J. Microbiol. Biotechnol. (2011), 21(8), 861–868doi: 10.4014/jmb.1102.02024First published online 15 June 2011

Cloning, Expression, and Characterization of a New Xylanase from Alkalophilic Paenibacillus sp. 12-11

Zhao, Yanyu1,2

, Kun Meng1, Huiying Luo

1, Peilong Yang

2*, Pengjun Shi

1, Huoqing Huang

1, Yingguo Bai

1,

and Bin Yao1*

1Key Laboratory for Feed Biotechnology of the Ministry of Agriculture, Feed Research Institute, Chinese Academy of AgriculturalSciences, Beijing 100081, P. R. China2Department of Microbial Engineering, Feed Research Institute, Chinese Academy of Agricultural Sciences, Beijing 100081, P. R.China

Received: February 16, 2011 / Revised: May 17, 2011 / Accepted: May 19, 2011

A xylanase gene, xyn7c, was cloned from Paenibacillus sp.

12-11, an alkalophilic strain isolated from the alkaline

wastewater sludge of a paper mill, and expressed in

Escherichia coli. The full-length gene consists of 1,296 bp

and encodes a mature protein of 400 residues (excluding

the putative signal peptide) that belongs to the glycoside

hydrolase family 10. The optimal pH of the purified

recombinant XYN7C was found to be 8.0, and the enzyme

had good pH adaptability at 6.5-8.5 and stability over a

broad pH range of 5.0-11.0. XYN7C exhibited maximum

activity at 55o

C and was thermostable at 50o

C and below.

Using wheat arabinoxylan as the substrate, XYN7C had a

high specific activity of 1,886 U/mg, and the apparent Km

and Vmax

values were 1.18 mg/ml and 1,961 µmol/mg/min,

respectively. XYN7C also had substrate specificity towards

various xylans, and was highly resistant to neutral

proteases. The main hydrolysis products of xylans were

xylose and xylobiose. These properties make XYN7C a

promising candidate to be used in biobleaching, baking,

and cotton scouring processes.

Keywords: Alkaline xylanase, Paenibacillus sp., Escherichia

coli, protease resistance

Xylanase (E.C. 3.2.1.8) randomly catalyzes the hydrolysis

of the main polysaccharide chain present in xylan to

produce xylooligosaccharides and xylose [6]. According to

the primary structures, xylanases are confined to glycosyl

hydrolase families 10 and 11 [10]. Xylanases have been

applied in a variety of industrial processes [2]. In the pulp

and paper industry, xylanases are amended to conventional

processes to reduce the use of chlorine and/or chlorine

dioxide in bleaching [1]. In the food industry, xylanases

are used as food additives to improve the dough handling

and the quality of baked products [21]. Xylanases are also

used in feed, bioconversion of lignocellulosic materials,

clarification of juices, and brewing industries [33]. Combination

of xylanases and other glycosyl hydrolases is common in

various fields for better effect [2].

Numerous xylanases have been isolated and characterized

from fungi [31] and bacteria [11]. The pH optima of fungal

xylanases are around 5, whereas that of bacterial xylanases

is generally slightly higher [40]. Ideal industrial xylanases

for specific applications should possess favorable properties.

For example, thermophilic and alkaline xylanases are

preferred in biobleaching.

Microbes from extreme or special environments have

been the good sources of xylanases in the recent years. In

the present work, we isolated an alkalophilic Paenibacillus

strain having significant xylanase activity from the alkaline

wastewater sludge of a paper mill. The related gene was

cloned and expressed. The recombinant xylanase had some

superior properties, and had potentials for application in

various industries.

MATERIALS AND METHODS

Microorganism Isolation

The alkaline wastewater sludge was collected from the discharge of

a paper mill in Henan Province, China. It was stored at -20oC before

use. The pH value of the sample was determined to be pH 9.0. The

enrichment medium for selection of xylan-degrading strains contained

*Corresponding authorB. YaoPhone: +86 10 82106063; Fax: +86 10 82106054;E-mail: yaobin@caas-bio.net.cnP. YangPhone: +86 10 82106063; Fax: +86 10 82106054;E-mail: yangpl@mail.caas.net.cn

862 Zhao et al.

1% birchwood xylan, 0.5% peptone, and 0.5% NaCl. After incubation

at 37oC for 36 h with agitation, the dilute suspension was spread

onto agar plates containing 0.5% birchwood xylan, 0.5% peptone,

and 0.1% KH2PO4 (pH 10.0) [17]. Pure cultures obtained through

repeated streaking were tested for xylanase activity by flooding

plates with 0.1% Congo red [39]. One strain, namely 12-11, with

significant xylanase activity was selected for further study. The

taxon of strain 12-11 was identified by comparison of the 16S rDNA

sequence amplified using primers 27f and 1492r [27] with that in

GenBank.

Strains, Vectors, and Materials

The pGEM-T Easy vector (Promega, USA) and pET-22b (+) (Novagen,

Germany) were used for gene cloning and expression, respectively.

