Chronic streptococcosis in Nile tilapia, Oreochromis niloticus (L.), caused by Streptococcu s agalactiae

Short Communication

Chronic streptococcosis in Nile tilapia, Oreochromisniloticus (L.), caused by Streptococcus agalactiae

Y W Li1, L Liu1, P R Huang2, W Fang3, Z P Luo4, H L Peng3, Y X Wang3 and A X Li1

1 Key Laboratory for Aquatic Products Safety Department of the Ministry of Education/State Key Laboratory of

Biocontrol, School of Life Sciences, Sun Yat-sen University, Guangzhou, Guangdong, China

2 College of Veterinary Medicine, Hunan Agricultural University, Changsha, Hunan, China

3 Guangdong Provincial Aquatic Animal Epidemic Disease Prevention and Control Center, Guangzhou,

Guangdong, China

4 Aquaculture Technology Service Station of Zhuhai, Zhuhai, Guangdong, China

Keywords: identification, Nile tilapia, Streptococcusagalactiae.

Streptococcus agalactiae, a gram-positive bacteriumthat can infect a number of fish species, includingfreshwater and seawater species, has a seriousimpact on fish aquaculture (Baeck et al. 2006;Garcia et al. 2008; Olivares-Fuster et al. 2008;Mian et al. 2009; Ye et al. 2011; Amal et al.2012; Azad et al. 2012; Bowater et al. 2012;Chen et al. 2012). Tilapia is extremely susceptibleto infection by S. agalactiae (Garcia et al. 2008;Olivares-Fuster et al. 2008; Hernandez et al.2009; Mian et al. 2009; Ye et al. 2011; Chenet al. 2012).Tilapia is a commercially important fish species

cultured worldwide, 72% of which are raised inAsia, especially in China and Southeast Asia.China has become the major tilapia output coun-try, with annual production of about 1.2 milliontons (Ye et al. 2011). From 2009 to 2012, how-ever, a large-scale outbreak of disease, caused byS. agalactiae, occurred in cultured tilapia in south-ern China, particularly in farms in the

Guangdong, Guangxi, Hainan and Fujian prov-inces, with high levels of infectivity and mortalitybeing recorded at some farms (Ye et al. 2011;Chen et al. 2012; and unpublished data), whichcaused heavy economic losses to the tilapia aqua-culture industry.Signs of S. agalactiae infection in tilapia typi-

cally include acute clinical signs such as septicae-mia infection, exophthalmia, corneal opacity,melanosis, swimming abnormalities, swelling andhaemorrhage in the internal organs (Ye et al.2011; Chen et al. 2012) (Fig. 1c–f). Death usu-ally occurs within a short period (10 days). In thepresent study, we report on a new clinical disease,described as a chronic type of streptococcosis,which is caused by S. agalactiae and affects Niletilapia, Oreochromis niloticus (L.).In recent years, some farmers reported on the

presence of yellow or dark red nodules that wereobserved in the muscle near the vertebrae of Niletilapia. No other typical clinical signs, or mortal-ity, were observed. It is initially thought that thesefish were infected by parasites, but research work-ers failed to locate, isolate or identify any suchparasites. In October 2012, Nile tilapia from afarm in Guangdong, China, showing signs of thedisease as described above, were brought to ourlaboratory for the purpose of identifying possibleparasites. A series of parasitological detectionprocedures were carried out but no parasites were

Correspondence A X Li, Key Laboratory for Aquatic Products

Safety Department of the Ministry of Education/State Key

Laboratory of Biocontrol, School of Life Sciences, Sun Yat-sen

University, 135 Xingang West Street, Haizhu District,

Guangzhou 510275, Guangdong Province, China

(e-mail: [email protected])

1� 2013

John Wiley & Sons Ltd

Journal of Fish Diseases 2013 doi:10.1111/jfd.12146

observed. A considerable quantity of bacteria were,however, isolated from pathological tissues andidentified as S. agalactiae. After epidemiologicalinvestigation, we learned that the streptococcosis

spread in Nile tilapia cultured at the farm inGuangdong in June 2012. Mortality ranged from50 to 200 fish per day in one pond, and cumula-tive mortality was 30%. Streptococcus agalactiae

