Upload
others
View
8
Download
0
Embed Size (px)
Citation preview
Effect of Female Sex Hormones on
Chlamydia trachomatis Growth and Gene Expression
By
Ashkan Amirshahi B.Sc., Grad. Cert. in Biotech
May 2009
School of Life Sciences
Queensland University of Technology
Submitted to Queensland University of Technology for the degree of Masters
i | P a g e
Abstract Transmissible diseases are re-emerging as a global problem, with Sexually Transmitted
Diseases (STDs) becoming endemic. Chlamydia trachomatis is the leading cause of
bacterially-acquired STD worldwide, with the Australian cost of infection estimated at $90 -
$160 million annually.
Studies using animal models of genital tract Chlamydia infection suggested that the hormonal
status of the genital tract epithelium at the time of exposure may influence the outcome of
infection. Oral contraceptive use also increased the risk of contracting chlamydial infections
compared to women not using contraception. Generally it was suggested that the outcome of
chlamydial infection is determined in part by the hormonal status of the epithelium at the
time of exposure.
Using the human endolmetrial cell line ECC-1 this study investigated the effects of C.
trachomatis serovar D infection, in conjunction with the female sex hormones, 17β-estradiol
and progesterone, on chlamydial gene expression. While previous studies have examined the
host response, this is the first study to examine C.trachomatis gene expression under different
hormonal conditions. We have highlighted a basic model of C. trachomatis gene regulation in
the presence of steroid hormones by identifying 60 genes that were regulated by addition of
estradiol and/or progesterone. In addition, the third chapter of this thesis discussed and
compared the significance of the current findings in the context of data from other research
groups to improve our understanding of the molecular basis of chlamydial persistence under
hormonal different conditions. In addition, this study analysed the effects of these female sex
hormones and C. trachomatis Serovar D infection, on host susceptibility and bacterial
growth. Our results clearly demonstrated that addition of steroid hormones not only had a
great impact on the level of infectivity of epithelial cells with C.trachomatis serovar D, but
also the morphology of chlamydial inclusions was affected by hormone supplementation.
ii | P a g e
Contents ABSTRACT ................................................................................................................................................................. I CONTENTS ................................................................................................................................................................II LIST OF FIGURES .................................................................................................................................................. IV LIST OF TABLES ...................................................................................................................................................... V LIST OF ABBREVIATIONS .................................................................................................................................. VI DECLARATION ................................................................................................................................................... VIII ACKNOWLEDGEMENTS ..................................................................................................................................... IX
CHAPTER 1 ................................................................................................................................................................... INTRODUCTION AND LITERATURE REVIEW ................................................................................................... 1. INTRODUCTION ................................................................................................................................................... 2
1.1 Chlamydia -------------------------------------------------------------------------------------------------------------------- 2 1.1.1 History and Taxonomy ............................................................................................................................ 2 1.1.2 C. trachomatis ......................................................................................................................................... 3 1.1.3 Epidemiology .......................................................................................................................................... 5 1.1.4 Structure and Genomics ........................................................................................................................... 6 1.1.5 The chlamydial development cycle ......................................................................................................... 8 1.1.6 Alternate growth modes and persistence ............................................................................................... 11 1.1.7 C. trachomatis Treatment ...................................................................................................................... 12
1.3 Female Reproductive Tract (FRT) ----------------------------------------------------------------------------------- 12 1.4 Female Reproductive Cycle ------------------------------------------------------------------------------------------- 15
1.4.1 Menstrual Phase ..................................................................................................................................... 17 1.4.2 Follicular and Proliferative Phases ........................................................................................................ 17 1.4.3 Luteal and Secretory Phases .................................................................................................................. 18 1.4.4 Menopause ............................................................................................................................................. 18
1.5 Female Sex Hormones ------------------------------------------------------------------------------------------------- 20 1.5.1 Estrogen ................................................................................................................................................. 21 1.5.2 Progesterone .......................................................................................................................................... 28 1.5.3 Oral contraceptives ................................................................................................................................ 31
1.2 HYPOTHESIS ..................................................................................................................................................... 33
1.3 AIMS ..................................................................................................................................................................... 33
CHAPTER 2 ................................................................................................................................................................... 2.1 INTRODUCTION ............................................................................................................................................... 38
2.1.1 Effect of steroid hormones on sexually transmitted infections (STI) in humans ------------------------------ 39 2.1.2 Effect of steroid hormones on STI in animal model studies ------------------------------------------------------ 41
2.2 MATERIALS AND METHODS ........................................................................................................................ 45 2.2.1 Cell lines ------------------------------------------------------------------------------------------------------------------- 45 2.2.2 C. trachomatis serovar D growth and propagation ----------------------------------------------------------------- 45 2.2.3 C. trachomatis Serovar D semi purification ------------------------------------------------------------------------- 46 2.2.4 Titration of C. trachomatis serovar D -------------------------------------------------------------------------------- 46 2.2.5 Hormone preparation ---------------------------------------------------------------------------------------------------- 47 2.2.6 Hormonal suppliment of FRT cell lines ------------------------------------------------------------------------------ 48 2.2.7 Statistical analysis -------------------------------------------------------------------------------------------------------- 48
2.3 RESULTS ............................................................................................................................................................. 49
iii | P a g e
2.3.1 Growth of C.trachomatis in ECC-1 cell line under normal conditions ----------------------------------------- 49 2.3.2: Effect of hormone addition on infection of C.trachomatis in ECC-1 cells grown for 1 week ------------- 51 2.3.3: Effect of hormone addition on infection of C.trachomatis ECC-1 cells grown for 26 weeks -------------- 54 2.3.4: Effect of extended hormone pre- suppliment (48 and 72 hrs) on C.trachomatis infection of ECC-1 cells -------------------------------------------------------------------------------------------------------------------------------- 57 2.3.6 Microscopic evidence of chlamydial persistence in hormone treated cultures -------------------------------- 62
2.4 DISCUSSION ....................................................................................................................................................... 63
CHAPTER 3 ............................................................................................................................................................... 70 3.1 INTRODUCTION ............................................................................................................................................... 72
3.1.1 In vitro chlamydial persistence ---------------------------------------------------------------------------------------- 73 3.2 METHODS ........................................................................................................................................................... 77
3.2.1 Cell lines ------------------------------------------------------------------------------------------------------------------- 77 3.2.2 C. trachomatis serovar D growth and propagation ----------------------------------------------------------------- 77 3.2.3 C. trachomatis serovar D semi purification -------------------------------------------------------------------------- 78 3.2.4 Titration of C. trachomatis serovar D -------------------------------------------------------------------------------- 78 3.2.5 Hormone preparation ---------------------------------------------------------------------------------------------------- 79 3.2.6 Hormonal suppliment of FRT cell lines ------------------------------------------------------------------------------ 79 3.2.7 Extraction of total RNA ------------------------------------------------------------------------------------------------- 80 3.2.8 Bacterial RNA Isolation ------------------------------------------------------------------------------------------------- 80 3.2.9 Microarray ----------------------------------------------------------------------------------------------------------------- 81 3.2.9 qRt-PCR ------------------------------------------------------------------------------------------------------------------- 82
3.3 RESULTS ............................................................................................................................................................. 85 3.4 DISCUSSION ....................................................................................................................................................... 92
CHAPTER 4 ................................................................................................................................................................... 4.1 GENERAL DISCUSSION AND CONCLUSIONS ........................................................................................ 102 CHAPTER 5 ............................................................................................................................................................. 108 REFERENCES CITED ........................................................................................................................................... 110
iv | P a g e
List of Figures
FIGURE 1.1: SCHEMATIC OF THE CHLAMYDIA TRACHOMATIS SEROVAR D DEVELOPMENTAL CYCLE. .................... 9
FIGURE 1.2: THIN SECTION ELECTRON MICROSCOPY OF A CELL INFECTED BY C.TRACHOMATIS ........................... 10
FIGURE 1.3: MATURE INCLUSION OF C.TRACHOMATIS ......................................................................................... 10
FIGURE 1.4: SCHEMATIC OF HUMAN FEMALE REPRODUCTIVE TRACT (FRT) ANATOMY ................................... 12
FIGURE 1.5 : SCHEMATIC OF THE HUMAN FEMALE MENSTRUAL CYCLE. ............................................................ 16
FIGURE 1.6: SCIENTIFIC CLASSIFICATION OF SEX STEROIDS ................................................................................ 20
FIGURE 1.7: CHEMICAL STRUCTURE OF ESTRADIOL (E2) .................................................................................... 21
FIGURE 1.8: ENZYMATIC STEPS IN THE CLASSICAL PATHWAY OF ESTRADIOL BIOSYNTHESIS IN THE OVARY ....... 22
FIGURE 1.9: SCHEMATIC DRAWING OF THE MEAN SERUM LEVELS OF E2 ............................................................. 24
FIGURE 1.10: CHEMICAL STRUCTURE OF PROGESTERONE ................................................................................... 29
FIGURE 1.11: OVERVIEW OF PROJECT PLAN. ....................................................................................................... 33
FIGURE 2.1: EXPERIMENTAL PLAN FOR CHAPTER 2 ............................................................................................ 43
FIGURE 2.2: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS (IN NORMAL FCS) ................................................... 50
FIGURE 2.2: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS ................................................................................ 50
FIGURE 2.3: PERCENTAGE OF ECC-1 CELLS INFECTED (1 WEEK PASSAGED IN STRRIPED FCS) ........................... 51
FIGURE 2.4: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS (1 WEEK PASSAGED IN STRIPPED FCS) .................... 52
FIGURE 2.5: PERCENTAGE OF ECC-1 CELLS INFECTED (26 WEEKS PASSAGED IN STRRIPED FCS) ....................... 54
FIGURE 2.6: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS ( 26 WEEKS PASSAGED IN STRIPPED FCS) ............... 55
FIGURE 2.7: PERCENTAGE OF ECC-1 CELLS INFECTED (48 HRS AND 72 HRS PRE-TREATED WITH HORMONE) ..... 57
FIGURE 2.8: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS (48 HRS HORMONE PRE-TREATED) .......................... 58
FIGURE 2.9: CONFOCAL MICROGRAPHS OF C.TRACHOMATIS (72 HRS HORMONE PRE-TREATED) .......................... 60
FIGURE 2.10: ABNORMAL MORPHOLOGY OF CHLAMYDIAL INCLUSIONS (ENLARGED RBS) UNDER ESTRADIOL ... 62
FIGURE 3.2: EXPERIEMNTAL PLAN FOR CHAPTER 3 ............................................................................................. 75
FIGURE 3.2: FOLD-CHANGE CHART FOR UP-REGULATED NORMALIZED GENE DATA UNDER P SUPPLIMENT 88
FIGURE 3.3: FOLD-CHANGE CHART FOR DOWN-REGULATED NORMALIZED GENE DATA UNDER P SUPPLIMENT .... 89
v | P a g e
List of Tables
TABLE 1.1: CHLAMYDIA TRACHOMATIS SEROVARS ................................................................................................. 4
TABLE 1.2: SCIENTIFIC CLASSIFICATION OF CHLAMYDIA ..................................................................................... 5
TABLE 1.3: SERUM ESTRADIOL (E2) CONCENTRATIONS DURING INFANCY, CHILDHOOD, DIFFERENT STAGES. .... 25
TABLE 2.1: SUMMARY OF INFLUENCE OF HORMONE SUPPLEMENTATION ON C.TRACHOMATIS SEROVAR D .......... 61
TABLE 3.1: QUALIFICATION AND QUANTIFICATION OF EXTRACTED ECC-1 RNA .............................................. 81
TABLE 3.2: REAL-TIME PCR PRIMERS USED IN THE ABI PRISM 7300 QUANTITATIVE RT-PCR SYSTEM .............. 83
TABLE 3.3: CHLAMYDIAL GENES EXHIBITING REPRODUCIBLE DIFFERENCES IN MRNA EXPRESSION .................. 86
TABLE 3.4: CHLAMYDIAL GENES EXHIBITING DIFFERENCE IN MRNA EXPRESSION ............................................. 87
TABLE 3.5: RELATIVE FOLD CHANGES (UP-REGULATED) FOR DIFFERENTIALLY EXPRESSED C.TRACHOMATIS . .... 88
TABLE 3.6: RELATIVE FOLD CHANGES (DOWN-REGULATED) FOR DIFFERENTIALLY EXPRESSED
C.TRACHOMATIS .................................................................................................................................................. 89
TABLE 3.7: SUMMARY TABLE FOR GENES PRESENTED IN OUR MICROARRAY EXPERIMENT.................................. 99
vi | P a g e
List of Abbreviations ADCC Antibody-dependent cellular cytotoxicity
ADP Adenosine di-phosphate
APC Antigen-presenting cell
ATP Adenosine tri-phosphate
CD Cluster of differentiation
CMI Cell-mediated immunity
CNS Central nervous system
CTL Cytotoxic lymphocytes
DC Dendritic cells
DNA Deoxyribonucleic acid
DGI Disseminated gonococcal infection
dNTP Deoxynucleotide triphosphate
E2 17 β estradiol
EB Elementary body
ER Estrogen receptor
ERE Estrogen response element
FBS Foetal bovine serum
FBS Foetal calf serum
FITC Fluorescein isothiocyanate
FRT Female reproductive tract
FSH Follicle stimulating hormone
GI Gastrointestinal
GM-CSF Granulocyte/Macrophage Colony Stimulating Factor
GnRH Gonadotrophin releasing hormone
hCG Human chorionic gonadotrophin
HEC Human endometrial epithelial cell line
HPO Hypothalamic-pituitary-ovarian
HRE Hormone Response Element
HSP Heat shock proteins
HSV Herpes simplex virus
IDO Indoleamine-2, 3-dioxygenose
IFN Interferon
vii | P a g e
IFU Inclusion forming unit
IgA Immunoglobulin A
IgG Immunoglobulin G
IL Interleukin
LGL Large granular lymphocytes
LGV Lymphogranuloma venereum
LH Luteinising Hormone
LPS Lipopolysacccharide
MØ Macrophages
MHC-II Major Histocompatibility Complex Class II
MOMP Major outer membrane protein
NK Natural killer cell
OM Outer membrane
PCR Polymerase chain reaction
PID Pelvic inflammatory disease
PRE Progesterone response element
RB Reticulate body
RNA Ribonucleic acid
rRNA Ribosomal RNA
SE Standard error
SIV Simian immunodeficiency virus
SPG Sucrose-phosphate-glutamic acid
STD Sexually transmitted diseases
STI Sexually transmissible infection
TCR T cell receptor
TEM Transmission electron microscopy
TER Transepithelial resistance
TGF Transforming growth factor
TLR Toll-like receptors
TNF Tumor necrosis factors
UTI Urinary tract infection
WBC White blood cells
viii | P a g e
Declaration
The work contained in this thesis has not been previously submitted to meet
requirements for an award at this or any other higher education institution. To the best
of my knowledge and belief, the thesis contains no material previously published or
written by another person except where due reference is made.
Ashkan Amirshahi Signature Date
ix | P a g e
Acknowledgements
This Master‟s project could not have been completed without the time and effort of not only
my supervisors but also some other, very special people. I would like to take this opportunity
to express my gratitude to them individually.
First of all my incredible thanks and gratitude to my supervisors, Professor Peter Timms and
Professor Kenneth Beagley for their trust and providing me this chance to work with them
and gain valuable experience. Equally, my thanks go to my parents, Mina and Siamak
Amirshahi, my younger brother Kourosh, for their love, generous support and the sacrifices
made for me; also my partner Mana Tavahodi for understanding and encouraging my
pursuits. Without the continuous support, inspiration and encouragement from this incredible
band of people, the completion of this study would not have occurred.
Thank you also to Dr Charles Wan for all his expertise and advice in PCR, microarray
analyses and for providing unlimited time and energy beyond the call of duty.
Simultaneously, I am indebted to Dr Jonathan Harris for all his kindness and for supporting
me all these years. I would like to extend a big thank-you to Dr Cameron Hurst for technical
statistical advice.
Thanks and gratitude must also be extended to the staff and students of the department of
infectious diseases at Institute of Health and Biomedical Innovation, Queensland University
of Technology. Specifically Dr Kelly Cunningham, Dr Christina Theodoropoulos, Candice
Mitchell, Elise Pelzer, Alison Carey, Shreema Merchant, Samantha Dando, Steven Bell ,
Dean Andrew and Farshid Dakh for their invaluable advice and supporting me all through
this project.
Finally, thanks also goes to QUT and IHBI for allowing me to undertake this project and for
providing me with a scholarship, travel and research funding.
x | P a g e
Chapter 1
Introduction and literature review
1 | P a g e
2 | P a g e
Introduction
1.1 Chlamydia
1.1.1 History and Taxonomy
Chlamydia-like disease affecting the eyes of people was first described in ancient Chinese and
Egyptian manuscripts (Gambhir et al., 2007). A modern description of Chlamydia-like
organisms was provided by Halberstaedter and von Prowazek who observed it in conjunctival
scrapings from an experimentally infected orangutan as far back as 1907 (Budai, 2007). In 1945,
the term Chlamydia (a cloak) appeared in the literature; however other names such as Bedsonia,
Miyagawanella, ornithosis-, TRIC-, and PLT-agents continued to be used. Two decades later,
Chlamydiae were recognized as bacteria and the genus Chlamydia was validated. In 1971 Storz
and Page created the order Chlamydiales and between 1989 and 1999 new families, genera, and
species were recognized (Budai, 2007; Horn et al., 2004).
By 2006, four chlamydial families, Simkaniaceae Parachlamydiaceae, Waddliaceae and
Chlamydiaceae were recognized and genetic data for over 350 chlamydial lineages had been
reported (Everett et al., 1999). Chlamydiaceae is a family of Gram-negative bacteria that belongs
to the Phylum Chlamydiae, order Chlamydiales and express the family-specific
lipopolysaccharide epitope αKdo-(2→8)-αKdo-(2→4)-αKdo (Everett et al., 1999).
Chlamydiaceae include two genera: Chlamydophila and Chlamydia. The latter genus is classified
into three species: Chlamydia muridarum, Chlamydia suis and Chlamydia trachomatis. C.
muridarum has been found in hamsters and mice, C. suis in swine and C. trachomatis in humans
(Budai, 2007; Everett et al., 1999).
3 | P a g e
1.1.2 C. trachomatis
C. trachomatis is a strictly human pathogen, with a tropism for the genital and conjunctival
epithelia. C.trachomatis infection causes trachoma, an ocular infection that leads to blindness,
and sexually trasmited diseases such as Pelvic inflammatory disease (PID), urethritis, cervicitis,
chronic pelvic pain, ectopic pregnancy and epididimitis (Cevenini et al., 2002; Gambhir et al.,
2007).
C. trachomatis strains were originally identified by their accumulation of glycogen in inclusions
and their sensitivity to sulfadiazine. Based on antigenic differences, C.trachomatis consists of 19
different serovars. In addition to serovars, numerous variants have been characterized. Serovars
A, B , Ba and C infect mainly the conjunctiva and are associated with endemic trachoma,
serovars D, Da, E , F, G, Ga, H, I, Ia, J and K are associated with sexually transmitted diseases,
inclusion conjunctivitis or neonatal pneumonitis in children born to infected mothers. Serovars
L1, L2, L2a and L3 can be found in the inguinal lymph nodes and are associated with
lymphogranuloma venereum (LGV) (Wang and Grayston 1991; Yamazaki et al., 2005).
4 | P a g e
Table 1.1: Chlamydia trachomatis Serovars, Method of Transmission, Associated Human Diseases, and Resultant Human Pathology
Serovars Human Disease Transmission Pathology
A, B, Ba, &
C Ocular Trachoma
Hand-to-Eye,
Fomites, & Eye-
Seeking Flies
Conjunctivitis with
Conjunctival & Corneal
Scarring
D, Da, E, F,
G, H, I, Ia, J,
Ja, & K
Oculogenital
Disease Sexual & Perinatal
Female: - Cervitis,
Endometritis, Pelvic
Inflammatory Disease, Tubal
Infertility, Ectopic Pregnancy
Male: - Orchitis, Urethritis
Epididymitis, Proctitis,
Proctocolitis, Reiter‟s
Syndrome
Children: - Neonatal
Conjunctivitis & Infant
Pneumonia
L1, L2, L3
Lymphogranulo
ma venereum
(LGV)
Sexual
Submucosa & Lymph-node
Invasion, with Necrotising
Granulomas & Fibrosis
(Budai 2007)
Conventional serotyping is performed after C.trachomatis culture using polyclonal and
monoclonal antibodies against the major outer membrane protein (MOMP) of C.trachomatis.
The recently developed method of direct PCR-based restriction fragment length polymorphism
analysis has partially replaced the complicated and less sensitive serotyping technique (Wang
and Grayston 1991). Based on biological chracteristics, the different serovars have been further
grouped into biovars: LGV (four serovars) and trachoma, including all the remaining ones
(Carlson et al., 2005; Yamazaki et al., 2005).
5 | P a g e
Table 1.2: Scientific classification of Chlamydia
Chlamydia species are readily identified and differentiated from other chlamydiales by some
genes signature sequence specifically 16s and 23s rRNA (Cevenini et al., 2002; Wang and
Grayston 1991).
1.1.3 Epidemiology Chlamydia is the most frequently reported sexually transmissible infection (STI) in Australia
with 43,681 notifications in 2006 and is a significant cause of infertility at a time when
Australia‟s population growth is at its lowest (World Health Organisation (WHO) 2006;
Australian Bureau of Statistics (ABS) 2005, 2006).
Statistically, women are more susceptible to C. trachomatis infection than men with young,
heterosexual females, aged 15 – 29 years, at greatest risk of infection (Brunham 2005). To date,
only limited success has been achieved in dealing with the rising rate of STDs, with Australian
infections reported to be increasing at approximately 20% per annum (World Health
Organisation (WHO) 2006; Australian Bureau of Statistics (ABS) 2005, 2006).
Kingdom Bacteria
Phylum Chlamydiae
Order Chlamydiales
Family Chlamydiaceae
Genus Chlamydia
Species C. trachomatis
6 | P a g e
1.1.4 Structure Chlamydiae are a unique bacterial evolutionary group that separated from other bacteria
approximately a billion years ago (Cevenini et al., 2002). Chlamydiae infect eukaryotic cells but
they differ from Rickettsiae, another group of intracellular parasites, in that they have a biphasic
developmental cycle of replication, unique among prokaryotes (Dautry-Varsat et al., 2005;
Hybiske and Stephens 2007). Reports have varied as to whether Chlamydiae are related to
Planctomycetales or Spirochaetes.
Chlamydiae can be either parasites or endosymbionts, depending on the eukaryotic host and
chlamydial species. The infectious, extracellular form is an elementary body (EBs) which is
electron-dense, typically 0.2-0.6 μm in diameter. EBs that have been endocytosed by eukaryotic
cells typically remain in vacuolar inclusions, where the disulfide bonds are reduced and EBs
transform into Reticulate bodies (RBs) (Abdelrahman and Belland 2005). RBs range up to 1.5
μm, take up nutrients from the host cell, and undergo multiple rounds of binary division.
Chlamydiae are spread by aerosol or by contact and require no alternate vector (Dautry-Varsat et
al., 2005; Hybiske and Stephens 2007).
Genome sequencing, however, indicates that 11% of the genes in Candidatus Protochlamydia
amoebophila UWE25 and 4% in Chlamydiaceae are most similar to chloroplast, plant, and
cyanobacterial genes (Dautry-Varsat et al., 2004). Comparison of ribosomal RNA genes has
provided a phylogeny of known strains within Chlamydiae.
Chlamydia spp. were early candidates for genome sequencing given their small genome size,
their enigmatic nature and their importance as pathogens. The first published chlamydial genome
sequence was that of C.trachomatis serovar D (Stephens et al., 1988).
1.1.5 Genome and gene expression
The development of molecular biology and recombinant DNA technology, three decades ago,
opened a new window into infectious diseases research. Since then, many research groups
revealed molecular secrets of microbial infection, gene by gene. Recent studies revealed genome
7 | P a g e
sequence and DNA microarray expression profiling information which showed molecular bases
of gene regulation during the developmental cycle. The sequenced chlamydial genome consists
of a 1,042,519 bp chromosome (60% A=T) and a 7493 bp plasmid. Chlamydial genome study
led to the identification of 894 likely protein-coding genes. Stephens and colleagues (1998)
revealed the inferred functional assignment of 605 (67%) encoded proteins, and 35 (4%) similar
to hypothetical proteins deposited for other bacteria. The 257 (29%) remaining genes predicted
proteins that were not similar to other sequences. Clustering by sequence similarity demonstrated
that 247 chlamydial proteins (27.5%) belong to 59 families of similar genes within the genome
(paralogs), and partially similar to other bacteria such as the Mycoplasmas and Haemophilus
influenzae thst possess small genomes. Currently, the genome list of chlamydial proteins is
classified according to the functional systems in this organism (gene map also available in gene-
bank http://www.genome.jp/kegg/). Belland et al. (2003) carried out a genomic transcriptional
study on the chlamydial developmental cycle demonstrated a small subset of genes that control
the primary (immediate-early genes) and secondary (late genes) differentiation stages of the
cycle. Primary gene products are involved in starting metabolism and modification of the
chlamydial phagosome to escape fusion with lysosomes. Secondary gene products terminate cell
division, control RE to EB conversion and encode structural components which play an
important role in attachment to the new host cells.