Escherichia coli JM109 (TaKaRa, Japan) was used for the construction

and propagation of recombinant plasmids. E. coli BL21 (DE3)

(Novagen) was used as the host for heterogeneous expression. The

DNA purification kit, LA Taq DNA polymerase with buffer, and

restriction endonucleases were purchased from TaKaRa. T4 DNA

ligase and buffer were obtained from NEB (USA). Substrates oat

spelt xylan, birchwood xylan, beechwood xylan, CMC-Na, Avicel,

barley β-glucan, PNP-cellobioside, and PNP-xylopyranoside; and

proteases trypsin (from bovine), α-chymotrypsin (type II from bovine),

proteinase K, subtilisin A (type VIII from Bacillus licheniformis), and

collagenase (type IV from Clostridium histolyticum) were purchased

from Sigma (USA). Wheat arabinoxylan was obtained from Megazyme

(Australia). All the other chemicals were of analytical grade and

commercially available.

Gene Cloning

Genomic DNA of strain 12-11 was extracted using a genome-

extracting kit (TIANGEN, China) and used as the template for PCR

amplification. Based on the conserved blocks (D-W-D-V-[V/C/N]-

N-E-V and [D/H]-[G/A/C]-[I/V/L]-G- [M/F/L/I]-Q-[S/G/M/C]-H, 85

amino acids between) of glycosyl hydrolase family 10 xylanases,

X10-R [36] and XF1 (Table 1) were designed and used to amplify

the partial xylanase gene from strain 12-11. The PCR conditions

were as follows: 95oC for 4 min, 12 cycles of 95

oC for 30 s, 56-

50oC for 30 s (decreasing 0.5oC per cycle), and 72oC for 1 min,

followed by 26 cycles of 95oC for 30 s, 50oC for 30 s, and 72oC for

30 s. The resulting amplified fragment was gel-purified, ligated with

pEASY-T3 Easy vector, transformed into E. coli JM109 cells, and

sequenced by Biomed (China). The partial sequence was subjected

to BLAST analysis. Thermal asymmetric interlaced (TAIL)-PCR

[20] was conducted with a genome walking kit (TaKaRa) to obtain

the 5' and 3' flanking regions. The nested insertion-specific primers

for TAIL-PCR are listed in Table 1.

Sequence Analysis

Sequence analysis and assembly, and molecular mass prediction of

the mature peptide were performed with Vector NTI 7.0 software

(InforMax, USA). Homology searches against NCBI database were

performed using the BLAST server (http://www.ncbi.nlm.nih.gov/

BLAST). The signal peptide was predicted using SignalP (http://

www.cbs.dtu.dk/services/SignalP/). The three-dimensional structure

was predicted using the SWISS-MODEL with xylanase B from

Clostridium stercorarium F9 (2DEP_A) as the template. Multiple

alignments of protein sequences were conducted using the ClustalW

program (http://www.ebi.ac.uk/clustalW) and GeneDoc software.

Expression of xyn7c in E. coli

The gene fragment without the signal peptide coding sequence was

PCR amplified with two expresssion primers, pET22-7-c-EF and

pET22-7-c-XR (Table 1). The PCR conditions were as follows:

4 min at 95oC, followed by 32 cycles of 30 s at 94oC, 30 s at 55oC,

and 2 min at 72oC, with a final extension at 72

oC for 10 min. The

PCR product was gel purified, digested with EcoRI and XhoI, and

cloned into the EcoRI-XhoI site of pET-22b(+). The recombinant

plasmid, pET-xyn7c, was transformed into E. coli BL21 (DE3)

competent cells by hot shock. Positive transformants harboring the

gene xyn7c were grown in Luria-Bertini broth containing 100 µg/ml

ampicillin overnight at 37oC with agitation of 250 rpm to an OD600

of approximately 0.6. The cultures were then induced with isopropyl-

β-D-1-thiogalactopyranoside (IPTG) to the final concentration of

0.8 mM at 18oC for 16-18 h. The culture having the highest xylanase

activity in the supernatant was subjected to purification and further

characterization.

Purification of the Recombinant Xylanase

The induced culture was centrifuged at 10,000 ×g, 4oC, for 10 min to

remove cell debris. The cell-free supernatant was concentrated with

a Hollow Fiber Membrane Module (Motian, China). The crude enzyme

(5-10 ml) was applied to a Ni-NTA chelating column (Qiagen,

Germany) equilibrated with buffer A [20 mM Tris-HCl, 500 mM

NaCl, and 10% (w/v) glycerol, pH 7.6]. Elution was carried out with

a gradient of imidazole (0, 20, 40, 60, 80, 100, 200, and 500 mM)

Table 1. Primers used in this study.

Primers Sequences (5'→3')a

XF1 GATTGGGACGTNGTNAAYGARGT

pET22-7-c-EF CCGGAATTCGCGTGACAAGCCCCCCGCCGAAA

pET22-7-c-XR CCGCTCGAGCTCAGATCCTGCCGCCTTAACA

d1 CGAGCGAATGGTATAAAATAGCCGGTACTGATTACATCG

d2 CGAAGCTTTATATTAACGATTACGGCACGGATAACCCTG

d3 GTGAAAAATTTGCTGGAGCAAGGTGTTCCGATCGAC

u1 CGGAACACCTTGCTCCAGCAAATTTTTCACAAGCTG

u2 CAGGGTTATCCGTGCCGTAATCGTTAATATAAAGCTTCG

u3 CGTTGCGATGTAATCAGTACCGGCTATTTTATACCATTCGaRestriction sites are underlined. R represents A or G; N represents A, C, G, or T; and Y represents C or T.

