of November 18, 2018.This information is current as

Internalization and NOD2 ActivationPathway Regulates Muramyl Dipeptide Clathrin- and Dynamin-Dependent Endocytic

Hu, David E. Smith, Geert-Jan Boons and Gabriel NúñezNoemí Marina-García, Luigi Franchi, Yun-Gi Kim, Yonjun

http://www.jimmunol.org/content/182/7/4321doi: 10.4049/jimmunol.0802197

2009; 182:4321-4327; ;J Immunol 

Referenceshttp://www.jimmunol.org/content/182/7/4321.full#ref-list-1

, 21 of which you can access for free at: cites 46 articlesThis article

        average*  

4 weeks from acceptance to publicationFast Publication! •    

Every submission reviewed by practicing scientistsNo Triage! •    

from submission to initial decisionRapid Reviews! 30 days* •    

Submit online. ?The JIWhy

Subscriptionhttp://jimmunol.org/subscription

is online at: The Journal of ImmunologyInformation about subscribing to

Permissionshttp://www.aai.org/About/Publications/JI/copyright.htmlSubmit copyright permission requests at:

Email Alertshttp://jimmunol.org/alertsReceive free email-alerts when new articles cite this article. Sign up at:

Print ISSN: 0022-1767 Online ISSN: 1550-6606. Immunologists, Inc. All rights reserved.Copyright © 2009 by The American Association of1451 Rockville Pike, Suite 650, Rockville, MD 20852The American Association of Immunologists, Inc.,

is published twice each month byThe Journal of Immunology

by guest on Novem

ber 18, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

by guest on N

ovember 18, 2018

http://ww

w.jim

munol.org/

Dow

nloaded from

Clathrin- and Dynamin-Dependent Endocytic PathwayRegulates Muramyl Dipeptide Internalization and NOD2Activation1

Noemí Marina-García,2,3* Luigi Franchi,2* Yun-Gi Kim,* Yonjun Hu,† David E. Smith,†

Geert-Jan Boons,‡ and Gabriel Nunez4*

Muramyl dipeptide (MDP), the NOD2 agonist, induces NF-�B and MAPK activation leading to the production of antimicrobialand proinflammatory molecules. MDP is internalized into acidified vesicles in macrophages. However, the endocytic mechanismof MDP uptake that induces NOD2 signaling is unknown. We now report the identification of an endocytosis pathway dependenton clathrin and dynamin that mediates MDP internalization and NOD2 activation. Intracellular MDP uptake was inhibited bychlorpromazine, a drug that disrupts clathrin-dependent endocytosis, but not by compounds that block pinocytosis or cellularentry via scavenger or mannose receptors. In contrast, MDP uptake and NOD2-dependent signaling were unimpaired in mac-rophages deficient in PepT1, a peptide transporter previously implicated in MDP internalization. Both chlorpromazine andknockdown of clathrin expression by RNA interference attenuated MDP-induced NF-�B and MAPK activation. Furthermore,MDP uptake and NOD2-dependent signaling were impaired by inhibition of dynamin, a GTPase required for budding of clathrin-coated vesicles from the plasma membrane. Finally, bafilomycin A, a specific inhibitor of the vacuolar proton pump, blocked MDPaccumulation in acidified vesicles and cytokine responses, suggesting that vacuolar maturation is important for MDP-inducedNOD2 signaling. These studies provide evidence for a clathrin- and dynamin-dependent endocytosis pathway that mediates MDPuptake and NOD2 activation. The Journal of Immunology, 2009, 182: 4321–4327.

N OD2 is a member of the nucleotide-binding oligomer-ization domain (NOD)5-like receptor (NLR) family (1).Several NLRs, including NOD2, function as intracellu-

lar pattern recognition receptors that sense microbial moieties thatare shared by a large number of bacteria (2). NOD2 is activated bypeptidoglycan-derived molecules containing muramyl dipeptide(MDP) that are produced by both Gram-negative and Gram-posi-tive bacteria (3, 4). Upon MDP recognition, NOD2 induces theactivation of the transcription factor NF-�B and the MAPKs viathe serine-threonine kinase RICK (also called RIP2) (3, 5–8). Re-

cent studies have demonstrated that K63-linked regulatory ubiq-uitination of RICK is essential for the recruitment of TAK1 (9, 10),a kinase required for the activation of the MAPKs and the I�B�kinase complex (11). The importance of NOD2 in inflammatoryhomeostasis is underscored by the observation that mutations inthe NOD2 gene increase the susceptibility to inflammatory disor-ders, including Crohn’s disease and Blau syndrome (12–15). Al-though the precise mechanisms by which NOD2 mutations pro-mote disease remain unclear, several studies have demonstratedthat Crohn’s disease-associated NOD2 variants are deficient inMDP recognition, whereas those linked to Blau syndrome exhibitconstitutive activity (3, 16).

The NOD2 signaling pathways induced by MDP stimulationhave been largely defined (1, 2). However, the cellular mechanismthat mediates MDP uptake to induce NOD2 activation and signal-ing is poorly understood. In intestinal epithelial cell lines, there isevidence that MDP can be internalized through the peptide PepT1transporter, but it is unclear if this mechanism is involved in MDP-induced signaling in cells such as macrophages that normally ex-press NOD2 (17–20). After MDP exposure, macrophages internal-ized the NOD2 agonist in acidified vesicles (22). However, theendocytic pathway responsible for MDP uptake is unknown. Fur-thermore, it remains unclear whether endocytosis of MDP is im-portant for NF-�B and MAPK activation induced via NOD2. Inthese studies, we have identified clathrin- and dynamin-dependentendocytosis, but not the peptide PepT1 transporter, as the mech-anism for the uptake of MDP, which is critical for MDP-inducedNOD2 activation and signaling.

Materials and MethodsMice and cells

C57BL/6 mice were purchased from The Jackson Laboratory. PepT1knockout (KO) mice in C57BL/6 background generated by homologous

*Department of Pathology and Comprehensive Cancer Center, University of Michi-gan Medical School, Ann Arbor, MI 48109; † Department of Pharmaceutical Sciencesand Upjohn Center for Clinical Pharmacology, University of Michigan, Ann Arbor,MI 48109; and ‡Complex Carbohydrate Research Center, University of Georgia, Ath-ens, GA 30602

Received for publication July 7, 2008. Accepted for publication January 28, 2009.