Belland et al. (2003) investigated IFN-γ- mediated persistence and demonstrated up-regulation of
genes which are involved in DNA repair, tryptophan and phospholipid utilization, protein
translation and stress. However, by contrast chlamydial secondary (late) genes and also genes
involved in proteolysis, peptide transport and cell division were down-regulated. The Chlamydia
remained metabolically active during persistence despite alteration in biosynthesis. Belland et al.
(2003) revealed a panel of C.trachomatis persistence marker genes. This panel may an important
tool for the validation of persistence, and pothentially more useful than morphological analyses
(confocal and TEM microscopy), particularly considering the altered morphological and genetic
hallmarks of persistent infections are not necessarily co-temporal.
8 | P a g e
Recent bacterial gene regulation studies showed that chlamydia has the ability to adapt to
different environments by regulating developmental changes based on the cell cycle. Chlamydiae
are phylogenetically distinct from other bacterial divisions based on rRNA sequence
comparisons (Belland et al., 2003). This separation is revealed phenotypically by chlamydial
unique obligate intracellular developmental cycle and lifestyle.
1.1.6 The chlamydial development cycle Chlamydiae have a unique biphasic development cycle in which the organism exists in two
distinctive forms; the Elementary Body (EB), which is the infectious form, and Reticulate Body
(RB), the replicating structure. In this developmental cycle, the infectious but metabolically
inactive elementary body, 200 – 300 nm in diameter, is endocytosed by eukaryotic cells and
resides within a cytoplasmic inclusion. Within the inclusion the EBs transform into the non-
infectious but metabolically active reticulate body which is larger, 1000 – 1500 nm in diameter.
The RBs divide by binary fission and transform back to the infectious form before being released
to the cell exterior (Abdelrahman and Belland 2005; Cevenini et al., 2002).
9 | P a g e
Figure 1.1: Schematic of the Chlamydia trachomatis Serovar D Developmental Cycle.
(Abdelrahman and Belland 2005) The RBs of Chlamydiae contain many ribosomes; they are surrounded by the cytoplasmic
membrane and a double-layered outer membrane without any evidence of a peptidoglycan layer.
The EB is derived from the RB by binary fission and appears as a round particle with an irregular
electron-dense central area (the nucleoid) (Abdelrahman and Belland 2005; Belland et al., 2003).
The structure of the membranes resembles that of a Gram-negative bacterial cell.
10 | P a g e
Figure 1.2: Thin section electron microscopy of a cell infected by C.trachomatis
Two early-stage inclusions are evident in the cytoplasm of the infected cell: arrows A indicate the inclusion membrane. Arrows B indicate dividing reticulate bodies inside the inclusion. Note that in the early stage of the development cycle elementary bodies are not yet present. (Cevenini et al., 2002)
Figure 1.3: Mature inclusion of C.trachomatis
Reticulate Body (A) and intermediate forms (B) are present as well as elementary bodies characterized by a electron-dense nucleoid (C). Glycogen-like granules (D) are also present in the inclusion. (Cevenini et al., 2002)
11 | P a g e
1.1.7 Alternate growth modes and persistence
Many chlamydial diseases are associated with a long term or chronic infectious state. In most
cases it is difficult to establish whether chronic or recurrent infections arise through the inability
of the host to resolve the infection or the occurrence of repeated infections with similar species
or genotypes. Despite the unresolved nature of the disease etiology, persistence models of
chlamydial infection have been studied to provide insight into the nature of chronic disease.
Persistence is defined as a long-term association between Chlamydia and their host cell in which
these organisms remain in a viable but culture-negative state (Abdelrahman and Belland 2005;
Hogan et al., 2004). Chlamydial persistence is thought to be due in part to a failure to undergo
secondary differentiation from RB to EB. Molecular consequences include a „blockage‟ in
development involving down-regulation of late gene products in persistent infections (Belland et
al., 2003). The in vitro persistence systems often share altered chlamydial growth characteristics
for example, many studies have described enlarged, and pleomorphic RBs that neither undergo
binary fission, nor differentiate to EBs, but nevertheless continue to replicate their chromosomes.
These changes are generally reversible upon removal of the growth inhibitory factor. Persistent
in vitro infections have been induced by penicillin treatment, amino acid starvation, iron
deficiency, IFN-γ exposure, monocyte infection, phage infection and continuous culture (Hogan
et al., 2004; Morrison 2003).
The patterns of chlamydial gene expression differ between the normal acute infectious form and
the persistent infectious form. A number of studies have begun to demonstrate the molecular
basis of chlamydial persistence. Diverse functional subsets of chlamydial genes have been
reported as being differentially regulated in response to the presence of a persistence-inducing
agent, culminating in the suggestion that a distinct chlamydial persistence phenotype was
observed in specific chlamydial response „stimulon‟ (Belland et al., 2003). Morrison (2003)
demonstrated that incomplete antibiotic eradication of infection or an inappropriate immune
response to a primary infection may set the stage for a cycle of persistent/chronic infections that
are reactivated periodically and as a result drive an ongoing inflammatory immune response over
months or years that ultimately causes salpingitis and PID.
12 | P a g e
1.1.8 C. trachomatis Treatment C. trachomatis infection can be effectively treated with antibiotics once it has been detected.
Current Centers for Disease Control guidelines provide for the following treatments:
Azithromycin 1 gram oral as a single dose, or Doxycycline 100 milligrams twice daily for seven
days or Tetracycline, Erythromycin, Amoxicillin once a day until infection subsides (Mpiga and
Ravaoarinoro 2006).
1.2 Female Reproductive Tract (FRT)
Figure 1.4: Schematic of Human Female Reproductive Tract (FRT) Anatomy
© (http://encarta.msn.com/media_461545224/Female_Reproductive_System.html 2007)
The Female Reproductive Tract (FRT) consists of two distinct compartments structurally
separated by the cervix. The upper compartment consists of the ovaries, the fallopian tubes, and
the glandular endometrium (shown above), and muscular myometrium (not shown) of the uterus
(Martini 2001b). The lower compartment consists primarily of the vagina, and often includes the
cervix, though the cervix is frequently considered a third, separate compartment (Cohen 2005 et
al.; Quayle 2002; Wira et al., 2005).
13 | P a g e
The FRT is immunologically unique in its requirement for tolerance to allogenic sperm to allow
access to ova, and to protect a semi-allogenic embryo throughout gestation (Wira et al., 2005;
Robertson et al., 1997). However, it must also be appropriately protected from, and respond to, a
diverse array of sexually transmitted pathogens. Some of these infections can be lethal (e.g.
Human Immunodeficiency Virus (HIV), Human Papilloma Virus (HPV)), and others (e.g.
Chlamydia trachomatis and Neisseria gonorrhoeae) have long term reproductive sequalae
(Quayle, 2002).
Mucosal surfaces are, to a greater or lesser extent, in contact with an environment rich in micro-
organisms (Martini 2001). Despite this, there is a low incidence of infection, and mucosal host
defence mechanisms create a hostile environment for potential pathogens, minimize
inappropriate microbial load and detect and respond appropriately to pathogen challenges. Innate
and early induced immune responses may prevent establishment of infection, or reduce pathogen
replication until antigen-specific cells are recruited to the local site (Cohen et al., 2005; Quayle,
2002). These responses are antigen non-specific, rapid, and are based on recognition of invariant
molecular structures on pathogens (Wira et al., 2005).
The upper and lower tissues of the FRT consist of morphologically different epithelia, which
confer different immunological functions upon each compartment, thereby inducing different
immunological responses to pathological challenges (Martini 2001c; Kelly, 2003). Importantly,
the epithelium at mucosal surfaces is semi-permeable and apical junctional complexes can be
manipulated by both physiological and pathological events (Wira et al., 2005).
This epithelial barrier is the interface between the endocrine system and the FRT mucosal
immune system, with the hormonally-influenced epithelial cells constituting the first line of
immunological defence by participating in antigen presentation, and secretion of anti-microbials,
chemokines and cytokines (Martini 2001b, 2001c; Quayle, 2002). FRT epithelial cells
concurrently initiate the innate immune response in the FRT lumen (Wira et al., 2005), and the
adaptive immune response via signalling to the FRT stromal cells (Quayle, 2002; Fahey et al.,
2005).
14 | P a g e
Infected epithelial cells contribute to the development of innate and adaptive immune responses
by producing pro-inflammatory mediators including: - IFN-α, and IFN-β, IL-6, IL-8, TNF-α and
TGF-β. IFN-α and β promote the production of IFN-γ to trigger inflammation and promote the
recruitment of immune cells (Wira et al., 2005), while IL-6 has been shown to suppress the HPO
axis and is involved in B-cell differentiation. TNF-α and the chemokine IL-8, also known as the
CXC ligand 8 (CXCL8), stimulate proliferation, differentiation and activation of neutrophils,
monocytes, dendritic cells (DCs) and natural killer (NK) cells, while TGF-β regulates NK
cytokine secretion, antigen presentation, and cellular proliferation, migration and differentiation
(Wira et al., 2005).
Similarly, cytokines act as extracellular stimuli on tight junctions with TNF-α and IFN-γ down
regulating tight junction molecule transcription and TGF-β preventing these cytokine-induced
effects. In vitro, estrogens affect both morphological and biochemical properties of the epithelial
cell tight junction/TER complex, thereby decreasing TER and disrupting epithelial integrity
(Quayle, 2002).
15 | P a g e
1.3 Female Reproductive Cycle The female reproductive cycle, also known as menstrual cycle, lasts an average of 28 days
(Martini 2001b; Cohen, 2005). Oocytes are present at birth, arrested until puberty in prophase of
meiosis I, when the first cycle, or menarche, is initiated in response to various signals including:
the asymptomatic cyclic secretion of Follicle Stimulating Hormone (FSH) and Luteinising
Hormone (LH), adipose tissue percentage and subsequent levels of the peptide hormone leptin
(Martini 2001a, 2001b).
Hormones control both the ovarian/follicular cycle, and the uterine/endometrial cycle, by
employing both positive and negative feedback mechanisms on the hypothalamic-pituitary-
ovarian (HPO) axis (Acron et al., 2001). The major hormones involved in the menstrual cycle
are: - the follicular hormones estrogens, progestins and inhibin, and the anterior pituitary
hormones: - luteinising hormone (LH) and follicle stimulating hormone (FSH). The ova-
containing follicle is the source of estrogens, while the post-ovulatory follicle is the source of
progestins (Martini, 2001a).
16 | P a g e
Figure 1.5: Schematic of the Human Female Menstrual Cycle.
(Martini 2004a) The human female reproductive cycle averages 28 days with two components working harmoniously: - the uterine cycle and the ovarian cycle. The ovarian cycle has two phases: - the Follicular Phase and the Luteal Phase, while the uterine cycle consists of three phases: - the Secretory Phase, the Proliferative Phase and Menses. (a and b). During the Follicular Phase immature follicles are stimulated to grow by the hypothalamic Gonadotrophin Releasing Hormone (GnRH)-induced, anterior pituitary release of Follicle Stimulating Hormone (FSH). (c and d). As the follicle matures it secretes the hormone estrogen in correlation with its size. (b, c and d). At maximum estrogen levels, GnRH pulse and frequency switch, resulting in the anterior pituitary gland-released Luteinising Hormone surge (LH surge). The LH surge causes follicle rupture and release of the oocyte into the fallopian tube (ovulation). Post-ovulation (Luteal Phase), estrogen levels fall and the follicle differentiates into the corpus luteum, which primarily secretes progesterone. (e). As progesterone levels rise, the endometrium thickens to prepare the uterus for implantation (Secretory Phase). If implantation is unsuccessful, progesterone levels
17 | P a g e
drop until the endometrial functional zone undergoes sloughing (Menses). Menses lasts approximately 5-7 days, until rising estrogen levels cause endometrial regeneration (Proliferative Phase), and the cycle re-commences (d). Inhibin is present throughout the menstrual cycle and primarily acts as a FSH inhibitor. (f). Female sex hormones affect basal body temperature throughout the cycle with a drop around ovulation, followed by elevation throughout the secretory phase. Basal body temperatures return to normal with the commencement of Menses.
1.3.1 Menstrual Phase The menstrual phase marks the beginning of the reproductive cycle, and is characterised by
endometrial sloughing known as menses (Martini 2001b). Menses lasts 5 – 7 days and involves
the degradation of the endometrial functional zone and decidua. Sloughing is attributable to the
drop in hormone levels, particularly the fall in progestins, and continues until estrogen levels
rise, and endometrial repair commences (Cohen et al., 2005; Martini 2001b).
Vaginal epithelial thickness is minimal during menses, and increases in thickness throughout the
other two reproductive phases (Wira et al., 2005). The end of the menstrual phase overlaps with
the beginning of the follicular phase (Patton et al., 2000).
1.3.2 Follicular and Proliferative Phases Simultaneous to endometrial repair, ovarian follicles are stimulated to grow and mature. This
initiation is a direct result of hypothalamic gonadotrophin releasing hormone (GnRH) pulse and
frequency signaling the anterior pituitary gland to release FSH (Martini 2001b). Estrogens are
released from the follicle in correlation with follicle size, until at approximately day 10, rising
estrogen levels cause GnRH pulse and frequency to switch signaling, and the anterior pituitary
gland begins releasing LH (Filicori et al., 2003; Goldfien et al., 2001). Around day 14, when
maximal levels of estrogen are reached, a LH surge occurs leading to ovulation, whereby, the
follicle ruptures and the ova is released into the fallopian tubes (O'Connor et al., 2001).
LH/FSH balance initiates and maintains production of estrogen and progestins, and is regulated
by the ovarian hormones themselves, with estrogen increasing GnRH pulses, and progestins
decreasing pulses (Filicori et al., 2003).
18 | P a g e
Post-ovulation, the ruptured follicle differentiates into the endocrine corpus luteum, which
principally releases progestins (O'Connor et al., 2001; Martini 2001b). With decreasing levels of
estrogens and rising levels of progestins, the combination of these hormones increases
endometrial proliferation (Filicori et al., 2003; Goldfien et al., 2001).
1.3.3 Luteal and Secretory Phases
Progestins continue to work at finalising the endometrium for implantation of fertilised ova, with
the ideal implantation period, around day 20 – 24, corresponding to maximal progestin levels
(Martini 2001b, 2001a; Carr et al., 1998). When implantation is achieved, the corpus luteum
secretes human chorionic gonadotrophin (hCG) hormone, inhibiting menses onset (Lessey,
2003).
Approximately 12 days post-ovulation, if no pregnancy occurs, the corpus luteum deteriorates
and becomes the non-functional, fibrous corpus albicans (Goldfien et al., 2001). The subsequent
decrease in progestins levels continues until endometrial thickness cannot be maintained and
menses occurs (Pierro et al., 2001). Approximately seven days post-menses, GnRH pulses
increase in conjunction with immature follicle activation, and the cycle resumes (Martini 2001b;
O'Connor et al., 2001).
1.3.4 Menopause Menopause is the period when no ova are left to mature and the vaginal epithelium is
consistently thinner, with age of onset at 42 – 60yrs. Menopause is defined as the last
spontaneous menstruation (Goldfien et al., 2001). Approximately five years prior to the absolute
failure of ovarian hormone production, the first clinical indicators of disturbances of estrogen
and progesterone production manifest with irregular menstrual bleedings (Cohen et al., 2005).
This phase is referred to as premenopause. Whereas progesterone production drops relatively fast
during that phase, E2 synthesis decreases more gradually. These hormonal changes reflect the
loss of ovarian follicles that may be stimulated. In addition, ovarian blood vessels show
regressive changes and eventually obliterate. With the progression of menopause, the E2 levels
19 | P a g e
in the circulation decrease considerably until they reach concentrations less than 20 pg/mL (Wira
et al., 2005). These concentrations are insufficient to induce adequate endometrial proliferation
and subsequent menstrual bleeding. Ovariectomy in postmenopausal women does not lead to a
further decrease in E2 concentrations, indicating the absolute loss of ovarian function
(Tsavachidou et al., 2002). Because the negative feedback on pituitary gonadotropin secretion is
lost, there is a significant continuous increase in serum LH and FSH concentrations (O'Connor et
al., 2001; Patton et al., 2000). This causes irregular cycles and anovulatory bleeding, with tissue
changes including: - ovary, oviduct, uterine, and vaginal atrophy, with a dehydrated and hyper-
sensitive vaginal mucosa (Wira et al., 2005). Due to the absence of follicles, estrogen and
progesterone are lacking, consequently elevating GnRH, LH and FSH, with FSH elevated more
than LH (Goldfien et al., 2001).
20 | P a g e
1.4 Female Sex Hormones
Female reproductive hormones rarely operate alone, functioning in harmony to either synergise,
or antagonise, different immunological outcomes throughout the FRT (Bentley, 2001; Wira et
al., 1985). Fluctuating hormones regulate both the ovarian and endometrial cycles, with
dysfunction causing irregular cycling (Goldfien, 2001).
The female sex hormones LH and FSH are glycopeptide gonadotrophin hormones, while
estrogens and progestins are steroid lipid hormones (Bentley, 2001; Martini 2001b, 2001a). Both
estrogens and progestins are regulated by the HPO axis and enter cells by diffusion to affect
muscle, bone, liver, kidneys, brain and the immune system (Bentley, 2001; Fahey et al., 2005).
.
Figure 1.6: Scientific classification of sex steroids
Ashkan Amirshahi 2009
Sex steroids, also known as gonadal steroids can be divided into 3 main classes namely
estrogens, androgens and progesterone. Estrogens split to three subclasses estradiol, estriol and
estrone while progestagens divide into progesterone and porgestins. Androgens also classify into
5 subunits namely testosterone, androstenedione, dihyrotestosterone, dehydroepiandrosterone
and anabolic steroids (Martini, 2001b).
21 | P a g e
1.4.1 Estrogen There are three types of circulating estrogens: estrone and estriole are synthesised from
cholesterol, via the P450 aromatase enzyme, and the follicular androgen, androstenedione.
Estradiol (E2) is the principle estrogen in circulation and is synthesised via androstenedione and
testosterone (Bentley, 2001; Goldfien et al., 2001). They all are steroids consisting of 18 carbon
atoms and characterized by an aromatic A ring. For the specific estrogen effect the aromatic A
ring and hydroxy group at positions 3 and 17 are essential (Metzler and Pfeiffer, 2001).
Figure 1.7: Chemical structure of Estradiol (E2)
(Metzler and Pfeiffer, 2001)
Characteristic chemical features of E2 are the aromatic ring (ring A) with a hydroxy group at C3, and a second hydroxy group at the C17 position of ring D. The formula of E2 also indicates the conformation of rings B, C, and D, and the orientation of the C17 hydroxy group.
E2, the most potent and important estrogen in non-pregnant women, is predominantly produced
by the granulosa cells of the active follicle from androgens delivered by the theca interna. During
pregnancy, E3 produced from androgenic precursors provided by the fetus and the mother,
respectively, represent the major estrogen (Dötsch et al., 2001). E1, the third of the major
endogenous estrogens, exists in metabolic equilibrium with E2 due to the action of 17 β-
hydroxysteroid dehydrogenase.In the classic pathway, the estrogen synthesis starts from
cholesterol provided by lipoproteins (Metzler and Pfeiffer, 2001).
22 | P a g e
Figure 1.8: Enzymatic steps in the classical pathway of estradiol biosynthesis in the ovary
Ashkan Amirshahi 2009
Estrogens are biologically inactivated and excreted after sulfation or glucuronidation,
respectively, allowing renal excretion of the inactivated steroids. Although considerable amounts
of conjugated estrogens are excreted into the bile, only a small fraction appears in the feces. The
majority of the conjugates are reabsorbed after hydrolysis by bacteria from the gastrointestinal
tract. The majority of E2 (98%) circulates bound to albumin or to sex hormone binding globulin
( SHBG), a specific carrier protein that bind estrogens and androgens with high affinity
(Bengtsson et al., 2004; Goldfien et al., 2001).
23 | P a g e
Estrogens can enter their target cells via passive diffusion though the cell membrane. After
transport through the cell membrane, estrogens bind to specific receptors located within the
nucleus of the target cells (Wira et al., 2005). There are two different receptors for E2: estrogen
receptor alpha ( ER α) and estrogen receptor beta ( ER β) that can form heterodimers exhibiting
different affinities to specific DNA sequences termed estrogen response elements (Dötsch et al.,
2001; Metzler and Pfeiffer, 2001).
The estrogen receptor (ER) belongs to the thyroid receptor family, and occurs in two isoforms,
ER-α and ER-β. ER may be membrane-bound or, more commonly, a soluble ligand-regulated
nuclear receptor that forms either heterodimers or homodimers (Baxter et al., 2001; Guseva et
al., 2005; Yang et al., 2006). Under basal conditions, ER is confined to the nucleus and
associates with Heat Shock Proteins (HSPs) (Goldfien, 2001). Once activated, HSPs disassociate
to expose the transcription factor Hormone Response Element (HRE), or Estrogen Response
Element (ERE) (Gardner et al., 2001). FRT epithelial and stromal cells both contain ERs, with
ER-α mediating estrogens effects in endothelial cells and ER-β mediating estrogens effects in
muscle (Han et al., 2005; Grant-Tschudy et al., 2004).
24 | P a g e
Figure 1.9: Schematic drawing of the mean serum levels of E2 and E1 in relation to progesterone (P), LH, and FSH during pre- and postmenopause
(Metzler and Pfeiffer 2001)
Increasing concentrations of FSH induce the aromatization of androgens in the granulosa cells of
the ovary, thus elevating E2 concentrations. E2 and FSH increase the FSH receptor concentration
of the granulosa cells of the ovarian follicle. The peripheral E2 concentrations increase further and
lead, together with ovarian inhibin, to a feedback inhibition of FSH secretion.When E2 levels
exceed a certain threshold for a defined period of time, indicating the full maturation of the
ovarian follicle, a massive increase of pituitary LH and FSH secretion is induced resulting in
ovulation and corpus luteum formation (Dötsch et al., 2001). However, the growth of preovulatory
follicles can proceed with minimal concentrations of LH and FSH in the presence of low
peripheral estrogen levels. Oocyte maturation and fertilization may proceed independently of
ambient estrogen levels (Metzler and Pfeiffer, 2001). This leads to the assumption that estrogens
exert a minimal autocrine paracrine function.
The rising E2 levels in the follicular phase result in proliferation of the uterine endometrium and in
an increase of the number of glands. There is an increase in the amount and a change in the
25 | P a g e
physicochemical properties of the cervical mucus termed Spinnbarkeit. The decline of E2 and
progesterone in the late luteal phase leads to a loss of endometrial blood supply and eventually to
the onset of menses (Dötsch et al., 2001).
Table 1.3: Serum estradiol (E2) concentrations during infancy, childhood, different stages.
Age/ Phase Reference values Reference values
(Conventional units) (S1 units)
Girls
1 week – 7 months < 7-55 pg/mL < 26-201 pmol/L
6 – 12 months < 7–44 pg/mL < 26-162 pmol/L
2nd year < 7-24 pg/mL < 26-88 pmol/L
2-7 years < 7-12 pg/mL < 26-44 pmol/L
Women
Follicular phase 30-300 pg/mL 110-1100 pmol/L
Ovulation 300-400 pg/mL 1100-1450 pmol/L
Luteal phase > 130 pg/mL > 470 pmol/L
Postmenopause
< 20 pg/mL < 70 pmol/L
26 | P a g e
It has to be emphasized that the determination of plasma estrogen levels varies considerably with the method used. Therefore, three conditions are compulsory for any specific assay measuring the three major endogenous estrogens E2, E1and E3: (1) reference values must be provided for every assay, (2) the reference values must not be related to the age but to the different developmental stage, i.e., puberty and menopause, and (3) the assay must be specific. The reference values shown above were established using radioimmunoassay after chromatographic separation. Lately, ultrasensitive assays for the determination of E2 concentrations have been introduced. Under certain pathophysiological situations like the premature telarche these new assays allow for discrimination even in prepubertal girls (Metzler and Pfeiffer 2001).
Estrogens have different effects on different tissues and regulate TER, WBCs, Igs, APCs,
chemo/cytokines, anti-microbials, oedema and susceptibility to infection (Wira et al., 2000,
2005a).
Estrogens enhance blood coagulation, increase clear, watery cervical mucus for sperm motility,
decrease bone resorption, reduce bowel mobility, vary enzymatic activity and metabolism,
increase fat deposition, and alter smooth muscle function via modulation of the sympathetic
Central Nervous System (CNS) (Goldfien, 2001). Estrogens also determine secondary sex
characteristics such as: gender-specific distribution of body fat, closing epiphyseal plates,
gender-specific distribution of body hair, voice changes in males and breast development in
females (Martini, 2001a, 2001b; Bentley, 2001).