A XYLANASE FROM ALKALOPHILIC PAENIBACILLUS SP. 863

in buffer B (20 mM sodium phosphate, 500 mM NaCl, pH 7.6), and

fractions with enzyme activity were pooled.

Protein expression and purification were analyzed by sodium dodecyl

sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) on a 12%

running gel [15]. The protein concentration was determined by

using the Bradford method [3] with bovine serum albumin as a

standard. The bands were visualized by staining with Coomassie

Brilliant Blue G250. Purified protein was analyzed using matrix-

assisted laser desorption/ionization time-of-flight mass spectrometry

(MALDI-TOF/MS) for peptide fingerprinting, at the Institute of

Zoology, Chinese Academy of Sciences.

Enzyme Activity Assay

Xylanase activity was determined by the 3.5-dinitrosalicylic acid

(DNS) method [26]. To prepare 1% (w/v) xylan solution, 1 g of

xylan was suspended in 100 ml of Tris-HCl (pH 8.0) and heated in

a boiling water bath for 5 min. The supernatant was collected by

centrifugation (10,000 ×g, 5 min) and used in the following tests.

The standard reaction system contained 0.1 ml of appropriately diluted

enzyme and 0.9 ml of 1% (w/v) soluble xylan. After incubation at

55oC for 10 min, the reaction was terminated with 1.5 ml of DNS

reagent. The mixture was then boiled for 5 min and cooled to room

temperature, and the absorption at 540 nm was measured. One unit

of xylanase activity was defined as the amount of enzyme that

released 1 µmol of reducing sugar equivalent to xylose per minute

under the assay conditions.

Biochemical Characterization of the Purified Recombinant

XYN7C

The effect of pH on xylanase activity of purified recombinant

XYN7C was evaluated at 55oC over the pH range of 4.0-12.0. The

buffers used were 0.1 M McIlvaine buffer (pH 3.0-8.0), 0.1 M Tris-

HCl (pH 8.0-9.0), and 0.1 M glycine-NaOH (pH 9.0-12.0). The

pH stability of recombinant XYN7C was determined at pH 8.0 and

55oC after pre-incubation of the enzyme solution in the buffers

mentioned above without substrate at 37oC for 1 h. The temperature

optimum of XYN7C was determined at the optimum pH by varying

the temperature from 20oC to 70

oC. The thermostability of XYN7C

was determined at pH 8.0 and 55oC after pre-incubation of the

enzyme solution at temperatures 45oC, 50oC, and 55oC for various

periods without substrate.

Proteolytic resistance of purified recombinant XYN7C was also

determined. XYN7C was incubated with trypsin (pH 7.0), α-chymotrypsin

(pH 7.0), proteinase K (pH 7.5), subtilisin A (pH 7.5), or collagenase

(pH 7.4) in 0.1 M Tris-HCl at a ratio of protease:xylanase of 0.1:1

(w:w) at 37oC for 1 h. The residual enzyme activity was determined

under standard conditions (pH 8.0, 55oC, 10 min).

To determine the effects of various metal ions and chemical reagents

on the activity of purified recombinant XYN7C, the enzyme was

assayed under standard conditions in the presence of 5 or 10 mM of

NaCl, KCl, CaCl2, LiCl, CoCl2, CrCl3, NiSO4, CuSO4, MgCl2, FeCl3,

MnSO4, ZnCl2, SDS, EDTA, or β-mercaptoethanol. The system without

any chemicals was treated as the blank control. Each experiment

included three replicate samples.

Substrate Specificity and Kinetic Parameters

The substrate activity of purified recombinant XYN7C was tested

by measuring its enzyme activity against oat spelt xylan, birchwood

xylan, beechwood xylan, wheat arabinoxylan, CMC-Na, Avicel,

barley β-glucan, PNP-cellobioside, and PNP-xylopyranoside in 0.1 M

Tris-HCl (pH 8.0), respectively. The Km and Vmax values of XYN7C

were determined by using 1-10 mg/ml oat spelt xylan and wheat

arabinoxylan, and the data were plotted according to the Lineweaver-

Burk method [18]. Each experiment was repeated three times.

Analysis of Hydrolysis Product

Oat spelt xylan and beechwood xylan as grass and hardwood xylan

representatives, respectively, were selected for hydrolysis product

analysis. The reaction mixture containing 3 U of the purified

recombinant XYN7C and 2 mg/ml oat spelt xylan or beechwood

xylan in 400 µl of 0.1 M Tris-HCl (pH 8.0) was incubated at 37oC

for 24 h. After hydrolysis, the enzyme was removed from the

reaction using the Nanosep Centrifugal 3 K Device (Pall, USA).

The hydrolysis products were analyzed by high-performance anion-

exchange chromatography (HPAEC) with a Dionex model 2500

system (USA) [17]. Xylose, xylobiose, xylotriose, xylotetraose, and

xylopentaose were used as standards.

Nucleotide Sequence Accession Numbers

The nucleotide sequences of the Paenibacillus sp. 12-11 16S rDNA

and xylanase gene (xyn7c) have been deposited in the GenBank

database under the accession numbers HQ688784 and HQ688783,

respectively.