(a)

(b)

(e) (f)

(c)

(d)

Figure 1 Clinical signs of Streptococcus agalactiae infection in tilapia. (a–b) and (c–f), respectively, indicate typical chronic and acute

signs, post-S. agalactiae infection. (a–b) yellow and dark red nodules in the muscle near the vertebra; (c) exophthalmia and corneal

opacity; (d) exophthalmia and eye congestion; (e) C-shaped curvature of the body and swimming abnormalities; (f) swelling and

haemorrhage in the liver and gallbladder.

2

Journal of Fish Diseases 2013 Y W Li et al. Chronic streptococcosis in Nile tilapia

� 2013


was isolated from moribund fish. All the Nile tila-pia sampled in this article were survivors from thisbacterial infection outbreak.Swabs were taken aseptically from the sites of

nodules in the muscle of diseased Nile tilapia andthen streaked on brain–heart infusion agar (BHI).Plates were incubated at 28 °C for 24 h. Singlebacterial colonies were then inoculated to otherBHI plates, to obtain pure isolates. The isolateswere then stained with gram stain, and the mor-phology observed under a microscope. Pureisolates were first identified by amplification ofthe 16S rDNA sequence with universal primers F:AGAGTTTGATCCTGGCTCAG and R: GGTTACCTTGTTACGACTT (Weisburg et al.1991). Bacterial genomic DNA was isolated usinga Wizard Genomic DNA Purification Kit (Pro-mega, USA) following the standard protocols andused as a template. PCR conditions were asfollows: one cycle of 95 °C for 5 min and 35cycles of 95 °C for 1 min, 55 °C for 45 s and72 °C for 2 min, followed by one cycle of 72 °Cfor 5 min. A DNA fragment of expected size wasthen purified, using an EZNATM Gel Extraction Kit(Omega), subsequently ligated into a pMD 18-Tvector (TaKaRa, Dalian), and sequenced at the In-vitrogen Corporation, Guangdong, China. Thepure isolates were also identified using API 20 Strepsystem, following the manufacturer’s instructions.For histological analysis, the pathological musclewas dissected and immersed in 10% natural buf-fered formalin. After fixing overnight at room tem-perature, the paraffin sections were prepared andstained with haematoxylin and eosin (H&E). His-tological changes were observed under microscope.The molecular type of the isolates was deter-

mined using a multiplex PCR described by Imperiet al. (2010) with some modifications. In brief, 19primers were synthesized and used as primers inthis PCR. The PCR contained 1 lL genomicDNA, 2.5 lL 10 9 buffer (Mg2+ plus), 2 lLdNTP mixture (2.5 mM each), 1 lL primer 1/16(10 lM), 0.625 lL each of other primers, and0.25 lL Taq DNA polymerase (5 U lL�1), andPCR-grade water was added to make up to25 lL. The PCR programme was performed asdescribed by Imperi et al. (2010), and the PCRproducts were then separated by electrophoresis in1.5% agarose gel and visualized under UV light(Tanon 2500 Gel Image System).The serotype of the isolates was determined by

the slide agglutination method with rabbit

polyclonal to Streptococcus Group B Ia (Abcam),following the manufacturer’s instructions. In brief,the test antigen was prepared using pure isolates.For slide agglutination, 20 lL anti-StreptococcusGroup B Ia serum was dropped onto the slide,after which 20 lL test antigen (1 9 107