The costs of publication of this article were defrayed in part by the payment of pagecharges. This article must therefore be hereby marked advertisement in accordancewith 18 U.S.C. Section 1734 solely to indicate this fact.1 This work was supported by National Institutes of Health Grants DK61707 (to G.N.)and GM035498 (to D.E.S.). L.F. was supported by a Fellowship from the ArthritisFoundation, and Y.-G.K. was supported by a Fellowship from the University of Mich-igan Comprehensive Cancer Center. MDP-derived compounds synthesis was sup-ported by National Institutes of Health Grant GM065248 (to G.-J.B.).2 N.M.-G. and L.F. contributed equally to the present work.3 Current address: Molecular Immunopathology Unit, Pompeu Fabra University(DCEXS), Barcelona Biomedical Research Park, 08003 Barcelona, Spain.4 Address correspondence and reprint requests to Dr. Gabriel Nunez, University ofMichigan Medical School, Department of Pathology and Comprehensive Cancer Cen-ter, 1500 E. Medical Center Drive, Ann Arbor, MI 48109. E-mail address: bclx@umich.edu5 Abbreviations used in this paper: NOD, nucleotide-binding oligomerization do-main; CPZ, chlorpromazine; DAPI, 4�,6�-diamino-2-phenylindole; KO, knockout;MDP, muramyl dipeptide; NLR, NOD-like receptor; shRNA, small hairpin RNA;WT, wild type.

Copyright © 2009 by The American Association of Immunologists, Inc. 0022-1767/09/$2.00

The Journal of Immunology

www.jimmunol.org/cgi/doi/10.4049/jimmunol.0802197

by guest on Novem

ber 18, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

recombination have been described (21). Mice were housed in a pathogen-free facility. The animal studies were conducted under approved protocolsby the University of Michigan Committee on the Use and Care of Animals.Bone marrow-derived macrophages were prepared as described (23). Hu-man monocytes were purified from PBMC of healthy volunteers by ad-herence to plastic dishes (24). Briefly, venous blood was drawn from thecubital vein into EDTA tubes, and mononuclear cells were isolated bydensity centrifugation of blood diluted 1/2 in PBS over Ficoll-Paque (Phar-macia Biotech). Cells were washed twice in PBS and suspended in culturemedium (RPMI 1640) supplemented with antibiotics, 10 mM L-glutamine,and 10 mM pyruvate. Mononuclear cells were incubated at 2–3 � 106/mlin plastic dishes for 1 h, washed to remove nonadherent cells, and adherentcells were recovered by scraping in PBS without Ca2� and Mg2� andreplated in complete medium. Human HEK293T cells were cultured inDMEM plus 10% FBS plus penicillin/streptomycin.

Reagents and plasmids

Ultrapure LPS from Escherichia coli 0111:B4 was purchased from Invivo-Gen. Human TNF-� was purchased from Roche. MDP (Ac-muramyl-Ala-D -Glu-NH2) was purchased from Bachem. MDP labeled with Alexa488 (MDP-Alexa 488) and rhodamine B (MDP-rhodamine) have been de-scribed (22). Fluorescent low density lipoprotein (LDL-BODIPY) was pur-chased from Invitrogen. Bafilomycin A, chlorpromazine (CPZ), dimethil-amyloride, polyinosinic acid, and mannans from Sacharomyces cerevesiaewere purchased from Sigma-Aldrich. Dynasore was synthesized by Dr.Henry Pelishand and generously provided by Dr. Tom Kirchhausen (Har-vard Medical School) (25). The luciferase NF-�B reporter assay using theNOD2 expression construct, pMXp-HA-NOD2, the luciferase reporterplasmid pBVIx-Luc, and the pEFBOS-�-galactosidase used for normaliza-tion have been reported (26). Plasmid expressing dominant-negative dy-namin II (K44A), dynamin K44A, and the parental control plasmid wereprovided by Dr. Theodora Ross (University of Michigan Medical School).Lentiviral constructs expressing small hairpin RNAs (shRNA) (shRNA1,CCGGGCCCAAATGTTAGTTCAAGATCTCGAGATCTTGAACTAACATTTGGGCTTTTT; shRNA2, CCGGGCCAATGTGATCTGGAACTTACTCGAGTAAGTTCCAGATCACATTGGCTTTTT) for silencing thehuman clathrin H chain gene were purchased from Sigma-Aldrich.

cDNA synthesis and real-time PCR

Total RNA was extracted from cultured macrophages derived from wild-type(WT) and PepT1 KO mice using the RNeasy Plus Mini kit (Qiagen), andcDNA was synthesized using SuperScript III reverse transcriptase (Invitrogen)according to the manufacturer’s instructions. Real-time PCR was performedusing TaqMan PCR Master mix (Applied Biosystems). The PCR conditionswere as follows: initial denaturation for 10 min at 95°C, followed by 40 cyclesof 15 s at 95°C and 1 min at 60°C. The primer sequences were: PepT1 forward,CTTGGAGCCACCACAATGG; PepT1 reverse, ACAGAATTCATTGACCACGATGA; PepT1 probe, 5�-56-FAM-TTGCTTCGGTTACCCGTTGAGCATCT-36-TAMSp-3�; PepT1 standard, CCGGAGCCTTGGAGCCACCACAATGGGGATGTCCAAGTCTCGGGGTTGCTTCGGTTACCCGTTGAGCATCTTCTTCATCGTGGTCAATGAATTCTGTGAAAGA; GAPDH forward, GAGACAGCCGCATCTTCTTGT; GAPDHreverse, CACACCGACCTTCACCATTTT; GAPDH probe, 5�-56-JOE-CAGTGCCAGCCTCGTCCCGTAGA-36-TAMSp-3�; GAPDH standard,TCCCTGTTCCAGAGACAGCCGCATCTTCTTGTGCAGTGCCAGCCTCGTCCCGTAGACAAAATGGTGAAGGTCGGTGTGAACGGATTTG.

Luciferase reporter gene assays

HEK293T cells were plated at 4 � 104 cells/ml in 24-well plates andtransfected with plasmid DNA using Lipofectamine Plus (Invitrogen) intriplicate. Transfected cells were stimulated for 16–18 h with 100 ng/mlMDP or 10 ng/ml human TNF-�, lysed in 1� reporter lysis buffer (Pro-mega), and cell extracts were assayed for luciferase and �-galactosidaseactivity (26). The luciferase activity was normalized for transfection effi-ciency using �-galactosidase values.