RESULTS

Microorganism Identification

Strain 12-11 showed optimal growth at pH 10.0. The culture

supernatant had xylanase activity of 6.8 U/ml at pH 6.0

and 9.0, and retained 40% of the maximal activity at pH

11.0. Colonies of strain 12-11 formed white, translucent,

and mucoid colonies on LB plates. Cells were rod-shaped

or cylindrical. Comparison of the full-length 16S rDNA gene

of strain 12-11 (1,508 bp) with that in the GenBank database

classified this strain in the genus Paenibacillus [99%

identity with that of Paenibacillus sp. S39 (AB043867.1)].

Strain 12-11 was deposited in the Agricultural Culture Collection

of China under the registration number ACCC05615.

Cloning and Sequence Analysis of the Xylanase Gene

xyn7c

A 257 bp gene fragment was obtained by PCR with

degenerate primers XF1 and X10-R. Based on the sequence

of this core region, 6 specific primers were designed and

used to clone the 5' and 3' flanking regions. By using

TAIL-PCR, fragments of 670 bp and 369 bp were obtained

and assembled with the core region to yield an open

reading frame (ORF) of 1,296 bp. The ORF of xyn7c DNA

encoded a 431-amino-acids polypeptide and a stop codon of

TGA. SignalP analysis indicated the presence of a signal

peptide at residues 1-31 (Fig. 1). The mature protein had a

calculated molecular mass of 45.4 kDa and an estimated pI

of 5.01. The ratio of acidic/basic residues of deduced XYN7C

was 1.65, and the frequency of Asp and Glu was 15.51%.

864 Zhao et al.

The deduced amino acid sequence of XYN7C showed

high identities to putative family 10 glycosyl hydrolases from

Geobacillus sp. Y412MC10 (ACX65538.1; 88% identity)

and Paenibacillus sp. JDR-2 (ACT02870.1; 63% identity)

and identified xylanases from C. stercorarium F9 (PDB:

2DEP_A, 69% identity), Bacillus halodurans (PDB: 2UWF_A,

55% identity), B. halodurans C-125 (NP_242986.1, 54%

identity), and alkalophilic Bacillus sp. Ng-27F10 (PDB:

2FGL_A, 53% identity) (Fig. 1). Based on BLAST and

analysis, the deduced XYN7C contained a catalytic domain

typical of glycosyl hydrolase family 10, and had a (α/β)8-

fold structure. The two conserved catalytic glutamate residues

(Glu-230 and Glu-338) of family 10 members [6] were

identified.

Expression and Purification of Recombinant XYN7C

The gene fragment coding for the mature protein without

signal peptide was amplified from Paenibacillus sp. 12-11

and used to construct the recombinant plasmid. After

transformation into E. coli BL21 (DE3) and induction with

0.8 mM IPTG for 18 h at 18oC, distinct xylanase activity

(17.2 U/ml) was detected in the culture supernatant of cells

harboring pET22-xyn7c, whereas the uninduced transformant

or transformant harboring the empty vector pET-22b (+)

showed no xylanase activity.

Recombinant His6-tagged XYN7C was purified to

electrophoretic homogeneity by metal chelate affinity

chromatography. The specific activity of purified recombinant

XYN7C towards oat spelt xylan was 1,340 U/mg. The

purified enzyme migrated one band of about 55 kDa on

SDS-PAGE (Fig. 2), which was higher than with the weight

of the predicted molecular mass plus His tag. The band was

analyzed using MALDI-TOF/MS. The amino acid sequences

obtained from the mass peaks (LYINDYGTDNPVKR,

SDYGQDLPQDILNLQADR, NLLEQGVPIDGVGHQ, and

THIDIYGPSVDSIITSMR matched the amino acid sequence

of deduced XYN7C, indicating that the purified protein

was indeed recombinant XYN7C.

Characterization of Recombinant Purified XYN7C

Purified recombinant XYN7C exhibited the highest

xylanase activity at pH 8.0 (Fig. 3A). More than 90% of

the maximum activity was retained between 6.5 and 8.5,

and about 40% of activity was retained at 9.0. The enzyme

Fig. 1. Amino acid sequence alignment of XYN7C with its close homologs. The abbreviation of sequences, microbial sources, and GenBank accession numbers are given as follows: XYN7C: Paenibacillus sp. 12-11, HQ688783,

S91-A428; C-Ge: Geobacillus sp. Y412MC10, ACX65538.1, S94-E429; C-Pa: Paenibacillus sp. JDR-2, ACT02870.1, S80-L419; X-Cl: Clostridium

stercorarium F9, 2DEP_A, S7-S344; X-C125: Bacillus halodurans C-125, NP_242986.1, S56-D396; X-B: B. halodurans, 2UWF_A, S10-D350; and X-Ng:

Bacillus sp. Ng-27, 2FGL_A, S10-D354. The putative signal peptide of XYN7C is underlined. The sequences used for primer design are indicated by

arrows. The similar and identical residues are marked in black and grey, respectively. The predicted catalytic glutamate residues are indicated by the asterisk.

A XYLANASE FROM ALKALOPHILIC PAENIBACILLUS SP. 865

was stable at pH 5.0 to 11.0, retaining more than 85% of

the initial activity after incubation at 37oC for 1 h (Fig. 3B).

