Clathrin adaptor AP1B controls adenovirus infectivityof epithelial cellsFernando Diaza,b, Diego Gravottaa, Ami Deoraa, Ryan Schreinera, John Schogginsc, Erik Falck-Pedersenc,and Enrique Rodriguez-Boulana,b,d,1

aDyson Vision Research Institute, Department of Ophthalmology, dDepartment of Cell and Developmental Biology, bGraduate Program in Neuroscience,and cHearst Research Foundation, Department of Microbiology and Immunology, Weill Medical College of Cornell University, 1300 York Avenue,New York, NY 10065

Edited by Peter Palese, Mount Sinai School of Medicine, New York, NY, and approved May 12, 2009 (received for review November 5, 2008)

Adenoviruses invading the organism via normal digestive or re-spiratory routes require the Coxsackie-adenovirus receptor (CAR)to infect the epithelial barrier cells. Because CAR is a component oftight junctions and the basolateral membrane and is normallyexcluded from the apical membrane, most epithelia are resistant toadenoviruses. However, we discovered that a specialized epithe-lium, the retinal pigment epithelium (RPE), anomalously expressedCAR at the apical surface and was highly susceptible to adenovirusinfection. These properties of RPE cells correlated with the absenceof the epithelial-specific clathrin adaptor AP1B. Furthermore,knockdown of this basolateral sorting adaptor in adenovirus-resistant MDCK cells promoted apical localization of CAR andincreased dramatically Adenovirus infectivity. Targeting assaysshowed that AP1B is required for accurate basolateral recycling ofCAR after internalization. AP1B knock down MDCK cells missortedCAR from recycling endosomes to the apical surface. In summary,we have characterized the cellular machinery responsible fornormal sorting of an adenovirus receptor and illustrated howtissue-specific variations in such machinery result in drasticchanges in tissue-susceptibility to adenoviruses.

CAR � epithelia � infection � trafficking

To gain access to a target organism, pathogens must developadaptive mechanisms to overcome the formidable barrier

presented by polarized epithelia lining the digestive or respira-tory tracts [reviewed in (1–3)]. Coxsackie and adenovirusesinvading the organism via normal intestinal or respiratory routesuse Coxsackie-adenovirus receptor (CAR) as a primary receptor(4). Interestingly, CAR is a normal transmembrane proteincomponent of tight junctions (TJ) and basolateral membranes,but it is excluded from the apical surfaces of most epithelial cells(5). Cocksackie viruses gain access to CAR by triggering specificsignaling events that mediate the opening of TJ and facilitatepenetration (3, 6) but adenoviruses have no similar mechanismavailable and require mechanical disruption of target epithelialtissues for penetration (7) (2, 8). However, the retinal pigmentepithelium (RPE) in situ is highly susceptible to adenovirusesintroduced by subretinal injection (9, 10), and confluent RPEmonolayers in culture can be efficiently inoculated with adenovi-ruses added to the apical medium (11). What is the mechanisminvolved in this facile adenovirus infection of some native epithelia?

Polarized epithelial cells are characterized by an asymmetricdistribution of plasma membrane proteins into apical and ba-solateral domains, separated by the tight junction (TJ) fence(12–14). Their polarized surface organization results from in-tracellular sorting of their apical and basolateral plasma mem-brane (PM) proteins at 2 major intracellular compartments,trans Golgi network (TGN), and recycling endosomes (RE).Sorting is carried out by cellular machinery that recognizessorting signals present in apical and basolateral PM proteins thatmediates their incorporation into transport vesicles for deliveryto their respective residence domains at the cell surface (12, 13,15). Recently, it has become apparent that most basolateral

proteins require clathrin for accurate sorting (16) and previouswork has shown that the clathrin adaptor AP1B facilitates thesorting of proteins with tyrosine-based basolateral sorting motifs(17, 18). Additional work has shown that AP1B localizes to REand sorts basolateral proteins not only in their recycling route(19) but also in the biosynthetic route (20, 21), supporting theconcept that newly synthesized PM proteins may transit from theGolgi complex to the endosomal compartment before reachingthe cell surface [reviewed by (12, 22)].

Here, we systematically analyzed the mechanisms that facili-tate adenovirus infection of some native epithelia. Our resultsshow that lack of expression of the epithelial-specific clathrinadaptor AP1B in RPE correlates with high infectivity by adeno-viruses and demonstrate that knockdown of AP1B by siRNAdramatically enhances adenovirus infectivity of a non-susceptible epithelium. They also illustrate the molecular mech-anism responsible for such variation in infectivity. In epithelialcells that contain AP1B, CAR is routed directly from the TGNto the basolateral surface and is incorporated slowly to the TJafter several rounds of internalization and basolateral recyclingfrom the RE. Epithelial cells that lack AP1B also route newlysynthesized CAR to the basolateral surface but fail to recycleendocytosed CAR accurately to the basolateral domain. Instead,they transcytose CAR to the apical surface, resulting in increasedapical expression of this receptor and higher adenovirus infectivity.