Clathrin H chain gene knockdown

HEK293T cells were plated at 4 � 104 cells/ml in 24-well plates andtransfected with 500 ng per well of the indicated shRNA plasmid usingLipofectamine Plus (Invitrogen). After 48 h, cells were transfected withplasmid DNA for luciferase reporter gene assays and stimulated as de-scribed before.

Immunoblotting

For analysis of I�-B�, p38, JNK, and ERK phosphorylation, cells weretreated for 30 min with medium alone or with medium containing CPZ or

dynasore, and then stimulated with MDP (10 �g/ml) for the time indicatedin the figures. Immunoblotting was performed using phospho-specific Abs(Cell Signaling Technology) as described (8). For analysis of clathrin Hchain gene knockdown, HEK293T cells were plated in 6-well plates andwere transfected with 2 �g per well of control shRNA plasmid, shRNA-,or shRNA targeting the clathrin H chain. Forty-eight hours after transfec-tion, cell lysates were prepared and immunoblotted with anti-clathrin Hchain Ab or anti-�-actin Ab as a control (BD Biosciences).

Inhibitor treatments

In the different MDP uptake or MDP stimulation experiments, bafilo-mycin A was used at 10 nM (27), CPZ at 5–20 �M (27, 28), dimeth-ylamiloride at 500 �M (28), polyinosinic acid at 50 �g/ml (28), man-nans at 1 mg/ml (30), and dynasore was used at 80 �M (25). Cells werepretreated with each inhibitor for 30 min and then further incubatedwith the corresponding stimuli, in the presence of the inhibitor, for thetime indicated in figure legends. Dynasore experiments were performedin media without serum.

Cytotoxicity assay

The percentage of macrophage death was determined by measurement ofthe release of LDH after incubation with the CytoTox 96 nonradioactivecytotoxicity assay (Promega). The absorbance at 490 nm was measured,and the percentage of cell death was calculated as follows: [(experimentalrelease � spontaneous release)/(maximum release-spontaneous release)] �100, where “spontaneous release” is that found in untreated macrophagesand “maximum release” is the value obtained after lysis of macrophageswith a solution of 0.1% Triton X-100.

Flow cytometry

Macrophages were plated at 5 � 105 cells/well and treated with mediumalone or medium containing the indicated inhibitors for 30 min, and thenincubated for 1 h with MDP-Alexa 488 (20 �g/ml) or with LDL-BODIPY(1 �g/ml). Cells were fixed and analyzed using a FACSCalibur cytometer(BD Biosciences) at the University of Michigan Flow Cytometry CoreFacility.

Fluorescence microscopy

For MDP-labeled uptake experiments, cultured macrophages were incu-bated with medium alone or medium containing CPZ or polyinosinic acidfor 30 min, and consequently incubated with MDP-rhodamine (20 �g/ml)for 3 h. In all experiments, nuclei were stained with nucleic acid dye 4�,6�-diamino-2-phenylindole (DAPI; Molecular Probes) and the cells were fixedwith 2.5% paraformaldehyde. Samples were imaged using an OlympusFluoview-500 Confocal laser scanning microscope at the University ofMichigan Microscopy and Image Analysis Facility.

Statistical analysis

Statistical significance between groups was determined by two-tailed Stu-dent’s t test. Differences were considered significant when p � 0.05.

ResultsThe PepT1 transporter is dispensable for intracellularinternalization of fluorescent-labeled MDP and MDP-inducedsignaling in mouse macrophages

It has been reported that the plasma membrane transporter PepT1can translocate MDP into the cytosol of epithelial cells (17, 18).PepT1 is expressed primarily at the apical membrane of intestinalepithelial cells, but its expression is also detected in human mono-cytes (20). To determine the requirement of PepT1 for MDP up-take and signaling, we used macrophages from genetically modi-fied mice in which PepT1 has been disrupted by homologousrecombination. In WT mice, PepT1 was expressed in bone mar-row-derived macrophages, although at lower levels than in thesmall intestine (Fig. 1A). As expected, the expression of PepT1was undetectable in macrophages from PepT1-null mice (Fig. 1A).Three hours after incubation, rhodamine-labeled MDP was foundintracellularly in a punctate granular pattern in macrophages,which is in line with previous results (22). Notably, the intracel-lular localization of MDP was unimpaired in macrophages defi-cient in PepT1 (Fig. 1B). Furthermore, NF-�B activation as well as

4322 MDP INTERNALIZATION VIA CLATHRIN ENDOCYTIC PATHWAY

by guest on Novem

ber 18, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

phosphorylation of p38, JNK, and ERK in response to MDP wascomparable in WT and PepT1-null macrophages (Fig. 1C). Fi-nally, enhancement of LPS-induced IL-6 and TNF-� productionby MDP was unimpaired in PepT1 mutant macrophages (Fig. 1, Dand E). These results indicate that PepT1 is not required for intra-cellular internalization of MDP and MDP-induced signaling inmacrophages.

Uptake of fluorescent-labeled MDP is inhibited bychlorpromazine in mouse macrophages

To study the mechanism by which MDP is internalized, mac-rophages were pretreated with compounds that target severalprocesses of cellular entry followed by incubation with Alexa488-labeled MDP. We first assessed CPZ, a drug that disruptsclathrin-mediated endocytosis. Pilot studies showed that CPZat concentration of 5 �M or lower induced �10% toxicity inmouse macrophages when evaluated 3.5 h after addition of thedrug (Fig. 2A). Incubation of macrophages with 5 �M CPZinhibited MDP uptake by �50 – 60% as assessed by flow cyto-

metric analysis (Fig. 2B). In contrast, incubation with dimeth-ylamiloride, an inhibitor of pinocytosis, or polyinosinic acid ormannan, specific inhibitors of scavenger receptors or entry viamannose receptors, respectively, did not affect MDP uptake(Fig. 2B). The inhibition of MDP uptake by CPZ was similar tothat of fluorescent LDL, a molecule known to be internalized byclathrin-mediated endocytosis (Fig. 2C). Importantly, incuba-tion of macrophages with MDP induced NF-�B and MAPKactivation as determined by immunoblotting with Abs recog-nizing phosphorylated forms of I�B� and Erk, and this responsewas attenuated in macrophages pretreated with 5 �M CPZ (Fig.2D). Consistently, intracellular localization of MDP-rhodaminewas inhibited in macrophages treated with CPZ, but not withpolyinosinic acid (Fig. 2E). These studies suggest that MDPuptake is regulated by a clathrin-dependent endocytosis path-way and inhibition of this pathway attenuates signaling inducedby MDP in macrophages.