XYN7C showed maximum activity at 55oC (Fig. 3C). The

thermostability of XYN7C was determined at 45oC, 50oC,

and 55oC, respectively. No activity was lost after incubation

at 45oC and 50oC for 60 min, and more than 40% of the

initial activity was retained after incubation at 55oC for

20 min (Fig. 3D).

As shown in Fig. 4, the purified recombinant XYN7C

exhibited strong resistance to neutral proteases. After treatment

with trypsin, α-chymotrypsin, collagenase, subtilisin A,

and proteinase K at 37oC for 60 min, the enzyme retained

almost all of its activity. The effects of various metal ions

and chemical reagents on enzyme activity were also

Fig. 2. SDS-PAGE analysis of the expression and purification ofrecombinant XYN7C. Lanes 1, molecular mass standard; 2, culture supernatant of the induced

transformant harboring the empty plasmid pET-22b (+); 3, culture

supernatant of the induced transformant harboring pET-xyn7c; 4, purified

XYN7C using Ni2+

-NTA metal chelating affinity chromatography.

Fig. 3. Characterization of the purified recombinant XYN7C. A. Effect of pH on XYN7C activity. The assay was performed at 55

oC in buffers ranging from pH 5.0 to 11.0. B. pH stability of XYN7C. After pre-

incubating the enzyme at 37oC for 1 h in buffers of pH 4.0-12.0, the activity was measured in 0.1 M Tris-HCl (pH 8.0) at 55

oC. C. Effect of temperature on

XYN7C activity measured in 0.1 M Tris-HCl (pH 8.0). D. Thermostability of recombinant XYN7C. The enzyme was pre-incubated at 45oC, 50

oC, and 55

oC

in 0.1 M Tris-HCl (pH 8.0) without substrate, and aliquots were removed at specific time points for the measurement of residual activity at 55oC.

Fig. 4. Proteolytic resistance of purified recombinant XYN7C. The residual activity was determined in 0.1 M Tris-HCl (pH 8.0) at 55

oC

after incubation with protease at a ratio of 10:1 (w/w) at 37oC for 30 min

(30 min sample) and 60 min (60 min sample). Purified recombinant

XYN7C was also incubated without proteases under the same conditions

for 30 min (30 min ck) or 60 min (60 min ck), and the residual activity was

measured as the control sample (100% of activity).

866 Zhao et al.

determined (data not shown). The activity of recombinant

XYN7C was significantly enhanced by about 1.2-fold in

the presence of 10 mM β-mercaptoethanol, and was strongly

inhibited by Cu2+, Fe2+, SDS, Ni+, Cr3+, Mn2+, and Zn2+.

The other chemicals had no effects on the enzyme activity

of XYN7C.

Substrate Specificity and Kinetic Parameters

With the activity of purified recombinant XYN7C towards

oat spelt xylan defined as 100%, the enzyme exhibited

high activity to wheat arabinoxylan (141%), followed by

beechwood xylan (96%) and birchwood xylan (80%)

(Table 2). No activity towards CMC-Na, Avicel, barley β-

glucan, PNP-cellobioside, and PNP-xylopyranoside was

detected.

Kinetic parameters were determined for oat spelt xylan

and wheat arabinoxylan. The calculated Km and apparent

Vmax were 4.43 mg/ml and 1,639 µmol/mg/min, respectively,

for oat spelt xylan, and 1.18 mg/ml and 1,961 µmol/mg/min,

respectively, for wheat arabinoxylan.

Hydrolysis Product Analysis

The hydrolysis products of beechwood xylan and oat spelt

xylan by purified recombinant XYN7C were determined

by HPAEC. The hydrolysis products of oat spelt xylan

comprised 14.83% xylose, 40.46% xylobiose, and 44.71%

xylan polymer, and the composition of the hydrolysis

products of beechwood xylan was 15.57% xylose, 41.36%

xylobiose, and 43.07% xylan polymer.

DISCUSSION

Microorganisms of extreme environments have attracted much

attention owing to their habitat-related adaptive properties

[6]. For example, alkaline xylanases have been isolated from

microbes and plants of alkaline or neutral environments.

To obtain the ideal alkaline xylanase for the textile and pulp

and paper industries, we selected the alkaline wastewater

sludge from a paper mill as the source material for

microorganism isolation. Strains were screened based on

xylanase activity, and one alkalophilic strain, Paenibacillus

sp. 12-11, showed significant xylanase activity. Many

Paenibacillus strains have been exploited for the production

of xylanolytic enzymes, including two xylanase genes of

family 10 and 11 [16], a family 10 xylanase with high activity

towards aryl-xylosides [7], and several xylanases with

different physical and kinetic properties [12]. All of these

strains were from neutral or acidic environments. However,

only two Paenibacillus strains have been reported that have

alkaline xylanase activity. One is from the black liquor of

the kraft pulping process and exhibits xylanase activity

under alkaline condition [14], and the other is from the

rearing farm of wood-eating oriental horned beetles and

produces an alkaline xylanase of family 10 [12]. In the

present work, Paenibacillus sp. 12-11 showed optimal

activity at pH 10.0 and grew well even at pH 11.0, which

might be a good microbial source of alkaline xylanase.

