children's Hospital, Cleveland, Ohio.

Note: Supplementary data for this article are available at Cancer ImmunologyResearch Online (http://cancerimmunolres.aacrjournals.org/).

Corresponding Author: Reshmi Parameswaran, Case Western Reserve Univer-sity, 2103 Cornell Road, Wolstein Research Building 2125, Cleveland OH 44106.Phone: 216-368-5697; Fax: 216-368-0494; E-mail: [email protected]

Cancer Immunol Res 2019;7:1106–19

doi: 10.1158/2326-6066.CIR-19-0058

�2019 American Association for Cancer Research.

CancerImmunologyResearch

Cancer Immunol Res; 7(7) July 20191106

on February 4, 2020. © 2019 American Association for Cancer Research. cancerimmunolres.aacrjournals.org Downloaded from

Published OnlineFirst May 28, 2019; DOI: 10.1158/2326-6066.CIR-19-0058

http://crossmark.crossref.org/dialog/?doi=10.1158/2326-6066.CIR-19-0058&domain=pdf&date_stamp=2019-6-13

http://cancerimmunolres.aacrjournals.org/

TGFb was a negative regulator of CD16 expression and, thus, NKcell ADCC function. After coincubation with ALL cells, NK cellshad decreased CD16 expression, which could be reversed byEW-7197 (26), a TGFb receptor 1 (TGFbR1) small-moleculeinhibitor. A combination of EW-7197 and VAY736 significantlyenhancedNKcell killingof ALL cells in vitro and in vivo. In summary,we demonstrated the in vivo therapeutic efficacy of the BAFF-Rantibody VAY736 in combination with the TGFbR1 inhibitorEW-7197 against advanced-stage drug-resistant B-ALL disease.

Materials and MethodsHuman peripheral blood mononuclear cells and patientsamples

Human peripheral blood mononuclear cells (PBMC) fromhealthy adult donors (12 females and 11 males) were obtainedwith informed consent at the Hematopoietic Stem Cell CoreFacility (HSC), Case Western Reserve University. ALL patientblood and bone marrow samples were obtained from 5 pediatricand 11 adult patients from Dr. Rose Beck, University Hospitals,Cleveland and also fromHSC core facility. Only discarded humanblood and bone marrow samples were used in accordance withthe common rule ethical standards, and informed consent for thisstudy was approved by the University Hospital's Case MedicalCenter Institutional Review Board (IRB). Both male and femaleALL patients as well as adults and pediatric ALL patients wereincluded in this study. Blood and bone marrow samples wereprocessed either for RBC lysis (Santa Cruz Biotechnology) or forFicoll-paque gradient (GE Healthcare) following standard proto-cols. PBMCs were frozen in 95% FBS (Sigma) containing 5%DMSO (Fisher Scientific).

NK cell expansionNK cells were expanded as previously described (27, 28).

Ficoll-purified PBMCs (20 � 106 cells) from healthy or ALLpatients were cocultured with 10 � 106 irradiated K562 clone9 cell line expressing membrane-bound IL-21 for 2 weeks. K562clone 9 cells were a kind gift from Dr. Dean A. Lee (NationwideChildren's Hospital, Columbus, OH). Cells were grown inRPMI-1640 medium supplemented with 10% FBS (Sigma) and1% penicillin/streptomycin (HyClone). Fresh media were addedevery third day containing IL2 (100 U/mL; PeproTech). NKcells were purified at the end of the 2-week coculture usingthe MojoSort Human NK cell Isolation Kit (BioLegend). NK cellpurity (>95%)was determined via flow cytometry (BDAccuri C6)using CD56 (5.11H11) and CD3 (HIT3a) antibodies fromBioLegend.

MiceNOD/SCID/IL2rg�/� (NSG) mice were purchased from Case

Western Reserve University (CWRU) Athymic Animal Core Facil-ity (Cleveland, OH). Mice were maintained in pathogen-freeconditions at the CWRU animal facility. All animal experimentswere performed in accordance with and with the approval ofCWRU's Institutional Animal Care and Use Committee (IACUC)and NIH guidelines.

Human ALL transplant modelNSG mice were used to expand ALL patients (PT) cells: PT-1

(newly diagnosed), PT-2 (relapse), PT-3 (drug resistant), and PT-4(drug resistant), which were further used in the experiments

(described below). For expansion purposes, NSG mice weretransplanted intravenously with 2 � 106 patient-derived ALLcells. ALL cells were allowed to proliferate, and mice were sacri-ficed when terminally ill: signs of hind limb paralysis, spleno-megaly which appears around days 35 to 42, or if mice lose morethan20%of its bodyweight. Splenic cells frommicewere culturedovernight in MEMa (Sigma) media supplemented with 20% FBS(Sigma), 1% L-glutamine (Gibco), and 1% penicillin/streptomy-cin (HyClone), after which nonadherent cells were analyzed byflow cytometry using the Accuri C6. Cells >95% CD19þ (4G7)and CD10þ (H110a) were frozen in 95% FBS, 5% DMSO (FisherScientific) in aliquots containing 10 million cells for further use.

For in vivo experiments, NSG mice were transplanted intrave-nously with 2 � 106 patient-derived drug-resistant ALL cells. ALLcells were allowed to proliferate in vivo for the indicated time priorto treatments. Transplanted mice (n¼ 3–6 per group) were eitherinjected i.p. with VAY736 (10 mg/kg; NCT02149420), PBS (con-trol mice), or oral administration of EW-7197 (3 mg/kg; ref. 26).Expanded NK cells (expanded for 2 weeks) were injected i.v. toeither the VAY736- or EW-7197-treated groups or the NK cell–treated-only group at the indicated time points. Mice were sacri-ficed at the indicated times. Bonemarrow, spleen, and bloodwereanalyzed by flow cytometry for the presence of human ALL cellsusing human CD19 and CD10 antibodies, as described below.The survival effect of VAY736þ EW-7197 combination treatmentcompared with control (PBS), VAY736, or EW-7197 single treat-ments was determined by Kaplan–Meier analysis and log-ranktest. All statistical analyses were performed using GraphPad Prism(GraphPad Software Inc.).

Flow cytometryBlood was collected with a 2-mL syringe from the heart of mice

into PBS-containing tubes followed by Red Blood Cell Lysis(Santa Cruz Biotechnologies) using the standard protocol. Bonemarrow was collected by flushing femurs and tibias with PBScontaining 5%FBS. Spleenswere smashedwith syringe plunges inPBS containing 5% FBS. Bone marrow and spleen suspensionswere filtered through a 70-mm nylon filter. Bone marrow andsplenic cells (1� 106) were aliquoted for extracellular staining in100 mL volume of PBS containing 5% FBS. Live-cell counts weredetermined by excluding Trypan blue-positive cells. Data collec-tion and analysis was performed using the Accuri C6 flow cyt-ometer and software (BD Biosciences).

For expression of BAFF-R in healthy donor immune cells,nonexpanded PBMCs (1 � 106 per stain) were washed andstained with CD3 (HIT3a), CD19 (4G7), CD56 (5.11h11), IgG(mopc-21), BAFF-R (11c1) from BioLegend. To assess NK cellreceptor expression, 1� 106 NK cells from the indicated donors(expanded for 2 weeks) were washed and stained with CD56(5.11h11), CD3 (HIT3a), NKp46 (9E2), NKp30 (p30-15),NKG2D (ID11), and KLRG1 (14C2A07). To analyze the expres-sion of HLAE and MICA/B, the indicated ALL cells were thawedovernight in MEMa (Sigma) media supplemented with 20%FBS (Sigma), 1% L-glutamine (Gibco), and 1% penicillin/streptomycin (HyClone). Then, 1 � 106 indicated ALL cellswere washed and stained with CD19 (4G7), CD10 (H110a),HLAE (3D12), and MICA/B (6D4) from BioLegend. For theanalysis of CD69 expression, indicated expanded NK cells(1 � 106) were cocultured with (2 � 105) PT-3 ALL cells thathad been pretreated with or without VAY736 (20 mg/mL for2 hours) for 4 hours. Cocultures were then washed and stained

VAY736-Mediated ADCC for ALL Therapy

www.aacrjournals.org Cancer Immunol Res; 7(7) July 2019 1107




with CD56 (5.11h11), CD3 (HIT3a), and CD69 (FN50) fromBioLegend. All data collection was done on Accuri C6 flowcytometer, and data analysis was performed using Accuri C6software (BD Biosciences).

