European Journal of Pharmacology 589 (2008) 45–48

Contents lists available at ScienceDirect

European Journal of Pharmacology

j ourna l homepage: www.e lsev ie r.com/ locate /e jphar

Short communication

Clinically relevant concentrations of valproic acid modulate melatonin MT1 receptor,HDAC and MeCP2 mRNA expression in C6 glioma cells

Bora Kim, Lyda M. Rincón Castro, Sana Jawed, Lennard P. Niles ⁎Department of Psychiatry and Behavioural Neurosciences, McMaster University, HSC-4N77, 1200 Main Street West, Hamilton, Ontario, Canada L8N 3Z5

⁎ Corresponding author. Department of Psychiatry anMcMaster University, HSC-4N77,1200Main StreetWest,3Z5. Tel.: +1 905 525 9140x22224; fax: +1 905 522 8804

E-mail address: niles@mcmaster.ca (L.P. Niles).

0014-2999/$ – see front matter © 2008 Elsevier B.V. Aldoi:10.1016/j.ejphar.2008.04.058

A B S T R A C T

A R T I C L E I N F O

Article history:

C6 glioma cellswere treated Received 5 February 2008Received in revised form 3 April 2008Accepted 22 April 2008Available online 7 May 2008

Keywords:Histone acetylationEpigenetic modulationTrichostatin ACombinatorial therapy

with clinically relevant concentrations of valproic acid (0.5 or 1.0mM) for 1–7 daysand RT-PCR used to examine expression of the melatonin MT1 receptor and selected epigenetic modulators.Valproic acid caused significant time-dependent changes in the mRNA expression of the melatoninMT1 receptor, histone deacetylase (HDAC) 1, 2 and 3, andmethyl CpG binding protein 2 (MeCP2). A structurallydistinct HDAC inhibitor, trichostatin A, also caused a significant concentration-dependent induction ofmelatoninMT1 receptor mRNA expression, suggesting involvement of an epigenetic mechanism. The ability ofclinical concentrations of valproic acid to significantly altermelatoninMT1 receptor expression, suggests a rolefor this receptor in the diverse neuropharmacological and oncostatic effects of this agent.

© 2008 Elsevier B.V. All rights reserved.

1. Introduction

Valproic acid (2-propylpentanoic acid), a short-chain branchedfatty acid, is widely used clinically as an anticonvulsant and moodstabilizer (Qiao et al., 2006). Various mechanisms including enhance-ment of GABAergic activity (Perucca, 2002) and the modulation ofmultiple signaling cascades such as the mitogen-activated proteinkinase/extracellular signal-regulated kinase (MAPK/ERK) and WNTsignaling pathways (Hao et al., 2004; Wiltse, 2005) are thought tounderlie the clinical and neuropharmacological properties of valproicacid. In addition, it is now known that valproic acid inhibits histonedeacetylase (HDAC) enzyme activity resulting in chromatin decon-densation (Marchion et al., 2005), with consequent changes in genetranscription (Rosenberg, 2007).

In mammals, melatonin signals via two G protein-coupledMT1 andMT2 receptors, which are involved in its modulation of diversephysiological activities including circadian rhythmicity, neuroendo-crine and immune function (von Gall et al., 2002; Dubocovich andMarkowska, 2005). This indoleamine hormone also exerts antioxidantand neuroprotective effects in the CNS (Rodriguez et al., 2004; Sharmaet al., 2006), and it may play a role in mood modulation, as melatoninMT1 receptor knockout mice exhibit depression-like behaviour (Weilet al., 2006). Moreover, the antidepressant effect of the melatoninMT1/MT2 agonist, agomelatine (Pandi-Perumal et al., 2006; Ghosh and

d Behavioural Neurosciences,Hamilton, Ontario, Canada L8N.

l rights reserved.

