CLINICAL AND PATHOLOGICAL FINDINGS OF A NEWLY …

1

Journal of Wildlife Diseases, 36(1), 2000, pp. 1–12q Wildlife Disease Association 2000

CLINICAL AND PATHOLOGICAL FINDINGS OF A NEWLYRECOGNIZED DISEASE OF ELEPHANTS CAUSED BYENDOTHELIOTROPIC HERPESVIRUSES

Laura K. Richman,1,6,7 Richard J. Montali,1 Richard C. Cambre,1 Dennis Schmitt,2 DouglasHardy,3 Thomas Hildbrandt,4 Roy G. Bengis,5 Fayez M. Hamzeh,6 Akbar Shahkolahi,6 andGary S. Hayward6

1 Smithsonian, National Zoological Park, Washington, DC 20008, USA2 Southwest Missouri State University, Springfield, Missouri 65804, USA3 Dickerson Park Zoo, Springfield, Missouri 65803, USA4 Institute for Zoo Biology and Wildlife Research, Berlin, Germany5 Kruger National Park, Skukuza 1350, Republic of South Africa6 Johns Hopkins School of Medicine, Baltimore, Maryland 21205, USA7 Corresponding author (e-mail: [email protected])

ABSTRACT: The unique clinical and pathological findings in nine Asian (Elephas maximus) andtwo African (Loxodonta africana) elephants from North American Zoos with a highly fatal diseasecaused by novel endotheliotropic herpesviruses are described. Identification of the viruses bymolecular techniques and some epidemiological aspects of the disease were previously reported.Consensus primer polymerase chain reaction (PCR) combined with sequencing yielded molecularevidence that confirmed the presence of two novel but related herpesviruses associated with thedisease, one in Asian elephants and the second in African elephants. Disease onset was acute,with lethargy, edema of the head and thoracic limbs, oral ulceration and cyanosis of the tonguefollowed by death of most animals in 1 to 7 days. Pertinent laboratory findings in two of threeclinically evaluated animals included lymphocytopenia and thrombocytopenia. Two affected youngAsian elephants recovered after a 3 to 4 wk course of therapy with the anti-herpesvirus drugfamciclovir. Necropsy findings in the fatal cases included pericardial effusion and extensive pe-techial hemorrhages in the heart and throughout the peritoneal cavity, hepatomegaly, cyanosis ofthe tongue, intestinal hemorrhage, and ulceration. Histologically, there were extensive microhem-orrhages and edema throughout the myocardium and mild, subacute myocarditis. Similar hem-orrhagic lesions with inflammation were evident in the tongue, liver, and large intestine. Lesionsin these target organs were accompanied by amphophilic to basophilic intranuclear viral inclusionbodies in capillary endothelial cells. Transmission electron microscopy of the endothelial inclusionbodies revealed 80 to 92 nm diameter viral capsids consistent with herpesvirus morphology. Theshort course of the herpesvirus infections, with sudden deaths in all but the two surviving ele-phants, was ascribed to acute cardiac failure attributed to herpesvirus-induced capillary injurywith extensive myocardial hemorrhage and edema.

Key words: Elephant, Elephas maximus, endotheliotropic viruses, famciclovir, herpesvirus,Loxodonta africana, new disease, penciclovir.

INTRODUCTION

Elephants are exceptionally charismaticmegavertebrates; the Asian (Elephas max-imus) and African (Loxodonta africana)species are listed respectively as endan-gered and threatened by The World Con-servation Union (IUCN). To increase ele-phant numbers, a great deal of effort isunderway by zoo organizations to breedthese majestic animals naturally and by as-sisted insemination techniques. However,too many young elephants still die fromunknown causes. Recently, we reportedthe virological and epidemiological find-

ings of a highly fatal disease of elephantsin North America caused by two relatedbut distinct novel, endotheliotropic her-pesviruses (Richman et al., 1999a). In thatpaper, sequences from two herpesvirusgene regions, terminase and DNA poly-merase, showed 80% and 65% DNA ho-mology, respectively between the virusesthat are lethal for Asian and African ele-phants. A similar disease attributed to anendotheliotropic herpesvirus has been re-ported in a young Asian elephant from acircus in Switzerland (Ossent et al., 1990)and was shown to have the same viral se-quences as in our cases (Richman et al.,

2 JOURNAL OF WILDLIFE DISEASES, VOL. 36, NO. 1, JANUARY 2000

1999a). In our series, a total of 11 cases ofendotheliotropic herpesvirus infectionswere identified from eight zoos in NorthAmerica by polymerase chain reaction(PCR). Six of the cases were found retro-spectively after identification of the indexcase involving a 16-mo-old Asian elephantat the National Zoological Park in 1995(Richman et al., 1999a). The disease wasfatal in six young Asian elephants repre-senting 18% of that species born in cap-tivity from 1983 to 1996 (Richman et al.,1999a). One adult Asian elephant and twoAfrican elephants (a calf and an adult) alsodied, and two young Asian elephants re-cently survived the disease after treatmentwith an anti-herpesvirus drug, famciclovir.The relationship between the Asian andAfrican elephant endotheliotropic herpes-viruses is under further investigation; how-ever, they appear to be closely related,novel herpesviruses that produce nearlyidentical lesions in the two elephant spe-cies (Richman et al., 1999a). Additionally,localized African elephant skin and vulvallesions were found to contain viral se-quences nearly identical to the virus thatcaused the highly fatal infections in Asianelephants (Richman et al., 1999a).