In vitro, estrogens decrease TER in a dose-dependent manner, and affect both morphological and
biochemical properties of the tight junction/TER complex, thereby disrupting epithelial integrity
(Grant-Tschydy and Wira, 2004).
The mucosal immune system in the female reproductive tract is the first line of defense against
pathogenic organisms. Immunoglobulin A (IgA) and IgG levels in uterine secretions change
markedly during the rat estrous cycle, with higher levels measured at ovulation than during any
other stage of the cycle (Bouman et al., 2005). When ovariectomized animals are treated with
E2, IgA and IgG levels markedly rise relative to untreated controls (Wira and Sandoe, 1987).
These results underline the role of estrogens in the regulation of the local uterine defense
mechanisms, enabling a pathogen free environment for the implantation of the blastocyst
(Ghanem et al., 2005).
27 | P a g e
Estrogens may influence lymphocyte type and concentration throughout the FRT (Ito et al.,
1995; Wira et al., 2003). For example, CD8+ CTL activity is present during the estrogen-
dominant proliferative phase, absent during the progesterone-dominant secretory phase and
maximal in post-menopausal women (White et al., 1997). Therefore, CTL activity may be
hormonally regulated, with decreasing hormone levels increasing cytolytic activity, and vice
versa (White et al., 1997). Similarly, NK cells appear to be hormonally regulated as they
materialise during the proliferative stage and increase in number during the secretory phase
(Sentman et al., 2004). Hence, CMI may be controlled by sex hormones (White et al., 1997).
Equally, estrogens affect humoral immunity by regulating pIgR and IgA translocation
(Richardson et al., 1995; Kaushic et al., 1997). IgA is essential for fighting genital tract
infections and estrogen facilitates SC/IgA binding (Wira et al., 1983; 1985). Both SC and IgA
are at their highest concentrations at estrogen-dominant estrous and their lowest concentrations
during progesterone-dominant diestrous (Kaushic et al., 1997).
In animals, estrogens induce opposite tissue-specific effects on various immune parameters in
both the upper and lower FRT, as seen by estrous decreases of pIgR, IgA and SC in vaginal
tissues and secretions, with simultaneous increases of pIgR, IgA and SC in the uterus. Progestins
have been shown to antagonise these effects in an equally opposing manner (Wira et al., 2005;
Wira and Sandoe, 1987).
Like IgA, vaginal IgG concentrations are lowest at diestrous, and highest at estrous, though the
method of translocation is still controversial (Stern et al., 1992; Wira et al., 1985, 1991, 1995).
In response to proestrous, FRT tissues retain water and it is proposed IgG accesses the FRT
lumen via this estrogen-induced oedema (Goldfien, 2001; Wira et al., 1983).
Uterine antigen presentation is increased by estrogens at proestrous and decreased by progestins
at diestrous; yet vaginal antigen presentation is increased at diestrous and decreased at proestrous
(Wira et al., 2000, 2002, 2005c). Estrogens and progestins even have opposing cell-specific
effects, with antigen presentation increased by estrogens in uterine epithelial cells yet decreased
in uterine stromal cells (Wallace et al., 2001; Wira et al., 2000). MHCs are essential for antigen
28 | P a g e
presentation and induction of the adaptive immune response. MHC-II is also under hormonal
control with expression increased at proestrous and decreased at diestrous (Prabhala et al., 1995).
Most chemo/cytokines are influenced by hormones, with estrogens regulating IFN-β, IFN-γ,
TGF-β (Wira et al., 2003), TNF-α, IL-1 and IL-6 (Eriksson et al., 2004; Grant-Tschudy et al.,
2004). Similarly, anti-microbial action is affected by sex hormones. Bactericidal activity is
highest at proestrus, decreased at diestrous, and absent in menopausal women, therefore,
bacterial colonisation and infection may vary throughout the cycle (Fahey et al., 2005; Kaushic
et al., 2000b).
Occasionally, estrogens act on stromal cells to mediate epithelial effects, and increase vascular
and epithelial permeability for leukocyte migration and IgG translocation (Grant et al., 2003;
Grant and Tschudy 2004). During the normal menstrual cycle, estrogens effects are induced by
complex interactions between epithelial and stromal cells, and their various chemo/cytokines and
antimicrobials (Grant and Tschudy 2004; Sentman et al., 2004).
1.4.2 Progesterone
Progesterone is also synthesised from cholesterol, via the parent compound pregnane, and is the
principle circulating progestin (Martini 2001b, 2001a). Progesterone receptors (PRs) belong to
the steroid receptor family and have two isoforms, PR-A and PR-B that form either heterodimers
or homodimers (Gardner et al., 2001; Goldfien, 2001). Under basal conditions, PR is cytosolic
and forms multimeric complexes with HSPs. Once activated, HSPs disassociate to expose the
nuclear translocation signal which initiates PR nuclear transport to bind with the transcription
factor HRE, or Progesterone Response Element (PRE) (Goldfien et al., 2001; Lessey, 2003).
Receptor expression is hormonally controlled with both isoforms expressed during the follicular
phase, but only PR-B expressed during the mid-secretory phase (Lessey et al., 2003).
Progesterone also weakly binds glucocorticoid and mineralocorticoid receptors (Baxter et al.,
2001; Schmidt et al., 1998).
29 | P a g e
Figure 1.10: Chemical structure of Progesterone
(Metzler and Pfeiffer, 2001)
As with estrogens, progestins affect TER, WBCs, Igs, APCs, MHCs, chemo/cytokines, anti-
microbials, oedema and susceptibility (Kaushic et al., 2003; Wira et al., 2005). Progestins
prepare mammary glands for secretory activities, decrease cervical mucus making it viscous and
cellular, affect respiration, metabolism, insulin levels, kidney function, increase body
temperature and have hypnotic brain effects during pregnancy (Martini 2001b, 2001a;
Richardson et al., 1995).
In general, progestins antagonise estrogen-induced effects on pIgR and SC expression, IgA/IgG
concentrations, antigen presentation, and WBC migration and translocation (Fahey et al., 2005;
Kaushic 2000, 2003, 1997; Wira et al., 2000). However, progestins do not alter estrogen-induced
TER effects and are suggested to be the primary regulators of SC, rather than estrogens (Grant
and Tschudy 2004; Sullivan et al., 1984). Progestins increase Th2 cytokines and inflammatory
responses (Tait et al., 2008), regulate TGF-β and IFN-γ, and induce vaginal epithelial thinning,
thus decreasing vaginal immunity and increasing vaginal infectivity (Kaushic, 2003; Wira et al.,
1985).
Animal studies have emphasised the influences hormones may have on susceptibility to
infection. Intravaginal infection of mice, with human chlamydial serovars and C. muridarum, is
generally only successful when progesterone treatment is employed. Progesterone is
administered to prolong diestrous so all mice are concurrently cycling, and to facilitate consistent
30 | P a g e
genital infection (Kaushic et al., 2000). Without progesterone, the stage of the menstrual cycle
affects infectivity, and extremely high doses of inoculum may be required to achieve infection
(Kaushic et al., 2000).
In contrast, humans and guinea pigs require estrogens to enhance infectivity (Rank et al., 1993).
C. trachomatis infection of rats, at estrous and diestrous, did not result in infection, with E2
administration resulting in absence of infection, and complete protection (Kaushic et al., 200b,
2003). With progesterone administration, C. trachomatis increases local immune responses,
while decreasing systemic immune responses (Baeten et al., 2001).
When both estrogen and progesterone were administered to rats, infection was high
(progesterone effects) yet no inflammation was observed (estrogen effects), with the ratio of E2
to progesterone important for immunological effects (Kaushic et al., 1998, 2000). The human
menstrual cycle has been shown to affect C. trachomatis infectivity with a notable increase in
infection during the proliferative phase (Kaushic et al., 2000).
Similar effects have been observed with other organisms such as: Herpes Simplex Virus 2 (HSV-
2) where progesterone increases murine mortality (Kaushic et al., 2003) and Neisseria
gonorrhoea where estrogens increase murine infection at proestrous (Kita et al., 1981).
Other hormones also contribute to FRT homeostasis; though E2 and progesterone are the major
hormones in C. trachomatis endocervical infection. Therefore, endocrine balance at the time of
infection plays a role in host susceptibility and may be an important determinant for successful
administration of mucosal vaccines (Kaushic et al., 1998; Wira et al., 2000).
31 | P a g e
1.4.3 Oral contraceptives Oral contraceptives are various combinations of estrogens and synthetic progesterone designed
to halt ovulation, with the aim to prevent pregnancy (Rubin et al., 1982). There are generally
four types of oral contraceptives in use, with an estimated effectiveness of 99%: - the most
commonly used fixed-combination contraceptives, where concentrations of estrogens and
progestins remain constant throughout therapy, the biphasic or triphasic contraceptives where
estrogen concentrations remain relatively constant and levels of progestins vary, and the
progesterone-only pill (mini-pill) (Baeten et al., 2001; Lavreys et al., 2004).
Oral contraceptives primarily act at the hypothalamus and pituitary gland to prevent the LH
surge required for successful ovulation; however these oral hormones also alter FRT tissues to
inhibit successful fertilisation and implantation (Rubin et al., 1982).
Oral contraceptives are proposed to decrease IgG responses and increase susceptibility to
infection, with vaginal candidiasis increasing with oral contraceptive use (Washington et al.,
1985). Consistently higher rates of C. trachomatis infection are found amongst oral contraceptive
users, though oral contraceptives are also associated with protection from chlamydial PID
(Baeten et al., 2001). This protection occurs owing to reduced menstrual flow and lack of retro-
grade menstruation, and decreased inoculum reaching the upper FRT due to thickened cervical
mucus (Rubin et al., 1982).
32 | P a g e
1.5 Hypothesis Recently it has become evident that Chlamydia can enter a chronic or persistent infectious form
that may be reactivated at a later stage. This form can be induced in vitro by treatment of
infected cells with some antibiotics or with low doses of IFNHogan et al., 2004). The patterns
of chlamydial gene expression differ between the normal acute infectious form and the persistent
infectious form (Hogan et al., 2003) and it has been suggested that incomplete antibiotic
eradication of infections or an inappropriate immune response to a primary infection may set the
stage for a cycle of persistent/chronic infections that are reactivated periodically that ultimately
causes salpingitis and PID. In addition, studies using animal models of genital tract chlamydial
infection suggested that the hormonal status of the genital tract epithelium at the time of
exposure influence the outcome of infection (Kaushic 1998; Wira et al., 2000). This suggested
that female sex hormones directly regulate host-pathogen interactions and may be important
determinants for successful mucosal vaccines (Beagley and Timms 2000).
If the hormonal status of the epithelium at the time of infection can influence the immune
response then this may indirectly affect the type of chlamydial infection that develops following
exposure. The development of a chlamydial gene array chip provides the unique opportunity to
investigate the effect of sex hormones on the patterns of chlamydial gene expression during
infection and to correlate this with the type of infection that develops.
The current project will use an in vitro infection model to test the hypotheis that the female sex
hormones estradiol and/or progesterone directly affect chlamydial gene expression and that this
may determine the actual outcome of infection ( acut versus persistence )
33 | P a g e
1.6 Aims The development of a chlamydial gene array chip provided a unique opportunity to investigate
the effect of sex hormones on the patterns of chlamydial gene expression during infection and to
compare this with the type of infection that develops. We determined how changes in estradiol
and/or progesterone affected chlamydial gene expression when the hormone-responsive ECC-1
cell line was infected with C.trachomatis serovar D.
The aims of this project were:
1- To determine the effect of female sex hormones on C.trachomats growth and inclusion morphology in ECC-1 cells
2- To determine the effect of steroid hormones on ECC-1 cells infectivity
3- To determine the effect of female sex hormones on chlamydial gene expression
The initial part of the project investigated the susceptibility of the hormone-responsive ECC-1
cell line to infection with C.trachomatis serovar D under different hormonal conditions.
Immunohistochemistry and confocal microscopy were used to monitor infectivity and inclusion
morphology. In the second part of the study a transcriptional analysis of C.trachomatis growth in
ECC-1 cells grown under different hormonal conditions was carried out using gene array
technology.
For the purpose of this experiment, the epithelial cell line (ECC-1) was grown in flasks
containing phenol red-free media and charcoal-stripped foetal calf serum (to remove endogenous
steroids). Twenty-four hours before Chlamydia infection, cells were supplemented with either
no added sex hormones, estradiol, progesterone or estradiol plus progesterone. These cell
cultures were then infected with C. trachomatis serovar D at a Multiplicity of Infection (M.O.I)
of 15. Total RNA was extracted from the infected ECC-1 cell monolayers using TRIzol
(Invitrogen) followed by a purification step. Eukaryotic RNA was removed using a Dynabead
mRNA purification kit and the bacterial mRNA-enriched supernatant was reversed-transcribed
with random primers and copied into dsDNAs.
34 | P a g e
The array was an Affymetrix oligonucleotide array format of 1800 features, covering the full C.
trachomatis genome (870 genes) and containing 8-11 oligonucleotides per target gene, each
designed for optimal hybridisation to C. trachomatis and screened against non-specific
hybridisation with the full human and mouse genomes. After hybridisation and subsequent
washing using the Affymetrix Fluidics station 400, the bound cRNAs were stained with
streptavidin phycoerythrin. The signal was then amplified with a fluorescent-tagged antibody to
streptavidin. Fluorescence was measured using the Affymetrix scanner and the results analyzed
using Affymetrix data analysis software. A total of 8 chlamydial arrays were analyzed under four
culture conditions (no hormone, E, P, E+P) x duplicates.
35 | P a g e
Figure 1.11: Overview of project plan.
Grow C.trachomatis
serovar D in 2 cell lines
Hormone preparation and
suppliments
ECC-1 Cells HEp-2 Cells
1 week culture in hormone-
reduced conditions
C.tachomatis
Growth and Propagation
26 weeks culture in hormone-
reduced conditions
Aim 1: Effect of estradiol and progesterone on the growth of Chlamydia
trachomatis in vitro
Aim 2: Investigate effects of female sex hormones on bacterial gene expression
36 | P a g e
Chapter 2
Effect of estradiol and progesterone on the growth of Chlamydia trachomatis in vitro
37 | P a g e
38 | P a g e
2.1 Introduction Chlamydia trachomatis is a Gram-negative, intracellular bacterium and the cause of the world‟s
most reported sexually transmitted bacterial infection. More than two-thirds of women with
chlamydial cervical inflammation are asymptomatic and are at risk for pelvic inflammatory
disease (PID), ectopic pregnancy and chronic pelvic pain (Cevenini et al., 2002).
It has been accepted and reported in several studies that genital C. trachomatis serovars D to K
are responsible for the epidemic of sexually transmitted infection (Abdelrahman and Belland
2005; Bavoil et al., 2000). The fact that C.trachomatis infection can have consequences for
females, such as PID, tubal factor infertility, and ectopic pregnancy, has been known for many
years and since infection is asymptomatic in the majority of cases; therefore, more attention
should be given to the influence of reproductive hormones on chlamydial infection of the genital
epithelia, both from a clinical and experimental perspective (Cevenini et al., 2002; Paavonen and
Eggert-Kruse 1999).
The female reproductive tract has a unique structure with a specialized mucosal surface with the
main role being to facilitate the growth of an allogeneic fetus while still providing protection
against potential pathogens. A key feature impacting on reproductive physiology, particularly the
uterus, are the female sex hormones, estrogen and progesterone. Estrogen predominates in the
early 10 days following menstruation and is at the highest level at time of ovulation (~14–15
days). Throughout the proliferative phase, the first 15 days, growth of the endometrial glands
occurs and epithelial cells move out of the glands to seed the endometrial surface. Progesterone
concentrations increase during the 10 days after ovulation, the secretory phase, following
decreased progesterone and estrogen; and if implantation does not occur, the fall in progesterone
and estrogen levels will lead to menstruation. In the human female genital tract, mucus
production is directly and/or indirectly under hormonal control (Martini 2004b; Martini 2004a).
39 | P a g e
2.1.1 Effect of steroid hormones on sexually transmitted infections (STI) in humans
Sex hormones play a crucial role in the host's resistance to sexually transmitted infections. This
is demonstrated by differences in the number of cases reported according to the phase of the
menstrual cycle, greater susceptibility during pregnancy (Montes et al., 2000; Rubin et al., 1982;
Washington et al., 1985). The mechanisms by which particular sex hormones modulate the
immune system were reviewed before in the first chapter. This is a complex topic, and
unfortunately, in spite of its potential importance, no clear conclusions have emerged about the
effect of steroid hormones on chlamydial growth in regards to the development of strategies for
controlling genital tract infection.
It has long been known that steroid hormones, especially estadiol (E2) and progesterone (P), can
affect the outcome of many bacterial and viral infections. Data collected over the past 25 years
suggested that female hormones may influence or modulate chlamydial infection. For example, it
was reported that epithelial cells were more susceptible to C. trachomatis serovar E in the
estrogen-dominant stage of the human menstrual cycle (proliferative phase) than in other stages
(Maslow et al., 1988; Wyrick et al., 1994). Since more chlamydial particles can be isolated from
the proliferative stage of the cycle it was concluded that women are more suceptible to infection
under estradiol influence (Sugarman and Agbor 1986).
Steroid hormones regulate the function of numerous separate compartments of the reproductive
system, and many of the mechanisms that lead to resistance to sexually transmitted infections,
such as cervical mucus production, occur through the menstrual cycle (Menon et al., 2007;
Nelson and Helfand 2001; Rolle et al., 2006). Bacterial adherence to mucosal epithelial cells
may be affected by several factors, including sex hormones. Neisseria gonorrhoeae has been
reported to adhere to vaginal epithelial cells, with the degree of adherence varying depending on
the stage in the menstrual cycle (Sweet et al., 1986).
40 | P a g e
Clinical observations have shown the possible interaction between sex hormones and gonococcal
infection. Firstly, gonococcal pelvic infection and disseminated gonococcal infection (DGI) both
have a greater chance of occuring during menstruation and secondly DGI is more commonly
seen in pregnant women (Sweet et al., 1986). However, similar to Chlamydia infection, oral
contraception has been reported as a risk factor for gonococcal infection (Baeten et al., 2001a;
Rubin et al., 1982).
Smith et al. (2000) have shown that hormonal contraceptives are associated with increased
shedding of HIV in cervical and vaginal secretions. Clinical studies have provided evidence that
HIV-infected women who received hormonal contraceptive treatment showed enhanced viral
shedding in their cervico-vaginal secretions (Lavreys et al., 2004).
Hooton et al. (1996) demonstrated a connection between estradiol and urinary tract infection
(UTI) in premenopausal women (Hooton et al., 1996). Their study reported that women were
more likely to present with acute cystitis between 8 and 15 days after the last menstrual cycle
than at any other time of the cycle. This association was true for women with UTI caused by
Escherichia coli and Staphylococcus saprophyticus; moreover, estradiol appeared to have a
protective role against UTI in post-menopausal women (Sonnex, 1998). Some studies have
indicated a higher risk of cervical neoplasia in users of oral contraception and in pregnant
women (Montes et al., 2000). In addition, pregnancy seemed to be associated with persistence of
HPV infection (Shew et al., 2002).
41 | P a g e
2.1.2 Effect of steroid hormones on STI in animal model studies
Since human tissue is of limited availability for research purposes, studies have used mice,
guinea pigs, rats, and rabbits as models to evaluate Chlamydia-host cell interactions. Previous
studies have shown that female sex hormones influence susceptibility to microbial infections in
the reproductive tract in a number of species. Other research reported that the susceptibility of
mice to genital infection with HSV-2 varies throughout the stage of the estrous cycle (Gillgrass
et al., 2005; Parr et al., 1994). A study by Gillgrass et al. (2005) demonstrated that mice treated
with progesterone showed higher rates of infection with herpes virus type 2. On the other hand, a
higher rate of genital tract susceptibility to Neisseria gonorrhoeae was reported in mice at
proestrus, when estrogen levels were at the peak (Kita et al., 1981). Rank et al. (1982) clearly
showed that guinea pigs were more susceptible to chlamydial infection when pre-treated with
estradiol, whereas other studies indicated that infection can be established in mice just after
progesterone pretreatment.
A study done by Berry et al. (2004) in a mouse model showed that mice were more susceptible
to chlamydial infection when they were under the influence of progesterone. Kuashic et al.
(1998b) used a rat model of Chlamydia infection, and found similar results reported for mice, as
pre-treatment of animals with progesterone increased susceptibility and inflammation, while
estradiol seemed to protect from this sexually transmitted bacterial infection. Animal model
studies have demonstrated that female mice were most sensitive to gonococcal infection at the
pro-oestrus stage (Fortenberry et al., 1999; Sweet et al., 1986).
Simian immunodeficiency virus (SIV) infections in a monkey model have shown that hormones
influence infection. Estradiol provided protection from SIV infection whereas progesterone led
to increased vaginal transmission and also viral loads (Marx et al., 1996; Smith et al., 2000).
Clinical examination, animal studies, and in vitro studies suggest that HPV infection may be
affected by sex hormones (Shew et al., 2002). In studies using guinea pigs, Pasley et al. (1985c)
and also Rank et al. (1982) reported that estrogen influences the attachment and infectivity of
chlamydial infections. Studies mentioned above emphasize the importance of understanding the
42 | P a g e
role of hormones in susceptibility to sexually transmitted agents. The exact mechanism which
steroid hormones impact on susceptibility in a species-specific manner is not understood.
Collectively these studies suggested that the outcome of infection may directly or indirectly be
regulated by female sex hormones. The interaction between host and microorganisms is a
complex issue and the role played by steroid hormones should be considered as only one of the
many potentially important influential factors. Since in vitro and in vivo studies from several
different laboratories as well as human clinical trials have implicated a role for female sex
hormones, estradiol and/ or progesterone, in enhancing genital chlamydial attachment and
infectivity, we decided to investigate the effect of female sex hormones on chlamydial growth
and bacterial gene expression.
43 | P a g e
Figure 2.1: Experimental plan for chapter 2: examination of the effect of the hormones, estradiol and/or progesterone, on C.trachomatis growth
Calture C.trachomatis
serovar D in 2 cell lines
Hormone preparations and supplementation
ECC-1 Cells HEp-2 Cells
1 week culture in hormone-
reduced conditions
C.tachomatis
Growth and Propagation
26 weeks culture in hormone-
reduced conditions
Titration in normal FCS on ECC-1 cell line
Staining cell monolayer using
CelLabs Chlamydia Cel
LPS
Infecting ECC-1 cells at an MOI
15 for 48 hrs
44 | P a g e
The hormone responsive human endometrial cell line, ECC-1, was grown in charcoal-stripped FCS to remove endogenous steroid hormones. Since essential growth factors and hormones were removed from culture media the cells growth rate reduced considerably. Cell cultures were split into two distinctive groups. The first group represents cells grown in normal conditions with FCS to 100% confluence in T75 flasks. These cells were then passaged in stripped-FCS for 1 week. The second group involved culturing in stripped-FCS for 26 weeks. C.trachomatis serovar D was grown and propagated on HEp-2 cells and titrated on the ECC-1 cell line. ECC-1 cells were grown on 10mm coverslips, within a 24-well plate, and treated with average physiological concentrations of estradiol and/or progesterone for 24, 48 and 72 hour pre-infection and then infected with C.trachomatis at an M.O.I of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Confocal microscopy was used to illustrate altered shape and size of bacterial inclusions under different hormonal conditions.
Experiment I: Investigate host susceptibility and
compare growth of C.trachomatis on ECC-1 in presence/absence of hormones
Experiment II: Analyze changes in inclusions morphology
in presence of hormones
Experiment III: Investigate effect of hormones on
development of chlamydial inclusions (evidence of chlamydial persistence) using
confocal microscopy
45 | P a g e
2.2 Materials and Methods
2.2.1 Cell lines ECC-1: The ECC-1 is a well-differentiated, steroid responsive human endometrial cell line and
was a kind gift from Dr John Fahey (Department of Physiology, Dartmouth Medical School,
New Hampshire, U.S.A.). ECC-1 cells were maintained in phenol red-free 1x Dulbecco‟s
Modified Eagle Medium/Ham‟s F12 nutrient mix (DMEM/F12 – 1:1) (Invitrogen, Carlsbad, CA,
USA) containing 15mM HEPES and 2.5mM L-glutamine, and supplemented with 15% heat-
inactivated charcoal/dextran-treated foetal bovine serum (FBS) (Hyclone, Logan, Utah, USA),
1M HEPES buffer, 500U/ml penicillin G sodium/5,000µg/ml streptomycin sulphate, 100x
200mM L-glutamine (Invitrogen) and 10mM 100x MEM non-essential amino acids (Thermo
Electron Corporation, Melbourne, Vic, Australia).