Hellewell, 2007), implicates the MT1 receptor in this therapeuticaction, given its predominant and widespread expression in the CNS(Liu et al., 1997; Mazzucchelli et al., 1996; Uz et al., 2005). We havereported that valproic acid, at high (supraclinical) concentrations of 3and 5 mM, induces melatonin MT1 receptor mRNA and proteinexpression after treatment for 24 or 48 h (Castro et al., 2005). Inaddition, these concentrations of valproic acid caused a significantincrease in HDAC1 mRNA expression, suggesting involvement of anepigenetic mechanism in melatonin MT1 receptor induction (Castroet al., 2005). In order to determine whether, after longer treatmentperiods, lower clinically relevant concentrations (Bowden et al., 1994;Cloyd et al., 2003) of valproic acid (0.5 and 1 mM), can similarlymodulate these and other related gene targets, the mRNA expressionof the melatonin MT1 receptor, HDAC1, HDAC2, HDAC3 and methylCpG binding protein 2 (MeCP2) was examined over 1 to 7 days. Inaddition, the effect of a structurally different and more potent HDACinhibitor, trichostatin A, on melatonin MT1 receptor expression wasexamined for the first time.

2. Materials and methods

2.1. Cell culture

Rat C6 glioma cells were cultured in Dulbecco's modified Eagle'smedium (DMEM) with 10% fetal bovine serum (FBS), penicillin/streptomycin (100 IU/mL/100 μL/mL), and fungizone (1.25 μg/mL;Gibco, Burlington, ON, Canada), at 37 °C under 5% CO2/air. After threedays, the medium was changed to DMEM with 1% FBS. Cellsfrom passages 41 to 44 were used for valproic acid treatments. For 1

Fig. 1. Time-dependent effects of clinically relevant concentrations of valproic acid ortrichostatin A onmelatoninMT1 receptor mRNA expression in C6 cells. (A–D) Cells weretreated with valproic acid (VPA) for 1–7 days, as indicated. Gel images of MT1 (397 bp)and GAPDH (237 bp) are shown. Lanes 1–3: Control (medium), 0.5 and 1 mM VPA.(E) Cells were treated with trichostatin A (TSA) for 24 h. Lanes 1–6: Control (0.01%ethanol), 0.1, 0.3, 0.5, 0.7 and 1 µM TSA. Histograms represent the means±S.E.M. (n=3)for percentage (%) values of MT1/GAPDH optical density (OD) ratios. (A–D) ⁎Pb0.05,⁎⁎Pb0.01, ⁎⁎⁎Pb0.001 versus controls; (E) ⁎Pb0.05, ⁎⁎Pb0.01 versus control, 0.1 and0.5 μM TSA; #Pb0.05 versus 0.3 μM TSA.

46 B. Kim et al. / European Journal of Pharmacology 589 (2008) 45–48

and 3-day treatments, cells at 55–70% confluence were used whilethose at 20–30% confluence were used for 5 and 7-day treatments.Valproic acid (0.5 mM and 1.0 mM) or medium only (controls) wereadded to plates for the times indicated (1, 3, 5, and 7 days). For the 3, 5,and 7-day treatments, valproic acid and mediumwere replaced everysecond day. Cells at 70% confluence were treated with trichostatin A(0.1, 0.3, 0.5, 0.7, 1.0 μM) or vehicle (0.01% ethanol) for 24 h.

2.2. RT-PCR

Following drug treatments, RNA was extracted using TRIzol asdescribed by the supplier (Invitrogen Canada Inc., Burlington, ON,Canada). cDNA was synthesized from 2 μg of DNAse-treated RNA,using an Omniscript Reverse Transcriptase kit (Qiagen) and oligo(dT) primers. RT product (1–10 μl) was amplified using theHotStarTaq Master Mix Kit (Qiagen). After heat activation of theHotStarTaq DNA Polymerase, at 95 °C for 15 min, samples wereamplified as follows: 94 °C for 30 s, 57 °C (MT1) or 55 °C (HDAC1, 2, 3,MeCP2, and GAPDH) for 30 s, 72 °C for 1 min and a final incubationperiod of 72 °C for 10 min. Negative controls, containing RNAwithout reverse transcription, were processed to confirm RT-PCRspecificity and the absence of DNA contamination. The melatoninMT1 receptor was amplified for 40 cycles and other genes for 30cycles. PCR forward (F) and reverse (R) primers (5′→3′) were asfollows: MT1 (F): ttgtggcgagtttagctgtg – (R): tttaccctccgtctgacctg(397 bp); HDAC1 (F): ctggggacctacgggatatt – (R): tgtcagggtcttcct-catcc (585 bp); HDAC2 (F): ccctcaaacatgacaaacca – (R):gatttggctcctttggtgtc (404 bp); HDAC3 (F): gagagtcagccccaccaata –