ResultsRPE Displays Anomalously High Adenovirus Infectivity. To studyadenovirus infection of polarized epithelial cell lines, we usedreplication defective adenovirus serotype 5, in which sequencesencoding transcription factors E1A/E1B (required for transcrip-tion of all viral proteins) are replaced by sequences encodingGFP. Infective viruses were generated by complementation ofE1A/E1B in HEK-293 cells. In cells other than HEK-293 cells,inoculation with these viruses reproduces all aspects of adeno-virus infection with the exception of the production of capsidproteins and virus assembly. Inoculation of several differentpolarized epithelial cell lines grown on Transwell filters from theapical side, the most likely route used by the virus in vivo (7),resulted in dramatic differences in infection levels with adeno-virus serotype-5. Confluent monolayers of Caco-2 (human in-testinal epithelial cell line), Calu-3 (human respiratory epithelialcell line), and MDCK (dog kidney epithelial cell line) werepoorly infected. On the other hand, confluent monolayers ofhuman fetal RPE (primary cultures) and ARPE-19 (human RPE

Author contributions: F.D., D.G., A.D., and E.R.-B. designed research; F.D. and A.D. per-formed research; F.D., D.G., R.S., J.S., and E.F.-P. contributed new reagents/analytic tools;F.D., D.G., and E.R.-B. analyzed data; and F.D. and E.R.-B. wrote the paper.

The authors declare no conflict of interest.

This article is a PNAS Direct Submission.

1To whom correspondence should be addressed. E-mail: boulan@med.cornell.edu.

This article contains supporting information online at www.pnas.org/cgi/content/full/0811227106/DCSupplemental.

www.pnas.org�cgi�doi�10.1073�pnas.0811227106 PNAS � July 7, 2009 � vol. 106 � no. 27 � 11143–11148

CELL

BIO

LOG

Y

Dow

nloa

ded

by g

uest

on

Nov

embe

r 26

, 202

0

cell line) were infected at much higher levels (5–20 fold).Importantly, brief pretreatment of the monolayers with 2.5 mMEDTA before inoculation resulted in 5–20 fold higher infectionof Caco-2, Calu-3, and MDCK while only marginally increasedinfectivity of RPE cells (Fig. 1). These experiments are consis-tent with the known localization of CAR to TJ and the baso-lateral membrane and its absence from the apical membrane inmany epithelia (5, 23). They also suggest the hypothesis that thehigher infectivity of some native epithelia, that is, RPE, resultsfrom the presence of accessible adenovirus receptors at theapical membrane.

CAR Is Present at the Apical Surface of RPE. To test this hypothesis,we studied the localization of CAR in the various epithelial celllines used in Fig. 1. Exposure of both sides of intact monolayersgrown on filters to a monoclonal antibody against the ectodo-main of human CAR demonstrated the presence of endogenousCAR in the basolateral membrane of Caco-2 and Calu-3 cells,but no staining of TJ or of the apical surface (Fig. 2). In strikingcontrast, the human CAR antibody labeled both apical andbasolateral surfaces of intact human RPE cells. Upon fixationand permeabilization, CAR was also detected at the TJ of allepithelial cell types (Fig. S1). CAR expression in all these celllines was also confirmed by western blot (Fig. S2). Theseexperiments supported our working hypothesis, that is, that thehigher apical infectivity of RPE by adenoviruses might beexplained by immunoaccessible CAR at the apical surface.

Cells Expressing Apical CAR Lack the Clathrin-Adaptor AP1B. CARdisplays a typical tyrosine-based basolateral signal of the Yxx�type (where Y is tyrosine, x is any amino acid, and � is anyhydrophobic amino acid) (5). As this class of basolateralsorting signals is typically recognized by AP1B (see Introduc-tion), we therefore tested the hypothesis: Might the apicallocalization of CAR in RPE cells be explained by the absenceof AP1B in these cells?

The epithelial-specific adaptor AP1B shares with the ubiqui-tous AP1A 3 of its 4 subunits (�, �1, and �), but it differs fromAP1A in the possession of a different medium (�) subunit,�1B instead of �1A. Analysis of different epithelial cell linesby RT-PCR (Fig. 3A) and western blot (Fig. 3B) demonstratedthe presence of �1A in all of them; by contrast, only RPE cellslacked �1B.