HEp-2: The HEp-2 cell line is a human epithelial cell line. The HEp-2 cell line was maintained
in 1x DMEM containing phenol red, 4.5g/L D-glucose, 110mg/L sodium pyruvate, and 584mg/L
L-glutamine, and supplemented with 500U/ml penicillin G sodium/5,000µg/ml streptomycin
sulphate (Invitrogen), 1x non-essential amino acids, and 10% heat-inactivated FBS (JRH
Biosciences, Lenexa, Kansas, USA).
2.2.2 C. trachomatis serovar D growth and propagation C. trachomatis Serovar D seed was grown, maintained and further propagated to create C.
trachomatis Serovar D stock. Stock was grown, maintained and propagated in 75cm2 flasks
(Griener Bio-One, Frickenhausen, Germany) containing the HEp-2 cell line, and using antibiotic-
free 1x DMEM medium, containing 4.5g/L D-glucose, 110mg/L sodium pyruvate and 584mg/L
L-glutamine, and supplemented with 1x non-essential amino acids and 10% heat-inactivated
FBS. Stock was stored with the addition of sucrose-phosphate-glutamic acid (SPG) (74.6g
sucrose [Chem Supply, Gillman, SA, Australia] 0.512g potassium dihydrogen orthophosphate
1.237g di-potassium hydrogen orthophosphate [BDH Chemicals, Port Fairy, Vic, Australia] 5µl
46 | P a g e
100x 200mM L-glutamine [Invitrogen], made up to 1L with Milli-Q H2O and pH 7.2), in 75cm2
flasks at -80°C.
Stocks of infected cells were thawed until “slushy”, lysed via sonication for 5 min and vortexing
for 2 min, and then centrifuged at 200xg ( Beckman Coulter, GS-6R ) for 5 min at 4°C to pellet
cell debris. The supernatant was then utilised to inoculate a 75cm2 flask of 70% confluent HEp-2
cells. Flasks containing inoculated HEp-2 cells were centrifuged at 600xg for 45 min at room
temperature (RT) then incubated at 37°C/5% CO2 for 4 hrs. Host cell proliferation was halted
with the addition of 1µl cyclohexamide (1 mg/µl)/1ml DMEM medium. Infections were
monitored for a further 44 hrs at 37°C/5% CO2, before the addition of 15mls ice-cold SPG.
Flasks were immediately stored at -80°C until chlamydial EB purification.
2.2.3 C. trachomatis Serovar D semi-purification C. trachomatis was semi-purified from the infected HEp-2 cells via sonication and vortexing, as
previously stated. The sonicate was centrifuged at 11,200xg for 30 min at 4°C (SORVALL® RC
26 PLUS ultra-centrifuge, SORVALL® SLA-1500 rotor, Thermo Electron Corporation,
Melbourne, Vic, Australia) to pellet chlamydial bodies. The pellet was re-suspended in 10 mls
SPG, snap-frozen in liquid N2, and stored at -80°C until further purification.
2.2.4 Titration of C. trachomatis serovar D ECC-1 cells were plated, in duplicate, with 1x DMEM supplemented with 10% heat-inactivated
FBS, at 1 x 105 cells/ml, in a 24-well plate containing 10mm diameter coverslips. At
approximately 70% confluence, DMEM medium was replaced with 200µl fresh DMEM
containing 20µl of purified chlamydial EBs. Serial dilutions (1:2) were performed and plates
centrifuged at 400xg for 45 min at RT, then incubated at 37°C/5% CO2 for 4 hrs. Host cell
proliferation was suppressed by the addition of 1 ml DMEM medium containing 1 µl
cyclohexamide 1 mg/µl. Plates were incubated for 24 hrs at 37°C/5% CO2. Infected cells were
then fixed and permeabilised with methanol and stored in PBS at 4°C until staining.
47 | P a g e
Infected cells were stained utilising the CelLabs Chlamydia Cel LPS staining kit, containing the
fluorescein isothiocyanate (FITC)-labelled mouse monoclonal antibody specific for chlamydial
lipopolysaccahride (LPS) (CelLabs, Brookvale, Australia), according to manufacturer‟s
instructions. Coverslips containing infected cells were placed cell-side-up on microscope slides
(Livingstone International Pty. Ltd., Rosebery, Australia), and Chlamydia Cel LPS Reagent was
added to coat each coverslip. Slides were incubated in a humidifier for 30 min at 37°C/5% CO2.
Following incubation, coverslips were removed, washed 3x with PBS, and placed back on the
microscope slide cell-side-up. Rhodamine-stained cells and FITC-stained chlamydial inclusions
were then visualised and counted using a ZEISS MC 63A microscope (Zeiss, Oberkochen,
Germany) and ifu/ml calculated. Rhodamine is a fluorone dye which is commonly used as a
tracer dye to stain eukaryotic cells, which bind to eukaryotic cells and appear as a red light under
fluorescent microscopy.
To calculate ifu/ml, the area of one 24-well plate well (cm2) at 40x magnification, was divided
by the area of the field examined (cm2) at 40x magnification, giving fields/well. A minimum of
40 fields were counted, with the average multiplied by fields/well to calculate the number of
chlamydial inclusions/well (ifu/well). Innoculum/well (µl) was calculated from the 1:2 dilutions
performed and the innoculum/ml calculated. The inclusions/well (ifu) was multiplied by the
innoculum/ml to calculate ifu/ml.
2.2.5 Hormone preparation Lyophilised progesterone and 17β-estradiol (Sigma-Aldrich, St. Louis, MO, USA) were
solubilised in absolute ethanol to 1mg/ml stock. Serum levels of female sex hormones, estradiol
and progesterone, fluctuate throughout the menstrual cycle. In this study mean physiological
concentrations of 17β-estradiol (200pg/ml) and progesterone (20ng/ml), adapted from Williams
et al. (2001) were further diluted using phenol red-free 1x DMEM/F12 medium (1:1) ( 1:1 was
chosen as starting point to investigate effect of both hormones toghetehr) (Invitrogen),
supplemented with 10% charcoal/dextran-treated FBS (Hyclone).
48 | P a g e
2.2.6 Hormonal suppliment of FRT cell lines Once the ECC-1 cells had reached 100% confluence, average physiological concentrations of
17β-estradiol, progesterone, and a combination of 17β-estradiol and progesterone (1:1) were
added to respective wells. Although physiological concentration of progesterone is higher than
estradiol, in this study a combination of 1:1, estradiol and progesterone, was chosen as starting
point to merely determine effect of both hormones togheter. Cells were then incubated for 24 hrs
before continuance of experiments.
2.2.7 Statistical analysis To determine the percentage of cells infected the number of inclusions and the total number of
cells per field of view was counted. These experiments performed in duplicate and each time 25
fields were compared and analyzed. The mean inclusion counts with standard errors were
determined (adapted from Bessho et al. method) (Bessho et al. 2001). Using Prism software the
standard error of the mean (SEM) were measured of how far each field mean was likely to be
from the true population mean. The SEM was calculated by this equation:
The difference between the percentages of infected cells was compared between groups by using
Prism Statistical Software. These data determined by statistically measuring the individual
samples using student‟s t-test with a P-value <0.05 assigned as significantly different.
49 | P a g e
2.3 Results To determine whether the female sex hormones affect ECC-1 cells‟ susceptibility to C.
trachomatis infection, susceptibility to Chlamydia under different hormonal conditions, estradiol
and/or progesterone, was examined.
In this part of the project, we used a human endometrial cell line, ECC-1, where the endogenous
source of hormones was removed to examine how the hormonal environment altered host
susceptibility to C.trachomatis serovar D. In order to investigate how sex hormone
supplementation affects susceptibility to genital chlamydial infection, ECC-1 cells were infected
with C.trachomatis serovar D at a multiplicity of infection of 15 ( Titrated on ECC-1).
2.3.1 Growth of C.trachomatis in ECC-1 cell line under normal conditions In the first part of this experiment the host susceptibility to chlamydial infection was determined
on ECC-1 cells, which were grown in normal FCS. Our data illustrated that by using normal FCS
containing essential hormones and growth factors, the percentage of ECC-1 cells infected with
C. trachomatis serovar D was approximatly 98.3 % (Figure 2.2).
50 | P a g e
Figure 2.2: Confocal micrographs of C.trachomatis (in normal FCS)
A1 A2 Figure 2.2: Confocal micrographs of C.trachomatis inclusions labelled with FITC conjugated anti-chlamydial LPS and counterstained host cells with Rhodamine. Scale bars represent 20 µm. C.trachomatis infection of ECC-1 cells grown in 10 % normal FCS with inclusion size of 10 to 15 µm. [this result was obtained by counting the number of inclusions per field (25x2 for each sample)].
51 | P a g e
2.3.2: Effect of hormone addition on infection of C.trachomatis in ECC-1 cells grown for 1 week in charcoal-stripped FCS In the second part of the experiment, ECC-1 cells were cultured in hormone-reduced medium
only for 1 week to remove endogenous hormones. Inclusion counts made by light and confocal
microscope consistently indicated there were higher percentages of cells infected with
C.trachomatis serovar D in hormone-supplemented sample compared to the sample grown in
charcoal-stripped media. Such a low level of infectivity and inclusions observed in control
samples indicated dramatic differences among hormone-supplemented and samples grown in
charcoal-stripped media. In the absence of any hormones, ECC-1 cells were approximately 2-
fold less susceptible (98.3 to 48 %) to infection with C.trachomatis compared to cells grown in
complete FCS (Figure 2.3).
Figure 2.3: Percentage of ECC-1 cells infected (1 week passaged in strriped FCS)
Control E P
P+E
0
20
40
60
80
100
Treatment Groups
% o
f ce
lls in
fect
ed
Fig 2.3: Influence of hormone supplementation on C.trachomatis serovar D infectivity in human epithelial cell line, ECC-1 with 24 hrs hormonal pre-supplement. Control represents no hormone supplement, E represents 17β-estradiol, P represents Progesterone and E+P represents combination of both hormones. Standard error of the mean (SEM) for Control, E, P, P+E samples were: 0.64, 0.66,
52 | P a g e
1.51 and 0.67 respectively. Difference between each group sample was tested and P< 0.05 was obtained.
The data presented demonstrated that with the human endometrial cell, ECC-1, infectivity was
regulated by female sex hormones when cells were depleted of hormones for 1 week. Both
hormones estradiol and/or progesterone resulted in higher infection levels in ECC-1 cells than
control (no hormone-added). Addition of estradiol alone had the highest impact on the level of
infectivity by 1.7-fold increase (48 to 83.2 %). The percentages of inclusion-containing cells in
samples supplemented with progesterone alone were approximately 1.4-fold less than any other
hormonal conditions. The combination of both hormones (E2 and P) had an intermediate affect
on susceptibility between estadiol and progesterone (74.8 %) (Figure 2.3).
Figure 2.4: Confocal micrographs of C.trachomatis (1 week passaged in stripped FCS)
A B.
C D .
53 | P a g e
Figure 2.4: The ECC-1 cell line was grown to 100% confluence on 10mm coverslips in a 24-well plate, and infected with C. trachomatis Serovar D at an M.O.I of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Cells were grown in hormone-reduced conditions (by passaging in charcoal striped FCS for 1 week) and pre-treated with hormones 24 hrs before infection. Scale bars represent 20 µm. A represents the no hormone [negative (-ve)] control, no hormone suppliment. B represents estradiol-supplimented, C represents progesterone-treated and D represents combination of both hormones.
The levels of chlamydial infectivity of human endometrial epithelial cells was greater in
estrogen-treated than in progesterone-treated cells. In fact, the inclusion count in progesterone-
treated ECC-1 seeded with 5 x 105 cells and infected at an M.O.I of 15 was lower than in ECC-1
treated with estradiol. When cells were grown and maintained in the normal human physiological
concentration of estrogen (200 pg/ml), chlamydial infectivity was increased up to 83.2%. In
other words, addition of estradiol restored infectivity almost to a level seen when cells were
grown in normal complete FCS; whereas addition of progesterone did not restore infectivity. The
average size of inclusions observed in this experiment was 10 to 15 µm which was similar to
what was seen in normal conditions (complete FCS).
54 | P a g e
2.3.3: Effect of hormone addition on infection of C.trachomatis ECC-1 cells cultured for 26 weeks in charcoal-stripped FCS In this part of the experiment, ECC-1 cells were cultured in hormone-reduced medium for 26
weeks to be sure all endogenous hormones were removed. Both hormones estradiol and/or
progesterone resulted in significantly higher infection levels in ECC-1 cells than control (no
hormone-added). Susceptibility of human endothelial, ECC-1, increased by approximately 2-
fold in response to E2 and/or P compared to cells grown in charcoal-stripped media. Endothelial
cells, when exposed to estradiol, were significantly more susceptible to chlamydial infection than
endothelial cells that had been grown in stripped FCS medium alone (39.9 % to 84.3 %) (Figure
2.5).
Figure 2.5: Percentage of ECC-1 cells infected (26 weeks passaged in strriped FCS)
Contr
ol E PP+E
0
20
40
60
80
100
Treatment Groups
% o
f cells
in
fecte
d
Figure 2.5: Influence of hormone supplementation on C.trachomatis serovar D infectivity in the human endothelial cell line, ECC-1 with 24 hrs hormonal pre-supplement. Control represents no hormone suppliment, E represents 17β-estradiol, P represents Progesterone and E+P represents combination of both hormones. Standard error of the mean (SEM) for Control, E, P, P+E samples were: 0.66, 0.65, 0.61 and 0.54 respectively. Difference between each group sample was tested and P< 0.05 was obtained.
55 | P a g e
Interestingly, there were approximately an identical number of inclusions in the samples grown
in charcoal-stripped media for 1 week and 26 weeks as both showed less than 50% infectivity.
Figure 2.6: Confocal micrographs of C.trachomatis (26 weeks passaged in stripped FCS)
A B .
C D . Fig. 2.6: Cells were grown in hormone-reduced conditions (by passaging in charcoal striped FCS for 26 weeks) and pre-treated with hormones 24 hrs before infection. The ECC-1 cell line was grown to 100% confluence on 10mm coverslips in a 24-well plate, and infected with C. trachomatis Serovar D at an M.O.I. of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Scale bars represent 20 µm. F1, F2 represents the negative (-ve) control, no hormone suppliment. G1, G2 represents estradiol-added, H1, H2 represents progesterone-treated and I1, I2 represents combination of both hormones.
56 | P a g e
Twenty four hours pre-supplement of ECC-1 with estradiol and/or progesterone made no
significant difference to the inclusion morphology (with average size of 10 to 15 µm), but the
inclusions count was higher than in cells grown in charcoal-stripped media. Our data clearly
showed that the ECC-1 cell line grown in estrogen-supplemented media were slightly more
susceptible (~ 85%) to C.trachomatis serovar D infectivity than were progesterone-supplemented
epithelial cells, where chlamydial infectivity increased by 77 %.
57 | P a g e
2.3.4: Effect of extended hormone pre- supplement (48 and 72 hrs) on C.trachomatis infection of ECC-1 cells cultured for 26 weeks in charcoal-stripped FCS
The length of time cells were pre-supplemented with hormones was increased and the effect of steroid
hormones on chlamydial growth and inclusion morphology was examined. Interestingly, the results
indicated that there were identical numbers of inclusions after both 48 and 72 hrs pre-hormone-
suppliment. For example, estradiol addition resulted in 89.1 and 90 % infectivity in the 48 and 72 hrs
hormone pre-treated samples respectively. Progesterone supplementation also increased infection
levels to 82.2 % and 84.9 % in the 48 and 72 hrs progesterone pre-supplemented samples respectively
(Figure 2.7). Therefore, neither 48 hrs nor 72 hrs pre-supplement with progesterone and/or estrogen
affected the amount of chlamydial infectivity in ECC-1 cells.
Figure 2.7: Percentage of ECC-1 cells infected (48 hrs and 72 hrs pre-supplemented with hormones)
Control
E-48
E-72
P-48
P-72
P+E-48
P+E-72
0
20
40
60
80
100
Treatment Groups
% o
f cel
ls in
fect
ed
Figure 2.7: Influence of hormone supplementation on C.trachomatis serovar D infectivity in the human epithelial cell line, ECC-1 with 48 hrs and 72 hrs hormonal pre-supplement. E represents 17β-estradiol, P represents Progesterone and E+P represents combination of both hormones. Standard error of the mean (SEM) for 48hrs E, P, P+E samples were: 0.61, 0.69 and 0.50 respectively and SEM for 72 hrs E, P, P+E samples were: 0.49, 0.69 and 0.66 respectively. Difference between each group sample was tested and P< 0.05 was obtained.
58 | P a g e
In addition to growth rate and infection level it was also decided to examine the morphology of C.trachomatis inclusions following pre- suppliment with steroid hormones.
Figure 2.8: Confocal micrographs of C.trachomatis (48 hrs hormone pre-supplementation)
A B .
C.
Figure 2.8: The ECC-1 cell line was grown to 100% confluence on 10mm coverslips, within a 24-well plate, and infected with C. trachomatis Serovar D at an M.O.I. of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Cells were grown in hormone-reduced conditions (by passaging in charcoal striped FCS for 26 weeks) and pre-treated with hormones 48 hrs before infection. Scale bars represent 20 µm. A represents estradiol-supplemented, B represents progesterone-treated and C represents combination of both hormones.
59 | P a g e
ECC-1 cells infected with C.trachomatis after 48 and 72 hrs of hormone conditioning contained
larger inclusions than cells conditioned by 24 hrs pre-treated with hormones. In both cases
infection was stopped 48 hrs post infection. This confirms that C.trachomatis seeded on
epithelial cells under extended hormone supplemented culture conditions have the potential to
form larger inclusions.
The result from this study showed that the duration of hormone supplementation had a less
noticeable influence on the infectivity in this epithelial cell as it was shown that the same percent
of cells were infected; however chlamydial inclusion formation was obviously different from
control cells. The average size of inclusions in normal condition (complete FCS) and after 24 hrs
of hormone supplementation were approximately 10 to 15 µm, but after 48 hrs of hormone
supplementation it was observed that the majority of the inclusions were larger than 20 µm,
Figure 2.8.
60 | P a g e
Once again, extended time supplementation with steroid hormones (72 hrs pre-supplement) increased the size of inclusions to 25 µm on average (Figure 2.9).
Figure 2.9: Confocal micrographs of C.trachomatis (72 hrs hormone-supplemented)
A B.
C .
Figure 2.9: The ECC-1 cell line was grown to 100% confluence on 10mm coverslips, within a 24-well plate, and infected with C. trachomatis Serovar D at an M.O.I. of 15. Infections were halted at 48 hrs, with cells fixed and permeabilised with methanol. Cells were stained with rhodamine (red), while inclusions were stained with fluorescein isothiocyanate (FITC)-conjugated anti-chlamydial lipopolysaccharide (LPS) (green). Cells were grown in hormone-reduced conditions (by passaging in charcoal striped FCS for 26 weeks) and pre-treated with hormones for 72 hrs before infection. Scale bars represent 20 µm. A represents estradiol-supplemented, B represents progesterone-treated and C represents combination of both hormones. 72 hrs hormonal pre-supplement, chlamydial inclusions increased further in size.
61 | P a g e
Table 2.1: Summary of influence of hormone supplementation on C.trachomatis serovar D infectivity and growth
Type of FCS Pre- suppliment with hormones
Hormonal Conditions
Average size of inclusions (µm)
Level of Infectivity (%)
ECC-1 cells grown in normal FCS N/A Normal 10 to 15 98.3
ECC-1 cells grown in stripped FCS for 1 week
24 hrs
Control 10 to 15 48
E 10 to 15 83.2
P 10 to 15 61.4
P+E 10 to 15 74.8
ECC-1 cells grown in stripped FCS for 26 weeks
24 hrs
Control 10 to 15 39.9
E 10 to 15 84.2
P 10 to 15 77
P+E 10 to 15 80
ECC-1 cells grown in stripped FCS for 26 weeks
48 hrs
E > 20 89.1
P > 20 82.2
P+E > 20 86.5
ECC-1 cells grown in stripped FCS for 26 weeks
72 hrs
E > 25 90
P > 25 84.9
P+E > 25 87.5 Control: sample grown in charcoal-stripped media E: Estradiol, P: Progesterone, P+E: combination of both hormones
62 | P a g e
2.3.6 Microscopic evidence of chlamydial persistence in hormone supplimented cultures Immunocytochemistry and confocal microscopy of C.trachomatis grown in the presence of
estradiol revealed abnormal large RBs contained within inclusions compared to the acute
cultures, which is one of the well known characteristics of chlamydial persistence (Figure 2.10).
This characteristic was consistent with previous reports of the C. trachomatis morphology during
antibiotics and IFN-γ induced persistence (Beatty et al., 1993; Kramer and Gordon 1971). In
marked contrast, in the presence of a combination of hormones and also progesterone alone there
were no signs of chlamydial persistence. This data are not complete and further investigation by
using Transmission Electron Microscopy (TEM) is required to confirm this result.
Figure 2.10: Abnormal morphology of chlamydial inclusions (enlarged RBs) under estradiol suppliment.
Figure 2.10: The estradiol supplemented sample showed microscopic evidence of persistence.
63 | P a g e
2.4 Discussion Using a rat model Kaushic et al. (2000) found that in rats infected with C.muridarum at either
estrus or diestrus, without progesterone pre- suppliment, no chlamydial inclusions were observed
in either the uterus or vagina, although an enhanced local immune response was noted. In
addition, following progesterone-supplement, rats were more susceptible to C. muridarum
infection. Chlamydial inclusions were observed in the uteri and vaginas of infected animals and
at the same time immune responses could be identified both locally and systemically.
Interestingly, they have found that rats were more susceptible to genital chlamydial infection
when exposed to progesterone pre-supplement (Kaushic et al., 2000). These results contrast with
data obtained from the guinea pig model, where a higher number of animals were sensitive to
chlamydial infection in the estradiol-treated animals than in animals without hormone
suppliment and the animals receiving progesterone (Pasley et al., 1985a, 1985b). Interestingly,
studies of chlamydial infection in humans revealed an association between chlamydial infection
and stage of the menstrual cycle (Ghanem et al., 2005; Sweet et al., 1986). For example, a higher
rate of chlamydial susceptibility was observed in the proliferative part of the menstrual cycle
when estradiol levels were high. In addition, hormonal contraceptives have also been shown to
enhance susceptibility to chlamydial infections and other STDs (Washington et al., 1985).
These previous studies provided direct evidence that the hormonal environment at the time of
pathogen exposure can have a distinct effect on the outcome of a microbial infection in the
genital tract. In the current experiment, we examined the effect of the hormonal environment in
(a) regulating ECC-1 susceptibility, (b) inclusions morphology and (c) the type of inclusions that
develop.
In many in vitro studies, cell culture experimental work with human chlamydial isolates has been
performed with McCoy cells. It should be considered that McCoy cells are not of reproductive
tract origin, therefore not a natural target for C.trachomatis infection. Instead, for many
experimental analyses HeLa cells were used, which are very sensitive to C.trachomatis infection,
but they are less representative of primary, differentiated target epithelial cells. As an alternative
a few studies have been performed with primary, hormone-responsive human endometrial
epithelial cells. In this study we used a well known hormone responsive cell line, the human
uterine cell line ECC-1.
64 | P a g e
In vitro studies showed that both estradiol and progesterone regulate the other‟s receptors and
antagonize the biological effects of each other (Gillgrass et al., 2005; Katzenellenbogen, 2000).
As a result it is essential to examine the outcome of each hormone separately before combining
their effects. In the current experiment, we examined the effect of estradiol and progesterone
separately and in combination by using the average physiological concentration of the hormones
across the reproductive cycle. Our observations support previous in vitro and in vivo results
which suggested that chlamydial infection might be modulated by steroid hormones.
The influence of exogenously supplied hormones on ECC-1 cells at various time points were
compared, and the results showed that only in cells cultured 1 week in stripped FCS,
progesterone-supplemented cells had a lower susceptibility to infection compared to when they
were supplemented with exogenous estrogen. The results showed that in cells passaged in
charcoal stripped FCS for 1 week, when it was administered alone, estradiol made the ECC-1
cell more susceptible to infection with C.trachomatis. In this part of study, the estradiol effect
was dominant on susceptibility when the combination of both hormones (E + P) was used. It was
demonstrated that progesterone by itself did not appear to have a significant role in regulating
susceptibility in cells grown for 1 week in stripped FCS.
The mechanism by which estradiol made ECC-1 cells more susceptible is not clear. One of the
probable mechanisms which may play a role in the differences in host susceptibility seen under
different hormonal conditions may be differential expression of receptors on epithelial cells,
which mediate chlamydial entry. The other well-accepted mechanism is that during estrus and
under the influence of estradiol, the vaginal and endocervical epithelium is several layers thick,
making it easier for viral and/or bacterial entry (Gallichan and Rosenthal, 1996). While this is a
possible explanation that may be true when cells are only under the influence of estradiol, there
may be other factors involved in host susceptibility.