CFU mL�1) was added and mixed by tilting theglass slide back and forth. Only strong agglutina-tion, observed within 1 min, was determined aspositive. PBS was used as a negative control.For the antibiotic susceptibility test, the cul-

ture suspension of the isolates was mixed withBHI medium containing 1.5% agar, to adjustthe bacteria concentration to 1 9 107 CFUmL�1. The mixture was then poured into 9-cmpetri dishes with 20 mL per disc. Discs contain-ing each antibiotic (Hangzhou Microbial ReagentCo., Ltd) were transferred to BHI plates. Eachplate contained three different antibiotics, andeach antibiotic test was performed in triplicate.After incubation at 28 °C for 24 h, the diameterof the growth inhibition zone was measured,and the susceptibility of the antibiotic was deter-mined according to the manufacturer’sinstructions.For detection of virulence, Nile tilapia (body

weight 45–50 g) were purchased from GuangdongTilapia Breeding Farm, Guangdong, China, andreared at 28 °C for 3 weeks to acclimate to labora-tory conditions. Before challenge, five fish werechosen randomly, for bacteriological examination.No bacterium was isolated from the brain, liver,spleen, kidney and muscle. The Nile tilapia werethen divided into 10 groups, of 20 fish each. In fivegroups, the tilapia received intraperitoneal (i.p.)injections containing 0.1 mL of S. agalactiae strain,isolated during this study, at a dosage of1.67 9 104 CFU per fish, 1.67 9 105 CFU perfish, 1.67 9 106 CFU per fish, 1.67 9 107 CFUper fish and 1.67 9 108 CFU per fish. Each fishfrom the other five groups was injected i.p. with0.1 mL of S. agalactiae THN strain (which cancause typical acute clinical signs) and used as a posi-tive control, at dosages of 2.24 9 104 CFU perfish, 2.24 9 105 CFU per fish, 2.24 9 106 CFUper fish, 2.24 9 107 CFU per fish and 2.24 9

108 CFU per fish, respectively. The mortality ofinfected fish was recorded daily for 2 weeks, andthe LD50 value was calculated using a LD50 dataprocessing software program (Lanyu).The Nile tilapia sampled here (weight between

500 and 1000 g) displayed normal swimming and

3


� 2013


ingestion behaviour and did not present any typi-cal clinical signs or specific macroscopically visiblepathological changes in the external or internalorgans. When each fish was carefully checked,however, the body surface was noted to be rough,with some protuberances under the skin. Whenshaved along the vertebra, the underlying muscledisplayed severe lesions. Numerous nodules,marked yellow or dark red, were observed on thesites of pathological muscle, near vertebrae, partic-ularly near the site of the caudal peduncle(Fig. 1a,b). Histopathologically, each nodule wasa typical granuloma with severe central necrosis.Scatter, or accumulation, bacteria were observedwithin the granulomas, but no parasites werefound (Fig. 2a,b).A total of 41 strains of bacteria were isolated

from the pathological tissues of diseased Nile tila-pia. The clones of all the isolates showed up aswhitish and smooth-edged on BHI plates, and nob-haemolysis was observed on blood agar plates.Under microscopic examination, the bacteria were

noted to be gram-positive and coccoid, in pairs,or in chain (Fig. 3). 16S rDNA sequence analysis(GenBank no. KF111277-KF111317) indicatedthat a 1507-bp amplicon was shared >99% iden-tity with S. agalactiae standard strain ATCC13813, and API 20 Strep system identification resultsalso identified the isolates as S. agalactiae (at a98% probability) (Table 1). The genotype (Fig. 4)and serotype (Fig. 5) of the isolates were both Ia,which were consistent with other isolates identi-fied from tilapia during an outbreak of S. agalacti-ae disease in China from 2009 to 2012 (Ye et al.2011 and our unpublished data). So far, onlythree types of serotypes (Ia, Ib and III) have beenidentified from S. agalactiae isolated from fish(Vandamme et al. 1997; Suanyuk et al. 2008; Yeet al. 2011; Bowater et al. 2012). Of these sero-types, Ia was regarded as the most important, as itcauses both human and fish diseases (Spellerberg2000; Jones et al. 2003; Persson et al. 2004).The isolated S. agalactiae was sensitive to 13 of

20 of the tested antibiotics (Table 2). The S. aga-lactiae was sensitive to amphenicol, tetracycline,macrolide, cephalosporin and rifamycin antibiot-ics, but resistant to aminoglycoside and polymyxinantibiotics that were tested. The isolate was alsosensitive to three kinds of quinolones antibioticstested. These results may help farmers to chooseeffective antibiotics for the prevention, or control,of S. agalactiae infection.The artificial infection test showed that a high

dose of S. agalactiae infection (1.67/2.24 9 107

and 1.67/2.24 9 108 CFU per fish) can causedeath of Nile tilapia within 24 h and that,

(a)

(b)

Figure 2 Histological sections of the pathological muscle.