Knockdown of AP1B in MDCK Cells Promotes Apical Infectivity withAdenoviruses. If lack of AP1B were indeed responsible for theapical localization of CAR in RPE cells, knockdown of AP1B in

Fig. 1. Adenovirus infection of polarized epithelial monolayers. Confluentmonolayers of epithelial cells, grown on TranswellR chambers, were inoculatedwith Adenovirus-5 (Ad5CiG), encoding GFP, added to the apical medium. Theinfection levels were quantified by measuring GFP fluorescence (see Experimen-tal Procedures). Caco-2 (human intestinal), Calu-3 (human respiratory), andMDCK (dog kidney) were poorly infected whereas human fetal RPE (primarycultures) and ARPE-19 (human RPE cell line) were efficiently infected. Pretreat-ment with EDTA before inoculation dramatically increased infection levels ofCaco-2, Calu-3, and MDCK but only marginally increased infection levels of RPEcells. The extent of viral transduction is cell-type dependent. (Scale bar, 20 �m.)Data are represented as mean � SD, n � 3.

Fig. 2. CAR is expressed apically in polarized RPE cells. Polarized monolayersof human epithelial cell lines Caco-2 and Calu-3, grown on TranswellR cham-bers, were fixed with paraformaldehyde and incubated in the presence ofanti-human CAR antibody (RmcB) added to both apical and basal media,overnight at 4 °C, washed, fixed, and exposed to fluorescent second antibodyadded to both sides. Note that Caco-2 and Calu-3 cells display CAR only on thebasolateral side whereas human fetal RPE and ARPE-19 cells display CAR inboth apical and basolateral surfaces. (Scale bar, 10 �m.)

Fig. 3. RPE cells lack clathrin adaptor AP1B. (A) RT-PCR and (B) western blotof �1A and �1B in various epithelial cell lines. Note absence of �1B in RPE cells.Calu-3 samples were run at a later time.

11144 � www.pnas.org�cgi�doi�10.1073�pnas.0811227106 Diaz et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 26

, 202

0

MDCK cells would result in increased expression of CAR at theapical surface. Staining of intact monolayers of MDCK cellsknocked down for AP1B (20) and overexpressing human CARdemonstrated the presence of this protein at both apical andbasolateral surfaces, whereas in control cells CAR was onlydetected at the basolateral surface (Fig. 4A). In agreement withthese findings, AP1B KD MDCK cells were approximately 15times more susceptible to adenoviruses from the apical surfacethan wild-type MDCK cells (Fig. 4 B and C). The same pheno-type was observed in a �1B knockdown clonal cell line derivedfrom the Fischer rat thyroid (FRT) epithelial cell line (21).Permanent expression of human �1B (resistant to the shRNAtargeting the canine sequence) into �1B KD MDCK cells (Fig.S3) restored the basolateral expression of CAR (Fig. 4A) and thelow apical infectivity by adenoviruses (Fig. 4 B and C).

Although to date we have not succeeded in reconstitutingAP1B into RPE cells due to technical difficulties in permanentlytransfecting these cells, our experiments with MDCK cellssupport our hypothesis that lack of AP1B in RPE cells promotesapical expression of CAR and increased apical infectivity withadenoviruses.

As an additional control for these experiments, we studied theinfectivity of wild-type and AP1B-KD MDCK cells byAd5F7CiG, a serotype-5 adenovirus bearing a subgroup Bserotype-7 fiber protein (24), modified to express chloramphen-icol acetyl transferase and GFP. Viruses from this subgroup have

been reported to use CD46 as a primary receptor instead of CAR(25). CD46 localizes to the basolateral surface of MDCK cellseven after mutation of a putative tyrosine signal (26, 27),suggesting that this protein would not be affected by the absenceof AP1B. Indeed, Ad5F7CiG did inefficiently infect control or�1B-knockdown MDCK cells from the apical side (Fig. S4).Only after TJ disruption by EDTA treatment was this virus ableto transduce MDCK monolayers, in agreement with the baso-lateral localization of CD46. These data support our hypothesisthat in the absence of AP1B, the depolarization of CAR, and nota non-specific event, indeed promotes the higher infectivity ofAd5 from the apical side in AP1B-knockdown MDCK cells.

Delivery of Newly Synthesized CAR to the Basolateral Membrane IsIndependent of AP1B. Clathrin adaptors have characteristic sub-cellular distributions that determine the sorting processes inwhich they participate (28). They are found in 2 varieties,tetrameric (AP1, AP2, AP3, and AP4) and monomeric (GGAs).AP2 localizes at the plasma membrane, where it cooperates withclathrin and other accessory proteins in the endocytosis of avariety of receptors, whereas AP1, AP3, AP4, and GGAslocalize to intracellular organelles, the example, the Golgi com-plex and recycling endosomes (RE), where they participate ininter-organellar trafficking. AP1B localizes to RE and partici-pates in the sorting of basolateral proteins such as transferrinreceptor (TfR) and VSV-G protein at both biosynthetic andrecycling routes of recently polarized (�1 day confluent) MDCKcells. However, in MDCK monolayers polarized for over 4days, biosynthetic delivery of newly synthesized TfR to thebasolateral membrane was independent of AP1B, suggestingthat an adaptor other than AP1B was involved in this route andthat AP1B controlled the polarity of TfR at the level of therecycling route (19–21).