Chlamydial infection is initiated by contact, attachment and entry of infectious elementary
bodies (EBs) into the host epithelial cell. The exact system of attachment and entry is still not
clear, even though numerous likely possibilities have been suggested. Zhang and Stephens
(1992) data suggested that a heparan sulfate-like glycosaminglycan on the surface of EBs binds
to a heparan sulfate receptor on the epithelial cells. Other studies by Su and Caldwell (1998)
have provided more information about the probability that chlamydial MOMP is the adhesion
65 | P a g e
molecule that attaches to heparan sulfate proteoglycans on the epithelial surface. Of these above
mentioned, the glycosaminglycan- mediated mechanism is the most commonly involved (Zhang
and Stephens 1992) and it may be under the influence of steroid hormones. Hence, from the
above data and the present study results, it seems that steroid hormones, particularly estradiol,
increase the probability that a potentially infective EB enters into a cell and gives rise to a
productive infection.
Although the number of inclusions is known to increase in the presence of estrogen-supplement
in our experiment, it should be highlighted, that the estrogen-enhanced chlamydial infectivity
reported may not involve bacteria at all but be the result of physiological effects of estrogen on
the target epithelial cell, i.e. epithelial hyperplasia. Therefore, we should consider the possible
mechanisms by which estradiol might affect the metabolism of mammalian cells in such a way
as to change their susceptibility to infection with intracellular parasites, such as Chlamydia spp.
The physiological effect of estrogen may also involve both the surface plasma membrane as well
as intracellular alterations/modifications (Guseva et al., 2005).
Our result indicated, addition of steroid hormones at 24 , 48 and 72 hrs before infection of the
cells cultured for 26 weeks in stripped FCS, restored infectivity almost to a level seen when cell
were grown in normal complete FCS. Therefore, steroid hormones may influence factors present
in the epithelium or the surrounding tissue to alter susceptibility that could increase the number
of infected cells. Another possibility is that the entry of C.trachomatis into the genital epithelium
could be modified by the expression of bacterial receptors that may be hormonally regulated.
The clinical observations also emphasized that steroid hormones directly or indirectly affect the
growth of C. trachomatis either by altering the metabolism of the cell in which C. trachomatis
was growing (Bushell and Hobson 1978). The effects of steroid hormones such as estradiol vary
considerably from one cell line to another. However, the specific action of these hormones has
been attributed to a common pathway in mammalian cells in which the hormone molecule enters
the cell and combines with a specific cytoplasmic receptor molecule (Bushell and Hobson 1978).
These above mentioned possibilities, need to be examined to fully understand the mechanism by
which female sex hormones regulate susceptibility.
66 | P a g e
The effect of sex hormones described in the present study was obtained with a single exposure of
infected cells to extracellular concentrations of the hormone which were similar to average levels
in human serum across the reproductive cycle. It is likely that these hormone concentrations will
be exceeded during pregnancy, and that the local concentration of hormones in inflamed tissues
may also be higher than those found in general circulation.
The results from this study also showed that, the duration of hormone supplement had a less
noticeable influence on the infectivity in this epithelial cell; however, chlamydial inclusion
morphology was noticeably different from control cells. ECC-1 cells infected with C.trachomatis
after 48 and 72 hrs of hormone conditioning contained larger inclusions than cells conditioned by
24 hrs pre-supplementation with hormones. This confirms that C.trachomatis seeded on
epithelial cells under extended hormone supplemented culture conditions favors the formation of
large inclusions. More infectious particles may enter the cells due to an enhancement of
adsorption to cells or of cellular endocytotic mechanisms. This finding is possibly a consequence
of EB attachment in estrogen- and progesterone-dominant phases (Guseva et al., 2003). Guseva
et al. (2003) suggested that EBs were able to bind to the surfaces of epithelial cells when
progesterone was at its highest concentration but did not enter the cells or form inclusions. In
2002, Davis et al.’s study on a component of the estrogen receptor complex (protein disulfide
isomerase) was associated with C. trachomatis serovar E suggested that EBs bind to this protein
on the apical membrane surface of the human endometrial epithelial cell line, HEC-1B (Davis et
al., 2002). In our present study, estradiol might up-regulate the estrogen receptor on the surface
of ECC-1 cells and therefore increase the EB attachment and host susceptibility.
A study by Sweet et al. (1987) revealed a significant prediction for development of salpingitis, as
a complication of chlamydial infection, was if infection occurred in the early, estrogen-dominant
phases of the cycle. Results of the clinical tests of the enhancing role of estrogen on chlamydial
infection in the upper genital tract have been confirmed by animal models (Guseva et al., 2005).
Rank et al. (1993) also found that at the time of chlamydial infection in the upper genital tract
where high estradiol levels occurred, a considerably higher percentage of guinea pigs developed
chronic inflammation, fibrosis and tubal dilation of the oviducts. Kaushic et al. (2003) suggested,
depending on the hormone treatment, susceptibility of mice to genital herpes infection can differ
significantly. In comparison with normal conditions, untreated mice, progesterone-treatment
67 | P a g e
increased susceptibility to HSV-2 significantly both at diestrus and estrus. On the other hand,
estradiol-treated animal protected from viral infection and did not show any vaginal pathology
(Gillgrass et al., 2005).
Lastly, and by no mean least, more verification of our findings was obtained by Guseva et al. in
a swine model (Guseva et al., 2003). As the organ physiology of swine is very similar to
humans, thus results from swine are more reliable than mice, rats and guinea pigs. The chance of
C. suis S45 infection in both luminal and glandular epithelial cells from female swine were
greater when the epithelial cells were obtained in the estrogen-dominant phase versus the
progesterone-dominant phase. For instance, cervical luminal epithelial cells, isolated in the early
diestrous and pro-estrous stages, were ten-fold more susceptible to infection than cervical cells
obtained from swine at the peak of progesterone activity (days 12 to 15). They showed the
luminal epithelial cells isolated from the uterus can be easily infected with Chlamydia on day 1
of the cycle, which was the estrogen-dominant phase, and the subsequent rate of infectivity of
these cells was correlated with fluctuations in the hormonal levels. Minimal susceptibility to C.
suis infection was reported throughout the progesterone-dominant phase in the Guseva et al.
study (Guseva et al., 2003). The above data suggests a possible role for greater estrogen activity
through these pre- and post-progesterone high concentration stages.
In our experiments, preliminary evidence of long-term chlamydial infections, termed persistent
infection in cell culture systems was observed, although our data are not complete and further
investigation by using Transmission Electron Microscopy (TEM) is required to confirm this
result. Persistent infections are characterized by the capacity of Chlamydia to enter a
metabolically inactive and non-infectious state and later on re-start productive growth with the
eventual release of infectious particles, EBs (Hogan et al., 2004). Persistent chlamydial
infections can develop in in vitro cell culture in response to nutrient starvation (lack of some
amino acids or iron), antibiotic treatment, and a low dose of IFN-γ-treatment. Typical chlamydial
persistence inclusions contain aberrant enlarged RBs which have not differentiated further into
infectious EBs. In our project, we observed evidence to suggest that chlamydial persistence
occurs during hormonal supplementation, estradiol in particular, in the in vitro model of ECC-1
infection. This evidence is based on various types of observations, including confocal
microscopy (abnormal large RBs), microarray data and real time PCR (Reviewed in chapter 3).
68 | P a g e
To summarize, our results illustrated that, except in cells cultured for 1 week in stripped FCS in
which progesterone has less effect on susceptibility, both hormones estradiol and/or progesterone
increase susceptibility to genital chlamydial infection. The effects of progesterone on the
infectivity of C.trachomatis in the ECC-1 cells varied between the first and second group, 1
week charcoal striped FCS and 26 weeks charcoal striped FCS supplemented media, although
the mechanism by which this occurred is not known. The results from this study showed that
progesterone and/or estradiol supplementation not only alter host susceptibility, allowing them to
be more easily infected with C.trachomatis, but estradiol also changes the morphology of
inclusion in the treated ECC-1 cells. The differences seen under different hormone conditions in
the infectivity make this a very useful system to identify the mechanism of susceptibility and
inflammation. The data from this study raise questions regards to the effect of hormones on
change in susceptibility of women to STDs. These findings have implications for future vaccine
strategies against genital infections. Using knowledge about the hormonal environment might
directly or indirectly help us to induce protective immune responses which may lead to more
effective vaccines.
Our data indicated that the most noticeable effect of hormone supplementation on epithelial cells
chlamydial infectivity was in the presence of estradiol. Therefore, we can conclude that at the
peak of estrogen concentration (proliferative phase) the chance of chlamydial infection is higher
than other phases. We hope that these results lead to further study on the influence of estradiol
and/or progesterone on chlamydial interaction with host genital epithelial cells. Results from this
study demonstrated that sex hormones modulate the hormone-responsive human genital
epithelial cell, ECC-1 susceptibility to C. trachomatis infection. Besides the levels of infectivity
of epithelial cells with C.trachomatis serovar D being affected by steroid hormones, the
morphology and size of chlamydial inclusions were also affected by hormone supplementation.
Since C.trachomatis infections of female genital tracts are often asymptomatic, and subsequent
re-infections lead to inflammatory responses with pathological sequelae such as pelvic
inflammatory disease, scarring of fallopian tubes and ectopic pregnancy, these findings have
important implications to reduce the health burden of such diseases. Further characterization of
this model could provide unique information to improve our understanding about asymptomatic
chlamydial infections, which have been difficult to study because of the lack of an appropriate
69 | P a g e
animal model. Further investigations are required to characterize the chlamydial infection under
different hormonal conditions to observe if inflammation persists or inclusions are regulated by
in vivo environment.
In conclusion, it is possible that the enhancement of chlamydial infection in ECC-1 cells
demonstrated here may not only be of practical application to the laboratory diagnosis of these
common infections, but may form a useful experimental model for the further study of hormonal
influences on natural infection. This knowledge is crucial for developing better prophylactic and
therapeutic strategies against these infections in women. An effective vaccine against chlamydial
infection would be an ideal choice for preventing transmission.
70 | P a g e
Chapter 3
Effect of the female sex hormones on C.trachomatis gene expression
71 | P a g e
72 | P a g e
3.1 Introduction Studies using animal models of genital tract Chlamydia infection suggested that the hormonal
status of the genital tract epithelium at the time of exposure may influence the outcome of
infection. For example, in the commonly used mouse model involving C. muridarum infection,
pre-treatment of animals with progesterone was required to achieve infection of all animals
(Rank 1994; Berry et al., 2004b). Conversely, guinea pigs were more susceptible to infection
following pre-treatment with estradiol (Rank et al., 1982). Using a rat model Kaushic and
colleagues found that in rats infected at either estrus or diestrus, without progesterone pre-
treatment, no chlamydial inclusions were observed in either the uterus or vagina (Kaushic et al.,
1998a). In an in vitro model of infection of HeLa cells with C. trachomatis, estradiol pre-
suppliment of cells enhanced both the adherence of chlamydial elementary bodies (EBs) to the
host cells as well as the development of chlamydial inclusions (Bose and Goswami 1986). Oral
contraceptive use also increased the risk of contracting chlamydial infections compared to
women not using contraception (Baeten et al., 2001a). Collectively, these data showed that the
outcome of chlamydial infection is partly determined by the hormonal status of the epithelium at
the time of exposure.
Recently it has become evident that Chlamydia can enter a chronic or persistent infectious form
that may be reactivated at a later stage. This form can be induced in vitro by treatment of
infected cells with some antibiotics or with low doses of IFNγ (Hogan et al., 2004). The patterns
of chlamydial gene expression differ between the normal acute infectious form and the persistent
infectious form (Hogan et al., 2003) and it has been suggested that incomplete antibiotic
eradication of infections or an inappropriate immune response to a primary infection may set the
stage for a cycle of persistent/chronic infections that might reactivated periodically and as a
result drive an ongoing inflammatory immune response over months or years that ultimately
causes salpingitis and PID.
In addition to acute chlamydial infections, Chlamydia is linked with a series of chronic diseases
which were characterized by inflammation and/or scarring, causing significant damage to the
host. Recurrent chlamydial disease can be caused by repeated infections or persistence of the
bacteria following unresolved infections. In fact, the increasing number of chlamydial infections
and transient immunity monitored post infection makes it hard to differentiate between persistent
73 | P a g e
infection and re-infection (Brunham 1999). Nonetheless, characterization of the in vitro
persistent phase of Chlamydiae and multiple lines of in vitro evidence suggested that Chlamydia
persist in an altered form during chronic disease (Hogan et al., 2004).
3.1.1 In vitro chlamydial persistence Chlamydial persistence has been described as a viable but non-cultivatable growth stage
resulting in a long-term relationship with the infected host cell (Beatty et al., 1994). Such
characteristics can be established in vitro, by inducing host cells with external stress. The
different in vitro persistence systems usually share altered chlamydial growth characteristics, for
instance a loss of infectivity and the development of relatively small inclusions containing less
chlamydial particles (Hogan et al., 2004).
Previous studies demonstrated abnormal chlamydial development following antibiotic treatment.
It is well known that agents that target bacterial protein or RNA synthesis are able to inhibit
chlamydial differentiation either from EB to RB or from RB to EB, depending on the time they
were added to an in vitro infection (Moulder 1991). In contrast to persistence induced by
antibiotics, the reduction of crucial nutrients in cell culture medium temporarily or permanently
arrested both Chlamydia and their host cells growth until the missing nutrients were replaced
(Moulder 1991). For instance, C.trachomatis grown in McCoy cells became persistent in
response to the removal of glucose from the cell culture medium, also losing infectivity and
showing abnormal morphology (Harper et al., 2000). Treatment of in vitro chlamydial infections
with cytokines, especially IFN-γ, indirectly provided a system of deficiency-induced persistence
that could possibly reflect in vivo events.
The recent finding that Chlamydia can enter a chronic/persistent infectious form that can be
reactivated, perhaps many times, over a period of months or years following infection is cause
for alarm. The fact that this form of infection can be induced, in vitro at least, by the antibiotics
commonly used to treat acute infections and by cytokines produced in response to infection itself
emphasizes the need for a greater understanding of how infection is linked to the development of
inflammatory upper tract disease in many infected individuals.
74 | P a g e
Previous data have demonstrated that the metabolic characteristics of persistent chlamydiae were
not the same as those of actively growing organisms (Beatty et al., 1994; Jones et al., 2001). The
data from Hogan et al. (2004) combined with Gérard et al. (2002), suggested that two major
hallmarks of persistence were inhibited RB-to-EB differentiation associated with shut down
(down-regulation) of late genes and impaired RB development caused by blockages in key
pathways. The omcB and trpB genes are currently the most reliable general markers of
chlamydial persistence. In addition, few other genes involved in chlamydial persistence revealed
by Gérard et al. (2002), (a) two genes encode glycolysis pathway (pyk, yggV) (b), two genes
(cydA, cydB) function in electron transport system, and (c) two genes encode production of
tryptophan syntheses subunits.
A previous study by Jane Finnie (Honors thesis, 2006, University of Newcastle) showed that the
host innate immune response to infection is regulated by changes in sex hormones during the
reproductive cycle. If the hormonal status of the epithelium at the time of infection can influence
the immune response then this may directly or indirectly affect the type of chlamydial infection
that develops following exposure. Therefore, for the first time ever we tested the hypothesis that
changes in sex hormones directly influence the type of chlamydial infection (resolving versus
chronic) that develops in the target epithelium, which may ultimately determine the pathological
outcomes of infection. This study determined how the sex hormones, estradiol and progesterone,
affect the type of chlamydial infection that develops.
75 | P a g e
Figure 3.2: Experimental plan for Chapter 3: preliminary transcriptional analysis of the C.trachomatis infection model under different hormonal conditions
Culture C.trachomatis
serovar D in 2 cell lines
Hormones preparation and
supplements
ECC-1 Cells HEp-2 Cells
1 week culture in hormone-
reduced conditions
C.tachomatis
growth and propagation
26 weeks culture in hormone-
reduced conditions
Infecting ECC-1 cells at an MOI
15
Total RNA extraction using
Trizol
76 | P a g e
The hormone responsive human endometrial cell line, ECC-1, was grown in charcoal-stripped FCS to remove endogenous steroid hormones. Since essential growth factors and hormones were removed from culture media the cells growth rate reduced considerably. Cell cultures were split into two distinctive groups. The fist group represents cells grown in normal conditions with FCS to 100% confluence on T75 flasks. These cells were then passaged in stripped-FCS for 1 week. The second group involved culturing in stripped-FCS for 26 weeks. C.trachomatis serovar D was grown and propagated on the HEp-2 cells and titrated on the ECC-1 cell line. ECC-1 cells were cultured with average physiological concentrations of estradiol and/or progesterone for 24 hours pre-infection and then infected with C.trachomatis at an M.O.I of 15. 48 hrs post-infection, RNA was harvested from ECC-1 following standard procedures. Dynabeads® (poly A+ purification kit) were used to remove eukaryotic RNA. The bacterial RNA was then subjected to microarray analysis. The microarrays were performed in duplicate and validated with qRT-PCR.
Eukaryotic RNA was removed
using Dynabead technique
Microarray experiment performed in duplicate
RNA labelled with ENZO RNA transcript labelling kit and hybridized to chlamydial whole
genome using Affymetrix array
Validate microarray data using q RT-PCR
Analysis of genes differentially regulated by
hormones
77 | P a g e
3.2 Methods
3.2.1 Cell lines
ECC-1: The ECC-1 is a well-differentiated, steroid responsive human endometrial cell line and
was a kind gift from Dr John Fahey (Department of Physiology, Dartmouth Medical School,
New Hampshire, U.S.A.). ECC-1 cells were maintained in phenol red-free 1x Dulbecco‟s
Modified Eagle Medium/Ham‟s F12 nutrient mix (DMEM/F12 – 1:1) (Invitrogen, Carlsbad, CA,
USA) containing 15mM HEPES and 2.5mM L-glutamine, and supplemented with 15% heat-
inactivated charcoal/dextran-treated foetal bovine serum (FBS) (Hyclone, Logan, Utah, USA),
1M HEPES buffer, 500U/ml penicillin G sodium/5,000µg/ml streptomycin sulphate, 100x
200mM L-glutamine (Invitrogen) and 10mM 100x MEM non-essential amino acids (Thermo
Electron Corporation, Melbourne, Vic, Australia).
HEp-2: The HEp-2 cell line is a human epithelial cell line. The HEp-2 cell line was maintained
in 1x DMEM containing phenol red, 4.5g/L D-glucose, 110mg/L sodium pyruvate, and 584mg/L
L-glutamine, and supplemented with 500U/ml penicillin G sodium/5,000µg/ml streptomycin
sulphate (Invitrogen), 1x non-essential amino acids, and 10% heat-inactivated FBS (JRH
Biosciences, Lenexa, Kansas, USA).
3.2.2 C. trachomatis serovar D growth and propagation C. trachomatis serovar D seed was grown, maintained and further propagated to create C.
trachomatis Serovar D stock. Stock was grown, maintained and propagated in 75cm2 flasks
(Griener Bio-One, Frickenhausen, Germany) containing the HEp-2 cell line, and using antibiotic-
free 1x DMEM medium, containing 4.5g/L D-glucose, 110mg/L sodium pyruvate and 584mg/L
L-glutamine, and supplemented with 1x non-essential amino acids and 10% heat-inactivated
FBS. Stock was stored with the addition of sucrose-phosphate-glutamic acid (SPG) (74.6g
sucrose [Chem Supply, Gillman, SA, Australia] 0.512g potassium dihydrogen orthophosphate
1.237g di-potassium hydrogen orthophosphate [BDH Chemicals, Port Fairy, Vic, Australia] 5µl
100x 200mM L-glutamine [Invitrogen], made up to 1L with Milli-Q H2O and pH 7.2), in 75cm2
flasks at -80°C.
78 | P a g e
Stocks of infected cells were thawed until “slushy”, lysed via sonication for 5 min and vortexing
for 2 min, and then centrifuged at 200xg ( Beckman Coulter, GS-6R ) for 5 min at 4°C to pellet
cell debris. The supernatant was then utilised to inoculate a 75cm2 flask of 70% confluent HEp-2
cells. Flasks containing inoculated HEp-2 cells were centrifuged at 600xg for 45 min at room
temperature (RT) then incubated at 37°C/5% CO2 for 4 hrs. Host cell proliferation was halted
with the addition of 1µl cyclohexamide (1 mg/µl)/1ml DMEM medium. Infections were
monitored for a further 44 hrs at 37°C/5% CO2, before the addition of 15mls ice-cold SPG.
Flasks were immediately stored at -80°C until chlamydial EB purification.
3.2.3 C. trachomatis serovar D semi-purification C. trachomatis was semi-purified from the infected HEp-2 cells via sonication and vortexing, as
previously stated. The sonicate was centrifuged at 11,200xg for 30 min at 4°C (SORVALL® RC
26 PLUS ultra-centrifuge, SORVALL® SLA-1500 rotor, Thermo Electron Corporation,
Melbourne, Vic, Australia) to pellet chlamydial bodies. The pellet was re-suspended in 10 mls
SPG, snap-frozen in liquid N2, and stored at -80°C until further purification.
3.2.4 Titration of C. trachomatis serovar D ECC-1 cells were plated, in duplicate, with 1x DMEM supplemented with 10% heat-inactivated
FBS, at 1 x 105 cells/ml, in a 24-well plate containing 10mm diameter coverslips. At
approximately 70% confluence, DMEM medium was replaced with 200µl fresh DMEM
containing 20µl of purified chlamydial EBs. Serial dilutions (1:2) were performed and plates
centrifuged at 400xg for 45 min at RT, then incubated at 37°C/5% CO2 for 4 hrs. Host cell
proliferation was suppressed by the addition of 1 ml DMEM medium containing 1 µl
cyclohexamide (1 mg/µl). Plates were incubated for 24 hrs at 37°C/5% CO2. Infected cells were
then fixed and permeabilised with methanol and stored in PBS at 4°C until staining.
Infected cells were stained utilising the CelLabs Chlamydia Cel LPS staining kit, containing the
fluorescein isothiocyanate (FITC)-labelled mouse monoclonal antibody specific for chlamydial
lipopolysaccahride (LPS) (CelLabs, Brookvale, Australia), according to manufacturer‟s
instructions. Coverslips containing infected cells were placed cell-side-up on microscope slides
79 | P a g e
(Livingstone International Pty. Ltd., Rosebery, Australia), and Chlamydia Cel LPS Reagent was
added to coat each coverslip. Slides were incubated in a humidifier for 30 min at 37°C/5% CO2.
Following incubation, coverslips were removed, washed 3x with PBS, and placed back on the
microscope slide cell-side-up. Rhodamine-stained cells and FITC-stained chlamydial inclusions
were then visualised and counted using a ZEISS MC 63A microscope (Zeiss, Oberkochen,
Germany) and ifu/ml calculated. Rhodamine-stained cells and FITC-stained chlamydial
inclusions were then visualised and counted using a ZEISS MC 63A microscope (Zeiss,
Oberkochen, Germany) and ifu/ml calculated. Rhodamine is a fluorone dye which is commonly
used as a tracer dye to stain eukaryotic cells, which bind to eukaryotic cells and appear as a red
light under fluorescent microscopy.
To calculate ifu/ml, the area of one 24-well plate well (cm2) at 40x magnification, was divided
by the area of the field examined (cm2) at 40x magnification, giving fields/well. A minimum of
40x fields were counted, with the average multiplied by fields/well to calculate the number of
chlamydial inclusions/well (ifu/well). Innoculum/well (µl) was calculated from the 1:2 dilutions
performed and the innoculum/ml calculated. The inclusions/well (ifu) was multiplied by the
innoculum/ml to calculate ifu/ml.
3.2.5 Hormone preparation Lyophilised progesterone and 17β-estradiol (Sigma-Aldrich, St. Louis, MO, USA) were
solubilised in absolute ethanol to 1mg/ml stocks. Serum levels of female sex hormones, estradiol
and progesterone, fluctuate throughout the menstrual cycle. In this study mean physiological
concentrations of 17β-estradiol (200pg/ml) and progesterone (20ng/ml), adapted from Williams
et al. (2001) were further diluted using phenol red-free 1x DMEM/F12 medium (1:1)
(Invitrogen), supplemented with 10% charcoal/dextran-treated FBS (Hyclone).
3.2.6 Hormonal supplement of FRT cell lines Once the ECC-1 cells had reached 100% confluence, physiological concentrations of 17β-
estradiol, progesterone, and combination of 17β-estradiol and progesterone (1:1) were added to
respective wells. Although the physiological concentration of progesterone is higher than
80 | P a g e
estradiol, in this study combination of 1:1, estradiol and progesterone, was chosen as starting
point to merely determine the effect of both hormones togheter. Cells were then incubated for 24
hrs before continuance of experiments.