FIGURE 1. PepT1 is not required for fluorescent-labeled MDP uptakeor MDP-induced signaling in mouse macrophages. A, Expression of PepT1mRNA isolated from bone marrow-derived macrophages (Mac) from WTand PepT1 KO mice by real-time PCR. Results were normalized toGAPDH levels. Expression of PepT1 in small intestine (SI) of WT mouseis shown for comparison. B, Macrophages derived from WT and PepT1KO mice were incubated for 3 h with MDP-rhodamine (20 �g/ml, red), thenuclei were counterstained with DAPI (blue), and cells were fixed andimaged by confocal microscopy. Arrows indicate intracellular MDP-rho-damine. C, Macrophages from WT and PepT1 KO were stimulated withMDP (10 �g/ml) for the indicated periods. Cell lysates were prepared andblotted with indicated Abs. Results are from one representative experimentof three independent experiments. p, phosphorylated. D and E, Macro-phages from WT and PepT1 KO mice were stimulated with the indicatedamount of LPS (ng/ml) in the absence or presence of MDP (10 �g/ml). Cellsupernatants were collected 24 h after stimulation, and IL-6 and TNF-�were measured by ELISA. Results are presented as the mean of triplicatewells � SD and correspond to one representative experiment of two in-dependent experiments.

FIGURE 2. Effect of inhibitors of different cellular uptake pathwayson the internalization of fluorescent-labeled MDP by mouse macro-phages. A, Bone marrow-derived macrophages were treated with theindicated doses of CPZ for 3.5 h and the induction of cell death wasevaluated by LDH release. Values represent means � SD of triplicatecultures. B, Percentage of MDP-labeled macrophages after incubationfor 15 min with medium alone (�), medium containing MDP-Alexa 488alone (untreated, Unt.), or in the presence of CPZ (5 �M), dimethyl-amiloride (DMA), polyinosinic acid (Poly I), or mannans from S. cer-evesiae (Mannans). Results are representative of two experiments. C,Bone marrow-derived macrophages were pretreated or not with CPZ (5�M) for 30 min and then incubated with MDP-Alexa 488 or LDL-BODIPY for 60 min. The uptake was analyzed by FACS and plotted aspercentage of uptake inhibition of the untreated cells. Results are pre-sented as the mean of triplicate wells � SD. Results are representativeof two experiments. D, Bone marrow-derived macrophages were pre-treated or not with CPZ (5 �M) and stimulated with MDP (10 �g/ml)for the indicated periods of time. Cell lysates were prepared and blottedwith indicated Abs. Results are from one representative experiment ofthree independent experiments. p, phosphorylated. E, Fluorescence con-focal images of mouse macrophages incubated for 3 h with MDP-rho-damine (red), alone or in the presence of CPZ or Poly I. In all cases, thenuclei were counterstained with DAPI (blue), and cells were fixed andimaged by fluorescence confocal microscopy. Arrows indicate intracel-lular MDP-rhodamine. �, p � 0.05 between untreated and CPZ-treatedcultures. Results are representative of three experiments.

4323The Journal of Immunology

by guest on Novem

ber 18, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

Clathrin-dependent endocytosis pathway regulatesMDP-induced responses in HEK293 epithelial cells

We next tested if CPZ affects NF-�B activation in HEK293cells, an epithelial cell line that responds to MDP stimulationwhen NOD2 is ectopically expressed (31). Expression ofNOD2, but not control plasmid, induced NF-�B activation byMDP in HEK293 cells as measured by reporter luciferase assay(Fig. 3A). Treatment with CPZ, but not with mannan or polyi-nosinic acid, inhibited MDP-induced NF-�B activation (Fig.3A). The effect of CPZ was specific in that NF-�B activationinduced by TNF-� was unimpaired in CPZ-treated HEK293cells when compared with that induced with MDP (Fig. 3B). Tofurther assess the role of clathrin-dependent endocytosis inMDP-induced signaling, HEK293 cells were transfected withtwo shRNA constructs that target the clathrin H chain gene orcontrol the shRNA construct. Immunoblotting analysis revealeddown-regulation of clathrin H chain levels by the two differentshRNAs when compared with the control shRNA construct(Fig. 3C). Functional assays revealed that both shRNAs againstthe clathrin H chain gene attenuated MDP-induced NF-�B ac-tivation, but they were ineffective in inhibiting that induced byTNF-� stimulation (Fig. 3, D and E). These results suggest thata clathrin-dependent endocytosis pathway regulates MDP-in-duced signaling in HEK293 cells.

Dynasore inhibits MDP uptake and MDP-induced caspase-1activation

Dynamin proteins are GTPases that are essential for budding ofclathrin vesicles from the plasma membrane (32). To furtherassess the role of dynamin in MDP internalization and signal-ing, macrophages were treated with dynasore, a cell-permeableinhibitor of dynamin (25). Intracellular uptake of rhodamine-labeled MDP was inhibited by pretreatment of macrophageswith dynasore (Fig. 4A). Macrophage cell death after incubationfor 8 h with dynasore at 80 �M in serum-free medium was �5%and increased to �25% by 24 h of incubation (Fig. 4B). Nota-bly, stimulation of human monocytes with MDP induced IL-1�secretion, which was abrogated by treatment with dynasore(Fig. 4C). Furthermore, in mouse macrophages dynasore inhib-ited caspase-1 activation induced by MDP and ATP (Fig. 4D).These results suggest that MDP is internalized by a dynamin-dependent endocytosis pathway, which is critical for MDP-in-duced caspase-1 activation and IL-1� secretion.