How does AP1B control the basolateral sorting of CAR? Doesit control its biosynthetic delivery to the basolateral membraneor its accurate basolateral recycling after internalization? Toinvestigate the first possibility, we carried out a pulse-chaseanalysis of CAR-GFP in fully polarized cells using opticalmicroscopy (29) and biochemical surface-capture assays thatmeasure the time course of delivery of PM proteins in thebiosynthetic route (12, 13, 15). Using these assays, we observedthat both control MDCK cells and AP1B-knockdown MDCKcells sorted newly synthesized CAR-GFP with normal kinetics tothe basolateral membrane, suggesting that CAR reaches the PMvia an AP1B-independent route. However, after several addi-tional hours of chase, AP1B-knockdown cells missorted CAR tothe apical surface (Fig. 5A and B), suggesting that AP1B sortsCAR post-endocytically, in the recycling route of this receptorto the basolateral PM.

CAR Undergoes Several Rounds of Endocytosis Before Incorporationto TJ and Transcytoses to the Apical Surface of AP1B-DeficientEpithelia. If CAR requires AP1B to accurately recycle to thebasolateral surface, knocking-down of AP1B should result inaberrant transcytosis of endocytosed CAR to the apical surface.To investigate this hypothesis, we developed antibody-bindingassays for CAR endocytosis and transcytosis (see ExperimentalProcedures).

The endocytosis assay (Fig. 6A) indicated that MDCK cellsinternalized CAR efficiently with an approximate half-life of 20min and that lack of AP1B did not interfere with this mechanism.By contrast, we observed a dramatic transcytosis of CAR inAP1B-knockdown MDCK cells, at the rate of 10% of the amountpresent at the basolateral surface per hour, which was notobserved in wild type MDCK cells (Fig. 6B). These experimentsindicate that AP1B is involved in normal basolateral recycling ofCAR from RE to the basolateral membrane and that its absence

Fig. 4. Apical CAR localization and high adenovirus infectivity of AP1B-KDMDCK cells. (A) Wild-type (WT) MDCK cells, AP1B knockdown (�1B KD) MDCKcells ,and �1B-KD MDCK cells expressing human �1B-HA were fixed andanalyzed for surface expression of overexpressed human CAR by immunoflu-orescence, exactly as in Fig. 2. Note that CAR is basolateral in WT MDCK cells,non-polar in �1B KD MDCK cells, and basolateral in �1B KD/human �1B-HAMDCK cells. (B and C) AP1B knock-down MDCK cells show higher susceptibilityto apical adenovirus infection than WT MDCK cells and �1B KD/�1B-HA MDCKcells. (Scale bar, 10 �m.) Data are represented as mean � SD, n � 6.

Diaz et al. PNAS � July 7, 2009 � vol. 106 � no. 27 � 11145

CELL

BIO

LOG

Y

Dow

nloa

ded

by g

uest

on

Nov

embe

r 26

, 202

0

promotes incorporation of CAR at RE into a transcytotic routeto the apical membrane.

Additional AP2 knockdown experiments demonstrated the in-volvement of AP2 in basolateral internalization of CAR (Fig. 6C).

DiscussionHere, we focused on elucidating the mechanism underlying thevery facile infection of certain epithelia by adenoviruses. Screen-ing of various epithelial cell types demonstrated that RPE wasmuch more susceptible to infection by adenoviruses serotype 5than respiratory, kidney, or intestinal epithelia. Analysis of thelocalization of CAR by immunofluorescence showed that RPEanomalously localized CAR to the apical surface. Additionalstudies demonstrated that RPE cells do not express the clathrinadaptor AP1B and that MDCK cells knocked-down of APIB bysiRNA (20) also localized CAR to the apical surface. Theseexperiments conclusively established that lack of AP1B confers

epithelial cells with high infectivity to adenoviruses due toanomalous apical localization of CAR.

To further understand how AP1B contributes to the morefrequently observed basolateral and TJ localization of CAR, wecarried out a careful analysis of its biosynthetic and recyclingroutes. Surprisingly, since our previous work has shown thatAP1B participates in the biosynthetic route of VSV-G protein,

Fig. 5. Newly synthesized CAR is delivered preferentially to basolateral PM.(A) CAR-GFP delivery to PM. Confluent monolayers of WT and �1B-KD MDCKcells were microinjected with cDNA encoding human CAR-GFP, incubated at37 °C for 1 h to express the protein, then at 20 °C to allow accumulation ofCAR-GFP at the TGN, and chased at 37 °C for different times. Fixed monolayerswere imaged with a laser scanning confocal microscope (LSCM). Note baso-lateral delivery of CAR-GFP in both WT and �1B-KD MDCK cells in the firsthours of trafficking. At late chase time points, some loss of polarity of CAR-GFPis observed in �1B-KD MDCK cells. (Scale bar, 10 �m.) (B) Domain selectivebiotinylation and surface capture of CAR. Confluent monolayers of WT and�1B-KD MDCK cells overexpressing human CAR-GFP were pulsed with 35Smethionine/cysteine, chased for different times, and the percentage of CARarriving to apical or basolateral domains retrieved by domain selective bioti-nylation and streptavidin precipitation. Note that CAR is delivered preferen-tially to the basolateral membrane in both WT and �1B-KD MDCK cells, but itprogressively loses polarity at late chase points in �1B-KD MDCK cells. Data arerepresented as mean � SD, n � 3.