Scatter or accumulation bacteria were observed (arrow); the

asterisk marks the necrosis centre.

Figure 3 Gram-stained bacterium in pure culture smear

(91000).

4


� 2013


immediately after death, S. agalactiae can berecovered from the brain, liver, spleen and kidney,but not from the muscle. No typical signs ofstreptococcus infection, including nodules in themuscle, were indicated during the course of theexperiment, with the exception of erratic swim-ming, post-infection, in both S. agalactiae strains.The LD50 of S. agalactiae isolated in this studyand the THN strain were 5.27 9 107 CFU perfish and 1.43 9 107 CFU per fish, respectively.

Previous studies have shown that pathogenicmicroorganisms develop highly efficient mecha-nisms to escape recognition and elimination bythe host immune system (Fedtke, Gotz & Peschel2004; Sitja-Bobadilla 2008; Brodsky & Medzhitov2009; Workenhe et al. 2010). Isolation in immu-nologically privileged sites, such as the brain andeyes, is one of the most efficient strategies, partic-ularly as the immune function in these organs isweak or reduced (Simpson 2006). In general,S. agalactiae can be detected in the brain, liver,spleen and kidney, post-infection. In this study,

Table 1 Biochemical identification of the bacteria isolated in this study

API 20 STREP test Results API 20 STREP test Results

D-amygdalin � Arginine dihydrolase 1 +Ala-Phe-Pro-arylamidase (+) b-galactopyranosidase �Leucine arylamidase + a-galactosidase �L-proline arylamidase � Urease �Tyrosine arylamidase � N-acetyl-D-glucosamine +L-aspartate arylamidase � D-mannose +L-pyrrolidonyl-arylamidase � Saccharose/sucrose +Alanine arylamidase + b-galactosidase �D-ribose + a-mannosidase �D-raffinose + D-maltose +Optochin resistance + Methyl-b-D-glucopyranoside �Phosphatidylinositol phospholipase C � D-trehalose +Cyclodextrin � a-glucosidase �L-Lactate alkalinization � Phosphatase (+)Growth in 6.5% NaCl � b-glucuronidase �O/129 resistance (comp.vibrio.) � D-galactose +D-xylose � Pullulan �b-glucuronidase � Arginine dihydrolase 2 +D-sorbitol � Salicin +Lactose � Bacitracin resistance +D-mannitol � Novobiocin resistance +

‘+’ positive, ‘�’ negative.

Figure 4 Results of multiple PCR to identify the genotype of

the Streptococcus agalactiae strains isolated in this study. Lane 1:

positive control (type Ia S. agalactiae); lane 2: the isolated

S. agalactiae strains; lane 3: negative control (distilled water);

lane 4: DL2000 DNA marker.

Figure 5 Results of slide agglutination test to identify the

serotype of the Streptococcus agalactiae strains. S.a (+): positive

control (type Ia S. agalactiae); S.a ZH: the isolated S. agalactiae

strains; S. i (�): negative control (S. iniae).