Functional dynamin is required for MDP-induced signaling

We next investigated whether MDP internalization and signalingwas dependent on dynamin using a construct that expressesdominant-negative dynamin II (K44A) (33). HEK293 cells werecotransfected with NOD2 or control plasmid in the presence orabsence of the dynamin (K44A) mutant construct. Stimulation of

FIGURE 3. Clathrin-mediated endocytosis regulates MDP-inducedNOD2-dependent NF-�B activation in HEK293T cells. A, HEK293T cellswere transiently transfected with a NF-�B luciferase reporter plasmidalong with a control �-galactosidase plasmid (control), and NOD2 expres-sion plasmid when indicated (NOD2), in triplicate. The cells were treatedwith medium alone or with medium containing 100 ng/ml MDP for 16 h,in the absence (untreated) or presence of mannans, polyinosinic acid (PolyI), or CPZ. Luciferase and �-galactosidase activity was measured in celllysates and values were normalized for transfection efficiency (nRLU). B,Luciferase reporter gene assays were performed as in A. Transfected cellswere treated with media alone (unst.) or with media containing either 100ng/ml MDP or 10 ng/ml human TNF-� for 16 h, alone (untreated) or in thepresence of CPZ. Results are presented as the mean of triplicate wells �SD and correspond to one representative experiment of three independentexperiments. �, p � 0.01 between untreated and CPZ-treated samples(Nod2 � MDP). C, HEK293T cells were transfected with a control plas-mid (shRNA�) or two shRNA plasmids targeting the clathrin H chain gene(CHC) (shRNA1 and shRNA2). Cell lysates were prepared and blottedwith indicated Abs. D and E, HEK293T cells were transiently transfectedwith a control plasmid (shRNA�) or with shRNA plasmids (shRNA1 andshRNA2). Luciferase reporter gene assays were performed as in A. Resultsare presented as the mean of triplicate wells � SD and correspond to onerepresentative experiment of three independent experiments. �, p � 0.05between control shRNA� plasmid and shRNA1 or shRNA2 constructs inMDP-stimulated cultures.

FIGURE 4. Dynasore impairs MDP uptake and caspase-1 activation.A, Fluorescence confocal images of mouse macrophages incubated for3 h with MDP-rhodamine (red), alone or in the presence of dynasore. Inall cases, the nuclei were counterstained with DAPI (blue), and cellswere fixed and imaged by fluorescence confocal microscopy. Arrowsdenote intracellular MDP-rhodamine. B, Bone marrow-derived macro-phages were treated with dynasore for the indicated time, and the in-duction of cell death was evaluated by the release of LDH. Valuesrepresent means � SD of triplicate cultures. C, Human monocytes werestimulated with 1 �g/ml MDP, in the absence (MDP) or in the presenceof dynasore (MDP � Dynasore) for 16 h, and the levels of IL-1� weremeasured in cell supernatants. Results are presented as the mean oftriplicate wells � SD and correspond to one representative experimentof three independent experiments. �, p � 0.05 for differences in thecytokines levels between untreated cells or dynasore-treated cells. D,Bone marrow-derived macrophages were pretreated or not with dyna-sore and stimulated with MDP, ATP, or MDP plus ATP. Extracts wereprepared from cell and culture supernatants and immunoblotted withcaspase-1 Ab. Arrows denote procaspase-1 (procasp-1) and its pro-cessed p20 subunit. Results are representative of three independentexperiment.

4324 MDP INTERNALIZATION VIA CLATHRIN ENDOCYTIC PATHWAY

by guest on Novem

ber 18, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

the cells with MDP induced NF-�B activation in a NOD2-depen-dent manner, which was greatly inhibited by the dominantinterfering dynamin construct, but little or not at all by the controlplasmid (Fig. 5A). In contrast, expression of dynamin (K44A) didnot affect NF-�B activation induced by TNF-� when comparedwith that observed with control plasmid (Fig. 5B). Importantly,ERK and I�B� phosporylation induced by MDP in mouse mac-rophages was impaired by treatment with dynasore (Fig. 5C). Inline with these results, secretion of IL-6 and TNF-� by mousemacrophages or IL-8 by human monocytes in response to MDPwas reduced in cells treated with dynasore (Fig. 5D–F). Similaruptake of labeled MDP was observed in mouse macrophages andhuman monocytes as determined by flow cytometric analysis (datanot shown). These results suggest that the a dynamin-dependentendocytosis pathway is critical for MDP-induced NOD2-depen-dent activation and cytokine responses.

Vacuolar maturation is important for MDP-induced signaling inmacrophages

Rhodamine-labeled MDP is first internalized into small intracel-lular structures that coalesce into larger acidified vesicles (22). Totest whether vacuolar maturation is important for MDP-inducedsignaling, macrophages were treated with bafilomycin A, a specificinhibitor of the vacuolar ATPase proton pump (34). Bafilomycin Ainhibits vacuolar acidification and blocks maturation of endosomalcompartments (35). Consistently, bafilomycin A did not inhibitearly MDP uptake but inhibited the subsequent localization of

MDP in large vesicles (Fig. 6, A, B, and C) that were shown tocolocalize with markers of acidified endosomal vesicles (22). Im-portantly, secretion of IL-6 and TNF-� by mouse macrophages orIL-8 by human monocytes was inhibited by bafilomycin A (Fig.6D–F). These results suggest that vacuolar maturation and/or acid-ification is important for MDP-induced cytokine responses.

DiscussionRecent studies have provided critical insight into the signalingcomponents and regulatory steps that are induced upon NOD2 ac-tivation in response to MDP stimulation. However, the cellularevents that act upstream of NOD2 to induce MDP-mediated sig-naling have remained poorly understood. Stimulation of phago-cytic and epithelial cells with MDP can result in NF-�B andMAPK activation, although delivery of MDP to the cytosol bytransfection is thought to enhance MDP-induced signaling (3).These results suggest that both macrophages and epithelial cellspossess the machinery to internalize MDP. In this study, we haveidentified an endocytic pathway that mediates MDP uptake andinduces NOD2-dependent signaling. Studies with both pharmaco-logical inhibitors and RNAi interference revealed that MDP inter-nalization is mediated by a clathrin-dependent endocytosis path-way. This endocytosis pathway was also dependent on dynamin, aGTPase that is required for budding of the clathrin-coated pitsfrom the plasma membrane (32, 36). Clathrin-dependent endocy-tosis constitutes a major route for the uptake of nutrients, patho-gens, growth factors, and transmembrane proteins in mammalian