3.2.7 Extraction of total RNA Total RNA was extracted from infected ECC-1 cells using Trizol® reagent protocol (Invitrogen)
and DNase treated. RNA was precipitated and purified by treatment with 7.5 M ammonium
acetate and washed with 70% ethanol. At 48 hrs post-infection, medium was removed and cells
lysed by the addition of 1ml Trizol® reagent (Invitrogen). Lysed cells were incubated at RT for
5mins and 200µl of chloroform (Merk, Kilsyth, Victoria, Australia) added. Samples were
incubated at RT for 3 min, then centrifuged (Eppendorf centrifuge 5417R, Eppendorf South
Pacific Pty. Ltd., North Ryde, Australia) at 12,000xg for 15 min at 4°C, to separate the samples
into 3 phases ( Figure 3.1). Approximately 600µl of the upper phase, containing the RNA, was
transferred to a sterile 1.5ml eppendorf tube and 600µl of ribonuclease (RNAse)-free 70%
ethanol (35mls absolute ethanol + 15mls Milli-Q H2O) added. Samples were then transferred to a
spin cartridge inserted in a collection tube, and centrifuged at 12,000xg for 15 sec at RT.
A DNAse mix was prepared, containing 70µl DNAse Buffer/sample, and 9.5µl 1U/µl DNAse I
/sample (Invitrogen). 80µl DNAse mix was added and samples incubated for 15 min at RT.
Samples were centrifuged as above, for 1min, to dry the membrane, and 50µl of RNAse-free
H2O added to the tube. Samples were stored at -80 freezer.
3.2.8 Bacterial RNA Isolation Eukaryotic RNA was removed from total RNA using the Dynabead (poly A+ purification kit)
technique (Dynal Biotech ASA, Oslo, Norway) according to manufacturer‟s instructions and the
bacterial mRNA re-suspended in DEPC water. Approximately 2µl elution fluid, containing
purified RNA, was removed determining the quality and quantity of RNA. Purified RNA was
examined, using a NanoDrop® Spectrophotometer (NanoDrop Technologies®, Wilmington, DE,
USA) and associated NanoDrop ND-1000 3.2.1 software (Coleman Technologies Inc., Glen
Mills, PA, USA), to ensure RNA purity and to determine whether amplification was required,
81 | P a g e
prior to microarray analysis. Extracted RNA was determined to be of high purity, as indicated by
the absorbance ratio (A260:A280) being very close to 2.00 (Table 3.1). The quantity of RNA
extracted indicated amplification was not required prior to microarray analysis as the
concentration of RNA was reasonably high and sufficient for our experiment (Table 3.1).
Table 3.1: Quality and Quantity of Extracted ECC-1 RNA
supplemented A260:A280 ng/µl
26 weeks passage - Estradiol 1.97 2649.01
26 weeks passage- Progesterone 1.96 3074.65
26 weeks passage- E2 + P 2.02 2404.53
26 weeks passage- no Hormone supplement 2.03 2487.64
1 week passage - Estradiol 1.98 2537.84
1 week passage- Progesterone 2.01 1935.28
1 week passage- E2 + P 2.05 3222.49
1 week passage – No Hormone supplement 1.94 2258.70
3.2.9 Microarray Eukaryotic RNA was removed using the Dynabead technique (Dynal Biotech ASA, Oslo,
Norway) and the bacterial mRNA re-suspended in DEPC water and sent to the AGRF
(Australian Genome Research Facility, Melbourne, Australia) for microarray analysis. In vitro
RNA transcription is performed to incorporate biotin-labeled ribonucleotide into the cRNA
transcripts using the ENZO RNA transcript labeling kit. Labeled cRNAs were purified using the
Qiagen kit, fragmented to approximately 50 to 200 bases by heating at 94 ºC for 35 min, and 15
µg hybridized to a Chlamydia whole genome Affymetrix Custom array. The array is an
Affymetrix oligonucleotide array format of 1800 features, covering the full C. trachomatis
genome (1175 genes) and containing 8-11 oligonucleotides per target gene, each designed for
optimal hybridization to C. trachomatis and/or C. pneumoniae and screened against non-specific
hybridization with the full human and mouse genomes. After hybridization and subsequent
washing using the Affymetrix Fluidics station 400, the bound cRNAs were stained with
streptavidin phycoerythrin, and the signal amplified with a fluorescent-tagged antibody to
82 | P a g e
streptavidin (Performed by AGRF). Fluorescence was measured using the Affymetrix scanner
and the results analyzed using GeneChip 1.4 analysis software, resulting in the detection of 1175
genes. A total of 8 chlamydial arrays were analyzed with the 4 culture conditions (no hormone,
E, P, E+P) x two different time points (26 weeks passage in charcoal/dextran-treated FCS
compared to 1 week passage).
3.2.9 q RT-PCR Quantitative Real-Time PCR was used to validate the microarray data for 8 selected target genes.
Optimized primer pairs were designed using primer construction software „Primer Express‟
(Applied Biosystems). Each primer pair was used to generate amplicon standards by amplifying
previously generated C.trachomatis cDNA. cDNA generation commenced with denaturation of 5
µg of total bacterial RNA and 1 µl of random hexamers (Invitrogen, Carlsbad, CA, USA) and 1
µl of 10 mM dNTPs at 65 ºC for 5 min. Reverse transcriptase reactions were prepared containing
2 µl 10x RT buffer, 4 µl 24 mM MgCl2, 2 µl 0.1 M DTT and 1 µl superscript III RT (200 U/ µl)
and incubated for 10 min at 25 ºC and then 50 ºC for 50 min. The reaction was terminated by
leaving the mixture at 85 ºC for 5 min. Eventually, cDNA was purified by treating with RNase
and stored at - 85 ºC.
One µg of template was added to the PCR mixture containing 0.15 µM of gene specific forward
and reverse primers, 1 x SYBR Green reaction mastermix before being made up to a final
volume of 25 µL with distilled water. The mix is optimized for SYBR Green reactions and
contains SYBR Green I dye, AmpliTaq DNA Polymerase, dNTPs and optimized buffer
components. Cycling parameters for all reactions were as follows: denaturation at 95 ºC for 10
min ; 40 cycles of denaturation at 95 ºC for 15 sec and 1 min of annealing and extension at 60
ºC; and melting curve analysis from 60 ºC to 95 ºC.
83 | P a g e
Table 3.2: Real-Time PCR primers used in the ABI Prism 7300 quantitative RT-PCR system Gene Product Primer Sequence
FER Forward TCGGCAGATGACGAGAATCA
Reverse CAATCACGCAAGTCCCACAA
LPLA-2 Forward GTTTTTGTTCATTGCGAAGGG
Reverse CCAATACCACAGCTTCCGGA
RecA_2 Forward AAAAGCAATTTGGCGCAGG
Reverse GGCTAAATCCAACGACAATGC
SdhB Forward GCCTGCCCACAAGTAAATGAA
Reverse CCCATCAATGCTCGTAACCG
YciA Forward TGGATCGATTGGCATTAGTGG
Reverse CGCCCATATAAGCAGGAGCA
YjbC Forward GGCCCCTTTGTGACTGTTGAT
Reverse ACCCAAGAGGTTTATGCACCA
YtgC Forward GATTTGCATGACGACTGCCTT
Reverse GGCACCTATTAAAAGCCCTGG
CT181 Forward TGCTATCGAAAAGGTTTCGGAT
Reverse AGGAAATTGGATAGCAAAACCG The ABI 7300 fast real-time PCR system (Applied Biosystems) was used for relative
quantification of cDNA copies for the 8 selected genes and an internal reference gene 16S rRNA
for the hormonal-supplemnted C.trachomatis experiment. Quantitation was carried out by using
a standard curve based on serial dilutions of the amplicon standards covering 6 logs. Real-time
PCR templates for each gene of interest included fresh dilutions of the amplicon standards, 8
cDNA samples (2 x 4 samples per experiment) and distilled water as a negative control. All
reactions were performed in triplicate. Reaction tube mastermixes were prepared as per the
preparation of amplicon standards described above.
84 | P a g e
ABI Prism 7300 SDS Software (Version 1.0) was used to analyze product integrity and to
quantitate relative cDNA concentrations in the samples. Melting curves observed for each gene
were confirmed to correspond to correct amplicon size by agarose gel electrophoresis of PCR
products. The mean cDNA copy number obtained for each gene (triplicate) was divided by the
corresponding mean 16S rRNA value for standardization.
Each gene array profile indicated the expression level of each gene under the differing
experimental conditions. To identify genes with similar expression profiles mathematical
clustering methods were used, with the resulting hierarchy displayed as dendrograms. 16s rRNA
was used as an internal control. The use of an internal control was necessary as the number of
genes expressed under different hormonal conditions varied substantially and no single gene was
constitutively expressed. This method of normalization was particularly important in comparing
samples grown in charcoal-stripped media to hormonal supplemented cultures.
85 | P a g e
3.3 Results The study by Hogan et al. (2004) demonstrated differential gene expression patterns between the
acute versus persistent forms of Chlamydia (Hogan et al., 2004). Whole genome Chlamydia
microarrays are now available and were used in this study to determine the effect of sex hormone
changes on chlamydial gene expression. The development of a chlamydial gene array chip
provided a unique opportunity to investigate the effect of sex hormones on the patterns of
chlamydial gene expression during infection of a hormone responsive endometrial cell line and
to correlate this with the type of infection that develops.
During the microarray analysis, up-regulation was defined as a 2-fold or greater change in the
normalized gene of interest expression levels and down regulation was defined as a 0.5 or lesser
change in the normalized gene of interest expression levels. These values were chosen in this
study since it is commonly considered as an appropriate cut-off for reproducible differential
expression (Walker, 2002). In fact, the 2-fold cut-off seems to be a valid standard for differential
expression, since it represents a compromise between the 1.5- and 3-fold thresholds that have
been used in other recent chlamydial gene expression studies ( Belland et al., 2003 , Nicholson et
al., 2003; Hogan et al., 2004). Using Affymetrix GeneChip software, 1175 chlamydial genes
were analyzed under different hormonal conditions. Finally, each gene of interest was compared
against the corresponding 16S rRNA, internal reference gene data for normalization of the
individual selected gene.
Using Affymetrix GeneChip software, our primary data showed that expression of 112 out of
1175 genes were significantly altered due to addition of female sex hormones to the culture
environment compared to infection in the absence of added hormone(s). Eventually, out of these
112 genes, a subset of 60 genes which showed constant gene expression patterns in ECC-1 cells
passaged for both 1 week and 26 weeks in charcoal-stripped media were selected for future
investigation. Chlamydial genes exhibiting two fold or greater difference (up-regulation) and 0.5
or less (down-regulation) in mRNA expression in the presence of estrogen or progesterone at 48
hrs PI are shown in Tables 3.3 and 3.4.
86 | P a g e
Table 3.3: Chlamydial genes exhibiting reproducible differences in mRNA expression in the presence of estradiol compared to no hormone addition Gene CT Number
Predicted Gene Function Gene Name Expression
817 tyrosine-specific transport protein, putative tyrP U
056 hypothetical protein U
689 ABC superfamily ATPase dppF U
021 hypothetical protein U
031 hypothetical protein U
317 50s ribosomal protein rs10 U
170 tryptophan synthase subunit beta trpB U 606 putative deoxyribonucleotide triphosphate yggV D
332 pyruvate kinase pyK D
591 succinate dehydrogenase subunit A sdhB D
316 50s ribosomal protein l2 rplL D
305 V-type ATPase, subunit I, putative, putative atpI D
013 cytochrome d ubiquinol oxidase subunit I cydA D
014 cytochrome d ubiquinol oxidase subunit II cydB D
249 hypothetical protein D
128 adenylate kinase adk D
296 conserved hypothetical protein D
236 acyl carrier protein acpP D
274 hypothetical protein D
060 type III secretion system protein flhA D
396 molecular chaperone DnaK dnaK D
443 60kD cysteine-rich outer membrane protein omcB D
507 DNA-directed RNA polymerase subunit rpoA D
515 chloroplast ribosomal protein S8 rpsH D
549 sigma regulatory factor-histidine kinase rsbW D
574 X-pro aminopeptidase pepP D
719 flagellar M-ring protein fliF D
723 phosphoglycerate mutase yjbC D
In the in vitro estradiol-supplemented cultures, our data identified 21 genes that were down-
regulated at 48 hrs PI, while 7 genes were significantly up-regulated at 48 hrs PI (Table 3.3).
87 | P a g e
Table 3.4: Chlamydial genes exhibiting difference in mRNA expression in the presence of progesterone compared to no hormone addition Gene CT Number
Gene Function Gene Name Expression
208 3-deoxy-D-manno-octulosonic-acid transferase gseA U
347 site-specific recombinase xerC U
499 lipoate-protein ligase A lplA_2 U
181 hypothetical protein U
535 acyl-CoA hydrolase yciA U
650 recombination protein RecA recA U
633 5-aminolevulinic acid dehydratase hemB U
099 thioredoxin reductase trxB D
047 hypothetical protein D
591 succinate dehydrogenase subunit A sdhB D
749 alanyl-tRNA synthetase alaS D
512 general secretion pathway protein D gspD D
186 devb protein, putative devB D
312 ferredoxin iv fer4 D
079 conserved hypothetical protein D
010 lipid a biosynthesis lauroyl acyltransferase htrB D
344 ATP-dependent protease lon D
129 glutamine ABC transporter, permease protein argR D
345 conserved hypothetical protein D
069 integral membrane protein MtsC, putative ytgC D
060 type III secretion system protein flhA D
389 conserved hypothetical protein D
402 etraacyldisaccharide lpxK D
733 hypothetical protein D
612 dihydropterin pyrophosphokinase or dihydropteroate
folA D
884 hypothetical protein D
723 ribosomal large subunit pseudouridine yjbC D
r06 5S ribosomal RNA D
In the in vitro progesterone-supplemented cultures, our data identified 21 genes whose
expression was down-regulated at 48 hrs PI, whereas 7 genes were markedly up-regulated at 48
hrs PI (Table 3.4). As an additional strategy to confirm the microarray results, 8 genes that were
up/down regulated under progesterone supplementation were selected for further investigation
using quantitative RT-PCR.
88 | P a g e
Table 3.5: Relative fold changes (up-regulated) for differentially expressed C.trachomatis Serovar D genes under progesterone supplementation for both RT-PCR and microarray analysis.
Gene Name
Function
Up-regulated in response to Progesterone
Microarray fold change (Duplicates)
q RT-PCR Fold change
1 lplA-2 lipoate-protein ligase A 3.89 3.11 4.41
2 recA recombination protein RecA 5.69 3.69 7.92
3 yciA acyl-CoA hydrolase 19.43 18.50 7.6
4 CT181 hypothetical protein 5.66 6.86 125
All 4 of the progesterone genes that showed up-regulation by microarray analysis, also
demonstrated up-regulation when analyzed by q RT-PCR (Table 3.5 and Figure 3.2)
Figure 3.2: Fold-change chart for up-regulated normalized gene data under progesterone supplementation using quantitative RT-PCR
89 | P a g e
Table 3.6: Relative fold changes (down-regulated) for differentially expressed C.trachomatis serovar D gene under progesterone supplementation for both RT-PCR and Microarray experiment
Gene Name
Function
Down-regulated in response to Progesterone
Microarray fold change (Duplicates)
q RT-PCR Fold change
1 ytgC integral membrane protein MtsC, 0.08 0.05 0.841
2 yjbC ribosomal large subunit 0.26 0.44 0.512
3 sdhB succinate dehydrogenase subunit 0.06 0.05 2.87
4 Fer-4 ferredoxin iv 0.4 0.05 1.46
During the analysis of the q RT-PCR data set generated in this project, slight differential
expression was defined for 2 down-regulated selected genes (sdhB, Fer-4) compared to the
microarray result (Table 3.6 and Figure 3.3). This might have happened because the microarray
data for these 2 genes came with a high probability of false signal. The other 2 genes (ytgC,
yjbC) revealed a constant pattern between q RT-PCR and microarray analysis. Our real time
PCR data validated our microarray system as 6 out of 8 randomly selected genes revealed similar
patterns in both experiments (RT-PCR and microarray).
Figure 3.3: Fold-change chart for down-regulated normalized gene data under progesterone supplementation using quantitative RT-PCR
90 | P a g e
With regard to the data discussed above, the majority of chlamydial genes which showed
consistent gene expression for both 1 week and 26 weeks cultured in stripped FCS were
observed to be down-regulated in the presence of progesterone or estradiol. Transcript levels for
these genes decreased between 0.5 to 0.0019- fold under hormonal supplementation at 48 hrs PI
(Table 3.3 and 3.4).
In addition to the 7 genes of interest which were up-regulated in the presence of estradiol, 21
genes were observed to be down-regulated under estradiol supplementation. Genes that showed
down-regulation in their mRNA expression profile include cytochrome d, ubiquinol oxidase
subunit I and II (cydA, cydB), uracil-DNA glycosylase (yggV), heat shock protein GrpE (dnaK)
and succinate dehydrogenase subunit A (sdhB). An additional group of hypothetical chlamydial
genes with no currently known function in Chlamydia were also down-regulated in the presence
of estradiol such as CT249 and CT274. These chlamydial genes observed to be down-regulated
in the presence of estradiol could not be assigned to clear functional groups based on similarity
to homologs in other prokaryotes. Seven chlamydial genes were observed to have two fold or greater up-regulated gene expression
levels in the presence of estradiol (Table 3.3). Genes that we observed with this mRNA
expression profile included tyrosine-specific transport protein and genes that encoded the ABC
superfamily ATPase. An additional group of genes were also up-regulated in the presence of
estradiol such as trpB and rs10.
Seven chlamydial genes were observed to have two fold or greater up-regulated gene expression
levels in the presence of progesterone (Table 3.4). Genes that we observed with this mRNA
expression profile included glucose inhibited division protein (lplA_2) and genes that encoded
the thiamin ABC transporter and several genes encoding 5-aminolevulinic acid dehydratase,
leucyl-tRNA synthetase and coenzyme pqq synthesis protein.
In addition to the 7 genes of interest whose expression level increased under progesterone
supplementation, 21 chlamydial genes were observed to have a reduced expression profile in
response to the presence of progesterone (Table 3.4). Down regulated genes include glutamine
ABC transporter (argR), ferredoxin IV (fer4) and phosphoglycerate mutase (yjbC). An additional
91 | P a g e
group of genes were also down-regulated in the presence of progesterone such as kgsA, gspD and
trxB.
As an additional strategy, we attempted to identify all chlamydial genes that were involved in
ADP/ATP exchange and energy source pathway reactions in the C.trachomatis genome. This
analysis revealed six targets which may be involved in chlamydial persistence (a) two genes
encode the glycolysis pathway (pyk, yggV) (b), two genes (cydA, cydB) function in the electron
transport system and (c) two genes encode production of tryptophan syntheses subunits. These
four chlamydial genes involved in ADP/ATP exchange and energy sources indicated the same
pattern as literature suggests for persistent chlamydial forms (cydA, cydB, pyk, yggV).
It has previously been shown that trpA and trpB are two well known genes involved in
chlamydial persistence (Hogan et al., 2004). Hogan et al. (2004) showed that the expression
patterns of these two selected genes were mostly up-regulated in chlamydial persistence. While
the gene expression of trpB in our experiment indicated a similar pattern with what the literature
suggests for chlamydial persistence, the gene expression of trpA appeared with slight difference
(no change). Moreover, our data showed regulation in genes predicted to be involved in
regulation of RB-to-EB differentiation (recA and dnaK).
92 | P a g e
3.4 Discussion C. trachomatis is an obligate Gram-negative intracellular bacterium which has a relatively small
genome of 1.04 megabases (Mb) consisting of 894 open reading frames (ORFs) between 135 and
5,358 nucleotides long, with an average length of 867 nucleotides (Abdelrahman and Belland
2005). Because of its unique lifestyle, the acquisition of exogenous DNA is believed to have had
a restricted role in the subsequent evolution of the species after the organisms started their
intracellular life cycle and evolved into both environmentally and genetically separated species
many years ago (Greub and Raoult 2002; Stephens et al., 1998). The observed diversity in
chlamydial genomes is therefore thought to be mainly due to nucleotide substitutions and gene
loss (Kalman et al., 1999). Chlamydia also has an unusual developmental cycle characterized by
two morphologic forms. Chlamydial infection is mediated by the extracellular metabolically
inactive elementary body (EB), which binds to host cells. Following internalization, the EBs are
transformed into the metabolically active RBs which are the replicating form. The reticulate
body (RB) begins to divide by binary fission and 24 to 48 hrs post infection, RBs transform back
into EBs. We isolated RNA from cells at 48 hrs post-infection, when the RB to EB
transformation occurs. Evidence suggests that inability in the secondary differentiation from RB
to EB leads to chlamydial persistence.
In this section two subjects will be discussed (a) the effect of the hormones on chlamydial gene
expression in general, (b) the effect of the hormones, estradiol in particular, on the chlamydial
persistence characterization. Three-quarters of the chlamydial genes in our experiments were
observed to be down-regulated in the presence of both estradiol and progesterone. The majority
of the chlamydial genes that were down-regulated in the presence of progesterone belong to
common biochemical enzymes or metabolic pathways such as thioredoxin reductase (trxB),
general secretion pathway protein D (gspD), ATP-dependent protease (lon), glutamine ABC
transporter permease protein (argR), and alanyl-tRNA synthetise (alaS) rather than structural
proteins. Interestingly, similar results were observed for genes down-regulated in the presence of
estradiol as most of them belong to common biochemical enzymes or metabolic pathways like
putative deoxyribonucleotide triphosphate (yggV), pyruvate kinase (pyK), V-type ATPase,
subunit I putative (atpI), cytochrome d ubiquinol oxidase subunit I and II (cydA, cydB) , acyl
carrier protein (acpP) and type III secretion system protein (flhA). This suggested that both
hormone-supplemented samples affect metabolism more than structural pathways. There was
93 | P a g e
only one gene (sdhB) which showed a similar pattern in the presence of both progesterone and
estradiol. sdhB encodes the succinate dehydrogenase and iron–sulphur protein subunits and is
anchored to the cytoplasmic membrane.
In vitro models of chlamydial persistence have been described in the literature during the last
two decades. For example, HeLa or other cell types infected with C. trachomatis displayed the
aberrant morphology characteristic of both synovial samples from patients and the Chlamydia-
infected monocytes in the presence of IFN-γ (Gerard et al., 2002). In addition, previous in vitro
studies showed abnormal chlamydial development following antibiotic treatment (Hogan et al.,
2004). Since no other research group has previously analyzed chlamydial gene expression under
hormonal supplement, to improve our knowledge of the molecular basis of chlamydial
persistence we investigated the chlamydial gene transcription under estradiol and/or progesterone
supplement. The outcome of this study should be of considerable value to compare the results of
such analyses with the other in vitro models of chlamydial persistence.
Chlamydial persistence is thought to be due in part to a failure to undergo secondary
differentiation from RB to EB. Molecular consequences include a „blockage‟ in development
involving down-regulation of late gene products in persistent infections (Belland et al., 2003;
Slepenkin et al., 2003) either as an indirect result of blockage or specific suppression by proteins
encoded by other genes which were reported to be strongly down-regulated in IFN-γ-treated
cultures of C.trachomatis ( Belland et al., 2003). Thejls et al. (1991) showed that the sequelae of
genital chlamydial infection usually involves a persistent form of the organism, and these
persistent forms may exist at anatomic locations far from that of the primary infection. That is,
under some particular conditions, C. trachomatis cells disseminate from the urogenital tract to
develop an infection in which RB-like forms persist over long periods in both metabolically and
morphologically aberrant form inside the host cytoplasmic inclusion.
A number of studies have begun to demonstrate the molecular basis of chlamydial persistence.
Diverse functional subsets of chlamydial genes have been reported as being differentially
regulated in response to the presence of a persistence-inducing agent, culminating in the
suggestion that a distinct chlamydial persistence phenotype was observed in the products specific
chlamydial response „stimulon‟ (Belland et al., 2003). As part of this response stimulon, special
94 | P a g e
attention has been placed on the expression of chlamydial genes encoding products associated
with DNA replication (recA, dnaK) (Gérard et al., 2002; Stephens et al., 1990). These studies
described constant expression of genes predicted to encode products with functions in DNA
replication.
Bacterial HSPs have captured the interest of microbiologists for many years, since they represent
major targets of the host‟s immune response. The best-characterized HSPs belong to the (DnaK)
families and are among the most conserved proteins known. The major targets of the humoral
immune response to a C. trachomatis infection are the two chlamydial outer membrane proteins
MOMP (major outer membrane protein) and Omp2, LPS, and the two cytoplasmic heat shock
proteins (HSPs) DnaK and GroEL. During the transformation of EBs to reticulate bodies, the
genes dnaK and groEL, encoding the HSPs DnaK and GroEL and which were involved in
protein folding and also known as chaperones, were highly transcribed (Larsen et al., 1994).