The purpose of this paper is to reportthe clinical and pathological findings ofthis new herpesvirus disease of elephantsand to describe a unique pattern of lesionsin the organs targeted which is attributedto the endotheliotropism of the virus. Inaddition, we have developed an early di-agnostic method for this disease by awhole blood PCR test, and propose a pos-sible source of the herpesvirus that causedthe deaths of the two African elephantswith endotheliotropic disease. The grossand microscopic findings together with themolecular virological data and diagnostictests support these herpesviruses as thecausative agents of this newly recognizeddisease syndrome.

MATERIALS AND METHODSGeneral

Clinical and/or postmortem samples wereobtained from 11 elephants from North Amer-

ican zoos with endotheliotropic herpesvirus in-fection which included seven Asian and two Af-rican elephants that died, and two Asian ele-phants that survived. A detailed account of theclinical management of one of the latter ele-phants is published elsewhere (Schmitt andHardy, 1998).

Clinical and pathological evaluations of recentcases (1995–98).

Signalment and disease status of elephant(E) #1 through E#4 were assessed (Table 1);clinical evaluations were dependent upon thetractability of the animals at the time of illnessbut usually included physical examinations, col-lection of one or more blood samples (EDTAand heparinized blood) for hemograms, bloodbacterial and viral cultures, and serum for se-rological testing, vitamin E levels (E. Dieren-feld, Wildlife Conservation Society, New YorkCity, New York, USA), and to assay famciclovirserum levels in E#3. Elephant #3 and E#4were treated with an anti-herpesvirus drug,famciclovir (Famvir, SmithKline Beecham,Philadelphia, Pennsylvania, USA) administeredorally or rectally at 500 mg/70 kg, three timesa day for 3 to 4 wk (Schmitt and Hardy, 1998).

Complete necropsies were performed onE#1 and E#2 and representative samples weretaken from all organs and fixed in buffered 10%formalin. All organs and tissues were embed-ded in paraffin, sectioned at 5 microns thick-ness, stained with hematoxylin and eosin, andexamined by light microscopy. Additional sec-tions of selected formalin-fixed heart, liver,tongue and intestinal tract were post-fixed in2.5% gluteraldehyde and 2% osmium tetroxide,dehydrated in a series of graded alcohols, andembedded in epoxy resin (Steele et al., 1997).Semi-thin sections were stained with toluidineblue, and ultra-thin sections were stained withuranyl acetate and lead citrate for electron mi-croscopy (Steele et al., 1997). From E#1, freshliver and spleen and paired serum sampleswere submitted for fluorescent antibody tests(FAT) for leptospirosis (Leptospira interrogansserotypes pomona, hardjo, icterohaemorrhagia/copenhageni, grippotyphosa, canicola, bratis-lava, and sejroe; New York State College ofVeterinary Medicine, Ithaca, New York, USA)and fresh heart for encephalomyocarditis virus(EMCV) cultures (J. Gaskin, University of Flor-ida, Gainesville, Florida, USA). Replicate sec-tions of heart, liver, tongue, lymph nodes,spleen, kidney, and intestinal tract were frozenat 270 C for further viral isolation attempts.

Retrospective pathological studies

A search for pathology material from poten-tial cases of this herpesvirus disease was carried

RICHMAN ET AL.—A NEW DISEASE OF ELEPHANTS CAUSED BY ENDOTHELIOTROPIC HERPESVIRUSES 3

out by sending a survey to all participating zoosvia the American Zoo and Aquarium Associa-tion (AZA, Silver Spring, Maryland, USA) Spe-cies Survival Plan (SSP, Portland, Oregon, USAand Indianapolis, Indiana, USA) and by review-ing the Asian and African elephant studbookmortality records (held by the AZA). Therewere no reports of herpesvirus infections as-sociated with elephant deaths from the surveyor recorded in the studbooks from early in thecentury in North America. Pathology records,microscopic slides and tissues (frozen andfixed) were obtained from over 20 elephantswhose clinical and pathological descriptionshad some similarities with E#1 (the index case)and the case reported in an Asian elephant inSwitzerland (Ossent et al., 1990). Additionally,archival paraffin blocks of lung tissue reportedto have herpesvirus inclusion bodies fromhealthy wild African elephants (McCully et al.,1971) (received from N. Kriek, OnderstepoortVeterinary College, Pretoria, Republic of SouthAfrica) were obtained. The fixed tissues wereprocessed as described for E#1 and E#2 forlight and electron microscopy; all slides re-ceived and any new slides prepared were re-viewed, all major organs and tissues were ex-amined by light microscopy, and the data col-lated.