A xylanase gene, xyn7c, was cloned from strain 12-11

and successfully expressed in E. coli. The molecular mass of

recombinant XYN7C (~55 kDa) was higher than the calculated

value (45.4 kDa), probably because of the occurrence of

unknown post-translation modifications. Compared with

the family 10 xylanases from Dictyoglomus thermophilum

Rt46B.1 [8], Bacillus sp. NG-27 [24], B. halodurans S7

[22], G. mesophila KMM 241 [9], Cohnella laeviribosi

HY-21 [13], Anoxybacillus sp. E2 [37], Streptomyces

megasporus DSM 41476 [29], Paenibacillus sp. HPL-001

[12], and P. curdlanolyticus [34] that had pH optima at pH

5.5 to 9.5 and exhibited good pH stability, XYN7C has

some similar alkaline properties, such as a pH optimum at

pH 8.0, and good pH adaptability (retaining above 90% of

its maximum activity at pH 6.5 to 8.5) and stability

(retaining more than 60% of the maximum activity at pH

5.0-12.0). Xylanases from S. megasporus DSM 41476

and C. laeviribosi HY-21 are stable over a broad pH range

as XYN7C is, but their specific activities towards oat spelt

xylan are only 242.1 and 88.6 U/mg, respectively, far lower

than that of XYN7C (1,340 U/mg) [13, 29]. Furthermore,

XYN7C has an optimum temperature of 55oC and was

highly stable at 50oC and below, which is considered as a

conventional temperature for enzyme treatment to unbleached

pulp [5]. For other applications, enzyme modifications

through site-directed mutagenesis or protein engineering

[30] will make XYN7C functional at higher temperatures.

In addition, it is known that cellulase activity may result in

poor fiber mechanical strength in pulp bleaching, and

therefore xylanases used for pulp treatment should be free

of cellulase activity [32]. XYN7C was identified as a

cellulase-free xylanase. Therefore, combination of the

Table 2. Substrate specificity and kinetic parameters of the purified recombinant XYN7C.

Substrate Specific activity (U/mg)a Relative activity (%) Vmax

(µmol/mg/min) Km (mg/ml) K

cat (/s)

Oat spelt xylan 1,340 ± 3 100 1,639 4.43 1,309

Wheat arabinoxylan 1,886 ± 4 141 1,961 1.18 1,565

Beechwood xylan 1,292 ± 4 96 - - -

Birchwood xylan 1,073 ± 2 80 - - -

aValues represent the means ± SD (n = 3).

A XYLANASE FROM ALKALOPHILIC PAENIBACILLUS SP. 867

alkaline properties and the cellulase-free nature of XYN7C

implied its potential as an alternative to biobleaching

agents for production of high-quality pulp.

The strong resistance of XYN7C against neutral proteases

and its wide substrate specificity make it an important

candidate for the cotton scouring process or baking [2]. In

the cotton scouring process, conventional alkaline scouring

can be substituted by enzymatic scouring (including neutral

cellulase, protease, and xylanase) owing to its ecofriendly,

energy-saving, and clean advantages [28, 38]. In the process

of breadmaking, different enzymes, such as α-amylases,

xylanases, and proteases, are combined and used to soften

the texture of transglutaminase-supplemented pan breads,

consequently leading to the improvement of shape and

volume and void fraction in loaves [4]. More than that,

arabinoxylans are the major non-starch polysaccharides of

barley grain, and XYN7C showed higher specific activity

towards wheat arabinoxylans than to other xylans. These

properties of XYN7C make it a potential for application in

the flour industry.

In recent years, researchers have been striving to explore

the mechanisms of pH properties of alkaline xylanases

based on the knowledge of protein structure and function

[25]. Liu et al. [19] established a computational method to

analyze responsible dipeptides for the optimum pH of

xylanase, and Mamo et al. [23] reported that the composition

of amino acids can influence the pH adaptability of alkaline

xylanases to a great degree. Here, we compared the amino

acid composition of XYN7C with that of some typical

xylanases such as 2UWF [22], 2F8Q [24], 1ISV [35], and

1B30 [31]. Negatively charged Asp and Glu are thought to

form salt bridges of Arg-Asp or Arg-Glu to establish a

more stable structure under alkaline conditions. In the case

of alkaline xylanases 2UWF and 2F8Q that had optimal

pH at 9.5 and 8.4, respectively, the proportions of Asp and

Glu were over 17%. XYN7C had an optimal pH at 8.0, and

contained 15.5% of Asp and Glu, significantly higher than

that of acidic xylanases 1ISV (pH optimum 5.7, 9.0%) and

1B30 (pH optimum 5.6, 8.5%) [31, 35]. In addition, the

charge ratio (the number of negatively charged residues to

that of positively charged residues) might play a key role

in pH optima [23]. The charge ratios of 2UWF, 2F8Q,

XYN7C, 1ISV, and 1B30 were 1.76, 1.83, 1.65, 1.08, and

0.96, respectively. This trend might reflect the electrostatic

potential generated for xylanases at extreme pH environments.

The amino acid composition of XYN7C is consistent with

the nature of alkaline enzymes, and can be used as material

for the basic research of alkaline xylanases.