Expression of the dnaK, is involved in protein folding, and was found to be attenuated in the
persistence model (Birkelund et al., 1994; Larsen et al., 1994). Among chlamydial genes, dnaK
gene is one of the heat shock genes which are highly transcribed during the EBs to RBs
transformation process. This suggested a possible explanation for the common observation of
inhibited RB to EB transformation in persistent chlamydiae (Beatty et al., 1995; Zhong and
Brunham 1992). We have supplied evidence that estradiol suppliment has impact on dnaK gene
expression. Our data indicated a 4-fold decrease in dnaK gene expression, suggesting that this
gene is highly down-regulated in presence of eastradiol. Therefore down-regulation of this gene
might directly or indirectly lead to chlamydial persistence. RecA protein also has multiple roles
in controlling SOS mutagenesis: first, the regulation of UmuDC mutagenesis proteins; second,
RecA promotes cleavage of UmuD to its mutagenically active form; and finally, a recently
defined third role involving a direct interaction with DNA polymerase III. Since RecA plays
important roles in recombination and repair of DNA, it is necessary to know of the existence and
function of this activity in Chlamydia under different hormonal conditions. Our data indicated
approximately 5-fold increase in presence of progesterone and no change in presence of estradiol
for this gene, suggesting that progesterone suppliment protects against persistence infection.
Knowledge about RecA and its role in the infection process may also prove useful in vaccine
production. Characterization of the chlamydial recA gene under different hormonal conditions
could be a first step to make a weakened strain for immunization.
95 | P a g e
In addition, the infectious EBs have a disulfide cross-linked outer membrane (OM) that enables
the EBs to attach to and enter host cells. A critical phase of the secondary differentiation process
(metabolically active RB to infectious EB) is the expression of genes that encode proteins which
form the highly disulfide cross-linked bacterial OM complex. The omcB encode cysteine-rich
OM proteins which link with the main OM protein (OmpA) to create this complex. Generally the
OM complex formation involves intra- and inter-protein connecting through the formation of
cysteine bonds. The expression of omcB, cysteine-rich OMP (60 kDa) is associated with
secondary differentiation RBs to EBs (Belland et al., 2003a).
A study on C. trachomatis conducted by Belland et al. (2003) reported down-regulated
expression of the omcB gene in IFN-γ-treatment. Similar to ompA/MOMP other studies have
also confirmed omcB down-regulation as a reliable marker of chlamydial persistence (Hogan et
al., 2003; Mathews et al., 2001; Slepenkin et al., 2003). Hogan and colleagues (2004) reported
down-regulation in omcB in C. trachomatis persistence.
Our results showed down-regulation of omcB at 48 hrs PI in the estradiol-added sample. omcB,
has been reported to be expressed late in infection with considerably higher levels of RNA
presented at 48 hrs PI compared to early infection (Belland et al., 2003b; Nicholson et al., 2003;
Slepenkin et al., 2003). Down-regulated expression of genes and proteins that are specifically
expressed late in the productive developmental cycle is a common observation most likely
reflecting the inhibited RB-to-EB differentiation that characterises persistence. Our data suggest
that estradiol down-regulation of omcB may attribute to persistence in vivo.
In general, persistent C. trachomatis infection expresses low levels of omp1 mRNA (Nanagara et
al., 1995; Beatty et al., 1994). This gene encodes the major outer membrane protein of the
organism, and actively growing C. trachomatis transcribe the gene at a high level. Jones and
colleagues (2001) also provided data demonstrating that persistent chlamydiae express hsp60, a
strongly immunogenic protein, at greater levels compared to those observed throughout normal
active growth. Moreover, evidence showed that throughout persistent synovial infection of
patients with Chlamydia-associated inflammation, C. trachomatis reveal unusual transcriptional
characteristics for some genes in addition to omp1 and hsp60 (Gerard et al., 2001). This unusual
96 | P a g e
pattern of gene expression was also noticed through persistent fallopian tube infection in patients
suffering from ectopic pregnancy (Gerard et al., 1998), and in an in vitro model of chlamydial
persistence (Koehler et al., 1997). Our data clearly demonstrated similar gene expression
patterns for both of the above mentioned genes under estardiol supplement. Both omp1 and
hsp60 were expressed at higher levels (1.4 and 1.6 respectively) in the presence of estradiol
compared to control samples.
Until 5 years ago, C. trachomatis was considered an obligate energy parasite within its host, with
uptake of ATP mediated by bacterially encoded ATP/ADP exchange proteins. Data have
demonstrated that the metabolic characteristics of persistent chlamydiae were not the same as
those of actively growing organisms (Beatty et al., 1994; Jones et al., 2001). The results reported
from the Gerard et al. (2002) indicate that during the primary phase of active infection, C.
trachomatis obtain the energy essential for EB to RB transformation, and also for metabolism,
from host cells via ATP/ADP exchange. Through active growth of the RB, the organisms
acquired ATP not only from the host, but also via their own glycolytic and pentose phosphate
pathways. Gerard et al. (2002) reported that throughout the initial phase of monocyte infection,
prior to the complete establishment of persistence, C.trachomatis cells utilized both ATP/ADP
exchange and their own pathways to support metabolic needs, even though the overall metabolic
rate in the organisms was relatively low. However, when persistence has been established the
only source of ATP seems to be the host (Gerard et al., 2002). That is, mRNA for glycolytic and
pentose phosphate pathway enzymes were absent or severely reduced, which suggested that
these systems were partially, if not completely, shut down during persistence. Therefore, C.
trachomatis cells seemed to be partial energy parasites on their hosts during active growth,
however during persistent infection the organisms appeared to be completely dependent on the
host for ATP.
Evidence suggested that the C.trachomatis genome encodes the glycolysis pathway enzyme,
ATP/ADP exchange protein, and other energy transduction-related components. Although
Chlamydia inside the joint is metabolically active, they showed an unusual transcriptional pattern
that makes it easy to differentiate them from RB during active infections (Gerard et al., 2002).
Because this organism showed differential expression of some genes during persistence, we
asked whether transcription of C. trachomatis genes encoding components of the glycolytic and
97 | P a g e
electron transport system, differs between active and persistent infection under different
hormonal conditions.
The genome of C. trachomatis includes genes involved in the glycolysis pathway (pyk and yggv),
as well as genes for an electron transport system (cydA, cydB). Work from the Gerard group
(2002) suggested that throughout active growth, transcripts from genes involved in encoding
glycolytic pathway enzymes in C.trachomatis were expressed. This study also demonstrated that
the chlamydial glycolytic pathway enzymes were functional. This showed that the bacteria can
produce ATP during active infection, in addition to obtaining this resource from its host.
Within HEp-2 and ECC-1 cells, C. trachomatis cells undergo normal EB to RB reorganization,
growth of RB, and normal RB to EB dedifferentiation at the end of the developmental cycle; the
cycle requires ≈50 hrs for completion in these host cell types. C. trachomatis genes encoding
enzymes involved in glycolysis were expressed at 1 and 2 days post-infection, so expression had
stopped after 48 hrs PI, when the characteristics of chlamydial persistence were well established.
Thus, during the early developmental cycle of chlamydial infection, C. trachomatis cells
appeared to undergo the initial portion of the developmental cycle normally, expressing energy
transduction-related genes and primary rRNA transcripts, as in human epithelial cell line
infection. Subsequent to chlamydial persistence formation, gene expression of genes involved in
encoding glycolysis pathway enzymes was down-regulated; however adt1 and primary rRNA
transcripts were produced. This clearly showed that persistent C. trachomatis cells took ATP
from their hosts during persistent infection, as they did not produce enzymes required for ATP
synthesis (Iliffe-Lee and McClarty, 1999, Gerard et al., 2002).
Our results identified hormonal regulation of chlamydial genes encoding pyruvate kinase, pyk
and yggv, which function in glycolysis. The microarray analyses targeting relative primary
chlamydial RNA transcript levels supported this contention, since those transcript levels were
several-fold lower in infected ECC-1 cells in the presence of estradiol than in infected cells with
no hormone supplement (sample grown in charcoal-stripped media). Our data showed significant
down-regulation in gene expression of both genes under supplement with 17β estradiol (3-fold
and 10-fold respectively). This suggested that since the availability of energy resources required
98 | P a g e
to support metabolism may be limited therefore Chlamydia may forced to change to a persistent
form in presence of E2.
C. trachomatis has no glyoxylate cycle, but the genome encodes components for an abridged
TCA cycle and an electron transport system (Kalman et al., 1999). C. trachomatis possess an
electron transport system (McCarty 1999) whose components were produced during active
growth. Both proteins were required for a functional electron transport component, and it was
suggested that this system is necessary during persistence to generate reducing equivalents in the
bacterial cell (Gerard et al., 2002). Chlamydial genes encoding two cytochrome oxidase subunits
which play important role in electron transport, cydA, cydB, are highly expressed during active
infection and absent throughout persistent infection. Our data indicated a minimum of 5 fold
decrease in genes, cydA, cydB, in presence of 17 β estradiol-supplemented. In addition, the trpB
(tryptophan synthase subunit β) gene is currently known as one of most reliable chlamydial
persistence markers. The down-regulation trends reported in this project for this gene under
estradiol supplement were consistent with previous data in the microarray study of IFN-γ-
mediated C. trachomatis serovar D persistence (Belland et al., 2003). Therefore we provided
evidence that mRNA for glycolysis and electron transport pathway-related genes were greatly
decreased during estrogen supplement. This suggested that whilst the primary phase of
chlamydial infection was relatively normal in terms of bacterial transcripts produced and
relatively normal in terms of EB to RB development, some host-parasite interaction initiated
during the developmental cycle infection led to a decrease in bacterial metabolism, possibly
influencing the elicitation of persistence in the presence of estradiol.
99 | P a g e
Table 3.7: Summary table for genes presented in our microarray experiment and involved in chlamydial persistence
Gene Name Function Literature P E2 1 cydA cytochrome d ubiquinol
oxidase I Down-regulation 1
Down-regulation
Down-regulation
2 cydB cytochrome ubiquinol oxidase II
Down-regulation 1
Unchanged Down-regulation
3 pyk pyruvate kinase Down-regulation 1
Unchanged Down-regulation
4 yggV putative deoxyribonucleotide Down-regulation 1
Unchanged Down-regulation
5 dnaK molecular chaperone DnaK Down-regulation 2
Down-regulation
Down-regulation
6 recA recombination protein RecA Down-regulation 3
Up-regulation Down-regulation
7 omcB cysteine-rich outer membrane Down-regulation 4
Unchanged Down-regulation
8 groES Hsp60 Unchanged 5 Unchanged Unchanged 9 trpA tryptophan synthase subunit α Up-regulation 5,6 Unchanged Unchanged 10 trpB tryptophan synthase subunit β Up-regulation 5,6 Unchanged Up-regulation
1: (Gerard et al. 2002), 2: (Jones et al. 2001), 3: (Hintz 1995), 4: (Belland et al. 2003b), 5:
(Hogan et al. 2004) 6: (Morrison 2003).
Collectively these data suggested that hormonal supplementation, estradiol in particular, may
directly or indirectly play an important role in development of chlamydial persistence as eight
well known genes involved in chlamydial persistence showed the same pattern in our microarray
experiment. Finally, it should be mentioned that there were a few more genes that were shown to
be up/down regulated in their gene expression pattern under estradiol supplement but their
function is not yet clear (CT56, CT21, CT31, CT296 and CT274). Similar results were achieved
for progesterone added samples as seven (conserved) hypothetical protein genes were up/down
regulated, such as CT47, CT79, CT181, CT345 and CT733. Our data clearly indicated that the
majority of the altered genes belong to common biochemical or metabolic pathways suggesting
that hormone supplementation affects metabolism more than the structural pathway. Further
investigations are required to study the pathways of these genes and examine their functions
under steroid hormone supplementation.
100 | P a g e
Chapter 4 General Discussion and Conclusions
101 | P a g e
102 | P a g e
4.1 General Discussion and Conclusions The work presented in this thesis investigated chlamydial growth and gene expression under
different hormonal conditions, and has made significant new contributions to the field of
chlamydial persistence. The studies in this project focused on 2 new areas of in vitro chlamydial
infection: firstly, the effect of steroid hormones on host susceptibility and inclusions
morphology; secondly, the effect of hormones on chlamydial gene expression.
The first aim of this project was to determine host susceptibility to chlamydial infection using
confocal microscopy. The focus of this part of the project was to examine the effect of estrogen
and/or progesterone on host susceptibility (by calculating the percentage of cells infected) and
analyse inclusion morphology. The second aim of the project investigated chlamydial gene
expression in the in vitro chlamydial infection model under different hormonal conditions for the
first time. Initial microarray data indicated that there was differential gene expression in C.
trachomatis infections in the presence of female sex hormones. After the establishment of the
second microarray experiment, our data was confirmed for selected genes of interest by using q
RT-PCR, some of which play an important role in chlamydial persistence. These data formed the
basis of the third chapter of this thesis.
Previous in vitro and in vivo studies reported that chlamydial infection may be modulated by
steroid hormones (Pasley et al., 1985a; Rank 1994; Kaushic et al., 1998b). The influence of
exogenously supplied hormones on ECC-1 cells at various time points were compared, and the
results clearly showed that only in cells grown for 1 week in stripped FCS, the levels of
chlamydial infectivity of ECC-1 cells was greater in estrogen-added than in progesterone-added
cells. Our data demonstrated that in cells passaged for 1 week in stripped FCS, the presence of
estradiol increases infectivity (1.7-fold compared to the sample grown in charcoal-stripped
media), while progesterone does not have as great as impact on infectivity (1.2-fold increase
compare to control). However, in cells grown for 26 weeks in stripped FCS both E2 and P
enhanced infectivity (2.1-fold and 1.9-fold increase compared to the control).
103 | P a g e
The results from this study showed that, the duration of hormone supplement had a less
noticeable influence on the infectivity of the epithelial cell line, however chlamydial inclusion
morphology was noticeably different from control cells. ECC-1 cells infected with C.trachomatis
after 48 hrs and 72 hrs of hormone supplement contained larger inclusions than cells conditioned
by 24 hrs pre-treatment with hormones. In all cases, infection was stopped 48 hrs post infection.
This confirmed that C.trachomatis seeded on epithelial cells under extended hormone
supplemented culture conditions have the potential to form large inclusions. In addition,
immunocytochemistry and confocal microscopy of C.trachomatis grown in the presence of
estradiol revealed abnormaly large RBs contained within inclusions compared to the control
acute cultures, which is one of the well known characteristics of chlamydial persistence. This
characteristic was consistent with previous reports of the C. trachomatis morphology during
antibiotics and IFN- γ induced persistence (Beatty et al. 1993; Kramer and Gordon 1971). In
marked contrast, in the presence of a combination of hormones and also progesterone alone,
there were no signs of chlamydial persistence.
Collectively our data indicated the most noticeable effect of hormone supplementation on
epithelial cells chlamydial infectivity was in the presence of estradiol. Therefore, we can
conclude that at the peak of estrogen concentration (proliferative phase) the chance of
chlamydial infection is higher than in other phases. In addition to differences in the levels of
infectivity of epithelial cells with C.trachomatis serovar D, the morphology of chlamydial
inclusions was also affected by hormone supplementation.
The third chapter of this thesis discussed the effect of steroid hormones on bacterial gene
expression. While previous studies have examined the host response, this is the first study to
examine C.trachomatis gene expression under different hormonal conditions. We have
highlighted a basic model of Chlamydia trachomatis gene regulation in the presence of steroid
hormones by identifying 60 genes that were regulated by adding estradiol and/or progesterone.
Generally, our results indicated that three-quarters of the chlamydial genes in our experiments
were observed to be down-regulated in the presence of both estradiol and progesterone. The
majority of the chlamydial genes down-regulated in the presence of steroid hormones belong to
common biochemical enzymes or metabolic pathways suggesting that hormone supplement is
affecting metabolism more than structural pathways. In addition, the third chapter of this thesis
104 | P a g e
discussed and compared the significance of the current findings in the context of data from other
research groups to improve our understanding of the molecular basis of chlamydial persistence
under hormonal conditions. Recently, the availability of chlamydial genome sequences and
chlamydial microarrays enabled us to examine the bacterial gene expression and identify
persistence markers under different hormonal conditions. By combining the data presented in
this thesis with those from other recent investigations in this area, it is now possible to construct
a hypothesis on the effect of steroid hormones on chlamydial persistence.
The hormone-supplemented model of C. trachomatis persistence in the work presented in this
thesis was determined using reliable genetic markers of persistence in this model (omcB, trpB),
and also more general markers of chlamydial persistence (cydA, cydB, pyk, yggV, dnaK and
recA). Gene expression analysis of estradiol-induced persistent C. trachomatis infections using
microarray and q RT-PCR methods revealed selective up- and down-regulation trends for genes
encoding products that were located at specific enzymatic points in glycolysis biosynthesis,
electron transport system, and also RB to EB differentiation pathways.
The microarray study conducted by Belland and colleagues (2003) of IFN-γ-mediated C.
trachomatis serovar D persistence revealed novel persistence gene candidates that have been
used in the current study. The Belland et al. (2003) panel of chlamydial persistence marker genes
was used to validate our in vitro persistence study. This panel can be an important tool for the
validation of persistence, more than morphological analyses (confocal and TEM microscopy),
since the altered morphological and genetic hallmarks of persistent infections are not necessarily
co-temporal.
The omcB and trpB genes are currently the most reliable general markers of chlamydial
persistence. The down-regulation trends reported in this project for these genes under estradiol
supplement were consistent with previous data in the microarray study of IFN-γ-mediated C.
trachomatis serovar D persistence (Belland et al., 2003). As an additional strategy, we attempted
to identify all chlamydial genes involved in ADP/ATP exchange and energy source pathway
reactions in the C.trachomatis genome. This analysis revealed six targets which may be involved
in chlamydial persistence (a) two genes encode glycolysis pathway (pyk, yggV) (b), two genes
105 | P a g e
(cydA, cydB) function in electron transport system, and (c) two genes encode production of
tryptophan syntheses subunits.
Previous data have demonstrated that the metabolic characteristics of persistent chlamydiae were
not the same as those of actively growing organisms (Beatty et al., 1994; Jones et al., 2001). The
results reported from Gerard et al. (2002) indicated that during the primary phase of active
infection, C. trachomatis obtain the energy essential for EB to RB transformation, and also for
metabolism, from host cells via ATP/ADP exchange. Through active growth of the RB, the
organisms acquire ATP not only from the host, but also via their own glycolytic and pentose
phosphate pathways. Gerard et al. (2002) determined that throughout the initial phase of
monocyte infection, prior to the complete establishment of persistence, C.trachomatis cells
utilized both ATP/ADP exchange and their own pathways to support metabolic needs, even
though the overall metabolic rate in the organisms was relatively low. However, when
persistence has been established the only source of ATP seemed to be the host (Gerard et al.,
2002). That is, mRNA for glycolytic and pentose phosphate pathway enzymes were absent or
severely reduced, showing that these systems were partially, if not completely, shut down
through persistence. Therefore, C. trachomatis cells seemed to be merely partial energy parasites
on their hosts during active growth, however during persistent infection the organisms appeared
to be completely dependent on the host for ATP.
Most notably in this project, pyk and yggV were strongly down-regulated (3-fold and 10-fold
respectively) following pre- suppliment with estradiol, which may contribute to a reduction in
the rate of glycolysis biosynthesis during persistence. Two other well known chlamydial
persistence genes (cydA, cydB) which play a part in the electron transport system were also
down-regulated (8-fold and 4-fold respectively) in the presence of estradiol.
It has previously been shown that trpA and trpB are two well known genes involved in
chlamydial persistence (Hogan et al., 2004). Hogan et al. (2004) showed that the expression
patterns of these two selected genes were mostly up-regulated in chlamydial persistence. While
the gene expression of trpB in our experiment indicated a similar pattern with what the literature
suggested for chlamydial persistence, the gene expression of trpA had no change. Moreover, our
data showed regulation of genes predicted to be involved in the regulation of RB-to-EB
differentiation (recA and dnaK).
106 | P a g e
The data from Hogan et al. (2004) combined with Gérard et al. (2002), suggested that two major
hallmarks of persistence were inhibited RB-to-EB differentiation associated with shut down
(down-regulation) of late genes and impaired RB development caused by blockages in key
pathways. In this respect, the gene expression of dnaK and recA from our microarray study were
consistent with the down-regulation seen for these genes in persistence infections in Jones et al.
(2001) and Hintz (1995) studies respectively.
Gérard et al. (2002) provided data for in vitro monocyte-induced C. trachomatis persistence
indicating that some metabolic pathways (such as the EMP and the PPP) were transcriptionally
down-regulated during persistence, whereas others (such as the TCA cycle) remain unchanged.
This was clearly validated by our microarray study of estradiol-added C. trachomatis persistence.
Belland et al. (2003) provided more evidence to support these differential pathway expression
patterns in persistence.
Collectively, in our experiments cydA, cydB, pyk, yggV, dnaK, recA and omcB were down-
regulated in estradiol-added samples at 48 hrs PI, whereas trpB and omp1 were up-regulated
which were consistent with C. trachomatis persistence literature. In addition to the present
project, Hogan et al. (2004) and Gerard et al. (2001) also identified the above mentioned down-
regulated genes as being selectively absent in IFN-γ-mediated C. pneumoniae persistence.
Furthermore, our microarray data revealed down-regulated expression of CT47, CT79, CT181,
CT345 and CT733 in progesterone-added C. trachomatis, of which their function is not clearly
known to us yet. These data may help to explain why infections are more common in the
estrogen-dominant phase of the menstrual cycle and suggest that estradiol favours the
development of persistent infections that may allow Chlamydia to (a) resist common antibiotic
therapy and (b) survive the innate immune response to infection, thereby facilitating repeated
reactivation of infection that drives damaging immunopathology.
The current in vitro persistence study will need to be evaluated in studies of animal infection
models and clinical samples from human disease, to determine the relevance of the panel to in
vivo disease.
107 | P a g e
The important results from this investigation can be applied to future research into gene
regulation in Chlamydia. This will lead to a better understanding of chlamydial development and
pathogenic mechanisms of this unique disease causing bacteria. An enhanced understanding of
the bacterial and host genetic factors that specifically influence the initiation, duration, and
reactivation of persistent chlamydial infections under hormonal conditions is likely to lead to the
development of novel strategies for the prevention and control of chlamydial disease.
The final outcome and application of this study could be in the development of an RNA-based
disease-specific diagnostic test to differentiate acute from persistent infections. Gérard and
colleagues (2001) have already shown the feasibility of PCR methods for such applications by
demonstrating in vitro differential expression profiles for the fts genes and certain metabolic
genes ( cydA, cydB ) (Gérard et al., 2002) as reliable persistence markers. In addition to
developing a group of genes for diagnostic purposes, a better understanding of the mechanisms
underlying differential persistence gene expression profiles under hormonal conditions will be
required for further applications such as the development of vaccines or novel drugs that
exclusively target persistent chlamydiae.
108 | P a g e
Chapter 5 References Cited
109 | P a g e
110 | P a g e
5.1 References Cited Abdelrahman, Y. M. and R. J. Belland. 2005. The chlamydial developmental cycle. FEMS Microbiology Reviews 29 (5):949-59.
Acron, D. C., J.W. Findling, J.B Tyrrell. 2001. Hypothalamus and Pituitary. In A Lange Medical Book: Basic and Clinical Endocrinology 6th Edition, ed. F. S. Greenspan, Gardner, D.G., 100-162. New York: Lange Medical Books/McGraw-Hill Medical Publishing Division.
Australian Bureau of Statistics (ABS). 2005. 1301.0 - Year Book Australia - Health: Communicable Diseases. http://www.abs.gov.au/Ausstats/[email protected]/0/096BF52E2838BDFFCA256F7200832FC9?Open (accessed 29th March).
Australian Bureau of Statistics (ABS). 2006. 1301.0 - Year Book Australia, Chapter 9 - Health: Communicable Diseases. http://www.abs.gov.au/Ausstats/[email protected]/Latestproducts/9155D0B9F4203474CA2570DE000D975D?opendocument (accessed 29th March).
Baeten, J. M., P. M. Nyange, B. A. Richardson, L. Lavreys, B. Chohan, H. L. Martin, Jr., K. Mandaliya, J. O. Ndinya-Achola, J. J. Bwayo and J. K. Kreiss. 2001b. Hormonal contraception and risk of sexually transmitted disease acquisition: results from a prospective study. American Journal of Obstetrics and Gynecology 185 (2):380-5.
Bates, G. W. and W. R. Boone. 1991. The female reproductive cycle: new variations on an old theme. Current Opinion in Obstetrics and Gynecology 3 (6):838-43.
Bavoil, P. M., R. Hsia, D. M. Ojcius. 2000. Closing in on Chlamydia and its intracellular bag of tricks. Microbiology 146 (Pt 11):2723-31.
Baxter, J. D. and R.C.J. Ribeiro. 2001. Introduction to Endocrinology. In A Lange Medical Book: Basic and Clinical Endocrinology 6th Edition, ed. F. S. Greenspan, Gardner, D.G., 1-37. New York: Lange Medical Books/McGraw-Hill Medical Publishing Division.
Beagley, K. W. and P. Timms. 2000. Chlamydia trachomatis infection: incidence, health costs and prospects for vaccine development. Journal of Reproductive Immunology 48 (1):47-68.