Fig. 6. AP1B-KD MDCK cells transcytose CAR to the apical PM. (A) CARendocytosis. An antibody-based assay was used to quantify CAR endocytosis insubconfluent WT and AP1B-KD MDCK cells permanently expressing humanCAR. Cells were exposed to CAR monoclonal antibody for 2 h at 0 °C, chasedfor 30, 60, or 120 min at 37 °C, fixed with 4% paraformaldehyde and stainedwith Cy5-donkey anti-mouse secondary antibody. After a second fixation with4% paraformaldehyde, the cells were permeabilized with 0.1% Triton X-100and stained with Cy3-donkey anti-mouse antibodies. Green Cy5 fluorescencerepresents surface CAR whereas red Cy3 fluorescence represents internalizedCAR. Results were quantified using a Nikon widefield microscope and plottedin bottom graph. The x-y fluorescence images shown below were obtainedwith a Leica SP2 scanning confocal microscope. Note that CAR endocytosisproceeds at the same rate in control and AP1B KD MDCK cells. (Scale bar, 10�m.) (B) CAR transcytosis. Fully polarized (4 days confluent) monolayers of WTand AP1B-KD MDCK cells expressing human CAR and grown on polycarbonatefilters were exposed to M�CAR antibody on the basal side (2 h, 0 °C), chasedat 37 °C with rabbit anti mouse (R�M) antibodies on the apical side fordifferent times, fixed, stained with IRDye800-G�R antibody and infra-redscanned with OdysseyR. After a wash, second fix, permeabilization with 0.1%saponin, R�M staining and IRDye800-G�R, cells were again infrared scanned.Results are plotted in the bottom graph. Note that CAR is transcytosed at therate of 10% per hour by AP1B KD MDCK but not by WT MDCK cells. Thefluorescence image below is a confocal image of parallel samples decoratedwith G��-Alexa488 (green) and G�R-Alexa555 (red) using a similar protocolto observe transcytosis at the microscope level. Green fluorescence representsbasolateral CAR whereas red fluorescence represents CAR transcytosed to theapical membrane. (Scale bar, 10 �m.) (C) AP2 depletion in fully polarizedMDCK-WT by siRNA decreases CAR internalization from the basolateral mem-brane. In all panels, data are represented as mean � SD, n � 3.

11146 � www.pnas.org�cgi�doi�10.1073�pnas.0811227106 Diaz et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 26

, 202

0

which like CAR exhibits a tyrosine-based (Yxx�) basolateralsignal (20), AP1B knockdown did not affect the basolateraldelivery of newly synthesized CAR from the TGN but, instead,interfered with the accurate post-endocytic recycling of CAR tothe basolateral membrane and promoted missorting of CAR tothe apical membrane. AP2 knockdown strongly interfered withthis step. Taken together, our results demonstrated that CAR isnormally targeted in an AP1B-independent fashion from theTGN to the basolateral membrane, where it undergoes severalrounds of AP2-dependent endocytosis and accurate basolat-eral recycling mediated by AP1B (Fig. 7). Future work mustidentify the adaptor involved in basolateral sorting of newlysynthesized CAR.

The paradigm we introduce here to describe how lack of aclathrin adaptor confers epithelial susceptibility to adenovirusesmay help understand how other pathogens normally enterepithelial cells. CD155, the receptor for human poliovirus (30)and for animal � herpes viruses (31) is known to interact withAP1B in epithelial cells (32). Reoviruses, which causes gastro-intestinal and respiratory illnesses, initiate infection by bindingthe junction adhesion molecule (JAM) via their capsid protein�1 (33). Of note, RPE cells localize large pools of JAM to theirapical surface; furthermore, this localization is phenocopied byMDCK cells depleted of AP1B by siRNA. Lastly, RPE displaysrelatively high apical susceptibility to herpes simplex virus type1 infection compared with MDCK cells, which might be attrib-uted to the anomalous apical localization of 1 of several possiblereceptors used by this virus (34, 35).

In summary, our experiments provide a molecular explanationfor the resistance of most epithelial tissues and the anomaloussusceptibility of RPE to adenoviruses. They describe the com-plete route followed by a TJ protein and the involvement ofclathrin adaptors in this route. Further studies should explore indetail whether other transmembrane components of the TJ (e.g.,claudins, occludin,) use a similar route and, importantly, to whatextent AP1B controls epithelial invasion by other human patho-gens. Additionally, it is likely that other epithelia found to lackAP1B might show similar enhanced viral infectivity as RPE.