PCR assay and sequencing

Polymerase chain reaction was performed onDNA extracted from either fresh or frozen (280C) peripheral blood from two ill elephants (E#3and E#4) with clinical signs of endotheliotropicherpesvirus disease, and on DNA isolated fromlung tissue from three healthy, wild African ele-phants containing lymphoid nodules reported toinclude herpesvirus inclusions (McCully et al.,1971) and processed for PCR as described pre-viously (Richman et al., 1999a). Specific singleprimer sets for the elephant herpesvirus termi-nase and DNA polymerase gene regions wereconstructed from the sequence initially obtainedfrom cases E#1 and E#2: Terminase primers forAsian elephants (59GTACGTCCTTTCTAGCT-CAC 39 and 59GTGTCGGCTAAATGTTCTTG39); terminase primers for African elephants(59AATGTGATATCCTACGTATG 39 and 59GTACTATATCTTATCATGTC 39); and DNApolymerase primers for both elephant species (59GTGTCTGGCTATAGCAGAGT 39 and 59CA-CATCGATACGGAATCTCT 39).

Polymerase chain reaction was performedwith these primers in a 50 ml reaction volumecontaining PCR SuperMix (Gibco/BRL-LifeTechnologies, Gaithersburg, Maryland, USA),0.3% (v/v) glycerol, and 20 pmol of each prim-er. Polymerase chain reaction was completed

using the following protocol: Denaturation at94 C for 1 min, annealing at 50 C for 1 min,and extension at 72 C for 2 min for a total of36 cycles. The final extension was performed at72 C for 7 min. The PCR product was visual-ized on a 1.5% agarose gel stained with ethi-dium bromide.

Serological testing

Selected serological tests were performed viathe National Animal Disease Laboratories(NADL; Ames, Iowa, USA) on sera from threeadult elephants (two Asian, one African) fromthe National Zoological Park (Washington DC,USA) as well as banked frozen sera from herd-mates from two other zoos (located in Bronx,New York, USA and Springfield, Missouri,USA). These were the sites where previousdeaths from the endotheliotropic herpesvirushad occurred. Serologic tests for antibodies tothe following were performed: bluetongue vi-rus by enzyme-linked immunosorbent assay,epizootic hemorrhagic disease virus of deer byagar gel immunodiffusion (AGID), bovine her-pesvirus 1 by serum neutralization (SN), bovineherpesvirus 2 by SN, bovine herpesvirus 4 byimmunoperoxidase (IPT), malignant catarrhalfever virus by IPT, equine herpesviruses by SN,equine viral arteritis virus by SN, encephalo-myocarditis virus by SN, equine infectious ane-mia virus by AGID, equine adenovirus by IPT,pseudorabies virus by SN and porcine repro-ductive and respiratory syndrome virus by IPT.

High performance liquid chromatography (HPLC)analysis

Famciclovir (Famvir, SmithKline Beecham,Philadelphia, Pennsylvania, USA) is a pro-drugthat is rapidly and completely converted topenciclovir by liver esterases (Vere Hodge etal., 1989). Penciclovir (SmithKline Beecham,Philadelphia, Pennsylvania, USA) is the com-pound that circulates in the blood after admin-istration of famciclovir. We used, with minormodifications, a previously described methodfor the determination of penciclovir concentra-tions in serum (Fowles and Pierce, 1989) fromelephant #3. The calibrators (range 10–10,000ng/mL), quality assurance samples, and E#3 se-rum samples were spiked with acyclovir (Sig-ma, St. Louis, Missouri, USA) (50 mL of 100mg/mL) which was used as the internal stan-dard. Trichloroacetic acid (0.5 mL) was addedto precipitate the proteins. The samples werecentrifuged at 1,200 rpm in an Eppendorf235C centrifuge (Fisher Scientific, Pittsburgh,Pennsylvania, USA) for 2 min and the super-natants were transferred to a new tube andthen dried in a Speed Vac (Savant Instrument


TABLE 1. Signalment and disease status of four elephants with endotheliotropic herpesvirus disease.

ID Species Sex Age Location Onset Course Status

Elephant #1Elephant #2Elephant #3Elephant #4

AsianAfricanAsianAsian

FMFM

16 mo11 mo17 mo16 mo

Washington, DCCaliforniaMissouriFlorida

Apr-95Aug-96Nov-97Sep-98

5 days3 days

10 days12 days

DiedDiedSurviveda

Surviveda

a Animals were treated with famciclovir, beginning 3 to 5 days after onset.

FIGURE 1. Asian elephant #3 has subcutanousedema of the head, neck, and thoracic limbs attri-buted to endotheliotropic herpesvirus disease.

Inc., Holbrook, New York, USA). The sampleswere resuspended in 300 mL of 0.001 MNaH2PO4. Aliquots of 100 mL were injectedusing an autoinjector (Waters Associates, Inc.,Milford, Massachusetts, USA) onto a C-18 re-verse phase HPLC column (Waters Associates,Inc., Milford, Massachusetts, USA) and thenwere eluted with 0.01 M NaH2PO4 (pH 7):methanol (9:1) at a flow rate of 1 mL/min usingWaters HPLC pump. The signal was detectedusing Waters spectrophotometric detector atUV absorption of 254 nm. Data acquisition wasdone using Waters Millennium Chromatogra-phy Manager. Samples were obtained from E#3several times each day during the treatment pe-riod and were compared to banked serum sam-ples from the same elephant before treatmentcommenced.