5


� 2013


however, no bacterium was identified from thesetissues in the majority of diseased Nile tilapiassampled from the tilapia farm. This may suggestthat bacteria were eliminated from these organs bythe host immune system, with supportingevidence indicating that high levels of S. agalacti-ae-specific agglutination antibody titre (1:256)were detected in the serum, and the remainingbacteria were transferred to the muscle, where hostimmune response was weak and could serve as an‘immunologically privileged site’. This may be anovel survival strategy of S. agalactiae, as a meansof escaping host immune responses.Since 2009, large-scale S. agalactiae disease out-

breaks have had a devastating effect on the devel-opment of tilapia aquaculture in China, resultingin direct economic losses reaching about 0.4billion dollars in 2011 (Chen et al. 2012). Strepto-coccus agalactiae infections, along with the occur-rence of new settlement modes and clinical signsobserved in this study, may intensify the hazardand cause serious food safety problems. The dis-eased Nile tilapias may function as an infectionreservoir. In suitable conditions, S. agalactiaecould spread to healthy fish and to humans, afterconsumption of raw fish muscle. Although noreports have so far indicated that fish-derivedS. agalactiae strains can infect human, Evans et al.(2009) showed that human-derived S. agalactiaestrains are able to cause disease and death in Niletilapia. Future work should therefore focus on

clarifying the pathogenic mechanisms and devel-oping efficient vaccines, to prevent the outbreakof chronic streptococcosis.

Acknowledgements

This work was funded by the Science and Technol-ogy Programmes from the Guangdong Province(Grant no. 2012A020800006) and Finance Sup-porting Specific Projects for Fish Diseases Controlfrom the Government of Guangdong Province.

References

Amal M.N., Zamri-Saad M., Iftikhar A.R., Siti-Zahrah A.,

Aziel S. & Fahmi S. (2012) An outbreak of Streptococcusagalactiae infection in cage-cultured golden pompano,

Trachinotus blochii (Lacepede), in Malaysia. Journal of FishDiseases 35, 849–852.

Azad I.S., Al-Marzouk A., James C.M., Almatar S.,

Ai-Gharabally H. & Qasem J.A. (2012) Outbreak of natural

Streptococcosis in hatchery produced silver pomfret (Pampusargenteus Euphrasen) larvae in Kuwait. Aquaculture 330,15–20.

Baeck G.W., Kim J.H., Gomez D.K. & Park S.C. (2006)

Isolation and characterization of Streptococcus sp. fromdiseased flounder (Paralichthys olivaceus) in Jeju Island.

Journal of Veterinary Science 7, 53–58.

Bowater R.O., Forbes-Faulkner J., Anderson I.G., Condon K.,

Robinson B., Kong F., Gilbert G.L., Reynolds A., Hyland

S., Mcpherson G., Brien J.O. & Blyde D. (2012) Natural

outbreak of Streptococcus agalactiae (GBS) infection in wild

giant Queensland grouper, Epinephelus lanceolatus (Bloch),and other wild fish in northern Queensland, Australia.

Journal of Fish Diseases 35, 173–186.

Brodsky I.E. & Medzhitov R. (2009) Targeting of immune

signalling networks by bacterial pathogens. Nature CellBiology 11, 521–526.

Chen M., Li L.P., Wang R., Liang W.W., Huang Y., Li J., Lei

A.Y., Huang W.Y. & Gan X. (2012) PCR detection and

PFGE genotype analyses of streptococcal clinical isolates from

tilapia in China. Veterinary Microbiology 159, 526–530.

Evans J.J., Klesius P.H., Pasnik D.J. & Bohnsack J.F. (2009)

Human Streptococcus agalactiae isolate in Nile tilapia

(Oreochromis niloticus). Emerging Infectious Diseases 15,774–776.

Fedtke I., Gotz F. & Peschel A. (2004) Bacterial evasion of

innate host defenses–the Staphylococcus aureus lesson.International Journal of Medical Microbiology 294, 189–194.

Garcia J.C., Klesius P.H., Evans J.J. & Shoemaker C.A.

(2008) Non-infectivity of cattle Streptococcus agalactiae inNile tilapia, Oreochromis niloticus and channel catfish,

Ictalurus punctatus. Aquaculture 281, 151–154.

Hernandez E., Figueroa J. & Iregui C. (2009) Streptococcosis

on a red tilapia, Oreochromis sp., farm: a case study. Journalof Fish Diseases 32, 247–252.