Experimental ProceduresAP1B Knockdown and Reconstitution. Generation of stable clones of MDCK �1Bknockdown was reported elsewhere (20). Briefly, a pair of custom-synthesizedsense and antisense oligonucleotides encoding the 19-mer �1B-targeted se-quence (1B-M16) were annealed and cloned into a pSuper. retro.puro vector(Oligoengine) following manufacturer’s instructions. The resulting vector,pSuper-1B-M16, was transfected into MDCK cells by electroporation (Amaxa).Puromycin-resistant clones were picked and further characterized by RT-PCRand western blot analysis. AP1B-KD cells were transfected with pCB6�1B-HA,encoding human �1B tagged with an HA epitope, and selected for 14 dayswith 1 mg/mL G418 in the presence of 2.5 �g/mL puromycin. Several clonesresistant to both puromycin and G418 were tested for expression of HA, andbasolateral expression of human transferrin receptor (overexpressed fromadenoviruses), as criteria for recovery of AP1B expression and function (20).Among these, clone 9 was selected for further studies on CAR localization andapical infectivity for adenoviruses.

For more details see SI Text.

Viral Infection. Inoculation of epithelial monolayers was carried out at amultiplicity of infection of 5,000 viral particles (in 400 �L) per cell (particles topfu ratio �100) in opti-MEM or in Ca/Mg-free Hank’s Balanced Salt Solution(HBSS) containing 2.5 mM EDTA at 37 °C, added only to the top chamber of thefilters. After viral transduction, cells were dissociated by trypsinization andcollected into Eppendorf tubes with 500 �L complete medium at 4 °C. Cellswere washed with cold HBSS and lysed with 250 �L RIPA (150 mM NaCl, 1%SDS, 1 mM EDTA, 025% sodium deoxycholate, 50 mM Tris-HCl, pH 7.4) buffercontaining protease inhibitors on ice for 1 h in the dark. Samples weretransferred to an opaque 96-well plate and read in a Gemini SoftMax platereader with filters set at 485/509 nm Ex/Em for GFP using uninfected cells asblank. Propidium iodide (PI) was then added, and filters were set at 535/617nm. GFP readings were normalized to PI values.

Plasmids and Transfections. pCDNA3.1 encoding the human isoform of CARwas kindly provided by Jeffrey M. Bergelson. A plasmid encoding a GFP-tagged form of CAR was generated as follows: human CAR was amplified withthe following primers (5�ATCTGGTACCATGGCGCTCCTGC3�/5�GATACGCGT-TACTATAGACCCATCCTTGC), changing the stop codon by the first 3 nucleo-tides of the MluI restriction site. The PCR product was purified, digested withKpnI and MluI and cloned into pCB7. The sequence encoding the spacer-GFPwas amplified with the following primers (5�ATGTAGCCGTCTCCCCGCCGAA-CAG3�/5�TAGTTCTAGATTACTTGTACAGCTCGTC3�) from the plasmid VSVG-sp-GFP (36). This PCR product was cloned between the MluI and XbaI sites of thepCB7CAR, thus tagging CAR with eGFP on the cytoplasmic side after a 23-amino acid spacer.

All transfections for transient expression of both full-length hCAR andhCAR-GFP were performed by electroporation of fully polarized monolayers,as previously described (37).

Targeting Assays.Optical Microscopy Assay. Both wild-type and AP1B-depletedMDCK cells were plated at confluency on glass-bottom dishes (Mattek P35G-1.0–14-C). After 3 days the cells were subjected to nuclear microninjectionwith 5 �g/mL CAR-GFP in microinjection buffer. Cells were allowed to expressthe protein for 1.5 h at 37 °C. Dishes were transferred to a 20 °C block to allowprotein accumulation at the TGN for 1 h. Cells were transferred to 32 °C in thepresence of 100 �g/mL cycloheximide for the chase. At each time point, cellswere fixed in PFA and processed for confocal microscopy.Biochemical Targeting Assay. MDCK cells stably expressing CAR-GFP, confluentfor 4.5 days on filters, were incubated with 5 mM butyrate (Sigma) for 12 hbefore experiments to boost CAR-GFP expression. Cells were then pulse-labeled for 20 min with 0.5 mCi/filter of 35SMet/Cys (NEG-072, Perkin-Elmer)and immediately chased at 37 °C in complete DMEM supplemented with 3mM cold methionine and cysteine. At each time point, cells were processedfor surface delivery as described elsewhere (20). For more information, seeSI Text.

Endocytosis Assay. The endocytosis assay used in AP1B-knockdown MDCK cellsis a modification of a previously published protocol (38). For more informa-tion, see SI Text.