Antibodies and other reagentsThe human anti-BAFF-R was obtained from Novartis. EW-719

is a synthetic small-molecule inhibitor of TGFbR1purchased fromCayman Chemicals. Flow cytometry antibodies for BAFF-R(11c1), IgG (mopc-21), CD56 (5.11h11), CD3 (HIT3a), CD19(4G7), CD10 (H110a), CD16 (3G8), NKp46 (9E2), NKp30(p30-15), NKG2D (ID11), KLRG1 (14C2A07), HLAE (3D12),MICA/B (6D4), and CD69 (FN50) were purchased from Bio-Legend. Secondary anti-human IgG was purchased from Invi-trogen (62-8411). Western blot antibodies p100 and p50(4882), A-1 (14093), and BCL-XL (2764) were purchased fromCell Signaling, and Pim-1 (13513) and GAPDH (47724) werepurchased from Santa Cruz Biotechnology. Recombinant TGFb(580702) and BAFF (591202) were purchased from BioLegend.

Cell linesOP9 bone marrow stroma (ATCC), K562 clone 9 chronic

myelogenous leukemia (Dean A. Lee), Jurkat T lymphocytes(Parameswaran Ramakrishna, CWRU, Cleveland, OH), Jeko-1mantle cell lymphoma (ATCC) were passaged >10 times. Brief-ly, OP9 cells were cultured in MEMa supplemented with20% FBS (Sigma), 1% penicillin/streptomycin (HyClone),1% L-glutamine (Gibco), whereas the other cell lines werecultured in RPMI (Sigma) media supplemented with 10%FBS (Sigma), 1% L-glutamine (Gibco), and 1% penicillin/streptomycin (HyClone). Mycoplasma detection was performedusing the Lonza Mycoalert Mycoplasma Detection Kit, but cellline authentication was not routinely assessed.

In vitro antibody treatmentsExpanded ALL cells (1 � 106, >95% CD19þ, CD10þ) were

incubated with BAFF-R antibody (5 mg/mL) for 30 minutes atroom temperature, washed with PBS, and incubated with anti-human IgG diluted 1:50 (Invitrogen), followed by fluorescence-activated cell sorting (Accuri C6). For competition experiments,ALL cells were incubated with BAFF (0.02, 0.05, 1, or 3 mg/mL),followed by the addition of BAFF-R antibody (5 mg/mL) for30 minutes at room temperature. Binding of BAFF-R antibodyto the BAFF-R on ALL cells was determined via flow cytometry(Accuri C6).

ELISASerum from mice transplanted with PBS or PT-3 ALL cells was

obtained by centrifugation of 500 mL of blood (10,000 � g for10minutes) on day 35. Serum samples were stored at�80�C andthawed prior to use. Mouse TGFb was measured with the LegendMax Mouse Latent TGFb ELISA Kit (BioLegend) and 1:50 serumdilution in manufacturer's buffer was performed as specified bythemanufacturer's instructions. Per condition, 4mL of samplewasdilutedwith 196 mL of Assay Buffer provided by themanufacturer,after which 50mLwas added to thewell in triplicates. TheHuman/Mouse TGF-beta 1 Uncoated Elisa Kit (Invitrogen) was also usedto measure TGFb, and serum was diluted 1:5 in PBS, followingspecific instructions from the manufacturer. Per condition, 20 mLof serumwas diluted in 80mLof PBS (1:5). Sampleswere activatedwith acid: 20mL of 1NHCL (Fisher Scientific)was added to 100mL

of serum diluted in 80 mL of PBS, incubated at room temperaturefor 10 minutes followed by the addition of 20 mL of 1N NaOH,after which 100 mL was added to each well in triplicates. Correc-tion to the dilution factor of 1.4 was made for final calculations.For granzyme B, TNFa, and IFNg ELISAs, indicated NK cells(1 � 106) were cocultured with (2 � 105) PT-3 ALL cells thathad been pretreated with or without VAY736 (20 mg/mL for2 hours) for 4 hours. Legend Max Human Granzyme B ELISA Kitwas obtained from BioLegend. TNFa and IFNg ELISAs wereobtained from Invitrogen. Per condition, 50 mL (granzyme BELISA) and 100 mL (TNFa, and IFNg ELISAs) of nondilutedsample was added to each well in triplicates. Binding of TGFb,granzyme B, TNFa, and IFNg was detected using secondaryantibody, streptavidin-HRP, and TMB substrate solution (provid-ed with specified ELISA kit). Substrate conversion was stoppedafter 20minutes with 100 mL stop solution (1MH3PO4) providedwith the ELISA Kits. Plates were washed with PBS plus 0.05%Tween20 in-between incubations. Assay diluent provided bythe manufacturer or RPMI medium (Sigma) was used as negativecontrols, and specific standard proteins were used as positivecontrols. Standard reconstitutions and curves were generated asper manufacturer's instructions for each assay. Optical densityvalues were obtained using a microplate reader set to 450 nm(Bio-Rad iMark Microplate reader). The derived TGFb, granzymeB, TNFa, and IFNg concentrations (ng/mL)were determined usingspecific standard curve-derived formulas. The derived TGFb con-centrations (ng/mL) were multiplied by 5 to correct for dilution.

Cytotoxicity assaysALL cell killing byNK cells was analyzed using calcein-AMassay

purchased from Life Technologies (17). Target tumor cells(10 � 106) were labeled with (0.5 mmol/L) calcein-AM for 30minutes at 37�C. Following staining, cells were washed with PBS,counted using Trypan blue (Sigma), and 2 � 106/mL cells wereincubated with VAY736 (20 mg/mL) for 2 hours. After washing2 times with PBS, ALL (10 � 103) cells per well (96-well plate)were cocultured at 37�C with MACs sorted indicated NK cells(5 � 104) at 5:1 ratio for 4 hours. NK cell purity was >95% asdetermined by CD56þ, CD3� cells via flow cytometry. The per-centage of specific lysis from triplicate wells was determined usingthe following equation, inwhich "AFUmean spontaneous release"is calcein-AMreleaseby target cells in the absenceof antibodyorNKcells and "AFU mean maximal release" is calcein-AM release bytarget cells upon lysis by detergent. % specific lysis ¼ 100 � (AFUmean experimental release�AFUmean spontaneous release)/(AFUmeans maximal release�AFU means spontaneous release).

Cell proliferation and viability assayThe indicated ALL cells were plated at a density of 1� 106 cells

per mL in different conditions in an irradiated OP9 bonemarrowstroma cells (16, 17). OP9 cells were purchased from ATCC.Coculture of human ALL cells with OP9 cells performed inMEM-a medium supplemented with 20% FBS (Sigma), 1%L-glutamine (Gibco), 1% penicillin/streptomycin (HyClone).The rate of proliferation and viability was monitored every otherday by manually counting the viable cells and total cells usingTrypan blue stain (Sigma). For the E670-based proliferationassays, 5�106ALL cellswere labeledwith 1mmE670 (Invitrogen)and cultured for 7 days. E670 dilution wasmeasured by gating onlive E670þ cells using flow cytometry (Accuri C6).

Vicioso et al.

Cancer Immunol Res; 7(7) July 2019 Cancer Immunology Research1108




For testing drug resistance in vitro, 1 � 106 cells (PT-1, PT-2, orPT-3) permLwere cultured in different conditions in an irradiatedOP9 bone marrow stroma cells. Vincristine (2.5 nmol/L) ornilotinib (300 nmol/L) were added every other day. Nonadherentleukemia cells were carefully collected from the stromal layer.Viability of the ALL cells was determined by excluding Trypanblue–positive ALL cells.

Annexin V and PI bindingA flow-based Annexin V/propidium iodide (PI) assay (Bio-

Legend) was used to measure ALL cells apoptosis following thevendor's protocol. Briefly, 1�106 tumor cellswerewashed inPBS,resuspended in 100 mL Annexin V–binding buffer (BioLegend),and stained with 1 mg/mL APC-conjugated Annexin V(BioLegend) for 15 minutes on ice in the dark. Cells werewashed and stained with PI for 5 minutes at room temperaturein the dark. Tumor cell apoptosis was evaluated by gatingon Annexin V and PI double-positive cells via flow cytometry(Accuri C6).