RESULTS

Clinical findings

From the clinical evaluations of E#1–E#4 (Table 1), the onset of the disease ap-

peared to be sudden with a course of 1 to7 days. The initial clinical signs were leth-argy, anorexia, mild colic, edema of thehead (especially the face and proboscis)neck and thoracic limbs (Fig. 1). E#1 hada diffusely cyanotic tongue and oral ulcerson the day that she died (day 5). Cyanosisof the tongue in E#2 was not observed,but in E#3 cyanosis began at the tip of thetongue and moved caudally on the thirdand fourth day. E#4 had swelling and cy-anosis of the tongue noted 4 days after theonset of illness. Pertinent laboratory testsincluded hemograms early in the course ofthe disease in the three Asian elephantswhich showed mainly lymphopenia andthrombocytopenia in two of the elephants,one of which also was anemic (Table 2).E#1 and E#2 died on the fifth and thirdday, respectively after the onset of the dis-ease. In E#3, the lingual cyanosis and headand neck edema resolved over the nextweek, approximately 9 days after begin-ning treatment with famciclovir. The ele-phant gained strength and resumed eating.Semiquantitative blood virus levels mea-sured daily from day 3 after disease onsetdecreased steadily to a non-detectable lev-el by 8 wk after the onset of illness. Serumlevels of penciclovir rose to 863 ng/ml af-ter the initial dose and fluctuated between0 (8 hr post-treatment) and 4,365 ng/ml (1hr post-treatment) over the 3 wk course oforal famciclovir administration.

Pathological findings (recent and retrospectivecases).

The necropsied elephants E#1 and E#2and seven of the 20 elephants reviewedretrospectively that died between 1983and 1993 all had similar lesions attributed


TA

BL

E2.

Blo

odpa

ram

eter

sdu

ring

the

acut

eon

set

ofen

doth

elio

trop

iche

rpes

viru

sdi

seas

ein

thre

eel

epha

nts.

WB

CR

BC

Pla

tele

tsN

eutr

ophi

lsL

ymph

ocyt

esM

onoc

ytes

Mea

nF

emal

ea

#1F

emal

e#3

Fem

ale

Mea

nM

alea

#4M

ale

(13.

53

103 /

ml)

4.6

19.5

(16.

53

103 /

ml)

15.8

(3.1

310

3 /m

l)3.

892.

55(3

.23

103 /

ml)

2.31

(601

310

3 /m

l)de

crea

sed

166

(518

310

3 /m

l)ad

equa

te

(4.7

310

3 /m

l)3.

19.

55(6

.13

310

3 /m

l)5.

06

(6.6

310

3 /m

l)0.

903.

5(8

.23

103 /

ml)

10.4

3

(2.4

310

3 /m

l)0.

401.

6(1

.43

103 /

ml)

0.16

aF

rom

Mik

ota

etal

.(1

994)

.

FIGURE 2. Left ventricular endocardial surface ofthe heart from Asian elephant #1 showing subendo-cardial ecchymotic hemorrhages due to endotheli-otropic herpesvirus disease.

to the endotheliotropic herpesviruses. Sixof the retrospective cases were Asian ele-phants from zoos in New York, Oklahoma,Illinois, and Missouri in the USA, and inOntario, Canada (2); one was an Africanelephant from a zoo in Texas (USA).

Gross findings typically included peri-cardial effusion with extensive petechial toecchymotic hemorrhages involving theepi- and endocardial heart surfaces (Fig.2) and throughout the myocardium. In ad-dition, diffusely scattered petechiae werewithin all of the visceral and parietal peri-toneal serous membranes and variably,there was cyanosis of the tongue (Fig. 3).There was also hepatomegaly, and variablyoral, laryngeal and large intestinal ulcers.

Light and electron microscopic findings

Pertinent microscopic findings consistedof extensive microhemorrhages through-out the heart (Fig. 4) and tongue associ-ated with edema, and mild infiltrates oflymphocytes, monocytes and a few neutro-phils between myofibers. There was mildto moderate hepatic sinusoidal expansionwith multifocal subacute inflammation,and mild hepatocellular vacuolar degen-erative changes. Ulcers of the oral and la-


FIGURE 3. Cross section of the tongue fromAsian elephant #1 demonstrating diffuse swelling andcyanosis attributed to endotheliotropic herpesvirusdisease.

FIGURE 5. Photomicrograph of liver from Asianelephant #1 that died with endotheliotropic herpes-virus disease, showing an intranuclear viral inclusionbody within a sinusoidal endothelial cell (arrow). Bar5 25 mm.