FIGURE 5. Functional dynamin is required for MDP-induced NOD2-mediated NF-�B activation. A and B, Luciferase reporter gene assays wereperformed as in Fig. 4. HEK293T cells transiently transfected in triplicatewith a NF-�B luciferase reporter plasmid, along with a �-galactosidasetransfection plasmid and a NOD2 expression plasmid (�), and togetherwith 50 or 200 ng of a plasmid producing dynamin (K44A), or with acontrol plasmid. The cells were treated with media alone (unst.) or mediacontaining 100 ng/ml MDP or 10 ng/ml human TNF-� for 16 h. Results arepresented as the mean of triplicate wells � SD and correspond to onerepresentative experiment of three independent experiments. �, p � 0.05between cells transfected with NOD2 plasmid and NOD2 plasmid plusdynamin (K44A) construct in MDP-stimulated cultures. C, Bone marrow-derived macrophages were pretreated or not with dynasore and stimulatedwith MDP (10 �g/ml) for the indicated periods of time. Cell lysates wereprepared and blotted with indicated Abs. p, phosphorylated. Results arefrom one representative experiment of three independent experiments. Dand E, Mouse macrophages were pretreated (or not) with dynasore and thenstimulated (or not) with 10 �g/ml MDP in the presence of 5 ng/ml LPS.Cells supernatants were collected 24 h after stimulation and IL-6 andTNF-� were measured by ELISA. F, Human monocytes were stimulatedwith 1 �g/ml MDP in the absence (MDP) or in the presence of dynasore(MDP � Dynasore) for 16 h and the levels of IL-8 were measured in cellsupernatants. Results are presented as the mean of triplicate wells � SDand correspond to one representative experiment of three independent ex-periments. �, p � 0.05 for cytokine levels between untreated cells or dy-nasore-treated cells.

FIGURE 6. Bafilomycin A blocks MDP-induced NF-�B activation inmouse macrophages and human monocytes. A, Percentage of MDP-labeledmacrophages after incubation for 15 min with media alone (�), mediacontaining MDP-Alexa 488 (untreated, Unt.) or MDP-Alexa 488 in thepresence of bafilomycin A (Baf. A). B, Fluorescence confocal images ofmouse macrophages incubated for 3 h with MDP-rhodamine (red), alone orin the presence of bafilomycin A. In all cases, the nuclei were counter-stained with DAPI (blue), and cells were fixed and imaged by fluorescenceconfocal microscopy. Notice the difference in size of intracellular MDP-rhodamine structures between untreated and bafilomycin A-treated cells. C,Percentage of MDP-labeled cells that displayed granular coarse (large)pattern in the absence (MDP) or presence of bafilomycin A (MDP � Baf.A). The bars represent the mean of 15–20 optical sections � SD and arerepresentative of at least three different experiments. D and E, Mouse mac-rophages were stimulated with 5 ng/ml LPS alone (�) or together with 10�g/ml MDP in the absence (MDP) or presence of bafilomycin A (MDP �Baf. A). Cells supernatants were collected 24 h after stimulation and IL-6and TNF-� were measured by ELISA. F, Human monocytes were stim-ulated with 1 �g/ml MDP alone or in the presence of bafilomycin A(MDP � Baf. A) for 16 h and levels of IL-8 were measured in cellsupernatants. Results are presented as the mean of triplicate wells � SDand correspond to one representative experiment of three independentexperiments. �, p � 0.05 between MDP and MDP plus bafilomycinA-treated cells.

4325The Journal of Immunology

by guest on Novem

ber 18, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

cells (37–41). Similarly, LPS is endocytosed by an endocytic path-way that is dependent on clathrin and dynamin (42). The mecha-nism by which MDP is targeted to clathrin-coated pits for endo-cytosis remains unclear. Because endocytosis is typically mediatedthrough transmembrane proteins that are selectively recruited tocoated pits by interaction to clathrin adaptors, the findings suggestthat MDP might be recognized by a plasma membrane receptorthat mediates its delivery to clathrin-coated pits. Our initial studiesrevealed that MDP uptake is unimpaired by treatment with an in-hibitor of scavenger receptors or mannan, a molecule that interactswith the mannose receptor. These results appear to rule out thelatter receptors, although other surface receptors might be involvedin promoting MDP internalization. Many pathogens that expressNOD2 stimulatory activity are internalized into host cells by clath-rin-dependent endocytosis (41, 43). Thus, both MDP and bacteriaappear to utilize the same route to trigger NOD2 activation andsignaling. Further studies are needed to determine the mechanismwhereby extracellular MDP is targeted to the clathrin-dependentendocytosis pathway.

Recent studies have shown that MDP induces caspase-1 activa-tion through the Nlrp3 inflammasome, an event that requires ex-ogenous ATP to deliver MDP from acidified vesicles into the cy-tosol via the pannexin-1 pore (22). In contrast, other authors haveconcluded that MDP-mediated caspase-1 activation is induced byan inflammasome complex containing Nlrp1 and NOD2 (46). Re-gardless of the mechanism involved, our results indicate that MDPinternalization via dynamin-mediated endocytosis is required forcaspase-1 activation. Unlike the activation of caspase-1, NF-�Band MAPK activation induced by MDP is mediated solely viaNOD2 and does not require exogenous ATP (3, 22, 44). Theseresults suggest that after internalization via clathrin-dependent en-docytosis, MDP relies on different mechanisms to activate Nlrp3and NOD2. One possibility is that NOD2 activation by MDP ismediated via a surface receptor also present in endocytic vesiclesor by another mechanism independent of cytosolic recognition.Alternatively, after internalization in acidified vesicles, MDP mayleak or be actively transported into the cytosol where it is sensedby NOD2. Our results rule out the peptide transporter PepT1, al-though other transporter systems operating in endosomes/lyso-somes may be involved. Furthermore, the studies with bafilomycinA suggest that vacuolar acidification and/or maturation are impor-tant for MDP-induced cytokine responses. These results are in linewith recent findings showing that bafilomycin A blocks activationof NOD2 in macrophages infected with a Listeria mutant that can-not escape the phagolysosome (45). Consistent with our findings,localization of the Listeria mutant in the phagolysosome, whichleads to the degradation of the bacterial cell wall and release ofpeptidoglycan fragments, was required for NOD2-induced signal-ing (45). Further studies are needed to understand the mechanismby which MDP and peptidoglycan fragments derived from bacteriaactivate NOD2.

AcknowledgmentsThe authors are grateful to Joel Whitfield from the Cellular ImmunologyCore Facility of the University of Michigan Cancer Center for ELISAassays, Tom Kirchhausen for generous supply of dynasore, and Theo Rossfor plasmids.

DisclosuresThe authors have no financial conflicts of interest.

References1. Inohara, N., M. Chamaillard, C. McDonald, and G. Nunez. 2005. NOD-LRR

proteins: role in host-microbial interactions and inflammatory disease. Annu. Rev.Biochem. 74: 355–383.

2. Franchi, L., J. H. Park, M. H. Shaw, N. Marina-Garcia, G. Chen, Y. G. Kim, andG. Nunez. 2008. Intracellular NOD-like receptors in innate immunity, infectionand disease. Cell. Microbiol. 10: 1–8.

