CIP – Katalogizacija u publikaciji Narodna biblioteka Srbije, Beograd Udruženje mikrobiologa Srbije, Beograd. Knjiga radova (Elektronski izvor) – Proceedings / MICROBIOLOGIA BALKANICA 2011 - 7th BALKAN CONGRESS OF MICROBIOLOGY & 8th CONGRESS OF SERBIAN MICROBIOLOGISTS, 25-29. oktobar 2011; (organizator) Udruženje mikrobiologa Srbije, Udruženje medicinskih mikrobiolga Srbije; (urednici: Dragojlo Obradović, Lazar Ranin, Špiro Radulović) – Beograd 1 elektronski optički disk (CD-ROM); 12cm Sistemski zahtevi: Nisu navedeni. Nasl. sa naslovnog ekrana. – Radovi na engleskom jeziku.- Tekst latinica. – Tiraž – 600. Abstracts. – Registar ISBN 978-86-914897-0-01 Udruženje mikrobiologa Srbije, Beograd. KNJIGA RADOVA / PROCEEDINGS MICROBIOLOGIA BALKANICA 2011 - 7th BALKAN CONGRESS OF MICROBIOLOGY & 8th CONGRESS OF SERBIAN MICROBIOLOGISTS, 25-29. oktobar 2011 Izdaje / Published by: Udruženje mikrobiologa Srbije Nemanjina 6, 11 080 Beograd, Srbija, tel/fax: 011 2199 711, dobradovic@agrifaculty.bg.ac.rs Za izdavača / For Publisher: Dragojlo Obradović, predsednik Udruženja Urednici/Editors: Dragojlo Obradović Lazar Ranin Špiro Radulović

ISBN 978-86-914897-0-01

Kompjuterska obrada teksta / Computer Layout: Jelena Zovko Belić Tiraž / Circulation 600 primeraka / 600 copy Umnožavanje / Copying Megaphone d.o.o., Vladimira Rolovića 105, Beograd, Srbija

Sensitivity of Real-time PCR method for detection of

Erwinia amylovora in plant material

Milan Ivanović, Nemanja Kuzmanović, Katarina Gašić, Anđelka Ćalić, Aleksa Obradović University of Belgrade, Faculty of Agriculture

Introduction Gram-negative bacterium Erwinia amylovora is the causal agent of fire blight, one of the most destructive diseases of pome fruits. Presumptive diagnosis of the disease can be relatively simple when typical symptoms are evident. However, when the pathogen is present in low concentration no symptoms of diagnostic value are visible. In order to detect latent infection use of modern and sensitive methods is necessary. Nowadays, Real-time PCR is one of the available methods for detection of E. amylovora in symptomless plant material.

Aim

Sensitivity of Real-time PCR detection of E. amylovora in pear leaves was studied.

Material and methods

Pear leaves and twigs were crushed in the antioxidant maceration buffer and inoculated with a range of bacterial suspensions from 2,1×101 CFU/ml (sample No. 1) to 2,1×106 CFU/ml (sample No. 6). Bacterial DNA was extracted according to the procedure of Taylor et al. (2001) and Real-time PCR reaction targeting chromosomal DNA amsC gene according to Pirc et al. (2009). The ams region of the E.

amylovora chromosome is involved in synthesis of the capsular polysaccharide amylovoran, which is considered unique to E.

amylovora. Specific primers Ams116F, Ams189R and TaqMan Ams141T probe were used in the reaction for 74 base pair fragment amplification. Automatic baseline was used and threshold was set manually crossing exponential phase of control amplification curves.

Results In our study, the lowest concentration of bacteria detected by Real-time PCR was 2,1×102 CFU/ml. Number of cycles required for reaching the defined fluorescence value varied between the samples:

in sample No. 2 the fluorescence level was reached in 36th amplification cycle, whereas in sample 6 the same level was reached in 26th cycle. Fewer amplification cycles are needed when higher initial amount of bacterial DNA is present in the sample. In our laboratory, Real-time PCR has proven to be the most sensitive method for detection of E. amylovora in plant material. Real-time PCR was 10 times more sensitive than Nested PCR and 100 times more sensitive when compared to other conventional PCR procedures.

Conclusion High sensitivity of Real-time PCR is the most efficient method for the detection of the pathogen in plant tissue. Low pathogen concentration can be efficiently detected in less than 5 hours. In addition, inhibitors and plant DNA did not reduce the sensitivity of the reaction. In spite of the advantages, high cost of the equipment and reagents stands as a limiting factor for the wider introduction of this method in our laboratories.

Keywords Real-time PCR, sensitivity, Erwinia amylovora

This study was supported by the Serbian Ministry of Education and Science, through the Project III46008.