Acknowledgments

This work was supported by the China Modern Agriculture

Research System (CARS-42) and the Key Program of

Transgenic Plant Breeding (2008ZX08003-002) and the

Agricultural Science and Technology Conversion Funds

(2009GB23260444).

REFERENCES

1. Bajpai, P. 1999. Application of enzymes in the pulp and paper

industry. Biotechnol. Prog. 15: 147-157.

2. Beg, Q. K., M. Kapoor, L. Mahajan, and G. S. Hoondal. 2001.

Microbial xylanases and their industrial applications: A review.

Appl. Microbiol. Biotechnol. 56: 326-338.

3. Bradford, M. M. 1976. A rapid and sensitive method for the

quantitation of microgram quantities of protein utilizing the

principle of protein-dye binding. Anal. Biochem. 72: 248-254.

4. Caballero, P. A., M. Gómez, and C. M. Rosell. 2007. Improvement

of dough rheology, bread quality and bread shelf-life by enzymes

combination. J. Food Process Eng. 81: 42-53.

5. Christov, L. P., G. Szakacs, and H. Balakrishnan. 1999. Production,

partial characterization and use of fungal cellulase-free xylanases

in pulp bleaching. Process Biochem. 34: 511-517.

6. Collins, T., C. Gerday, and G. Feller. 2005. Xylanases, xylanase

families and extremophilic xylanases. FEMS Microbiol. Rev. 29:

3-23.

7. Gallardo, O., P. Diaz, and F. I. J. Pastor. 2003. Characterization

of a Paenibacillus cell-associated xylanase with high activity on

aryl-xylosides: A new subclass of family 10 xylanases. Appl.

Microbiol. Biotechnol. 61: 226-233.

8. Gibbs, M. D., R. A. Reeves, and P. L. Bergquist. 1995. Cloning,

sequencing, and expression of a xylanase gene from the extreme

thermophile Dictyoglomus thermophilum Rt46B. 1 and activity

of the enzyme on fiber-bound substrate. Appl. Environ. Microbiol.

61: 4403-4408.

9. Guo, B., X. Chen, C. Sun, B. Zhou, and Y. Zhang. 2009. Gene

cloning, expression and characterization of a new cold-active

and salt-tolerant endo-β-1,4-xylanase from marine Glaciecola

mesophila KMM 241. Appl. Microbiol. Biotechnol. 84: 1107-1115.

10. Henrissat, B. and A. Bairoch. 1996. Updating the sequence-based

classification of glycosyl hydrolases. Biochem. J. 316: 695-696.

11. Huang, J., G. Wang, and L. Xiao. 2006. Cloning, sequencing

and expression of the xylanase gene from a Bacillus subtilis strain

B10 in Escherichia coli. Bioresour. Technol. 97: 802-808.

12. Hwang, I. T., H. K. Lim, H. Y. Song, S. J. Cho, J. S. Chang,

and N. J. Park. 2010. Cloning and characterization of a

xylanase, KRICT PX1 from the strain Paenibacillus sp. HPL-

001. Biotechnol. Adv. 28: 594-601.

13. Kim, D. Y., M. K. Han, H. W. Oh, K. S. Bae, T. S. Jeong, S. U.

Kim, et al. 2010. Novel intracellular GH10 xylanase from

Cohnella laeviribosi HY-21: Biocatalytic properties and alterations

of substrate specificities by site-directed mutagenesis of Trp

residues. Bioresour. Technol. 101: 8814-8821.

14. Ko, C. H., W. L. Chen, C. H. Tsai, W. N. Jane, C. C. Liu, and

J. Tu. 2007. Paenibacillus campinasensis BL11: A wood material-

utilizing bacterial strain isolated from black liquor. Bioresour.

Technol. 98: 2727-2733.

15. Laemmli, U. K. 1970. Cleavage of structural proteins during the

assembly of the head of bacteriophage T4. Nature 227: 680-

685.

868 Zhao et al.

16. Lee, H., D. Shin, N. Cho, H. Kim, S. Shin, S. Im, H. Blaise

Lee, S. Chun, and S. Bai. 2000. Cloning, expression and

nucleotide sequences of two xylanase genes from Paenibacillus

sp. Biotechnol. Lett. 22: 387-392.

17. Li, N., K. Meng, Y. Wang, P. Shi, H. Luo, Y. Bai, P. Yang, and

B. Yao. 2008. Cloning, expression, and characterization of a new

xylanase with broad temperature adaptability from Streptomyces

sp. S9. Appl. Microbiol. Biotechnol. 80: 231-240.

18. Lineweaver, H. and D. Burk. 1934. The determination of

enzyme dissociation constants. J. Am. Chem. Soc. 56: 658-666.

19. Liu, L., X. Li, and W. Shao. 2004 Computational analysis of

responsible dipeptides for optimum pH in G/11 xylanase.

Biochem. Biophys. Res. Commun. 321: 391-396.

20. Liu, Y. and R. F. Whittier. 1995. Thermal asymmetric interlaced

PCR: Automatable amplification and sequencing of insert end

fragments from P1 and YAC clones for chromosome walking.

Genomics 25: 674-681.