3. Inohara, N., Y. Ogura, A. Fontalba, O. Gutierrez, F. Pons, J. Crespo, K. Fukase,S. Inamura, S. Kusumoto, M. Hashimoto, et al. 2003. Host recognition of bac-terial muramyl dipeptide mediated through NOD2: implications for Crohn’s dis-ease. J. Biol. Chem. 278: 5509–5512.

4. Girardin, S. E., I. G. Boneca, J. Viala, M. Chamaillard, A. Labigne, G. Thomas,D. J. Philpott, and P. J. Sansonetti. 2003. NOD2 is a general sensor of pepti-doglycan through muramyl dipeptide (MDP) detection. J. Biol. Chem. 278:8869–8872.

5. Chin, A. I., P. W. Dempsey, K. Bruhn, J. F. Miller, Y. Xu, and G. Cheng. 2002.Involvement of receptor-interacting protein 2 in innate and adaptive immuneresponses. Nature 416: 190–194.

6. Kobayashi, K., N. Inohara, L. D. Hernandez, J. E. Galan, G. Nunez,C. A. Janeway, R. Medzhitov, and R. A. Flavell. 2002. RICK/Rip2/CARDIAKmediates signalling for receptors of the innate and adaptive immune systems.Nature 416: 194–199.

7. Abbott, D. W., A. Wilkins, J. M. Asara, and L. C. Cantley. 2004. The Crohn’sdisease protein, NOD2, requires RIP2 in order to induce ubiquitinylation of anovel site on NEMO. Curr. Biol. 14: 2217–2227.

8. Park, J. H., Y. G. Kim, C. McDonald, T. D. Kanneganti, M. Hasegawa,M. Body-Malapel, N. Inohara, and G. Nunez. 2007. RICK/RIP2 mediates innateimmune responses induced through Nod1 and Nod2 but not TLRs. J. Immunol.178: 2380–2386.

9. Kim, J. Y., E. Omori, K. Matsumoto, G. Nunez, and J. Ninomiya-Tsuji. 2008.TAK1 is a central mediator of NOD2 signaling in epidermal cells. J. Biol. Chem.283: 137–144.

10. Hasegawa, M., Y. Fujimoto, P. C. Lucas, H. Nakano, K. Fukase, G. Nunez, andN. Inohara. 2008. A critical role of RICK/RIP2 polyubiquitination in Nod-in-duced NF-�B activation. EMBO J. 27: 373–383.

11. Wang, C., L. Deng, M. Hong, G. R. Akkaraju, J. Inoue, and Z. J. Chen. 2001.TAK1 is a ubiquitin-dependent kinase of MKK and IKK. Nature 412: 346–351.

12. Hugot, J.-P., M. Chamaillard, H. Zouali, S. Lesage, J.-P. Cezard, J. Belaiche,S. Almer, C. Tysk, C. A. O’Morain, M. Gassull, et al. 2001. Association ofNOD2 leucine-rich repeat variants with susceptibility to Crohn’s disease. Nature411: 599–603.

13. Miceli-Richard, C., S. Lesage, M. Rybojad, A. M. Prieur, S. Manouvrier-Hanu,R. Hafner, M. Chamaillard, H. Zouali, G. Thomas, and J. P. Hugot. 2001.CARD15 mutations in Blau syndrome. Nat. Genet. 29: 19–20.

14. Ogura, Y., D. K. Bonen, N. Inohara, D. L. Nicolae, F. F. Chen, R. Ramos,H. Britton, T. Moran, R. Karaliuskas, R. H. Duerr, et al. 2001. A frameshiftmutation in NOD2 associated with susceptibility to Crohn’s disease. Nature 411:603–606.

15. Kanazawa, N., I. Okafuji, N. Kambe, R. Nishikomori, M. Nakata-Hizume,S. Nagai, A. Fuji, T. Yuasa, A. Manki, Y. Sakurai, et al. 2005. Early-onsetsarcoidosis and CARD15 mutations with constitutive nuclear factor-B activation:common genetic etiology with Blau syndrome. Blood 105: 1195–1197.

16. Tanabe, T., M. Chamaillard, Y. Ogura, L. Zhu, S. Qiu, J. Masumoto, P. Ghosh,A. Moran, M. M. Predergast, G. Tromp, et al. 2004. Regulatory regions andcritical residues of NOD2 involved in muramyl dipeptide recognition. EMBO J.23: 1587–1597.

17. Vavricka, S. R., M. W. Musch, J. E. Chang, Y. Nakagawa, K. Phanvijhitsiri,T. S. Waypa, D. Merlin, O. Schneewind, and E. B. Chang. 2004. hPepT1 trans-ports muramyl dipeptide, activating NF-�B and stimulating IL-8 secretion inhuman colonic Caco2/bbe cells. Gastroenterology 127: 1401–1409.

18. Ismair, M. G., S. R. Vavricka, G. A. Kullak-Ublick, M. Fried, D. Mengin-Lec-reulx, and S. E. Girardin. 2006. hPepT1 selectively transports muramyl dipeptidebut not Nod1-activating muramyl peptides. Can. J. Physiol. Pharmacol. 84:1313–1319.

19. Ogihara, H., H. Saito, B. C. Shin, T. Terado, S. Takenoshita, Y. Nagamachi,K. Inui, and K. Takata. 1996. Immuno-localization of H�/peptide cotransporterin rat digestive tract. Biochem. Biophys. Res. Commun. 220: 848–852.

20. Charrier, L., A. Driss, Y. Yan, V. Nduati, J. M. Klapproth, S. V. Sitaraman, andD. Merlin. 2006. hPepT1 mediates bacterial tripeptide fMLP uptake in humanmonocytes. Lab. Invest. 86: 490–503.

21. Hu, Y., D. E. Smith, K. Ma, D. Jappar, W. Thomas, and K. M. Hillgren. 2008.Targeted disruption of peptide transporter Pept1 gene in mice significantly re-duces dipeptide absorption in intestine. Mol. Pharmaceutics 5: 1122–1130.

22. Marina-Garcia, N., L. Franchi, Y. G. Kim, D. Miller, C. McDonald, G. J. Boons,and G. Nunez. 2008. Pannexin-1-mediated intracellular delivery of muramyldipeptide induces caspase-1 activation via cryopyrin/NLRP3 independently ofNOD2. J. Immunol. 180: 4050–4057.