FIGURE 4. Photomicrograph of heart from Asianelephant #1, demonstrating extensive hemorrhageand separation of myocardial fibers attributed to en-dotheliotropic herpesvirus. Bar 5 150 mm.

ryngeal mucous membranes in E#1 wereacute, with necrotic surface cells still intactin some areas. The endothelial cells of cap-illaries in the myocardium (9/9 animals)and tongue muscle (from 6/6 animals fromwhich tongue was available), and withinthe hepatic sinusoids of the liver (9/9 ani-mals) contained amphophilic to basophilicintranuclear viral inclusion bodies (Fig. 5).The endothelial cells with the viral inclu-sion bodies were in close association withthe microhemorrhages in the heart andtongue. The inclusion bodies were less of-ten seen in capillary endothelial cells inthe lamina propria and smooth muscle lay-ers of the intestinal tract, but were not ev-ident in any of the ulcers or in blood ves-sels larger than capillaries. Ultrastructuralmicroscopic studies of the endothelial in-clusion bodies in all nine cases revealed80–92 nm particles morphologically con-sistent with herpesviruses (Figs. 6, 7). His-


FIGURE 6. Transmission electron micrograph(TEM) of heart from African elephant #2 that diedwith endotheliotropic herpesvirus disease, demon-strating an intranuclear inclusion body within a cap-illary endothelial cell. Herpesvirus particles (arrows)are seen emerging from the inclusion body. Bar 5500 nm.

FIGURE 7. Higher magnification TEM of the in-tranuclear inclusion body from Figure 6, showinggreater detail of the emerging herpesvirus nucleocap-sids (arrows). Bar 5 200 nm.

tologically, pulmonary nodules from archi-val African elephant tissues were com-posed of multiple large lymphoid follicles(Fig. 8) which surrounded epithelial cellsthat contained intranuclear inclusion bod-ies (Fig. 9). These epithelial cells oftenformed syncytia.

Clinical laboratory findings

In E#1, aerobic and anaerobic bacterialcultures of heart blood, pericardial andperitoneal fluid, cerebrospinal fluid, axil-lary lymph node, and liver were negative,and bacterial cultures of multiple seg-ments of the gastrointestinal tract yieldedno enteric pathogens. Co-cultivation of liv-er and heart were performed as previouslydescribed (Richman et al., 1999a) and alsowere negative for any of the known humanor animal herpesviruses or any other vi-

ruses. In addition, serology and cultures ofheart tissue were negative for encephalo-myocarditis virus; FAT and paired serawere negative for Leptospira interrogansantigens and antibodies. Blood alpha to-copherol level was 0.62 mg/ml (referencerange is 0.2 mg/ml to 0.9 mg/ml for Asianelephants) at the time of her illness.

PCR and viral sequencing

Polymerase chain reaction, followed bysequencing of DNA extracted from pe-ripheral blood from E#3 and E#4 con-tained nearly identical endotheliotropicherpesvirus sequences in the terminasegene region (up to 3 base pairs differencefrom some of the deceased Asian ele-phants, but all are silent mutations) as thetarget tissues from the deceased Asian el-ephants. DNA extracted from pulmonarytissue of wild African elephants with mor-phological evidence of herpesvirus con-


FIGURE 8. Pulmonary lymphoid nodules from ahealthy, free ranging adult African elephant. Follic-ular lymphoid hyperplasia surrounds epithelial cellswhich contain intranuclear herpesviral inclusion bod-ies, shown in Figure 9. Bar 5 250 mm.

FIGURE 9. Higher magnification of the lung nod-ule from Figure 8, demonstrating intranuclear her-pesviral inclusion bodies (arrows) within epithelialsyncytial cells. Herpesviral protein sequences fromthe DNA polymerase gene region obtained fromthese African elephant pulmonary nodules are iden-tical to those found in deceased African elephantswith endotheliotropic herpesvirus disease. Bar 5 25mm.

tained viral sequences in the DNA poly-merase gene region that had 100% proteinidentity with the herpesvirus that was fatalfor the two African elephants in our studygroup.

Serological studies

One herdmate of E#1 had low serumantibody titer to bovine herpesvirus-4, andseveral others tested had low titers to ma-lignant catarrhal fever virus (alcelaphineherpesvirus 1) and to equine adenovirus.Serosurveys from remaining viruses listedwere all negative. Herd mates from theSwiss case (Metzler et al., 1990) also hadlow titers considered cross reactive to bo-vine herpesviruses but the significance ofthese serologic findings is currently un-known since there was no consistent pat-tern, nor were herpesviruses isolated fromany of the cases.

HPLC for penciclovir

Serum levels of penciclovir from E#3varied from 97 ng/ml to 4,365 ng/ml, de-pending on the time interval betweentreatment and blood collection. Lower lev-els of serum penciclovir were present inthe early morning, 8 hr after the last doseof famciclovir was administered. Highervalues of serum penciclovir correlated withtreatment administration 1 to 3 hr prior toblood collection (data not shown). Theseconcentrations are comparable to penci-clovir concentrations in humans after ad-ministration of a 500 mg dose of famciclo-vir (Vere Hodge et al., 1989; Boike et al.,1994).