21. Maat, J., M. Roza, J. Verbakel, H. Stam, M. J. Santos Da Silva,

M. Bosse, et al. 1992. Xylanases and their application in

bakery, pp. 349-360. In J. Visser, M. A. Kusters van Someren,

G. Beldman, and A. G. J. Voragen (eds.). Xylans and Xylanases.

Progress in Biotechnology, No. 7. Elsevier Science Publishers,

Amsterdam, The Netherlands.

22. Mamo, G., R. Hatti-Kaul, and B. Mattiasson. 2006. A thermostable

alkaline active endo-β-1-4-xylanase from Bacillus halodurans

S7: Purification and characterization. Enzyme Microb. Technol.

39: 1492-1498.

23. Mamo, G., M. Thunnissen, R. Hatti-Kaul, and B. Mattiasson.

2009. An alkaline active xylanase: Insights into mechanisms of

high pH catalytic adaptation. Biochimie 91: 1187-1196.

24. Manikandan, K., A. Bhardwaj, N. Gupta, N. K. Lokanath, A.

Ghosh, V. S. Reddy, and S. Ramakumar. 2006. Crystal structures

of native and xylosaccharide-bound alkali thermostable xylanase

from an alkalophilic Bacillus sp. NG-27: Structural insights into

alkalophilicity and implications for adaptation to polyextreme

conditions. Protein Sci. 15: 1951-1960.

25. Mchunu, N. P., S. Singh, and K. Permaul. 2009. Expression of

an alkalo-tolerant fungal xylanase enhanced by directed evolution

in Pichia pastoris and Escherichia coli. J. Biotechnol. 141: 26-

30.

26. Miller, G. L. 1959. Use of dinitrosalicylic acid reagent for

determination of reducing sugar. Anal. Chem. 31: 426-428.

27. Monis, P. T., S. Giglio, and C. P. Saint. 2005. Comparison of

SYTO9 and SYBR Green I for real-time polymerase chain

reaction and investigation of the effect of dye concentration on

amplification and DNA melting curve analysis. Anal. Biochem.

340: 24-34.

28. Ossola, M. and Y. M. Galante. 2004. Scouring of flax rove with

the aid of enzymes. Enzyme Microb. Technol. 34: 177-186.

29. Qiu, Z., P. Shi, H. Luo, Y. Bai, T. Yuan, P. Yang, S. Liu, and B.

Yao. 2010. A xylanase with broad pH and temperature adaptability

from Streptomyces megasporus DSM 41476, and its potential

application in brewing industry. Enzyme Microb. Technol. 46:

506-512.

30. Roberge, M., F. Shareck, R. Morosoli, D. Kluepfel, and C.

Dupont. 1998. Site-directed mutagenesis study of a conserved

residue in family 10 glycanases: Histidine 86 of xylanase A

from Streptomyces lividans. Protein Eng. 11: 399-404.

31. Schmidt, A., A. Schlacher, W. Steiner, H. Schwab, and C. Kratky.

1998. Structure of the xylanase from Penicillium simplicissimum.

Protein Sci. 7: 2081-2088.

32. Subramaniyan, S. and P. Prema. 2000. Cellulase-free xylanases

from Bacillus and other microorganisms. FEMS Microbiol. Lett.

183: 1-7.

33. Subramaniyan, S. and P. Prema. 2002. Biotechnology of microbial

xylanases: Enzymology, molecular biology, and application. Crit.

Rev. Biotechnol. 22: 33-64.

34. Sudo, M., M. Sakka, T. Kimyra, K. Ratanakhanokchai, and K.

Sakka. 2010. Characterization of Paenibacillus curdlanolyticus

intracellular xylanase Xyn10B encoded by the xyn10B gene.

Biosci. Biotechnol. Biochem. 74: 2358-2360.

35. Sun, H. J., S. Yoshida, Y. Kawabata, N. H. Park, and I.

Kusakabe. 2002. Separation of two functional domains of the

family F/10 β-xylanase from Streptomyces olivaceoviridis E-86

limited proteolysis with papain and some of their properties.

Biotechnol. Lett. 24: 595-601.

36. Wang, G., Y. Wang, P. Yang, H. Luo, H. Huang, P. Shi, K.

Meng, and B. Yao. 2010. Molecular detection and diversity of

xylanase genes in alpine tundra soil. Appl. Microbiol. Biotechnol.

87: 1383-1393.

37. Wang, J., Y. Bai, P. Yang, P. Shi, H. Luo, K. Meng, H. Huang,

J. Yin, and B. Yao. 2010. A new xylanase from thermoalkaline

Anoxybacillus sp. E2 with high activity and stability over a

broad pH range. World J. Microbiol. Biotechnol. 26: 917-924.

38. Wang, Q., X. Fan, W. Gao, and J. Chen. 2006. Scouring of

knitted cotton fabrics with compound enzymes. J. Text. Res. 27:

27-30.

39. Wood, P. J., J. D. Erfle, and R. M. Teather. 1988. Use of

complex formation between Congo red and polysaccharides in

detection and assay of polysaccharide hydrolases. Methods

Enzymol. 160: 59-74.

40. Yu, E. K. C., L. U. L. Tan, M. K. H. Chan, L. Deschatelets, and

J. N. Saddler. 1987. Production of thermostable xylanase by a

thermophilic fungus, Thermoascus aurantiacus. Enzyme Microb.

Technol. 9: 16-24.