Oncomine database analysisData and corresponding statistics were downloaded directly

fromhttps://www.oncomine.org. BAFF-RmRNA expression anal-ysis from 359 pediatric, 147 adults ALL patients, and 74 healthydonors analyzed on Affymetrix U133 plus microarray wasobtained directly from the Haferlach Leukemia Dataset (ReporterID: 1552892_at). TGFbmRNA expression from 20 B-cell ALL and8 healthy lymphocyte samples analyzed on Affymetrix U133Amicroarray was downloaded from the Mia Leukemia Dataset(Reporter ID: 203085_s_at).

Conjugation assayFive million expanded NK cells were labeled with eFluor 670

(APC; eBioscience), and 5 � 106 ALL cells were labeled withCellTracker Green CMFDA (FITC; Invitrogen), according to themanufacturer's protocol. Cells were coincubated at 37�C for 30minutes at a ratio of 2:1 (NK:tumor). The proportion of double-positive cells (conjugate formation) was analyzed using BD AcuriC6 flow cytometer.

RNA isolationTotal RNAwas isolated from2� 106 of the indicated cells using

High pure RNA isolation kit from Roche Life Science. RNAconcentration and quality were determined by a Thermo FisherNanodrop Lite Spectrophotometer.

Quantitative real-time PCRcDNA synthesis was performed on 1 mg RNA per sample using

the Bio-Rad iScript Reverse Transcription Supermix cDNA syn-thesis kit. qRT-PCRwas performed in triplicates using the Bio-RadiQ SYBRGreen Supermix according to themanufacturer's instruc-tions. GAPDH was used for normalization, and BAFF-R relativemRNA expression was determined using the DDCT method. Thefollowing primers were used:

BAFF-R: Forward CCCTGGACAAGGTCATCATTBAFF-R: Reverse TCTTGGTGGTCACCAGTTCAGAPDH: Forward TGGAAATCCCATCACCATCTTGAPDH: Reverse CCTGCTTCACCACCTTCTT

Western blotALL PT-3 cells (2 � 106) were cultured in MEMa with either

VAY736 (20 mg/mL), recombinant BAFF (200 ng/mL), or com-bination for 72 hours. Indicated cells were washed with PBS,followed by lysis with 9 M urea buffer (Fisher Chemicals) in TrisBuffer (Fisher Bioreagents). Supernatant was collected aftercentrifuging lysed cells at 14,000 � g for 10 minutes at 4�C, andprotein concentration was estimated using Thermo ScientificNanodrop Lite Spectrophotometer. Protein samples (30 mg) wererun on an SDS-polyacrylamide gel electrophoresis and transferredto a nitrocellulose membrane (Bio-Rad). The membrane wasblocked for 1 hour with 5% nonfat dry milk prepared in TrisBuffer Saline containing 0.1% Tween 20 (Fisher Scientific).Membranes were probed with the primary antibodies over-night at 4�C, and with secondary antibodies for 1 hour at roomtemperature. Respectivemouse or rabbitHRP-conjugated second-ary antibodies were used to detect specific protein bands. Blotswere developed using Clarity Western ECL substrate (Bio-Rad).

Statistical analysisApplicable data were analyzed using unpaired Student t test

using Prism 8 software. All in vitro experiments were done intriplicates. P values assigned were ns, not significant; �, P < 0.05;��, P < 0.01; ��, P < 0.001; ��, P < 0.0001. Statistical analysisof mice survival curve was done by log-rank (Mantel–Cox) testusing GraphPad Prism software Inc.

ResultsVAY736 effectively binds to drug-resistant ALL cells

BAFF-R is known to be aberrantly expressed on B-ALL (13, 14).To confirm BAFF-R expression in ALL cells, we analyzed 359pediatric and 147 adults ALL patient samples compared withPBMCs from 74 healthy donors using the Haferlach LeukemiaOncomine database (29). In accordancewith previous reports, wedetected a significant fold increase in BAFF-R expression in pedi-atric (1.3, P ¼ 1.08 � 10�19) and adult ALL cells (1.4, P ¼ 1.6 �10�22) comparedwith PBMCs (Fig. 1A).We also detected variableBAFF-R expression in 11 adults and 5 pediatric ALL patient blastsby flow cytometry (Fig. 1B; Table 1). mRNA expression was alsoanalyzed by RT-PCR (Supplementary Fig. S1A). B lymphocytes(CD19þCD10�) from normal donors also expressed BAFF-R butwere absent on NK or T cells (Supplementary Fig. S1B). Becausedrug resistance and relapse are two major problems in ALL, wetested whether BAFF-R expression was maintained in relapse anddrug-resistant patient ALL cells. Drug-resistant patient cells devel-oped resistance to vincristine (ph�) or tyrosine kinase inhibitornilotinib (phþ; Supplementary Fig. S1C) in a coculture OP9stromal system (16, 17). Both relapse and drug-resistant ALL cellsexpressed surface BAFF-R (Fig. 1C; Table 1). We next tested thebinding efficacy of VAY736 (anti-human BAFF-R optimized forADCC) to drug-resistant and relapsed ALL cells. VAY736 was ableto bind to newly diagnosed, drug-resistant, and relapsed ALL cells,as detected with human IgG (Fig. 1D and E). We previouslyreported that this antibody is not internalized upon binding toBAFF-R inALL cells (17). Because surface presentationof antibodyis a crucial factor in determining ADCC efficacy, we tested howlong VAY736 remains bound to the surface of ALL cells. VAY736can be detected on ALL cell surface even after 48 hours, making itideal for ADCC (Fig. 1F). Normal serum BAFF concentrations arein the range of 0.3–2 ng/mL, and it is elevated in autoimmune





https://www.oncomine.org


diseases such as SLE to a range of 0.5–6 ng/mL (30). We specu-lated that endogenous BAFF would compete with VAY736 bind-ing to BAFF-RonALL cells.WepreincubatedALL cellswithhumanrecombinant BAFF for 2 hours, followed by the addition ofVAY736. Preincubation of ALL cells with 50 ng/mL of humanrecombinant BAFF did not affect binding of VAY736. BAFF con-centrations (1 or 3 mg/mL), which is higher than endogenousBAFF, competed with VAY736 binding (Fig. 1G).

VAY736 has no effect on ALL cell proliferation and survivalTo address the effect of VAY736 on the proliferation of ALL

cells, we monitored ALL cell proliferation for a week in thepresence or absence of VAY736 (20 mg/mL). Proliferation ofVAY736-treated ALL cells was comparable with untreated ALL

cells, and addition of recombinant BAFF or a combination ofVAY736 and recombinant BAFF did not affect ALL cell prolifer-ation (Fig. 2A). We also analyzed viable cell counts and percentviability using Trypan blue in PT-3 and PT-4 ALL cells treated withBAFF, VAY736, and BAFF þ VAY736 compared with nontreatedcontrol ALL cells. No significant difference in viable cell count orpercent viability was seen in VAY736-treated ALL cells comparedwith other groups, even after 6 days of incubation (Fig. 2B and C).There was no noticeable cell death in VAY736-, BAFF-, orVAY736 þ BAFF-treated PT-3 and PT-4 ALL cultures (Fig. 2D).BAFF is known to induce alternate NF-kB signaling in normal Bcells (31, 32) without affecting their proliferation or survival rate.As expected, BAFF induced alternate NF-kB signaling in ALL cells,as evidenced by p100 to p52 conversion (Supplementary Fig. S2),

Figure 1.