DISCUSSION

The acute nature and high fatality ratein clinically affected elephants of this her-pesvirus disease is unusual for infectionscaused by herpesviruses in humans andother animals. One of the major factorsconsidered important in the epidemiologyof the elephant herpesviruses is the prem-ise of the herpesvirus being innocuous inone elephant species and highly pathogen-ic for the other. This relationship is knownfor a number of herpesviruses includingherpesvirus B, latent in Macaca spp. andpotentially fatal in humans, and malignantcatarrhal fever herpesviruses carried bysheep or wildebeest and producing overtdisease in cattle and acelaphine antelopes(Schuller et al., 1990). The evidence indi-cating probable cross-species transmissionof a herpesvirus from benign lesions inotherwise asymptomatic African elephantsto susceptible Asian elephants was thefinding of nearly identical herpesvirus se-quences in these two species (Richman etal., 1999a). This suggested that otherwisehealthy African elephants are a source ofthe herpesvirus that is highly pathogenicfor Asian elephants.

Another important factor considered inthe pathogenicity and the unusual natureof the lesions observed in these elephantherpesvirus infections is the endotheli-otropism of these viruses. Most animalherpesviruses are epitheliotropic or have apredilection for nervous tissue. The targetorgans for many of the disseminated her-pesvirus infections in mammals are usuallythe liver, adrenal glands and brain, inwhich the herpesvirus forms characteristicintranuclear inclusion bodies and producesfoci of necrosis in the parenchymal cells.The finding of intranuclear inclusion bod-ies in the endothelial cells of capillaries inthe elephant lesions provides histomor-phological evidence of their tropism forthese vascular cells. In fact, these endo-thelial inclusion bodies found in all nineelephants that died of the herpesvirus in-fection are histological hallmarks and may

be pathognomonic for this disease syn-drome.

It has been reported (Metzler et al.,1990) that elephants that had contact withthe Swiss case had serological evidence ofexposure to bovine herpesvirus 2 (BHV2).Because of this report, we tested conva-lescent serum samples from Asian ele-phant E#3 for exposure to or cross-reac-tivity with BHV1, BHV2 and BHV4 (datanot shown). All convalescent serum sam-ples from E#3 were negative by ELISA forBHV1, BHV2 and BHV4 (R. Eberle, pers.comm.) and negative by immunofluores-cence for BHV1, BHV2, BHV4 and otherungulate herpesviruses including equineherpesviruses 1 and 4 (M. Kennedy, pers.comm.). This supports our molecular find-ings, and demonstrates that the elephantherpesviruses are unique in immunogenic-ity such that cross reactivity with otherherpesviruses is not detected. Additionally,the vitamin E (alpha-tocopherol) level inE#1 was within normal range for Asian el-ephants. In the earlier cases, at the timeof their deaths, hypovitaminosis E wasconsidered in the differential diagnosis ofseveral of the elephants in our study groupdue to ecchymotic hemorrhages that wereseen at necropsy.

The endotheliotropism of the elephantherpesviruses also may explain the organtropism of these viruses for the heart, liverand tongue, the capillary endothelial cellsof which harbor the inclusion bodies. Thereason for the specific tropism for endo-thelial cells mainly in these targeted organsis not clear, but may reflect some differ-ence in metabolic properties or surface re-ceptor characteristics between endothelialcells in different organs. Other instancesof endotheliotropism for herpesviruseshave been reported with varicella-zostervirus (VZV) in children with fatal dissem-inated infections, and more recently withhuman herpesvirus-8 (HHV8) and its as-sociation with Kaposi’s sarcoma, which arethought to be derived from endothelial-like spindle cells (Moore and Chang,1995).


Based on these morphologic findings,the proposed pathogenesis is as follows:once the elephant becomes viremic (pos-sibly via circulating lymphocytes after ex-posure to the virus), ensuing viral repli-cation in the heart leads to endothelial celldamage resulting in capillary leakage andsevere intramyocardial hemorrhage andedema. The magnitude of this damage, asreflected by the microscopic lesions, leadsto cardiac failure either by disruption ofthe conducting system, the mass effect ofthe intracardiac swelling, or myocardial is-chemia and localized metabolic distur-bances. Cardiac insufficiency may alsocontribute to glossal cyanosis. The regres-sion of lingual cyanosis as noted in E#3treated with famciclovir reflects a similarprocess of capillary injury and leakagewithin the tongue, followed by resolutionas recovery progressed. The severe hem-orrhage and congestion was manifested asthe blue discoloration noted clinically inE#3 and involving the entire tongue of el-ephant E#1 in the terminal stages of theherpesvirus infection.

In support of this pathogenesis, E#3 andE#4 were found to be viremic by PCR ear-ly in the disease, had all the classic clinicalsigns, and were treated with famciclovirfor 3 to 4 wk. After several days of treat-ment, at a time when elephants would nor-mally die, appetite returned, lingual cya-nosis slowly regressed and edema was nolonger visible. In E#3, temporal semiquan-titative PCR showed decreasing detectableblood viral load that coincided with serumfamciclovir at therapeutic levels (data notshown) which strongly suggests a benefi-cial effect of the antiherpesvirus drug. Therecovery of the second young elephant(E#4) that was treated with famciclovirfurther supports the efficacy of this drugin the treatment of these elephant herpes-virus infections.