Table 2 Results of antibiotic susceptibility test

Name Results

Florfenicol S

Chloramphenicol S

Furadantin S

Doxycycline S

Tetracycline S

Minocycline S

Josamycin S

Acetylspiramycin S

Clindamycin S

Cefadine (Vanguard ADM VI) S

Rifampicin S

Gatifloxacin S

Ofloxacin S

Fluazinam acid R

Fleroxacin R

Penicillin I

Neomycin R

Kanamycin R

Streptomycin R

Polymyxin B R

‘S’, sensitive; ‘I’, between sensitive and resistant; ‘R’, resistant.

6


� 2013


Imperi M., Pataracchia M., Alfarone G., Baldassarri L., Orefici

G. & Creti R. (2010) A multiplex PCR assay for the direct

identification of the capsular type (Ia to IX) of Streptococcusagalactiae. Journal of Microbiological Methods 80, 212–214.

Jones N., Bohnsack J.F., Takahashi S., Oliver K.A., Chan

M.S., Kunst F., Glaser P., Rusniok C., Crook D.W.,

Harding R.M., Bisharat N. & Spratt B.G. (2003)

Multilocus sequence typing system for group B

streptococcus. Journal of Clinical Microbiology 41,2530–2536.

Mian G.F., Godoy D.T., Leal C.A., Yuhara T.Y., Costa G.M.

& Figueiredo H.C. (2009) Aspects of the natural history

and virulence of S. agalactiae infection in Nile tilapia.

Veterinary Microbiology 136, 180–183.

Olivares-Fuster O., Klesius P.H., Evans J. & Arias C.R. (2008)

Molecular typing of Streptococcus agalactiae isolates fromfish. Journal of Fish Diseases 31, 277–283.

Persson E., Berg S., Trollfors B., Larsson P., Ek E., Backhaus

E., Claesson B.E., Jonsson L., Radberg G., Ripa T. &

Johansson S. (2004) Serotypes and clinical manifestations of

invasive group B streptococcal infections in western Sweden

1998–2001. Clinical Microbiology and Infection 10,

791–796.

Simpson E. (2006) A historical perspective on immunological

privilege. Immunological Reviews 213, 12–22.

Sitja-Bobadilla A. (2008) Living off a fish: a trade-off between

parasites and the immune system. Fish & ShellfishImmunology 25, 358–372.

Spellerberg B. (2000) Pathogenesis of neonatal Streptococcusagalactiae infections. Microbes and Infection 2, 1733–1742.

Suanyuk N., Kong F., Ko D., Gilbert G.L. & Supamattay K.

(2008) Occurrence of rare genotypes of Streptococcusagalactiae in cultured red tilapia Oreochromis sp. and Nile

tilapia O. niloticus in Thailand—Relationship to human

isolates? Aquaculture 284, 35–40.

Vandamme P., Devriese L.V., Pot B., Kersters K. & Melin P.

(1997) Streptococcus dificile is a nonhemolytic group B, type

Ib Streptococcus. International Journal of SystematicBacteriology 47, 81–85.

Weisburg W.G., Barns S.M., Pelletier D.A. & Lane D.J.

(1991) 16S ribosomal DNA amplification for phylogenetic

study. Journal of Bacteriology 173, 697–703.

Workenhe S.T., Rise M.L., Kibenge M.J.T. & Kibenge F.S.B.

(2010) The fight between the teleost fish immune response

and aquatic viruses. Molecular Immunology 47, 2525–2536.

Ye X., Li J., Lu M.X., Deng G.C., Jiang X.Y., Tian Y.Y.,

Quan Y.C. & Jian Q. (2011) Identification and molecular

typing of Streptococcus agalactiae isolated from pond-cultured

tilapia in China. Fisheries Science 77, 623–632.

Received: 18 April 2013Revision received: 27 May 2013Accepted: 28 May 2013

7


� 2013


Documents

Chronic streptococcosis in Nile tilapia, Oreochromis niloticus (L.), caused by Streptococcu s agalactiae