Binding efficacy of VAY736 to ALL cells. A, BAFF-R mRNA expression in 359 pediatric and 147 adults ALL patients' samples compared with PBMCs from 74healthy donors as revealed by the Haferlach Leukemia database on ONCOMINE (29). B, Summary data from flow cytometry analysis of cell-surface BAFF-Rexpression on gated CD19þCD10þ cells in 5 pediatric and 11 adults ALL patients' samples compared with PBMCs from 4 adult healthy donors 21–50 years old. Thethick line represents the mean value. The bottom and top of the boxes are the minimum andmaximum percentiles. The statistical difference of BAFF-Rexpression in the three groups was compared through the unpaired Student t test. �� , P < 0.001; �� , P < 0.0001. C, Flow cytometry histograms of BAFF-Rexpression in the Jurkat cell line (negative control), Jeko-1 cell line (positive control), newly diagnosed (PT-1), relapse (PT-2), and drug-resistant (PT-3 and PT-4)ALL cells. Gated on CD19þCD10þ blasts, black (left, isotype staining) and gray (right, stained with anti-BAFF- R clone 11C1). D, Representative histograms and E,percentages of VAY736 (5 mg/mL, 30minutes) binding to the indicated ALL cells detected using anti-human IgG. F, Time kinetics of VAY736 (5 mg/mL) bindingto ALL cells for the indicated times followed by flow-cytometric analysis using anti-human IgG. G, Binding competition of recombinant BAFF [preincubated for2 hours, followed by incubation with (5 mg/mL) VAY736 for 30minutes] in ALL cells measured by anti-human IgG by flow cytometry. Patient-derived ALL cellswere used. All these experiments (B–G) are representative of the mean� SD of three or more independent experiments with three technical replicates. UnpairedStudent t test; �� , P < 0.001; �� , P < 0.0001.

Vicioso et al.





and addition of VAY736 partially inhibited this. VAY736 treat-ment alone did not significantly change p52 levels. BAFF-inducedsurvival proteins also behaved similarly, without showing anysignificant changes in VAY736 alone-treated cells, but inhibited inBAFF þ VAY736-treated cells compared with BAFF alone–treatedcells (Supplementary Fig. S2).

VAY736 mediates in vitro ADCC of drug-resistant andrelapse ALL

We next tested the efficacy of VAY736 to mediate NK cell–mediatedADCCofALL cells. ComparedwithNK cells alone (3%–

40%), VAY736 significantly increased NK cell–mediated cytotox-icity of drug-resistant and relapse ALL cells (15%–70%) depend-ing on the NK cell donor (Fig. 3A). ALL cells from four differentpatients (PT-1, PT-2, PT-3, and PT-4) andNK cells from3differentdonors (NK-2, NK-3, and NK-4) were used to confirm the effectof VAY736 in mediating ADCC. NK cell receptor expression andthe corresponding ligand expression by tumor cells contribute toNK cell heterogeneity in tumor cell killing. We analyzed expres-sion of receptors, such as NKP46, NKp30, NKG2D, KLRG1 onNKcells (Supplementary Fig. S3A), andMICA/B, an HLA-E ligand onALL cells (Supplementary Fig. S3B), and found that receptorexpression (Supplementary Fig. S3A) was donor specific for NKcells, whereas the ligands did not show much variability (Sup-plementary Fig. S3B). The cytotoxic functionofNK cellswas testedafter optimizing the effector (NK) to target (ALL) ratio to be 5:1(Supplementary Fig. S3C) for in vitro ADCC experiments. ALL cellkilling by NK cells varied from donor to donor (SupplementaryFig. S3D).

NK cells from cancer patients are reported as dysfunctional(25, 33–35). Hence, we asked whether the patients' own NK cellscould mediate ADCC in the presence of VAY736. We tested theADCC-promoting activity of VAY736 on NK cells expandedfrom healthy donors (allogeneic) and ALL patients (autologous).VAY736mediated enhanced killing of ALL cells in the presence ofboth allogeneic and autologous NK cells compared with NK cellsalone (Fig. 3B). ALL cells from 2 different patients, PT-5 and PT-7,were used in this assay.

We then analyzed NK-ALL conjugate formation and foundthat more conjugates are formed in VAY736þNKþ ALL culturescomparedwithNKþALL cell cultures (Fig. 3C). CD69 expression

on NK cells was also significantly increased in the presence ofVAY736, as confirmed using NK cells from 4 different patients(NK-6,NK-8,NK-9, andNK-10; Fig. 3D). Secretion of TNFa, IFNg ,and granzyme B, major players in NK cell cytotoxic function weresignificantly increased in the presence of VAY736 (Fig. 3E).

VAY736 mediates in vivo ADCC of drug-resistant andrelapse ALL

We transplanted NSG mice with drug-resistant ALL (2 � 106)cells and allowed them to proliferate for 3 days to mimic early-stage disease.Micewere treatedwith either 10mg/kgVAY736withor without 3� 106 NK cells, NK cells alone, or PBS on days 3, 10,17, and 24 (Fig. 4A). On day 31, mice were sacrificed, and tumorburden in the bone marrow and spleen was assessed by thepercentage of CD19þCD10þ human cells in the live-cell gate(Supplementary Fig. S4A). Leukemia burden in the bone marrow(�80%) and spleen (�90%) of control untreated mice wasanalyzed as shown in Fig. 4B. VAY736 alone (�55%) and NKcell–treated (�60%) mice showed reduced tumor burden in thebone marrow, but tumor burden in the spleen was similar tocontrol mice. This is consistent with our in vitro data (Fig. 2B andC) showing little effect of VAY736 on cell viability or proliferationof ALL cells. However, a significant reduction of tumor load wasseen both in spleen (40%) and bone marrow (27%) of theVAY736þNKcombination–treated group (Fig. 4B andC). Spleenweights and sizes (Supplementary Fig. S4B) of VAY736 þNK-treated mice were reduced by �50% compared with controlsor NK alone–treated mice. It was indeed surprising to noticethe lack of ALL killing in spleen of mice treated with NK cellsalone, despite similar percentages of NK cells (CD56þCD3�)detected in the spleen or bone marrow of NK- and NK þVAY736-treated mice (Supplementary Fig. S4C). Survival ofleukemic mice treated with VAY736 and NK cells was also sig-nificantly enhanced compared with VAY736 alone, NK alone,or PBS-treated mice (Fig. 4D and E).

Because drug-resistant and relapsed patients do not respondwell to conventional treatment strategies, they often developadvanced-stage disease. Figure 4F shows the leukemic burden inmice on day 5 (early) and day 15 (advanced). We further inves-tigated whether VAY736 þ NK cell treatment was effective in anadvance leukemia disease model. We started treatment on day 14

Table 1. ALL patients' samples characteristics: summary data from 11 adults and 5 pediatric ALL patients

Sample # Age/sex Diagnosis Genetics ALL expanded % Blast % CD19þ, CD10þ, BAFF-Rþ CD19þ, CD10�, BAFF-Rþ

1 Adult Diagnosis Ph� Mice 100 99 N/A2 Adult Relapse Ph� Mice 100 99 N/A3 Adult Nilotinib resistant Phþ Mice 100 98 N/A4 Adult Nilotinib resistant Phþ Mice 100 98 N/A5 Adult Diagnosis Ph� OP9 70 97 98.56 Adult Diagnosis Ph� Primary 44 16 997 Adult Diagnosis Phþ OP9 95 92 98.58 Adult Diagnosis Ph� Primary 91 94 98.29 Adult Relapse t(x;20) Primary 85 26 N/A10 Pediatric Diagnosis CRLF2� Primary 71 17 9511 Pediatric Diagnosis CRLF2� Primary 79 59 9512 Pediatric Diagnosis Ph� Primary 58 56 9113 Pediatric Diagnosis Ph� Primary 34 55 9414 Adult Diagnosis Ph� Primary 71 16 8915 Adult Relapse CRLF2þ Primary 65 28 7316 Pediatric Diagnosis Ph� Primary 80 80 97

NOTE: Genetic and diagnostic information was provided by clinical pathologist Rose Beck at University Hospitals Medical Center (UHMC). BAFFR expression wasdetermined by FACs analysis of gated CD19þ, CD10þ cells (each sample represents an independent experiment).Abbreviations: CRLF2, cytokine receptor like factor 2; N/A, not applicable; ph, Philadelphia chromosome.






and four treatments were performed on days 14, 21, 28, and 35.On day 42, we analyzed tumor burden (Fig. 4G). VAY736 þ NKtreatment significantly reduced disease burden in the spleen andbone marrow of leukemic mice compared with control mice(Fig. 4H). However, NK cell killing of drug-resistant ALL cellswas not as pronounced, as was seen in our previous experiment,where treatment was started early (day 3). Together, these datasuggest that the ALL tumor microenvironment renders NK þVAY736 treatment less effective.

Inhibiting TGFb signaling enhances VAY73-mediated NK cellkilling of ALL

NK cells from ALL patients exhibit impaired cytotoxic func-tion (25), and factors in the tumor microenvironment contributeto decreased expression of NK cell–activating receptors (25, 36).