Prior to the identification and descrip-tion of this highly fatal herpesvirus diseasein captive elephants (Ossent et al., 1990;Richman et al., 1999a), there existed onlyseveral reports of herpesviruses occurring

in skin papillomas and pulmonary nodulesof African elephants by light and electronmicroscopy, but no references to herpes-virus in Asian elephants. At the time, theselesions with herpetic inclusion bodies inthe African elephants were considered in-cidental or localized findings with no sys-temic illnesses associated with them, andno documentation of herpesvirus isolation(McCully et al., 1971; Jacobson et al.,1986). The agent observed in the Africanelephant cutaneous papillomas is homolo-gous with the virus lethal for Asian ele-phants in the terminase gene region (Rich-man et al., 1999a). In that study, the samevirus was also identified by PCR in biop-sies of the lymphoid patches from the dis-tal vaginal tract (vestibulum) of wild Afri-can elephants which did not contain viralinclusion bodies histologically. This her-pesvirus is now considered to be a novel,indigenous herpesvirus of African ele-phants, possibly latent in lymphocytes ofthe vaginal lymphoid follicle-containingpatches. These lymphoid patches periodi-cally become hyperplastic and occasionallyulcerate (Munson et al., 1995) which thenmay afford transmission of the virus to an-other host. The additional findings in ourreport here indicate that there is a secondrelated herpesvirus identified in pulmo-nary nodules obtained from healthy wildAfrican elephants that has 100% proteinidentity (in the DNA polymerase gene re-gion) with the previously reported virusthat was lethal for the two African ele-phants with endotheliotropic disease. Al-though currently limited by data obtainedfrom a small portion of the viral genomes,and given the obvious need for additionalviral sequence data, the results obtained todate may indicate that African elephantscan harbor two novel herpesviruses, onethat can cause fatal endotheliotropic dis-ease in Asian elephants and the other inAfrican elephants. Currently, intensivework is underway to further elucidate theepidemiology of these two herpesviruseswhich are either carried latently, or as


chronic low-level infections in African el-ephants.

In addition to the Asian elephant fromSwitzerland (Ossent et al., 1990), the virusof which we determined is homologous (inthe terminase gene region) with our othernine Asian elephant cases from NorthAmerica, we have confirmed by PCR and/or morphological techniques similar her-pesvirus cases in five Asian elephants fromGermany, Netherlands, and Israel (Rich-man et al., 1999b). The implications of theherpesvirus in wild African elephants areunknown but no herpesvirus-associated ill-nesses have been observed or reportedthrough the diagnostic laboratory in On-derstepoort, Republic of South Africa. Theexistence of any elephant herpesviruses inAsian elephants in the wild is currently un-known.

Although our findings to date implicatethe African elephant as a potential reser-voir of herpesviruses that can cause dis-ease in the two elephant species, directproof of transmission has not been estab-lished between contact and exposed ani-mals. Considerably more epidemiologicalwork is required to clarify the potentialcarrier status of the Asian elephant for ei-ther of these viruses. Some of these factorswill depend on cultivating the viruses, orby the development of serological tests sothat elephants previously exposed to theseviruses can be identified. It might be im-portant to minimize the co-mingling or so-cializing of Asian and African elephants atthe same facility or between facilities asthis may increase the risk of the transmis-sion of herpesviruses particularly in breed-ing operations, or where new elephantsare being introduced.

ACKNOWLEDGMENTS

Funded by NIH grant No. 1 K08 AI01526-01, the Smithsonian Scholarly Studies Program,the Kumari Elephant Conservation Fund, andFriends of the National Zoo. The authors thankR. Garber, D. Nichols, V. Bonshock, D. Fi-scher, A. Bratthauer, N. Spangler, L. Cheng, K.Clark, J. Sutton, E. Lamirande, J. Lehnhardt,N. Pratt, M. Bush, J. Block, the elephant keep-

er staff at the National Zoological Park, P. An-gle, J. Cohen, S. Feldman, S. Mikota, R. Mir-kovic, J. d’Offay, R. Eberle, G. Letchworth, K.Steele, B. Connolly, P. Jahrling, J. C. Zong, M.Lucskay, J. Cannon, J. Yang, R. Ambinder, J.Nicholas, A. Hess, L. Poole, D. Ciufo, W. Gib-son, A. Ruebel, P. Ossent, F. Osorio, S. Kania,M. Kennedy, E. Dierenfeld, T. McNamara, J.Trupkiewicz, L. Munson, L. Lowenstine, B.Rideout, I. Stalis, J. St. Leger, J. Fickel, J. Par-rott, K. Emanualson, D. Taylor, J. Jenkins, R.V. Ferris, D. Scott, G. Coleman, B. Schmitt, A.D. Alstad, J. Gaskin, D. Olson, M. Keele, A.Schanberger, E. Jacobson, L. Gage, MarineWorld Africa-USA, L. Bingaman-Lackey, N.Kriek, A. Greenwood, W. Lindsay, G. West, R.Isaza, L. Reeve Peddie, J. Peddie, J. Williams,T. Williams, elephant keeper staff at RinglingBrothers, San Diego Zoo and Wild AnimalPark, Center for Reproduction of EndangeredSpecies (CRES), New York Wildlife Conser-vation Society, Lincoln Park Zoo, DickersonPark Zoo, African Lion Safari, Tulsa ZoologicalPark, Fort Worth Zoo, Indianapolis Zoo, DallasZoo, Houston Zoo, Oakland Zoo, Have TrunkWill Travel, National Veterinary Services Lab-oratories, and California Veterinary DiagnosticLaboratory.