(R): gacccggtcagtgaggtaga (349 bp); MeCP2 (F): ggacgcgaaagcttaaa-cag – (R): cgtttgatcaccatgacctg (439 bp); GAPDH (F): ttcaccaccatg-gagaaggc; (R): ggcatggactgtggtcatga (237 bp). Amplified cDNA bandswere separated on a 2% agarose gel, stained with ethidium bromideand digitally scanned using an AlphaImager™ 2200 program(Kodak).

2.3. Data analysis

The optical density (OD) values for PCR products were normalizedagainst GAPDH, the internal control. Following conversion to percen-tage values, data were assessed by two-way ANOVA in order to detecttreatment by time interactions. Subsequently, data were analyzed byone-way ANOVA, followed by a Neuman–Keuls test to determinesignificant differences between treatment groups. Data shown areexpressed as means±S.E.M.

3. Results

3.1. Effects of valproic acid and trichostatin A on MT1 mRNA expression inC6 cells

Two-way ANOVA indicated a significant treatment× time inter-action (F(6,23) =2.77, Pb0.035) for MT1 mRNA data from C6 cellstreated with valproic acid (0.5 and 1 mM) for 1, 3, 5 or 7 days.Further analysis of data at each treatment time, using one-wayANOVA and Neuman–Keuls tests, revealed significant increases inmelatonin MT1 receptor mRNA following treatment with 0.5 mMvalproic acid for 1 or 7 days (Pb0.05 and Pb0.01, respectively), asshown in Fig. 1A and D. A stronger time-dependent induction wasobserved with 1 mM valproic acid, which caused a maximalincrease of about 5–6-fold in melatonin MT1 receptor mRNAlevels, after 3-day (Pb0.001) or 5-day (Pb0.01) treatment (Fig. 1Band C). However, in contrast to the lower concentration of valproicacid, there was a complete reversal to baseline melatonin MT1receptor expression levels in C6 cells treated with 1 mM of thisdrug for 7 days (Fig. 1D). Treatment of C6 cells with trichostatin Afor 24 h resulted in a concentration-dependent induction of

melatonin MT1 receptor mRNA expression. As shown in Fig. 1E,significant increases in melatonin MT1 receptor mRNA wereobserved at 0.7 μM (Pb0.05) and 1 μM (Pb0.01) concentrationsof trichostatin A.

3.2. Effects of valproic acid on HDAC1, 2, 3, and MeCP2 mRNA expressionin C6 cells

Two-way ANOVA indicated significant treatment effects for HDAC1(F(2,22)=4.80, Pb0.018) and HDAC2 (F(2,19)=6.76, Pb0.006), but therewas no interaction effect. Subsequent analysis by one-way ANOVA andNeuman–Keuls tests, revealed significant increases in HDAC1 mRNAexpression following valproic acid treatment for 1, 5 and 7 days(Fig. 2B, E and F). HDAC2 and HDAC3 also showed significant increases,but only after treatment with valproic acid (1 mM) for 7 days (Fig. 2F).Two-way ANOVA revealed a significant treatment×time interactionfor MeCP2 (F(6, 23)=2.78, Pb0.035). Significant valproic acid-induced