One such factor is TGFb, a negative regulator of NK cell cytotoxicfunction in ALL patients (25). To confirm TGFb expression in ALLcells, we compared TGFb mRNA expression in pre-B cells from 5pediatric healthy donors compared with 18 pediatric B-ALLpatient samples using the Maia leukemia database on Onco-mine (37). TGFb expression was increased in B-ALL comparedwith normal counterpart pre-B cells (Fig. 5A). We further con-firmed this by analyzing serum TGFb from ALL or PBS-injectedmice. Human TGFbwas enhanced in the serum of leukemic micecompared with control mice (Fig. 5B), whereas mouse TGFb didnot show significant changes (Supplementary Fig. S5A). CD16expression on NK cells is essential for ADCC. TGFb reduced thepercentage of CD16þ NK cells from 28% to 12% (Fig. 5C) andreduced NK cell cytotoxicity against ALL cells from 30% to 17%(Fig. 5D). Addition of EW-7197, a potent TGFbRI inhibitor, to

Figure 2.

VAY736 effect on ALL cell proliferation and survival.ALL cells were labeled with cell proliferation dyeeFluor 670, cultured for 7 days, and then flowcytometry was used to identify proliferating ALL cells.A, Representative histograms of live PT-2 ALL cells atday 0 (D0), day 3 (D3), day 5 (D5), and day 7 (D7).B and C, Total cell count and viability over time ofindicated ALL cells treated with VAY736 (20 mg/mL),BAFF (0.2 mg/mL), VAY736þ BAFF combination, orPBS control as quantified by Trypan blue stain. D,Dotplots (left) and percentages (right) representing totalpopulation of apoptotic cells under the indicatedculture conditions for the indicated times. Datarepresent mean� SD of technical replicates.Experiments A–D 3–4 independent experiments withthree technical replicates. Unpaired Student t test;� , P < 0.05.

Vicioso et al.





Figure 3.

VAY736 increases NK cell killing of drug-resistant and relapsed ALL. ALL cells were preincubated with 20 mg/mL VAY736 or media alone, washed,and cocultured with NK cells for 4 hours. Effector-to-target ratio of 5:1 was used. A, Comparison of ADCC using NK cells expanded from 3 differenthealthy donors with the indicated treatments (mean � SD of technical replicates). B, ADCC mediated by either allogeneic NK cells expanded fromhealthy donors (left) or autologous NK cells expanded from the indicated patient samples (right; mean � SD of technical replicates). C, NK cellslabeled with efluor 670 were coincubated with PT-3 cells labelled with calcein-AM. Representative dot plots of conjugate formation (left) andpercentage of conjugates (right) was analyzed by flow cytometry. Similar observations were made in three independent experiments with threedifferent NK cell donors. Indicated NK cells were cocultured with PT-3 cells pretreated with VAY736 or media alone for 2 hours. D, Flow cytometryanalysis of NK cell expression of CD69, gated on CD56þCD3� cells (mean � SD of technical replicates). A–D, Three independent experiments weredone with three technical replicates. E, ELISA was used to measure granzyme B, TNFa, and INFg in the conditioned media (mean � SD of 3 technicalreplicates). Calculated specific lysis is shown as the mean � SD of 4 independent experiments with 3 technical replicates. � , P < 0.05; �� , P < 0.01;�� , P < 0.001; �� , P < 0.0001 compared with NK cell only by two-tailed Student t test.






Figure 4.

VAY736 mediates NK cell lysis of human ALL in vivo. A, Schematic of in vivo early treatment with 10 mg/kg VAY736 with or without NK cells, NKcells alone, or PBS. B, Percentages of human CD19þCD10þ ALL cells as detected by flow cytometry in the bone marrow and spleen of NSG leukemicmice (n ¼ 5/group) gated on live cells. C, Percentages of CD19þCD10þ ALL cells from VAY736, NK alone, and NK þ VAY736 treated mice shownseparately to appreciate the difference among these three groups (data from B). Error bars represent mean � SD. D, Schematic of in vivo earlytreatment with 10 mg/kg VAY736 with or without NK cells, NK cells only, or PBS controls to assess survival. E, Overall survival curves of mice(n ¼ 5/group) from D. Statistical analysis of mice survival curve was done by log-rank (Mantel–Cox) test; �� , P ¼ 0.0002. F, Percentage of humanCD19þCD10þ ALL cells in bone marrow and spleen (n ¼ 3/group) of mice injected with 2 � 106 PT-3 cells on days 5 and 15 post leukemia celltransplantation. G, Schematic of in vivo late treatment with 10 mg/kg VAY736 with NK cells only or PBS controls. H, Percentage of humanCD19þCD10þ ALL cells as detected by flow cytometry in the bone marrow and spleen (n ¼ 5/group) gated on live cells. �� , P < 0.001;�� , P < 0.0001 compared with PBS-treated group by two-tailed Student t test. A–C, Two independent experiments performed with 3 technicalreplicates, A–E and G–I experiments were also done with 3 technical replicates. All data represent mean � SD of 3–5 mice.

Vicioso et al.





the culture restored CD16 expression on NK cells and NK cellcytotoxicity against ALL cells (Fig. 5C and D). Coculturing NKcells with drug-resistant ALL cells also led to decreased expres-sion of CD16 on NK cells, and this effect was partially ame-

liorated by EW-7197 (Fig. 5E). We next tested whether thecombination of VAY736 and EW-7197 would further increaseNK cell killing of anti-BAFF-R–targeted ALL cells. The combi-nation of VAY736 and EW-7197 further increased NK cell lysis

Figure 5.

EW-7197 increases NK cell killing of anti-BAFF-R–targeted ALL cells. A, TGFbmRNA expression in pre-B cells from 5 pediatric healthy donors compared withB-ALL cells from 18 pediatric B-cell ALL patient samples as revealed by Maia Leukemia Statistics on Oncomine. B,NSGmice were engrafted with the indicatedALL patient sample (2� 106) and sacrificed at day 35. TGFb (mouse/human) was measured by ELISA in the serum of these mice (n¼ 3–5). C, The percentage ofCD16þNK cells after 14 days treatment with recombinant TGFb (5 ng/mL) in the presence or absence of EW-7197 (5 ng/mL) compared with medium alone (mean� SD in triplicate wells).D, Percent lysis of ALL cells preincubated with TGFb (5 ng/mL) in the presence or absence of EW-7197 (5 ng/mL) compared withcontrols after 4 hours of incubation with NK cells on day 14. E, Flow cytometry analysis of CD16 expression in NK cells after a 14-day culture in control medium,coculture with drug-resistant ALL cells with or without EW-7197. F, Percent lysis of ALL cells treated with VAY736 (20 mg/mL) or media alone after 4 hours ofincubation with NK cells pretreated with EW-7197 or left untreated. Effector-to-target (E:T) ratio of 5:1 was used. Data are shown as the mean� SD of triplicatesamples. � , P < 0.05; �� , P < 0.01; �� , P < 0.001; �� , P < 0.0001 compared with indicated controls by two-tailed t test. All experiments C–F, 3–4 independentexperiments performed. B–F, Experiments done with 3 technical replicates.






of ALL cells by 10% to 35% using 4 different ALL patientcells (Fig. 5F).

Combination of VAY736 and EW-7197 enhances NK cellkilling of ALL cells in vivo

EW-7197 has been reported to exert therapeutic activity againstsolid tumors (NCT02160106, NIH). We first examined whetherEW7197, which inhibits intracellular TGFb signaling, has antitu-mor activity against ALL by treating NSG mice bearing drug-resistant ALL cells with oral EW-7197 three times perweek starting

from day 14. On day 42, we analyzed tumor burden (Fig. 6A). Acomparable tumor load in the spleen and bone marrow ofEW-7197–treatedmicewas seen comparedwith control untreatedleukemic mice (Fig. 6B). To evaluate the in vivo efficacy ofcombination EW-7197, NK cells, and VAY736, we treated NSGmice bearing drug-resistant PT-3 cells with daily oral administra-tion of EW-7197 alone or in combination with weekly VAY736and NK cells or PBS (Fig. 6C). At day 35, control mice wereterminally ill, and we sacrificed all mice to analyze tumor burdenin the spleen, bone marrow, and blood. Leukemia cell frequency

Figure 6.