Sensitivity of Real-time PCR method for detection of

Erwinia amylovora in plant material

Ivanović Milan, Kuzmanović Nemanja, Gašić Katarina, Ćalić Anđelka, Obradović Aleksa

This work was supported by the Serbian Ministry of Education and Science, through the project III46008

Conclusion

Real-time PCR is the most efficient method for the detection of the pathogen in plant tissue. Low pathogen concentration can be efficiently

detected in less than 5 hours. In addition, inhibitors and plant DNA did not reduce the sensitivity of the reaction. Therefore, it could be recommended

for use when reliable detection of a low number of E. amylovora is needed or when diagnosis is difficult due to lack of symptoms and presence of the

pathogen under culturable level. However, in spite of the advantages, high cost of the equipment and reagents stands as a limiting factor for the

wider introduction of this method in our laboratories.

Introduction

Gram-negative bacterium Erwinia amylovora is the causal

agent of fire blight, one of the most destructive diseases of

pome fruits. Presumptive diagnosis of the disease can be

relatively simple when typical symptoms are evident (Picture

1). However, when the pathogen is present in low

concentration no symptoms of diagnostic value are visible. In

order to detect latent infection use of modern and sensitive

methods is necessary. Real-time PCR is one whose

application in plant pathology is increasing lately, especially

for detection of pathogens in symptomless material. Material and methods

In order to artificially inoculate plant material pear leaves and

twigs were crushed in the antioxidant maceration buffer and

inoculated with a range of bacterial suspensions from 2,1101

CFU/ml (sample No. 1) to 2,1106 CFU/ml (sample No. 6).

Bacterial DNA was extracted according to the procedure of Taylor

et al. (2001) and Real-time PCR reaction targeting chromosomal

DNA amsC gene according to Pirc et al. (2009). The ams region

of the E. amylovora chromosome is involved in synthesis of the

capsular polysaccharide amylovoran, which is considered unique

to E. amylovora. Specific primers Ams116F, Ams189R and

TaqMan Ams141T probe (Table 1) were used in the reaction for

74 base pair fragment amplification. Reaction volume of 20µl

contained, in final concentrations: 0,9µM primers, 0,2µM probe,

1TaqMan Fast Universal PCR Master Mix and 4µl of sample

DNA. The baseline was set automatically, and the fluorescence

threshold was set manually to intersect with the linear part of the

amplification curves of all Real-time PCR assays, resulting in the

final Ct value for each well.

Results

In our study, the lowest concentration of bacteria detected by Real-time

PCR was 2,1102 CFU/ml (Picture 3). Number of cycles required for

reaching the defined fluorescence value varied between the samples: in

sample No. 2 the fluorescence level was reached in 36th amplification cycle,

whereas in sample 6 the same level was reached in 26th cycle. Fewer

amplification cycles are needed when higher initial amount of bacterial DNA

is present in the sample. Comparative studies in our laboratory showed that

Real-time PCR is 10 times more sensitive than Nested PCR and 100 times

more sensitive when compared to the other conventional PCR procedures.

Picture 1. Erwinia amylovora. Twig and fruit necrosis, typical symptoms of fire blight on pear

and apple trees.

University of Belgrade, Faculty of Agriculture, Department of Plant Pathology, Belgrade, Serbia E-mail: aleksao@agrif.bg.ac.rs

Picture 2. 7500 Real-Time PCR System (Applied Biosystems, USA)

used for detection of E. amylovora

Ekstrakcija Taylor i sar. (2001)

Assay Name Sequence (5’-3’) Amplicon length

Ams (amsC gene) Ams116F TCCCACATACTGTGAATCATCCA 74 bp

Ams189R GGGTATTTGCGCTAATTTTATTCG

Ams141T FAM-CCAGAATCTGGCCCGCGTATACCG-BHQ1

Table 1. Primers and TaqMan probes used for Real-time PCR detection of E. amylovora

5

Sample 6

3 4

2

Th

Table 2. Sensitivity of Real-time PCR compared to conventional PCR for the detection of

E. amylovora in spiked samples

Concentration of

E. amylovora (CFU/ml)

PCR method

Real-time Conventional

Pirc et al. (2009) Llop et al. (2001) Taylor et al. (2001) Stöger et al. (2006)

106 + + + +

105 + + + +

104 + + + +

103 + + ̶ ̶

102 + ̶ ̶ ̶

101 ̶ ̶ ̶ ̶

2 min at 50 °C UNG activation step

10 min at 95 °C polymerase activation

40 cycles of

15 s at 95 °C DNA denaturation

1 min at 60 °C annealing and extension

Table 3. Reaction conditions used in this study for detection

of E. amylovora

Picture 3. Real-time PCR with Taqman probe and primers

Ams116F/Ams189R for detection and quantitative amplification of E.

amylovora DNA. Fluorescence signal is in relation to the amount of

template: sample 6 - 2,1106 CFU/ml, and four tenfold dilutions,

respectively (in curves from left to right); Th - cycle threshold.