23. Celada, A., P. W. Gray, E. Rinderknecht, and R. D. Schreiber. 1984. Evidence fora gamma-interferon receptor that regulates macrophage tumoricidal activity.J. Exp. Med. 160: 55–74.

24. Rubartelli, A., F. Cozzolino, M. Talio, and R. Sitia. 1990. A novel secretorypathway for interleukin-1 beta, a protein lacking a signal sequence. EMBO J. 9:1503–1510.

25. Macia, E., M. Ehrlich, R. Massol, E. Boucrot, C. Brunner, and T. Kirchhausen.2006. Dynasore, a cell-permeable inhibitor of dynamin. Dev. Cell. 10: 839–850.

26. Inohara, N., T. Koseki, J. Lin, L. del Peso, P. C. Lucas, F. F. Chen, Y. Ogura, andG. Nunez. 2000. An induced proximity model for NF-�B activation in the Nod1/RICK and RIP signaling pathways. J. Biol. Chem. 275: 27823–27831.

27. Long, G., X. Pan, R. Kormelink, and J. M. Vlak. 2006. Functional entry ofbaculovirus into insect and mammalian cells is dependent on clathrin-mediatedendocytosis. J. Virol. 80: 8830–8833.

4326 MDP INTERNALIZATION VIA CLATHRIN ENDOCYTIC PATHWAY

by guest on Novem

ber 18, 2018http://w

ww

.jimm

unol.org/D

ownloaded from

28. Inoue, Y., N. Tanaka, Y. Tanaka, S. Inoue, K. Morita, M. Zhuang, T. Hattori, andK. Sugamura. 2007. Clathrin-dependent entry of severe acute respiratory syn-drome coronavirus into target cells expressing ACE2 with the cytoplasmic taildeleted. J. Virol. 81: 8722–8729.

29. Burgdorf, S., A. Kautz, V. Bohnert, P. A. Knolle, and C. Kurts. 2007. Distinctpathways of antigen uptake and intracellular routing in CD4 and CD8 T cellactivation. Science 316: 612–616.

30. Mansour, M. K., L. S. Schlesinger, and S. M. Levitz. 2002. Optimal T cellresponses to Cryptococcus neoformans mannoprotein are dependent on recogni-tion of conjugated carbohydrates by mannose receptors. J. Immunol. 168:2872–2879.

31. McDonald, C., F. F. Chen, V. Ollendorff, Y. Ogura, S. Marchetto, P. Lecine,J. P. Borg, and G. Nunez. 2005. A role for Erbin in the regulation of NOD2-dependent NF-�B signaling. J. Biol. Chem. 280: 40301–40309.

32. Urrutia, R., J. R. Henley, T. Cook, and M. A. McNiven. 1997. The dynamins:redundant or distinct functions for an expanding family of related GTPases?Proc. Natl. Acad. Sci. USA 94: 377–384.

33. Damke, H., T. Baba, D. E. Warnock, and S. L. Schmid. 1994. Induction of mutantdynamin specifically blocks endocytic coated vesicle formation. J. Cell Biol. 127:915–934.

34. Bowman, E. J., A. Siebers, and K. Altendorf. 1988. Bafilomycins: a class ofinhibitors of membrane ATPases from microorganisms, animal cells, and plantcells. Proc. Natl. Acad. Sci. USA 85: 7972–7976.

35. Yoshimori, T., A. Yamamoto, Y. Moriyama, M. Futai, and Y. Tashiro. 1991.Bafilomycin A1, a specific inhibitor of vacuolar-type H�-ATPase, inhibits acid-ification and protein degradation in lysosomes of cultured cells. J. Biol. Chem.266: 17707–17712.

36. Ungewickell, E. J., and L. Hinrichsen. 2007. Endocytosis: clathrin-mediatedmembrane budding. Curr. Opin. Cell Biol. 19: 417–425.

37. Takei, K., and V. Haucke. 2001. Clathrin-mediated endocytosis: membrane fac-tors pull the trigger. Trends Cell Biol. 11: 385–391.

38. Roth, T. F., and K. R. Porter. 1964. Yolk protein uptake in the oocyte of themosquito Aedes aegypti L. J. Cell Biol. 20: 313–332.

39. Mellman, I. 1996. Endocytosis and molecular sorting. Annu. Rev. Cell. Dev. Biol.12: 575–625.

40. Hirst, J., and M. S. Robinson. 1998. Clathrin and adaptors. Biochim. Biophys.Acta 1404: 173–193.

41. Veiga, E., and P. Cossart. 2006. The role of clathrin-dependent endocytosis inbacterial internalization. Trends Cell Biol. 16: 499–504.

42. Husebye, H., O. Halaas, H. Stenmark, G. Tunheim, O. Sandanger, B. Bogen,A. Brech, E. Latz, and T. Espevik. 2006. Endocytic pathways regulate Toll-likereceptor 4 signaling and link innate and adaptive immunity. EMBO J. 25:683–692.

43. Veiga, E., J. A. Guttman, M. Bonazzi, E. Boucrot, A. Toledo-Arana, A. E. Lin,J. Enninga, J. Pizarro-Cerda, B. B. Finlay, T. Kirchhausen, and P. Cossart. 2007.Invasive and adherent bacterial pathogens co-Opt host clathrin for infection. CellHost Microbe 2: 340–351.

44. Kobayashi, K. S., M. Chamaillard, Y. Ogura, O. Henegariu, N. Inohara,G. Nunez, and R. A. Flavell. 2005. NOD2-dependent regulation of innate andadaptive immunity in the intestinal tract. Science 307: 731–734.

45. Herskovits, A. A., V. Auerbuch, and D. A. Portnoy. 2007. Bacterial ligandsgenerated in a phagosome are targets of the cytosolic innate immune system.PLoS Pathog. 3: e51.

46. Hsu, L. C., S. R. Ali, S. McGillivray, P. H. Tseng, S. Mariathasan, E. W. Humke,L. Eckmann, J. J. Powell, V. Nizet, V. M. Dixit, and M. Karin. 2008. A NOD2-NALP1 complex mediates caspase-1-dependent IL-1� secretion in response toBacillus anthracis infection and muramyl dipeptide. Proc. Natl. Acad. Sci. USA105: 7803.

4327The Journal of Immunology

by guest on Novem

ber 18, 2018http://w

ww

.jimm

unol.org/D

ownloaded from