Inhibition of TGFbRI increases NK cell killing of anti-BAFF-R–targeted ALL cells in vivo.A, Schematic of in vivo treatment with EW-7197 (3 mg/kg 3� per week) orcontrol PBS. B, Percentage of human CD19þCD10þ ALL cells (PT-3) as detected by flow cytometry in the blood, bone marrow, and spleen of NSG leukemic mice(n¼ 3/group). C, Schematic of in vivo treatment with VAY736 (10 mg/kg) with NK cells, EW-7197 (3 mg/kg daily) with or without (5� 106) NK cells, or PBS. D,Percentages of human CD19þCD10þALL cells (PT-3) as detected by flow cytometry in the blood, bone marrow, and spleen. E, Percentages of CD19þCD10þ ALLcells from NKþ VAY736 and NKþ VAY736þ EW-7197–treated mice from D, shown separately to appreciate the difference among these three groups. F,Schematic of in vivo treatment with VAY736 (10 mg/kg) with or without NK cells, EW-7197 (3 mg/kg daily) with or without (5� 106) NK cells, or PBS. G,Percentages of CD19þCD10þALL cells (PT-4) from VAY736, EW-7197, NKþ VAY736, NKþ EW-7197, and NKþ VAY736þ EW-7197 treated mice. H, Percentagesof CD19þCD10þALL cells from NKþ EW-7197, NKþ VAY736, and NKþ VAY736þ EW-7197 treated mice from G, shown separately to appreciate the differenceamong these three groups. I, Percentage BAFF-Rþ ALL cells in the bone marrow of PBS and NKþ VAY736þ EW-7197 treated mice. Data are shown as mean�SD of n¼ 4–6mice/group. � , P < 0.05; �� , P < 0.01; �� , P < 0.001; �� , P < 0.0001 compared with controls by two-tailed Student t test. All experiments A–Iweredone with 3 technical replicates.

Vicioso et al.





was significantly reduced in thebonemarrow (29%–36%), spleen(17%–20%), and blood (10%–13%) of EW-7197 þ NK-treatedmice compared with untreated control mice (Fig. 6D). Leukemiacell frequencies were significantly reduced in the bone marrow(36%–44%), spleen (19%–24%), and blood (43%–50%) ofVAY736 þ NK-treated mice compared with control PBS-treatedmice. However, with the combination EW-7197þ VAY736þNKtreatment, there was a significant reduction in ALL cell growth inthe bone marrow (50%–58%), spleen (46%–48%), and blood(62%–77%) compared with control PBS-treated mice. The com-bination of EW-7197 þ VAY736 þ NK cells showed significantlyreduced percentage of ALL cells in the bone marrow, spleen, andblood compared with NK þ EW-7197 or NK þ VAY736-treatedgroups (Fig. 6E). Spleen weights and sizes from the mice treatedwith combination of EW-7197 þ VAY736 þ NK cells weresignificantly reduced compared with control untreated mice(Supplementary Fig. S5B). Similar to the in vitro findingsin Fig. 5C–E, NK cells from EW-7197–treated mice showedincrease in CD16 expression compared with NK þ VAY736–treated mice (Supplementary Fig. S6A). We performed anotherin vivo experiment by injecting PT-4 ALL cells to confirm theeffect of EW-7197 to enhance NK cell–mediated ADCC andsimilar results were obtained (Fig. 6F–H; Supplementary Fig.S6B). Because cancer cells tend to lose target antigens anddevelop resistance to targeted therapies, we analyzed BAFF-Rsurface expression in PT-4 ALL cells from control PBS-injectedand EW-7197 þ VAY736 þ NK cell combination–treated miceat day 42. We found that BAFF-R expression was not affectedafter VAY736 targeting (Fig. 6I). These data indicated that TGFbproduced by ALL cells and the tumor microenvironment neg-atively influenced NK cell–mediated ADCC, and by inhibitingthe TGFb receptor on NK cells, we could partially reverse thisdysfunction (Supplementary Fig. S6C).

DiscussionAdoptive cell therapy using NK cells is of high priority for

leukemia treatment, but often NK cells are dysfunctional inthese patients or tumor cells escape from NK cell–mediatedkilling by various mechanisms (36). ALL cells have downregu-lated expression of MICA and MICB, which are ligands foractivating receptors on NK cells, whereas inhibitory ligandssuch as HLA class 1 have no change, which makes NK celltherapy difficult in these patients (36). Here, we showed that NKcells in the presence of VAY736 exhibits enhanced ALL cellkilling by ADCC. ADCC is a rapid process mediated by effectorimmune cells like NK cells, macrophages, and neutro-phils (38, 39). We assessed the binding affinity of VAY736 todrug-resistant ALL cells and found that the antibody was surfacebound as early as 30 minutes and still remained on the surfaceafter 48 hours. This demonstrated that VAY736 is presented onthe cell surface of ALL cells, improving NK cell–mediated ADCCefficacy. BAFF-R expression on surface of ALL cells varies frompatient to patient, hence confirming BAFF-R expression on ALLblast cells is a prerequisite for treatment with VAY736 antibody.Our data point to reduced BAFF-R expression in pediatric ALLpatients compared with adult ALL patients, but 16 ALL patientsare not sufficient to draw a conclusion and need further analysisusing larger patient data sets. Another factor that could possiblyaffect binding of VAY736 to ALL cells is competition with serumBAFF in patients (17). Increased BAFF expression is reported in

ALL patients (40), so we evaluated the competition of VAY736with BAFF. Our data showed no competition of VAY736 bind-ing when exposed to endogenous BAFF. BAFF is a survival factorfor mature B cells and inhibiting BAFF signaling affects matureB-cell antigen-induced proliferation (9, 17, 31, 32). VAY736 didnot inhibit BAFF-induced signaling pathways or survival genesin ALL cells at basal state, which could explain why VAY736monotherapy did not show any effect on survival or prolifer-ation of ALL cells. Also, VAY736-induced ALL cell killing issolely via ADCC. Addition of exogenous BAFF also had no effecton ALL cell basal survival or proliferation, similar to normal Bcells (31).

NK cells from different donors exhibited a different degree ofALL cytotoxic activity, and this could be explained by hetero-geneous nature of human NK cells. Tumor killing function ofNK cells depends on various factors, including the nature of theNK cell subset, activating/inhibitory receptor repertoire, andinteraction of HLA on tumor cells and KIRs on NK cells (36).VAY736 and NK cell combination treatment in vivo also killedALL cells in PDX-ALL mouse models, provided the treatmentstarted early before establishment of a significant tumor load orsuppression in the tumor microenvironment. Delayed treat-ment onset was not as efficient in killing ALL cells both in thebone marrow and spleen. In real-life situations, most patientshave a high tumor load and a suppressive tumor microenvi-ronment at disease presentation, especially in drug-resistantand relapsed patients who fail to respond to conventionaltherapies. Because of this, it is important to evaluate the efficacyof novel treatment strategies in an advanced-stage tumor modelin preclinical drug testing.

TGFb is reported to inhibit interleukin-15 (IL15)-inducedactivation of mTOR and IFNg production in NK cells, down-regulates NKp30 and NKG2D (activating NK receptors), inhibitsCD16-associated g-chain, resulting in decreased surface expres-sion of CD16, and thus contributing to NK cell dysfunction(41–44). TGFb is produced by both tumor cells and NK cells inthe tumor microenvironment. Hence, neutralizing TGFb sig-naling in NK cells could contribute to enhanced ADCC per-formance. We observed that exposure of NK cells to TGFb leadsto suppression of ADCC via CD16 downregulation, whereasinhibiting TGFbR1 on ex vivo–expanded NK cells usingEW-7197 partially reversed this ADCC inhibition. EW7197 hasalready been certified as an Investigational New Drug, andphase I clinical trials are ongoing (ref. 45; NCT02160106,NIH). Similarly, VAY736 is also used in clinical trials forvarious diseases including pemphigus vulgaris (NCT01930175,Novartis), rheumatoid arthritis (NCT02675803, NIH), Sjogrensyndrome (NCT0296289, NIH), idiopathic pulmonary fibrosis(NCT03287414), autoimmune hepatitis (NCT03217422), andCLL (NCT03400176, NIH), making the combination therapymore feasible in ALL patients.