Fig. 2. Time-dependent effects of clinically relevant concentrations of valproic acid onHDAC isoform and MeCP2 mRNA expression in C6 cells. (A) Gel images of HDAC 1(585 bp), MeCP2 (439 bp), HDAC 2 (404 bp), HDAC 3 (349 bp) and GAPDH (237 bp) areshown. Lanes 1–3: Control, 0.5 and 1 mM valproic acid (VPA) for 1 day; lanes 4–6:control, 0.5 and 1 mM VPA for 3 days. (B) and (C) Data shown are the means±S.E.M.(n=3) for % values of each gene target/GAPDH optical density (OD) ratios for 1 and3 days, as indicated. (D) Gel images as described in (A) are shown. Lanes 1–3: Control,0.5 and 1 mM VPA for 5 days; lanes 4–6: control, 0.5 and 1 mM VPA for 7 days. (E) and(F) Data shown are the means±S.E.M. (n=3) as described above, for 5 and 7 days asindicated. White, light grey and dark grey bars represent controls, 0.5 and 1 mM VPA,respectively. ⁎Pb0.05, ⁎⁎Pb0.01 versus controls.

47B. Kim et al. / European Journal of Pharmacology 589 (2008) 45–48

increases in MeCP2 mRNA were observed after treatment for 1 and7 days (Fig. 2B and F).

4. Discussion

In earlier studies, we observed that valproic acid upregulatesexpression of melatonin MT1 receptor mRNA and protein in C6 cells,especially at higher concentrations (3 and 5 mM), after treatment for24 or 48 h (Castro et al., 2005). We now report that treatment of C6cells with lower clinically relevant concentrations of valproic acid(0.5 mM or 1 mM) caused significant time-dependent increases inMT1 mRNA expression (Fig. 1A–D). After 7 days, cells treated with0.5 mM valproic acid still exhibited higher MT1 mRNA expression,whereas cells exposed to the 1 mM concentration had revertedto basal melatonin MT1 receptor levels (Fig. 1D). Activation of theMAPK-ERK pathway by valproic acidmay be involved in the reversal ofMT1 induction after 7 days. We have observed that blockade of thispathway, with PD98059, enhances melatonin MT1 receptor mRNAinduction by valproic acid, which suggests a role for MAPK/ERK in thenegative regulation of this melatonin receptor subtype (Castro et al.,2005). After 7 days, activation of the MAPK-ERK cascade maysupersede the inductive effect of 1 mM valproic acid on melatoninMT1 receptor expression, whereas receptor upregulation persists incells exposed to the lower (0.5 mM) concentration of this drug.

We have reported that higher concentrations of valproic acid(3 and 5 mM) caused a significant induction of HDAC1 mRNAexpression in C6 cells, presumably due to compensation for thesuppression of histone deacetylase activity (Castro et al., 2005).Although this finding does not confirm that inhibition of histone

deacetylase activity underlies the induction of melatonin receptorexpression, it was seen at valproic acid concentrations which weremost effective in upregulating the melatonin MT1 receptor, suggestingthat an epigenetic action is involved (Castro et al., 2005). Similarly, inthe present study, the clinical concentrations of valproic acid, whichinduced melatonin MT1 receptor mRNA expression, also causedsignificant increases in the mRNA expression of Class I HDAC isoforms(HDAC1, 2, and 3). In addition, an increase in MeCP2 mRNA expressionwas observed following valproic acid treatment. Histone acetylationby valproic acid and other HDAC inhibitors has been linked to DNAdemethylation (Dong et al., 2007), which may impair binding of therepressor protein, MeCP2, to DNA. Therefore, the observed changes inMeCP2 mRNA expression following valproic acid treatment mayreflect a compensatory upregulation of this target. As can be seen inFig. 2, there were time-dependent differences in the effects of valproicacid on the expression of the three HDAC isoforms and MeCP2.Presumably, this reflects the dynamic interplay between the activitiesof histone acetyltransferases and histone deacetylases (Eberharter andBecker, 2002), which may differentially influence the temporalexpression of each target in response to epigenetic modulators, suchas valproic acid.

In order to further examine the possibility that chromatinremodeling is involved in the upregulation of the melatonin MT1receptor, the effects of a structurally different HDAC inhibitor,trichostatin A, were examined. Consistent with the foregoing,trichostatin A caused a significant concentration-dependent inductionof melatonin MT1 receptor mRNA in C6 cells, which supportsinvolvement of an epigenetic mechanism in the similar action ofvalproic acid.