AP2 was knocked-down in MDCK cells according to previous protocols (16).Monolayers of AP2-knockdown MDCK cells, fully polarized on filters for 3days, were incubated with anti-CAR antibody in 1% BSA OptiMEM in the basalchamber for 2 h at 0 °C, washed, and chased at 37 °C. At each time point, cellswere chilled on ice and fixed in 4% PFA at 0 °C for 10 min. Cy5-conjugatedsecondary antibodies were used to label the bound anti-CAR antibodies at the

Fig. 7. CAR trafficking in polarized epithelial cells. (A) Epithelial cells thatexpress AP1B efficiently target newly synthesized CAR to the basolateralmembrane via an unknown adaptor (1), internalize CAR via AP2 and likelyclathrin (white dots) into recycling endosomes (RE) (2) and recycle CAR accu-rately to the basolateral surface via AP1B/clathrin-mediated sorting (3). CAR isexcluded from the apical membrane of these cells and therefore adenovirusesor Cocksackie viruses require opening of TJ for efficient infection. (B) Epithe-lial cells lacking AP1B target newly synthesized CAR to the basolateral mem-brane (1), internalize CAR via AP2 into RE (2), but fail to accurately recycle CARto the basolateral surface (3) due to lack of AP1B. CAR is transcytosed to theapical PM by an unknown mechanism (4) where it is available for adenovirusinfection.

Diaz et al. PNAS � July 7, 2009 � vol. 106 � no. 27 � 11147

CELL

BIO

LOG

Y

Dow

nloa

ded

by g

uest

on

Nov

embe

r 26

, 202

0

surface and PI in 0.1% TX-100 was used as a counterstain. Samples werescanned in a Typhoon Trio with the appropriate filters for each fluorophore.Internalization was calculated as surface signal over PI.

Trancytosis Assay. A fluorescence based capture assay of secondary antibodyon the apical chamber was used to measure trancytosis of anti-CAR antibody

bound to basal membrane of fully polarized WT or AP1B-knockdown MDCKcells expressing hCAR. For more information, see SI Text.

ACKNOWLEDGMENTS. This work was supported by National Institutes ofHealth grants EY08538 and GM34107 to ERB, by the Dyson Foundation and bythe Research to Prevent Blindness Foundation.

1. Vogelmann R, Amieva MR, Falkow S, Nelson WJ (2004) Breaking into the epithelialapical-junctional complex–news from pathogen hackers. Curr Opin Cell Biol 16:86–93.

2. Amieva MR, et al. (2003) Disruption of the epithelial apical-junctional complex byHelicobacter pylori CagA. Science 300:1430–1434.

3. Coyne CB, Bergelson JM (2006) Virus-induced Abl and Fyn kinase signals permitcoxsackievirus entry through epithelial tight junctions. Cell 124:119–131.

4. Bergelson JM, et al. (1997) Isolation of a common receptor for Coxsackie B viruses andadenoviruses 2 and 5. Science 275:1320–1323.

5. Cohen CJ, Gaetz J, Ohman T, Bergelson JM (2001) Multiple regions within the coxsack-ievirus and adenovirus receptor cytoplasmic domain are required for basolateralsorting. J Biol Chem 276:25392–25398.

6. Diaz F, Rodriguez-Boulan E (2006) Open sesame! Coxsackieviruses conspire to trespassthe tight junctional gate. Dev Cell 10:151–152.

7. Walters RW, et al. (1999) Basolateral localization of fiber receptors limits adenovirusinfection from the apical surface of airway epithelia. J Biol Chem 274:10219–10226.

8. Stonebraker JR, et al. (2004) Glycocalyx restricts adenoviral vector access to apicalreceptors expressed on respiratory epithelium in vitro and in vivo: Role for tetheredmucins as barriers to lumenal infection. J Virol 78:13755–13768.

9. Bennett J, Wilson J, Sun D, Forbes B, Maguire A (1994) Adenovirus vector-mediated invivo gene transfer into adult murine retina. Invest Ophthalmol Vis Sci 35:2535–2542.

10. Marmorstein AD, et al. (1998) Apical polarity of N-CAM and EMMPRIN in retinalpigment epithelium resulting from suppression of basolateral signal recognition. J CellBiol 142:697–710.

11. Marmorstein AD, et al. (2000) Saturation of, and competition for entry into, the apicalsecretory pathway. Proc Natl Acad Sci USA 97:3248–3253.

12. Rodriguez-Boulan E, Kreitzer G, Musch A (2005) Organization of vesicular traffickingin epithelia. Nat Rev Mol Cell Biol 6:233–247.

13. Yeaman C, Grindstaff KK, Nelson WJ (1999) New perspectives on mechanisms involvedin generating epithelial cell polarity. Physiol Rev 79:73–98.

14. Cereijido M, Valdes J, Shoshani L, Contreras RG (1998) Role of tight junctions inestablishing and maintaining cell polarity. Annu Rev Physiol 60:161–177.

15. Mostov K, Su T, ter Beest M (2003) Polarized epithelial membrane traffic: Conservationand plasticity. Nat Cell Biol 5:287–293.