Because TGFbR1 inhibitors TEW-7197 (45) and LY2157299(46) are used in clinical trials for solid tumors, as well asrefractory multiple myeloma (NCT03143985), we analyzedthe effect of EW-7197 on ALL cells in vivo. No significant changein tumor load was seen after EW-7197 treatment. Hence,increased ALL cell killing in the presence of EW-7197 and NKcells will be due to inhibition of TGFb signaling in NK cellstogether with the increased numbers of CD16þ NK cells.VAY736 can also kill tumor cells through antibody-mediatedphagocytosis (ADCP), as macrophages can be a major effector






cell type that mediates cell killing through antibodies (38, 39).In this study, we injected only human NK cells for performingADCC, and we assume injecting macrophages will furtherincrease ALL killing by ADCP. In patients, both NK cells andmacrophages can mediate ADCC or ADCP, thus more likely toeradicate B-ALL cells. Another way to enhance ADCC is touse TGFb inhibitors in combination with EW-7197 to inhibitTGFb signaling in NK cells, but this combination has to befurther tested.

In summary, we showed that early treatment with VAY736enhances ADCC in BAFF-Rþ drug-resistant PDX-ALL mice, but ifadvanced disease is present, microenvironmental factors, such asTGFb, could inhibit ADCC efficacy. Therefore, inhibition of TGFbsignaling inNKcells is required to achieve a significant therapeuticeffect. We showed here that a combination of EW-7197 andVAY736 enhanced NK cell–mediated ADCC killing of BAFF-Rþ

ALL cells, even at advanced stages of disease or difficult-to-treatdrug-resistant cells.

Disclosure of Potential Conflicts of InterestH. Gram is director of Novartis Pharma AG. No potential conflicts of interest

were disclosed by the other authors.

Authors' ContributionsConception and design: R. Parameswaran, Y. Vicioso, R. Beck, J. LetterioDevelopment of methodology: Y. Vicioso, H. Gram

Acquisition of data (provided animals, acquired and managed patients,provided facilities, etc.): R. Parameswaran, Y. Vicioso, R. Beck, A. Asthana,K. Zhang, D.P. WongAnalysis and interpretation of data (e.g., statistical analysis, biostatistics,computational analysis): R. Parameswaran, Y. Vicioso, R. Beck, A. Asthana,K. Zhang, J. LetterioWriting, review, and/or revision of the manuscript: R. Parameswaran,Y. Vicioso, H. Gram, R. Beck, A. Asthana, D.P. Wong, J. LetterioAdministrative, technical, or material support (i.e., reporting or organizingdata, constructing databases): R. Parameswaran, Y. Vicioso, J. LetterioStudy supervision: R. ParameswaranOther (provision of critical reagent): H. Gram

AcknowledgmentsThis work was supported by the Athymic Animal, Hematopoietic Biorepo-

sitory andCellular Therapy, RadiationCore facilities, FlowCytometry and otherCommon Resources of the Case Comprehensive Cancer Center. This work wassupported by NIH 1R21CA201775-01A1 (R. Parameswaran), St. Baldrick'sFoundation (R. Parameswaran), The Andrew McDonough Bþ Foundation(R. Parameswaran), and The Jane & Lee Seidman Chair in Pediatric CancerInnovation (J. Letterio).

The costs of publication of this articlewere defrayed inpart by the payment ofpage charges. This article must therefore be hereby marked advertisement inaccordance with 18 U.S.C. Section 1734 solely to indicate this fact.

Received January 24, 2019; revised March 5, 2019; accepted May 21, 2019;published first May 28, 2019.

References1. Pui CH, Evans WE. Treatment of acute lymphoblastic leukemia. N Engl J

Med 2006;354:166–78.2. Pui CH, Relling MV, Downing JR. Acute lymphoblastic leukemia. N Engl J

Med 2004;350:1535–48.3. Mejstríkov�aE,HrusakO,BorowitzMJ,Whitlock JA, BrethonB, Trippett TM,

et al. CD19-negative relapse of pediatric B-cell precursor acute lympho-blastic leukemia following blinatumomab treatment. BloodCancer J 2017;7:659.

4. Pui CH, Pei D, Campana D, Cheng C, Sandlund JT, Bowman WP, et al. Arevised definition for cure of childhood acute lymphoblastic leukemia.Leukemia 2014;28:2336–43.

5. Ma W, Kantarjian H, Yeh CH, Zhang ZJ, Cortes J, Albitar M. BCR-ABLtruncation due to premature translation termination as a mechanism ofresistance to kinase inhibitors. Acta Hematol 2009;121:27–31.

6. Pochitaloff L, Baranger M, Hunault L, Cuccuni M, Lefebvre W, BidetCA. Impact of cytogenetic abnormalities in adults with Ph-negativeB-cell precursor acute lymphoblastic leukemia. Blood 2017;130:1832–44.

7. Chiarini F, Lonetti A, Evangelisti C, Buontempo F, Orsini E, Cappellini A,et al. Advances in understanding the acute lymphoblastic leukemia bonemarrow microenvironment: from biology to therapeutic targeting.Biochim Biophys Acta 2016;1863:449–63.

8. Bakker E, Qattan M, Multi Demonacos L, Krstic-Demonacos CM. The roleof the microenvironment and immunity in drug response in leukemia.Biochim Biophys Acta 2016;1863:414–26.

9. Mackay F, Schneider P, Rennert P, Browning J. BAFF and APRIL: a tutorialon B cell survival. Annu Rev Immunol 2003;21:231–64.

10. Bossen C, Schneider P. BAFF, APRIL and their receptors: structure, functionand signaling. Semin Immunol 2006;18:263–75.

11. Rodig SJ, Shahsafaei A, Li B, Mackay CR, Dorfman DM. BAFF-R, themajor B cell activating factor receptor, is expressed on most mature Bcells and B-cell lymphoproliferative disorders. Hum Pathol 2005;36:1113–9.

12. Klaus W, Salzer U, Rizzi M, Fischer B, Gutenberger S, Bohm J, et al. B-cellactivating factor receptor deficiency is associated with an adult-onsetantibody deficiency syndrome in humans. Proc Natl Acad Sci U S A2009;106:13945–50.

13. Parameswaran R, Muschen M, Kim YM, Groffen J, Heisterkamp N.A functional receptor for B-cell-activating factor is expressed onhuman acute lymphoblastic leukemias. Cancer Res 2010;70:4346–56.

14. Mihalcik SA, Tschumper RC, Jelinek DF. Transcriptional and post-transcriptional mechanisms of BAFF-receptor dysregulation in human Blineage malignancies. Cell Cycle 2010;9:4884–92.

15. Lyu MA, Cheung LH, Hittelman WN, Marks JW, Aguiar RC, RosenblumMG. The rGel/BLyS fusion toxin specifically targets malignant B cellsexpressing the BLyS receptors BAFF-R, TACI, and BCMA. Mol Cancer Ther2007;6:460–70.

16. Parameswaran R, YuM, LyuM, RosenblumMG, Groffen J, HeisterkampN.Treatment of acute lymphoblastic leukemia with an rGel/BLyS fusiontoxin. Leukemia 2012;26:1786–96.

17. Parameswaran R, Lim M, Fei F, Abdel-Azim H, Arutyunyan A, Schiffer I,et al. Effector-mediated eradication of precursor B acute lymphoblasticleukemia with a novel Fc engineered monoclonal antibody targeting theBAFF-R. Mol Cancer Ther 2014;13:1567–77.

18. Natsume A, Niwa R, Satoh M. Improving effector functions of antibodiesfor cancer treatment: Enhancing ADCC and CDC. Drug Des Devel Ther2009;3:7–16.

19. Asselin BL, Gaynon P,Whitlock JA. Recent advances in acute lymphoblasticleukemia in children and adolescents: an expert panel discussion.Curr Opin Oncol 2013;25:S1–13.

20. Pillay V,GanHK, Scott AM.Antibodies inoncology.NBiotechnol 2011;28:518–29.

21. Sebastien M, Sylvie C, Xavier T, Dominik H, Thibaut L, Francoise H, et al.Rituximab in B-lineage adult acute lymphoblastic leukemia. N Engl J Med2016;375:1044–53.

22. Huhn D, von Schilling C, Wilhelm M, Ho AD, Hallek M, Kuse R, et al.Rituximab therapy of patients with B-cell chronic lymphocytic leukemia.Blood 2001;98:1326–31.