In view of the psychotropic, anticonvulsant, neuroprotective andoncostatic properties of valproic acid (Dong et al., 2007; Chen et al.,2006; Blaheta et al., 2005) and melatonin or its receptor agonists(Ghosh and Hellewell, 2007; Mayo et al., 2005; Sharma et al., 2006;Blask et al., 2005), these findings have implications for thecombinatorial treatment of psychiatric disorders, epilepsy, neurode-generation and cancer. In keeping with the foregoing, add-onmelatonin has been reported to improve the quality of life and sleepbehavior in epileptic children on valproate monotherapy (Gupta et al.,2004, 2005). Moreover, we have reported that valproic acid inducesmelatonin MT1 receptor expression in human MCF-7 breast cancercells and, when administered in combination with melatonin, asynergistic antiproliferative effect was observed (Jawed et al., 2007). Itis anticipated that similar combinatorial approaches will be beneficialin enhancing the diverse therapeutic effects of valproic acid andmelatonin.

Acknowledgements

This work was supported by NSERC Canada via a research grant toLPN and an undergraduate student research award to BK.

References

Blaheta, R.A.,Michaelis,M., Driever, P.H., Cinatl Jr., J., 2005. Evolvinganticancer drug valproicacid: insights into the mechanism and clinical studies. Med. Res. Rev. 25, 383–397.

Blask, D.E., Dauchy, R.T., Sauer, L.A., 2005. Putting cancer to sleep at night: theneuroendocrine/circadian melatonin signal. Endocrine 27, 179–188.

Bowden, C.L., Brugger, A.M., Swann, A.C., Calabrese, J.R., Janicak, P.G., Petty, F., Dilsaver, S.C.,Davis, J.M., Rush,A.J., Small, J.G., et al.,1994. Efficacyof divalproexvs lithiumandplaceboin the treatment of mania. The Depakote Mania Study Group. JAMA 271, 918–924.

Castro, L.M., Gallant, M., Niles, L.P., 2005. Novel targets for valproic acid: up-regulationof melatonin receptors and neurotrophic factors in C6 glioma cells. J. Neurochem.95, 1227–1236.

Chen, P.S., Peng, G.S., Li, G., Yang, S., Wu, X., Wang, C.C., Wilson, B., Lu, R.B., Gean, P.W.,Chuang, D.M., Hong, J.S., 2006. Valproate protects dopaminergic neurons inmidbrain neuron/glia cultures by stimulating the release of neurotrophic factorsfrom astrocytes. Mol. Psychiatry 11, 1116–1125.

Cloyd, J.C., Dutta, S., Cao, G., Walch, J.K., Collins, S.D., Granneman, G.R., Depacon StudyGroup, 2003. Valproate unbound fraction and distribution volume following rapidinfusions in patients with epilepsy. Epilepsy Res. 53, 19–27.

48 B. Kim et al. / European Journal of Pharmacology 589 (2008) 45–48

Dong, E., Guidotti, A., Grayson, D.R., Costa, E., 2007. Histone hyperacetylation inducesdemethylation of reelin and 67-kDa glutamic acid decarboxylase promoters. Proc.Natl. Acad. Sci. U. S. A. 104, 4676–4681.

Dubocovich, M.L., Markowska, M., 2005. Functional MT1 and MT2 melatonin receptorsin mammals. Endocrine 27, 101–110.

Eberharter, A., Becker, P.B., 2002. Histone acetylation: a switch between repressive andpermissive chromatin. Second in review series on chromatin dynamics. EMBO Rep.3, 224–229.

Ghosh, A., Hellewell, J.S., 2007. A review of the efficacy and tolerability of agomelatine inthe treatment of major depression. Expert Opin. Investig. Drugs 16, 1999–2004.

Gupta, M., Aneja, S., Kohli, K., 2004. Add-on melatonin improves quality of life inepileptic children on valproatemonotherapy: a randomized, double-blind, placebo-controlled trial. Epilepsy Behav. 5, 316–321.