16. Deborde S, et al. (2008) Clathrin is a key regulator of basolateral polarity. Nature452:719–723.

17. Ohno H, et al. (1999) Mu1B, a novel adaptor medium chain expressed in polarizedepithelial cells. FEBS Lett 449:215–220.

18. Folsch H, Ohno H, Bonifacino JS, Mellman I (1999) A novel clathrin adaptor complexmediates basolateral targeting in polarized epithelial cells. Cell 99:189–198.

19. Gan Y, McGraw TE, Rodriguez-Boulan E (2002) The epithelial-specific adaptor AP1Bmediates post-endocytic recycling to the basolateral membrane. Nat Cell Biol 4:605–609.

20. Gravotta D, et al. (2007) AP1B sorts basolateral proteins in recycling and biosyntheticroutes of MDCK cells. Proc Natl Acad Sci USA 104:1564–1569.

21. Cancino J, et al. (2007) Antibody to AP1B adaptor blocks biosynthetic and recyclingroutes of basolateral proteins at recycling endosomes. Mol Biol Cell 18:4872–4884.

22. Ellis MA, Potter BA, Cresawn KO, Weisz OA (2006) Polarized biosynthetic traffic in renalepithelial cells: sorting, sorting, everywhere. Am J Physiol Renal Physiol 291:F707–713.

23. Cohen CJ, et al. (2001) The coxsackievirus and adenovirus receptor is a transmembranecomponent of the tight junction. Proc Natl Acad Sci USA 98:15191–15196.

24. Schoggins JW, Nociari M, Philpott N, Falck-Pedersen E (2005) Influence of fiber detar-geting on adenovirus-mediated innate and adaptive immune activation. J Virol79:11627–11637.

25. Segerman A, et al. (2003) Adenovirus type 11 uses CD46 as a cellular receptor. J Virol77:9183–9191.

26. Maisner A, Liszewski MK, Atkinson JP, Schwartz-Albiez R, Herrler G (1996) Two differ-ent cytoplasmic tails direct isoforms of the membrane cofactor protein (CD46) to thebasolateral surface of Madin-Darby canine kidney cells. J Biol Chem 271:18853–18858.

27. Maisner A, et al. (1997) Membrane cofactor protein (CD46) is a basolateral protein thatis not endocytosed. Importance of the tetrapeptide FTSL at the carboxyl terminus. J BiolChem 272:20793–20799.

28. Bonifacino JS, Lippincott-Schwartz J (2003) Coat proteins: Shaping membrane trans-port. Nat Rev Mol Cell Biol 4:409–414.

29. Kreitzer G, Marmorstein A, Okamoto P, Vallee R, Rodriguez-Boulan E (2000) Kinesinand dynamin are required for post-Golgi transport of a plasma-membrane protein. NatCell Biol 2:125–127.

30. Mendelsohn CL, Wimmer E, Racaniello VR (1989) Cellular receptor for poliovirus:Molecular cloning, nucleotide sequence, and expression of a new member of theimmunoglobulin superfamily. Cell 56:855–865.

31. Geraghty RJ, Krummenacher C, Cohen GH, Eisenberg RJ, Spear PG (1998) Entry ofalphaherpesviruses mediated by poliovirus receptor-related protein 1 and poliovirusreceptor. Science 280:1618–1620.

32. Ohka S, Ohno H, Tohyama K, Nomoto A (2001) Basolateral sorting of human poliovirusreceptor alpha involves an interaction with the mu1B subunit of the clathrin adaptorcomplex in polarized epithelial cells. Biochem Biophys Res Commun 287:941–948.

33. Barton ES, et al. (2001) Junction adhesion molecule is a receptor for reovirus. Cell104:441–451.

34. Topp KS, Rothman AL, Lavail JH (1997) Herpes virus infection of RPE and MDCK cells:polarity of infection. Exp Eye Res 64:343–354.

35. Schelhaas M, Jansen M, Haase I, Knebel-Morsdorf D (2003) Herpes simplex virus type 1exhibits a tropism for basal entry in polarized epithelial cells. J Gen Virol 84:2473–2484.

36. Keller P, Toomre D, Diaz E, White J, Simons K (2001) Multicolour imaging of post-Golgisorting and trafficking in live cells. Nat Cell Biol 3:140–149.

37. Deora AA, Diaz F, Schreiner R, Rodriguez-Boulan E (2007) Efficient electroporation ofDNA and protein into confluent and differentiated epithelial cells in culture. Traffic8:1304–1312.

38. Blot V, McGraw TE (2006) GLUT4 is internalized by a cholesterol-dependent nystatin-sensitive mechanism inhibited by insulin. EMBO J 25:5648–5658.

11148 � www.pnas.org�cgi�doi�10.1073�pnas.0811227106 Diaz et al.

Dow

nloa

ded

by g

uest

on

Nov

embe

r 26

, 202

0