23. Daver N, O'Brien S. Novel therapeutic strategies in adult acute lympho-blastic leukemia a focus on emerging monoclonal antibodies. CurrHematol Malig Rep 2015;8:123–31.

24. HagenbeekA,GadebergO, JohnsonP, Pedersen LM,Walewski J,HellmannA, et al. First clinical use of aftumumab, a novel fully human anticd20

Vicioso et al.





monoclonal antibody in relapse or refractory follicular lymphoma: resultsof a phase 1/2 trial. Blood 2008;111:5486–95.

25. Rouce RH, Shaim H, Sekine T, Weber G, Ballard B, Ku S, et al. The TGF-b/smad pathway is an important mechanism for NK cell immuneevasion in childhood B-acute lymphoblastic leukemia. Leukemia2015;30:800.

26. Son JY, Park SY, Kim SJ, Lee SJ, Park SA, Kim SW, et al. EW-7197, a NovelALK-5 Kinase Inhibitor, potently inhibits breast to lung metastasis.Mol Cancer Ther 2014;13:1704–16.

27. Denman CJ, Senyukov VV, Somanchi SS, Phatarpekar PV, Koop LM,Johnson JL, et al. Membrane-bound IL-21 promotes sustained ex vivoproliferation of human natural killer cells. PLoS One 2012;7:e30264.

28. Liu Y, Wu HW, Sheard MA, Sposto R, Somanchi SS, Cooper LJ, et al.Growth and activation of natural killer cells ex vivo from children withneuroblastoma for adoptive cell therapy. Clin Cancer Res 2013;19:2132–43.

29. Haferlach T, Kohlmann A, Wieczorek L, Basso G, Kronnie GT, B�en�e MC,et al. Clinical utility of microarray-based gene expression profiling inthe diagnosis and sub classification of leukemia: report from theinternational microarray innovations in leukemia study group. JCO2010;28:2529–37.

30. Fawzy Samar M, Tamer AG, Eman EN, Heba HE-D, Olfat G. Serum BAFFlevel and its correlations with various disease parameters in patients withsystemic sclerosis and systemic lupus erythematosus. The Egyptian Rheu-matologist 2011;33:45–51.

31. Sandra G, Robert B. Non-Canonical NF-kB signaling initiated by BAFFinfluences B Cell Biology at multiple junctures. Front Immunol 2013;4:509.

32. Alina P, Ingrid M, Hediye E, Paul T, Alexander T. BAFF controls B cellmetabolic fitness through a PKCb and Akt-dependent mechanism. JEM2006;203:2551–62.

33. Sullivan EM, Sima J,GuolianK,ChengC, Barbara R,MarthaH, et al.NK cellgenotype and phenotype at diagnosis of acute lymphoblastic leukemiacorrelates with post-induction residual disease. Clin Cancer Res 2014;20:5986–94.

34. Anne MD, Proctor SJ, Elizabeth J, Reid MM, Walker W, Craft AW. NaturalKiller cell activity in childhood acute lymphoblastic leukaemia in remis-sion. Br J Haematol 1985;59:45–53.

35. Farnault L, Sanchez C, Baier C, Le Treut T, Costello RT. HematologicalMalignancies escape from NK cell innate immune surveillance: mechan-isms and therapeutic implications. Clin Dev Immunol 2012;2012:421702.

36. Romanski A, Bug C, Becker S, Kampfmann M, Seifried E, Hoelzer D,et al. Mechanisms of resistance to natural killer cell-mediated cyto-toxicity in acute lymphoblastic leukemia. Exp Hematol 2005;33:344–52.

37. Maia S, Haining WN, Ansen S, Xia Z, Armstrong SA, Seth NP, et al. Geneexpression profiling identifies BAX-d as a novel tumor antigen in acutelymphoblastic leukemia. Cancer Res 2005;65:10050–8.

38. Yeap WH, Wong KL, Shimasaki N, Teo EC, Quek JK, Yong HX, et al. CD16is indispensable for antibody-dependent cellular cytotoxicity by humanmonocytes. Sci Rep 2016;6:34310.

39. Takai T, Li M, Sylvestre D, Clynes R, Ravetch JV. FcRg chain deletion resultsin pleiotrophic effector cell defects. Cell 1994;519–29.

40. SunB, Li L, XuM,Wang F,NiH. Significance of BAFF/APRIL expression andtheir receptors in pediatric patients with acute lymphoblastic leukemia.J Pediatr Hematol Oncol 2016;38:167–72.

41. Camille G, Nicholas DH, Mark JS. Targeting natural killer cells in cancerimmunotherapy. Nat Immunol 2016;17:1025–36.

42. Viel S, Marcais A, Guimares FS, Loftus R, Rabilloud J, Grau M, et al. TGF-binhibits the activation and functions of NK cells by repressing the mTORpathway. Sci Signal 2016;9:ra19.

43. Courtney A, Seunggu JH, Jeffery JB, Brian JA, Lewis LL, Andrew TP. TGF-bdownregulates the activating receptor NKG2D on NK cells and CD8þ Tcells in glioma patients. Neuro Oncology 2010;12:7–13.

44. Trotta R, Dal Col J, Yu J, Ciarlariello D, Thomas B, Zhang X, et al. TGF-betautilizes SMAD3 to inhibit CD16-mediated IFN-gamma production andantibody-dependent cellular cytotoxicity in human NK cells. J Immunol2008;181:3784–92.

45. Naka K, Ishihara K, Jomen Y, Jin CH, Kim DH, Gu YK. Novel oraltransforming growth factor-b signaling inhibitor EW-7197 eradicatesCML-initiating cells. Cancer Sci 2016;107:140–8.

46. Stephan H, Scott J, Anja S, Ivelina G, Kyla ED, Shawn TE, et al. Clinicaldevelopment of galunisertib (LY2157299 monohydrate), a small-molecule inhibitor of transforming growth factor-beta signaling pathway.Drug Des Devel Ther 2015;9:4479–99.






2019;7:1106-1119. Published OnlineFirst May 28, 2019.Cancer Immunol Res Yorleny Vicioso, Hermann Gram, Rose Beck, et al. Lymphoblastic LeukemiaCombination Therapy for Treating Advanced Drug-Resistant Acute

Updated version

10.1158/2326-6066.CIR-19-0058doi:

Access the most recent version of this article at:

Material

Supplementary

http://cancerimmunolres.aacrjournals.org/content/suppl/2019/05/25/2326-6066.CIR-19-0058.DC1

http://cancerimmunolres.aacrjournals.org/content/suppl/2019/06/19/2326-6066.CIR-19-0058.DC2Access the most recent supplemental material at:

Cited articles

http://cancerimmunolres.aacrjournals.org/content/7/7/1106.full#ref-list-1

This article cites 45 articles, 15 of which you can access for free at:

E-mail alerts related to this article or journal.Sign up to receive free email-alerts

Subscriptions

Reprints and

[email protected]

To order reprints of this article or to subscribe to the journal, contact the AACR Publications Department

Permissions

Rightslink site. Click on "Request Permissions" which will take you to the Copyright Clearance Center's (CCC)

.http://cancerimmunolres.aacrjournals.org/content/7/7/1106To request permission to re-use all or part of this article, use this link



http://cancerimmunolres.aacrjournals.org/lookup/doi/10.1158/2326-6066.CIR-19-0058

http://cancerimmunolres.aacrjournals.org/content/suppl/2019/06/19/2326-6066.CIR-19-0058.DC2 http://cancerimmunolres.aacrjournals.org/content/suppl/2019/05/25/2326-6066.CIR-19-0058.DC1

http://cancerimmunolres.aacrjournals.org/content/suppl/2019/06/19/2326-6066.CIR-19-0058.DC2 http://cancerimmunolres.aacrjournals.org/content/suppl/2019/05/25/2326-6066.CIR-19-0058.DC1

http://cancerimmunolres.aacrjournals.org/content/7/7/1106.full#ref-list-1

http://cancerimmunolres.aacrjournals.org/cgi/alerts

mailto:[email protected]

http://cancerimmunolres.aacrjournals.org/content/7/7/1106


Documents

Combination Therapy for Treating Advanced Drug-Resistant ... · TGFb was a negative regulator of CD16 expression and, thus, NK cell ADCC function. After coincubation with ALL cells,