LITERATURE CITED

BOIKE, S. C., M. PUE, P. R. AUDET, M. I. FREED, A.FAIRLESS, B. E. ILSON, AND N. J. D. K. ZARIFFA.1994. Pharmacokinetics of famciclovir in subjectswith chronic hepatic disease. Journal of ClinicalPharmacology 34: 1199–1207.

FOWLES, S. E., AND D. M. PIERCE. 1989. High per-formance liquid chromatographic method for thedetermination of 9-(4-hydroxy-3-hydroxymethyl-but-1-yl) guanine (BRL-39123) in human plasmaand urine. Analyst 114: 1373–1375.

JACOBSON, E. R., J. P. SUNDBERG, J. M. GASKIN, G.V. KOLLIAS, AND M. K. O’BANION. 1986. Cuta-neous papillomas associated with a herpesvirus-like infection in a herd of captive African ele-phants. Journal of the American Veterinary Med-ical Association 189: 1075–1078.

MCCULLY, R. M., P. A. BASSON, J. G. PIENAAR, B. J.ERASMUS, AND E. YOUNG. 1971. Herpes nodulesin the lung of the African elephant (Loxodontaafricana). Onderstepoort Journal of VeterinaryResearch 38: 225–236.

METZLER, A. E., P. OSSENT, F. GUSCETTI, A. RUBEL,AND E. M. LANG. 1990. Serological evidence ofherpesvirus infection in captive Asian elephants(Elephas maximus). Journal of Wildlife Diseases26: 41–49.

MIKOTA, S. K., E. L. SARGENT, AND G. S. RANELAK.1994. Medical management of the elephant. In-


dira Publishing House, West Bloomfield, Michi-gan, pp. 54–58.

MOORE, P. S., AND Y. CHANG. 1995. Detection ofherpesvirus-like DNA sequences in Kaposi’s sar-coma in patients with and without HIV infection.New England Journal of Medicine 332: 1181–1185.

MUNSON, L., W. KARESH, S. SHIN, J. BALKE, P. CAL-LE, R. CAMBRE, M. CRANFIELD, S. CITINO, AND

R. JUNGE. 1995. Lymphoid follicular vulvitis inAfrican (Loxodonta africana) and Asian (Elephasmaximus) elephants. Journal of Zoo and WildlifeMedicine 26: 353–358.

OSSENT, P., F. GUSCETTI, A. E. METZLER, E. M.LANG, A. RUBEL, AND B. HAUSER. 1990. Acuteand fatal herpesvirus infection in a young Asianelephant (Elephas maximus). Veterinary Pathol-ogy 27: 131–133.

RICHMAN, L. K., R. J. MONTALI, R. L. GARBER, M.A. KENNEDY, J. LEHNHARDT, T. HILDEBRANDT,D. SCHMITT, D. HARDY, D. J. ALCENDOR, AND

G. S. HAYWARD. 1999a. Novel endotheliotropicherpesviruses fatal for Asian and African ele-phants. Science 283: 1171–1176.

, , T. HILDEBRANDT, J. FICKEL, D.

SCHMITT, AND G. S. HAYWARD. 1999b. Status ofa new, fatal herpesvirus disease in elephants inNorth America and Europe. Verhandlangsber-icht des 39 International Symposium uben Er-krankungen der Zoo und Wildtiere, Wien 39: 17–21.

SCHMITT, D. L., AND D. A. HARDY. 1998. Use offamciclovir for the treatment of herpesvirus in anAsian elephant. Journal of the Elephant Manag-ers Association 9: 103–104.

SCHULLER, W., S. CERNY-REITERER, AND R. SILBER.1990. Evidence that the sheep associated formof malignant catarrhal fever is caused by a her-pesvirus. Zentralbl Veterinarmed 37: 442–447.

STEELE, K. E., F. Y. SCHULMAN, H. MENA, AND E.O. STRIMPLE. 1997. Rhabdoid tumor in the brainof a dog. Veterinary Pathology 34: 359–363.

VERE HODGE, R. A., D. SUTTON, M. R. BOYD, M. R.HARNDEN, AND R. L. JARVEST. 1989. Selectionof an oral prodrug (BRL 42810; famciclovir) forthe antiherpesvirus agent BRL 39123 [9-(4-hy-droxy-3-hydroxymethylbut-1-yl) guanine; penci-clovir]. Antimicrobial Agents and Chemotherapy33: 1765–1773.

Received for publication 19 February 1999.

Documents

CLINICAL AND PATHOLOGICAL FINDINGS OF A NEWLY …