Gupta, M., Aneja, S., Kohli, K., 2005. Add-on melatonin improves sleep behavior inchildren with epilepsy: randomized, double-blind, placebo-controlled trial. J. ChildNeurol. 20, 112–115.

Hao, Y., Creson, T., Zhang, L., Li, P., Du, F., Yuan, P., Gould, T.D., Manji, H.K., Chen, G., 2004.Mood stabilizer valproate promotes ERK pathway-dependent cortical neuronalgrowth and neurogenesis. J. Neurosci. 24, 6590–6599.

Jawed, S., Kim, B., Ottenhof, T., Brown, G.M., Werstiuk, E.S., Niles, L.P., 2007. Humanmelatonin MT1 receptor induction by valproic acid and its effects in combinationwith melatonin on MCF-7 breast cancer cell proliferation. Eur. J. Pharmacol. 560,17–22.

Liu, C., Weaver, D.R., Jin, X., Shearman, L.P., Pieschl, R.L., Gribkoff, V.K., Reppert, S.M.,1997. Molecular dissection of two distinct actions of melatonin on the suprachias-matic circadian clock. Neuron 19, 91–102.

Marchion, D.C., Bicaku, E., Daud, A.I., Sullivan, D.M., Munster, P.N., 2005. Valproic acidalters chromatin structure by regulation of chromatin modulation proteins. CancerRes. 65, 3815–3822.

Mayo, J.C., Sainz, R.M., Tan, D.X., Antolín, I., Rodríguez, C., Reiter, R.J., 2005. Melatoninand Parkinson's disease. Endocrine 27, 169–178.

Mazzucchelli, C., Pannacci, M., Nonno, R., Lucini, V., Fraschini, F., Stankov, B.M., 1996. Themelatonin receptor in the human brain: cloning experiments and distributionstudies. Brain Res. Mol. Brain Res. 39, 117–126.

Pandi-Perumal, S.R., Srinivasan, V., Cardinali, D.P., Monti, M.J., 2006. Could agomelatinebe the ideal antidepressant? Expert Rev. Neurother. 6, 1595–1608.

Perucca, E., 2002. Pharmacological and therapeutic properties of valproate: a summaryafter 35 years of clinical experience. CNS Drugs 16, 695–714.

Qiao, L., Schaack, J., Shao, J., 2006. Suppression of adiponectin gene expression byhistone deacetylase inhibitor valproic acid. Endocrinology 147, 865–874.

Rodriguez, C., Mayo, J.C., Sainz, R.M., Antolín, I., Herrera, F., Martín, V., Reiter, R.J., 2004.Regulation of antioxidant enzymes: a significant role for melatonin. J. Pineal Res. 36,1–9.

Rosenberg, G., 2007. The mechanisms of action of valproate in neuropsychiatricdisorders: can we see the forest for the trees? Cell. Mol. Life Sci. 64, 2090–2103.

Sharma, R., McMillan, C.R., Tenn, C.C., Niles, L.P., 2006. Physiological neuroprotection bymelatonin in a 6-hydroxydopamine model of Parkinson's disease. Brain Res. 1068,230–236.

von Gall, C., Stehle, J.H., Weaver, D.R., 2002. Mammalianmelatonin receptors: molecularbiology and signal transduction. Cell Tissue Res. 309, 151–162.

Weil, Z.M., Hotchkiss, A.K., Gatien, M.L., Pieke-Dahl, S., Nelson, R.J., 2006. Melatoninreceptor (MT1) knockout mice display depression-like behaviors and deficits insensorimotor gating. Brain Res. Bull. 68, 425–429.

Wiltse, J., 2005. Mode of action: inhibition of histone deacetylase, altering WNT-dependent gene expression and regulation of beta-catenin—developmental effectsof valproic acid. Crit. Rev. Toxicol. 35, 727–738.

Uz, T., Arslan, A.D., Kurtuncu, M., Imbesi, M., Akhisaroglu, M., Dwivedi, Y., Pandey, G.N.,Manev, H., 2005. The regional and cellular expression profile of the melatoninreceptor MT1 in the central dopaminergic system. Brain Res. Mol. Brain Res. 136,45–53.