Beatty, W. L., G. I. Byrne and R. P. Morrison. 1993. Morphologic and antigenic characterization of interferon gamma-mediated persistent Chlamydia trachomatis infection in vitro. Proceedings of the National Academy of Sciences of the United States of America 90 (9):3998-4002.
Beatty, W. L., R. P. Morrison and G. I. Byrne. 1994. Persistent chlamydiae: from cell culture to a paradigm for chlamydial pathogenesis. Microbiological Reviews 58 (4):686-99.
Belland, R. J., G. Zhong, D. D. Crane, D. Hogan, D. Sturdevant, J. Sharma, W. L. Beatty and H. D. Caldwell. 2003. Genomic transcriptional profiling of the developmental cycle of Chlamydia
111 | P a g e
trachomatis. Proceedings of the National Academy of Sciences of the United States of America 100 (14):8478-83.
Bengtsson, A. K., E. J. Ryan, D. Giordano, D. M. Magaletti and E. A. Clark. 2004. 17beta-estradiol (E2) modulates cytokine and chemokine expression in human monocyte-derived dendritic cells. Blood 104 (5):1404-10.
Bentley, P. J. 2001. Sex Hormones in Vertebrates. In Encyclopaedia of Life Sciences. London: Nature Publishing Group.
Berry, L. J., D. K. Hickey, K. A. Skelding, S. Bao, A. M. Rendina, P. M. Hansbro, C. M. Gockel and K. W. Beagley. 2004. Transcutaneous Immunization with Combined Cholera Toxin and CpG Adjuvant Protects against Chlamydia muridarum Genital Tract Infection. Infect Immun 72 (2):1019-1028.
Bessho, H., S. Arita, K. Yamane and Y. Hori. 2001. A simple titration method for determining Chlamydia infectivity using an image analyzing system. Journal of Microbiological Methods 45 (1):21-9.
Birkelund, S., B. Larsen, A. Holm, A. G. Lundemose and G. Christiansen. 1994. Characterization of a linear epitope on Chlamydia trachomatis serovar L2 DnaK-like protein. Infection and Immunity 62 (5):2051-7.
Birkelund, S., P. Mygind, A. Holm, B. Larsen, F. Beck and G. Christiansen. 1996. Characterization of two conformational epitopes of the Chlamydia trachomatis serovar L2 DnaK immunogen. Infection and Immunity 64 (3):810-7.
Bose, S. K. and P. C. Goswami. 1986. Host modification of the adherence properties of Chlamydia trachomatis. Journal of General Microbiology 132 (6):1631-9.
Bouman, A., M. J. Heineman and M. M. Faas. 2005. Sex hormones and the immune response in humans. Human Reproduction Update 11 (4):411-23.
Brunham, R. C. 1999. Human Immunity to Chlamydiae. In Chlamydia intracellular Biology, Parthenogenesis and Immunity ed. R. S. stephens, 211-238. US.
Brunham, R. C. 2005. Parran Award Lecture: insights into the epidemiology of sexually transmitted diseases from Ro betacD. Sexually Transmitted Diseases 32 (12):722-4.
Brunham, R. C. and J. Rey-Ladino. 2005. Immunology of Chlamydia infection: implications for a Chlamydia trachomatis vaccine. Nature Reviews. Immunology 5 (2):149-61.
Budai, I. 2007. Chlamydia trachomatis: milestones in clinical and microbiological diagnostics in the last hundred years: a review. Acta Microbiologica et Immunologica Hungarica 54 (1):5-22.
Bushell, A. C. and D. Hobson. 1978. Effect of cortisol on the growth of Chlamydia trachomatis in McCoy cells. Infection and Immunity 21 (3):946-53.
112 | P a g e
Carlson, J. H., S. F. Porcella, G. McClarty and H. D. Caldwell. 2005. Comparative genomic analysis of Chlamydia trachomatis oculotropic and genitotropic strains. Infection and Immunity 73 (10):6407-18.
Carr, B. R., J.E. Griffin. 1998. Reproduction: Fertility Control and Its Complications. In Willams Textbook of Endocrinology, ed. J. D. Wilson, Foster, D.W., Kronenberg, H.M., Larsen, P.R., 901-925. Philadelphia: W.B. Saunders.
Cevenini, R., M. Donati and V. Sambri. 2002. Chlamydia trachomatis - the agent. Best Practice and Research. Clinical Obstetrics and Gynaecology 16 (6):761-73.
Cohen, B. J. and J.J. Taylor. 2005. Perpetuation of Life: The Male and Female Reproductive Systems. In Memmler's The Human Body in Health and Disease, 455-476. Philadelphia: Lippincott Williams and Wilkins.
Cooke, P. S., F.D.A. Uchima, D.K. Fujii, H.A. Bern, G.R. Cuhna. 1986. Restoration of Normal Morphology and Estrogen Responsiveness in Cultured Vaginal and Uterine Epithelia Transplanted with Stroma. Cell Biology 83:2109-2113.
Dautry-Varsat, A., A. Subtil and T. Hackstadt. 2005. Recent insights into the mechanisms of Chlamydia entry. Cellular Microbiology 7 (12):1714-22.
Dautry-Varsat, A., M. E. Balana and B. Wyplosz. 2004. Chlamydia-host cell interactions: recent advances on bacterial entry and intracellular development. Traffic 5 (8):561-70.
Davis, C. H., J. E. Raulston and P. B. Wyrick. 2002. Protein disulfide isomerase, a component of the estrogen receptor complex, is associated with Chlamydia trachomatis serovar E attached to human endometrial epithelial cells. Infection and Immunity 70 (7):3413-8.
Debattista, J., P. Timms, J. Allan, 2003. Immunopathogenesis of Chlamydia trachomatis Infections in Women. Fertility & Sterility 79 (6):1273-1287.
Dötsch, J., H. G. Dörr and L. Wildt. 2001. Exposure to Endogenous Estrogens During Lifetime. In The Handbook of Environmental Chemistry, ed. Manfred Metzler, 82-99.
Ennis, D. G., R. Woodgate and M. Shi. 2000. Selective inhibition of RecA functions by the Hc1 nucleoid condensation protein from Chlamydia trachomatis. FEMS Microbiology Letters 182 (2):279-83.
Eriksson, M., S.K. Meadows, C.R. Wira, C.L. Sentman. 2004. Unique Phenotype of Human Uterine NK Cells and Their Regulation by Endogenous TGF-b. Journal of Leukocyte Biology 76:667-675.
Everett, K. D. E. 2002. Chlamydiae. In Encyclopaedia of Life Sciences, 296-305. London: Macmillan Publishers/Nature Publishing Group.
113 | P a g e
Everett, K. D., R. M. Bush and A. A. Andersen. 1999. Emended description of the order Chlamydiales, proposal of Parachlamydiaceae fam and Simkaniaceae fam. nov., each containing one monotypic genus, revised taxonomy of the family Chlamydiaceae, including a new genus and five new species, and standards for the identification of organisms. International Journal of Systematic Bacteriology 49 Pt 2:415-40.
Fahey, J. V. and C. R. Wira. 2002. Effect of menstrual status on antibacterial activity and secretory leukocyte protease inhibitor production by human uterine epithelial cells in culture. Journal of Infectious Diseases 185 (11):1606-13.
Fahey, J. V., R.M. Rossoll, C.R. Wira. 2005. Sex Hormone Regulation of Anti-Bacterial Activity in Rat Uterine Secretions and Apical Release of Anti-Bacterial Factor(s) by Uterine Epithelial Cells in Culture. Steroid Biochemistry and Molecular Biology 93:59-66.
Filicori, M., G.E. Cognigni, P. Pocognoli, W. Ciampaglia, S. Bernardi. 2003. Current Concepts and Novel Applications of LH Activity in Ovarian Stimulation. Trends in Endocrinology and Metabolism 14 (6):267-273.
Fortenberry, J. D., E. J. Brizendine, B. P. Katz, K. K. Wools, M. J. Blythe and D. P. Orr. 1999. Subsequent sexually transmitted infections among adolescent women with genital infection due to Chlamydia trachomatis, Neisseria gonorrhoeae, or Trichomonas vaginalis. Sexually Transmitted Diseases 26 (1):26-32.
Gallichan, W. S. and Rosenthal, K. L. 1996. Effects of the estrous cycle on local humoral immune responses and protection of intranasally immunized female mice against herpes simplex virus type 2 infection in the genital tract. Virology 224 (2):487-97.
Gambhir, M., M. G. Basanez, F. Turner, J. Kumaresan and N. C. Grassly. 2007. Trachoma: transmission, infection, and control. Lancet Infectious Diseases 7 (6):420-7.
Gardner, D. G. 2001. Mechanisms of Hormone Action. In A Lange Medical Book: Basic and Clinical Endocrinology 6th Edition, ed. F. S. Greenspan, Gardner, D.G.,, 59-79. New York: Lange Medical Books/McGraw-Hill Medical Publishing Division.
Gerard, H. C., B. Krausse-Opatz, Z. Wang, D. Rudy, J. P. Rao, H. Zeidler, H. R. Schumacher, J. A. Whittum-Hudson, L. Kohler and A. P. Hudson. 2001. Expression of Chlamydia trachomatis genes encoding products required for DNA synthesis and cell division during active versus persistent infection. Molecular Microbiology 41 (3):731-41.
Gerard, H. C., J. Freise, Z. Wang, G. Roberts, D. Rudy, B. Krauss-Opatz, L. Kohler, H. Zeidler, H. R. Schumacher, J. A. Whittum-Hudson. 2002. Chlamydia trachomatis genes whose products are related to energy metabolism are expressed differentially in active vs. persistent infection. Microbes and Infection 4 (1):13-22.
114 | P a g e
Gerard, H. C., P. J. Branigan, G. R. Balsara, C. Heath, S. S. Minassian and A. P. Hudson. 1998. Viability of Chlamydia trachomatis in fallopian tubes of patients with ectopic pregnancy. Fertility and Sterility 70 (5):945-8.
Ghanem, K. G., N. Shah, R. S. Klein, K. H. Mayer, J. D. Sobel, D. L. Warren, D. J. Jamieson, A. C. Duerr and A. M. Rompalo. 2005. Influence of sex hormones, HIV status, and concomitant sexually transmitted infection on cervicovaginal inflammation. Journal of Infectious Diseases 191 (3):358-66.
Gillgrass, A. E., S. A. Fernandez, K. L. Rosenthal and C. Kaushic. 2005. Estradiol regulates susceptibility following primary exposure to genital herpes simplex virus type 2, while progesterone induces inflammation. Journal of Virology 79 (5):3107-16.
Gillgrass, A. E., V. A. Tang, K. M. Towarnicki, K. L. Rosenthal and C. Kaushic. 2005. Protection against genital herpes infection in mice immunized under different hormonal conditions correlates with induction of vagina-associated lymphoid tissue. Journal of Virology 79 (5):3117-26.
Glasser, S. R., J. Julian, G.L. Decker, J.P. Tang, D.D. Carson. 1988. Development of Morphological and Functional Polarity in Primary Cultures of Immature Rat Uterine Epithelial Cells. The Journal of Cellular Biology 107:2409-2423.
Goldfien, A. 2001. Ovaries. In A Lange Medical Book: Basic and Clinical Endocrinology 6th Edition, ed. F. S. Greenspan, Gardner, D.G., 453-508. New York: Lange Medical Books/McGraw-Hill Medical Publishing Division.
Grant, K. S. and C.R. Wira. 2003. Effect of Mouse Uterine Stromal Cells on Epithelial Cell Transepithelial Resistance (TER) and TNF and TGF Release in Culture. Biology of Reproduction 69:1091-1098.
Grant-Tschudy, K. S., C.R. Wira. 2004. Effect of Estradiol on Mouse Uterine Epithelial Cell Transepithelial Resistance (TER). American Journal of Reproductive Immunology (AJRI) 52:252-262.
Greco, T. L., T. M. Duello and J. Gorski. 1993. Estrogen receptors, estradiol, and diethylstilbestrol in early development: the mouse as a model for the study of estrogen receptors and estrogen sensitivity in embryonic development of male and female reproductive tracts. Endocrine Reviews 14 (1):59-71.
Greub, G. and D. Raoult. 2002. Parachlamydiaceae: potential emerging pathogens. Emerging Infectious Diseases 8 (6):625-30.
Guseva, N. V., S.C. Dessus-Babus, J.D. Whittimore, C.G. Moore, P.B. Wyrick. 2005. Characterisation of Estrogen-Responsive Epithelial Cell Lines and their Infectivity by Genital Chlamydia trachomatis. Microbes and Infection 7 (15):1469-1481.
115 | P a g e
Guseva, N. V., S. C. Dessus-Babus, J. D. Whittimore, C. G. Moore and P. B. Wyrick. 2005. Characterization of estrogen-responsive epithelial cell lines and their infectivity by genital Chlamydia trachomatis. Microbes and Infection 7 (15):1469-81.
Guseva, N. V., S. T. Knight, J. D. Whittimore and P. B. Wyrick. 2003. Primary cultures of female swine genital epithelial cells in vitro: a new approach for the study of hormonal modulation of Chlamydia infection. Infection and Immunity 71 (8):4700-10.
Han, G., T. Magee, O. Khorram, 2005. Regulation of Nitric Oxide Synthase Isoforms by Estrogen in the Human Endometrium. Fertility and Sterility 84 (S2):1220-1227.
Harper, A., C. I. Pogson, M. L. Jones and J. H. Pearce. 2000. Chlamydial development is adversely affected by minor changes in amino acid supply, blood plasma amino acid levels, and glucose deprivation. Infection and Immunity 68 (3):1457-64.
Hintz, N. J., D. G. Ennis, W. F. Liu and S. H. Larsen. 1995. The recA gene of Chlamydia trachomatis: cloning, sequence, and characterization in Escherichia coli. FEMS Microbiology Letters 127 (3):175-80.
Hogan, R. J., S. A. Mathews, A. Kutlin, M. R. Hammerschlag and P. Timms. 2003. Differential expression of genes encoding membrane proteins between acute and continuous Chlamydia pneumoniae infections. Microb Pathog 34 (1):11-6.
Hogan, R. J., S. A. Mathews, S. Mukhopadhyay, J. T. Summersgill and P. Timms. 2004. Chlamydial persistence: beyond the biphasic paradigm. Infection and Immunity 72 (4):1843-55.
Hooton, T. M., C. Winter, F. Tiu and W. E. Stamm. 1996. Association of acute cystitis with the stage of the menstrual cycle in young women. Clinical Infectious Diseases 23 (3):635-6.
Horn, M., A. Collingro, S. Schmitz-Esser, C. L. Beier, U. Purkhold, B. Fartmann, P. Brandt, G. J. Nyakatura, M. Droege, D. Frishman. 2004. Illuminating the evolutionary history of chlamydiae. Science 304 (5671):728-30.
Hybiske, K. and R. S. Stephens. 2007. Mechanisms of Chlamydia trachomatis Entry into Nonphagocytic Cells. Infection and Immunity 75 (8):3925-34.
Iliffe-Lee, E. R. and G. McClarty. 1999. Glucose metabolism in Chlamydia trachomatis: the 'energy parasite' hypothesis revisited. Molecular Microbiology 33 (1):177-87.
Inaba, T., W. Wiest, R.C. Strickler, J. Mori. 1988. Augmentation of the Response of Mouse Uterine Epithelial Cells to Estradiol by Uterine Stroma. Endocrinology 122:1253-1258.
Ito, I., T. Hayashi, K. Yamada, M. Kuzuya, M. Naito, A. Iguchi. 1995. Physiological Conbcentration of Estradiol Inhibits Polymorphonuclear Leukocyte Chemotaxis via a Receptor Mediated System. Life Sciences 56 (25):2247-2253.
116 | P a g e
Jones, M. L., J. S. Gaston and J. H. Pearce. 2001. Induction of abnormal Chlamydia trachomatis by exposure to interferon-gamma or amino acid deprivation and comparative antigenic analysis. Microbial Pathogenesis 30 (5):299-309.
Kalman, S., W. Mitchell, R. Marathe, C. Lammel, J. Fan, R. W. Hyman, L. Olinger, J. Grimwood, R. W. Davis and R. S. Stephens. 1999. Comparative genomes of Chlamydia pneumoniae and C. trachomatis. Nature Genetics 21 (4):385-9.
Kaushic, C., A.A. Ashkar, L.A. Reid, K.L. Rosenthal. 2003. Progesterone Increases Susceptibility and Decreases Immune Responses to Genital Herpes Infection. Journal of Virology 77 (8):4558-4565.
Kaushic, C., E. Frauendorf, C.R. Wira. 1997. Polymeric Immunolglobulin A Receptor in the Rodent Femal Reproductive Tract: Influence of Estradiol in the Vagina and Differential Expression of Messenger Ribonucleic Acid During Estrous Cycle. Biology of Reproduction 57:958-966.
Kaushic, C., K. Grant, M. Crane, C.R. Wira. 2000a. Infection of Polarized Primary Epithelial Cells from Rat Uterus with Chlamydia trachomatis: Cell–Cell Interaction and Cytokine Secretion. American Journal of Reproductive Immunology 44:73–79.
Kaushic, C., A.D. Murdin, B.J. Underdown, C.R. Wira. 1998. Chlamydia trachomatis Infection in the Female Reproductive Tract of the Rat: Influence of Progesterone on Infectivity and Immune Response. Infection and Immunity 66 (3):893–898.
Kaushic, C., F. Zhou, A.D. Murdin, C.R. Wira. 2000b. Effects of Estradiol and Progesterone on Susceptibility and Early Immune Responses to Chlamydia trachomatis Infection in the Female Reproductive Tract. Infection and Immunity 68 (7):4207-4216.
Katzenellenbogen, B. S. 2000. Mechanisms of action and cross-talk between estrogen receptor and progesterone receptor pathways. Journal of the Society for Gynecologic Investigation 7 (1 Suppl):S33-7.
Kearns, M. and P.K., Lala. 1983. Life History of Decidual Cells: a Review. American Journal of Reproductive Immunology 3:78-82.
Kelly, K. A. 2003. Cellular Immunity and Chlamydia Genital Infection: Induction, Recruitment, and Effector Mechanisms. International Reviews of Immunology 23:3-41.
Kita, E., H. Matsuura and S. Kashiba. 1981. A mouse model for the study of gonococcal genital infection. Journal of Infectious Diseases 143 (1):67-70.
Kliman, H. J. 2000. Uteroplacental Blood Flow: The Story of Decidualisation, Menstruation, and Trophoblast Invasion. American Journal of Pathology 157 (6):1759-1768.
117 | P a g e
Koehler, L., E. Nettelnbreker, A. P. Hudson, N. Ott, H. C. Gerard, P. J. Branigan, H. R. Schumacher, W. Drommer and H. Zeidler. 1997. Ultrastructural and molecular analyses of the persistence of Chlamydia trachomatis (serovar K) in human monocytes. Microbial Pathogenesis 22 (3):133-42.
Korenman, S. G. 1998. Reproduction: Sexual Function and Dysfunction. In Williams Textbook of Endocrinology, ed. J. D. Wilson, Foster, D.W., Kronenberg, H.M., Larsen, P.R., 927-938. Philadelphia: W.B. Saunders.
Kramer, M. J. and F. B. Gordon. 1971. Ultrastructural Analysis of the Effects of Penicillin and Chlortetracycline on the Development of a Genital Tract Chlamydia. Infection and Immunity 3 (2):333-341.
Larsen, B., S. Birkelund, C. H. Mordhorst, L. Ejstrup, L. S. Andersen and G. Christiansen. 1994. The humoral immune response to Chlamydia trachomatis in patients with acute reactive arthritis. British Journal of Rheumatology 33 (6):534-40.
Lavreys, L., V. Chohan, J. Overbaugh, W. Hassan, R. S. McClelland, J. Kreiss, K. Mandaliya, J. Ndinya-Achola and J. M. Baeten. 2004. Hormonal contraception and risk of cervical infections among HIV-1-seropositive Kenyan women. AIDS 18 (16):2179-84.
Lessey, B. A. 2003. Two Pathways of Progesterone Action in the Human Endometrium: Implications for Implantation and Contraception. Steroids 68:809-815.
Mahfoudi, A., M. Nicollier, L. Beck, A. Mularoni, B. Cypriani, S. Fauconet. 1994. Effect of Progesterone on Proteins Vectorially Secreted by Glandular Epithelail Cells of Guinea-Pig Endometrium: Modulation by Homologous Stroma. Journal of Reproduction and Fertility 100:637-644.
Martini, F. H. 2001a. The Endocrine System. In Fundamentals of Anatomy and Physiology 5th Edition, 576-622. New Jersey: Prentice Hall.
Martini, F. H. 2001b. The Reproductive System. In Fundamentals of Anatomy and Physiology 5th Edition, 1016-1063. New Jersey: Prentice Hall.
Martini, F. H. 2001c. The Tissue Level of Organisation. In Fundamentals of Anatomy and Physiology 5th Edition, 106-142. New Jersey: Prentice Hall.
Marx, P. A., A. I. Spira, A. Gettie, P. J. Dailey, R. S. Veazey, A. A. Lackner, C. J. Mahoney, C. J. Miller, L. E. Claypool, D. D. Ho. 1996. Progesterone implants enhance SIV vaginal transmission and early virus load. Nature Medicine 2 (10):1084-9.
Maslow, A. S., C. H. Davis, J. Choong and P. B. Wyrick. 1988. Estrogen enhances attachment of Chlamydia trachomatis to human endometrial epithelial cells in vitro. American Journal of Obstetrics and Gynecology 159 (4):1006-14.
118 | P a g e
Menon, S., M. D. Sammel, M. Vichnin and K. T. Barnhart. 2007. Risk factors for ectopic pregnancy: a comparison between adults and adolescent women. Journal of Pediatric and Adolescent Gynecology 20 (3):181-5.
Metzler, M. and E. Pfeiffer. 2001. Chemistry of Natural and Anthropogenic Endocrine Active Compounds. In The Handbook of Environmental Chemistry, ed. Manfred Metzler, 63-80: Springer Berlin / Heidelberg.
Montes, M. B., A. C. Ferreira, J. C. Fenolio, S. A. Franceschini and M. R. Toloi. 2000. Effects of oral contraceptives in vaginal cytology. Pathologica 92 (3):185-8.
Morrison, R. P. 2003. New insights into a persistent problem - chlamydial infections. Journal of Clinical Investigation 111 (11):1647-9.
Moulder, J. W. 1991. Interaction of chlamydiae and host cells in vitro. Microbiological Reviews 55 (1):143-90.
Mpiga, P. and M. Ravaoarinoro. 2006. Effects of sustained antibiotic bactericidal suppliment on Chlamydia trachomatis infected epithelial-like cells (HeLa) and monocyte-like cells (THP-1 and U-937). International Journal of Antimicrobial Agents 27 (4):316-24.
Nanagara, R., F. Li, A. Beutler, A. Hudson and H. R. Schumacher. 1995. Alteration of Chlamydia trachomatis biologic behavior in synovial membranes. Suppression of surface antigen production in reactive arthritis and Reiter's syndrome. Arthritis and Rheumatism 38 (10):1410-7.
Nelson, H. D. and M. Helfand. 2001. Screening for chlamydial infection. American Journal of Preventive Medicine 20 (3 Suppl):95-107.
O'Connor, K. A., D.J. Holman, J.W. Wood. 2001. Menstrual Cycle Variability and the Perimenopause. American Journal of Human Biology 13:465-478.
Paavonen, J. and W. Eggert-Kruse. 1999. Chlamydia trachomatis: impact on human reproduction. Human Reproduction Update 5 (5):433-47.
Parr, M. B., L. Kepple, M. R. McDermott, M. D. Drew, J. J. Bozzola and E. L. Parr. 1994. A mouse model for studies of mucosal immunity to vaginal infection by herpes simplex virus type 2. Laboratory Investigation 70 (3):369-80.
Pasley, J. N., R. G. Rank, A. J. Hough, Jr., C. Cohen and A. L. Barron. 1985a. Absence of progesterone effects on chlamydial genital infection in female guinea pigs. Sexually Transmitted Diseases 12 (3):155-8.
Pasley, J. N., R. G. Rank, A. J. Hough, Jr., C. Cohen and A. L. Barron. 1985b. Effects of various doses of estradiol on chlamydial genital infection in ovariectomized guinea pigs. Sexually Transmitted Diseases 12 (1):8-13.
119 | P a g e
Patton, D. L., S.S. Thwin, A. Meier, T.M. Hooton, A.E. Stapleton, D.A., Eschenbach. 2000. Epithelial Cell Layer Thickness and Immune Cell Populations in the Normal Human Vagina at Different Stages of the Menstrual Cycle. American Journal of Obstetrics and Gynecology 183:967-973.
Pierro, E., F. Minici, O. Alesiani, F. Miceli, C. Proto, I. Screpanti, S. Mancuso, A. Lanzone. 2001. Stromal-Epithelial Interactions Modulate Estrogen Responsiveness in Normal Human Endometrium. Biology of Reproduction 64:831-838.
Prabhala, R. H., C.R. Wira. 1995. Sex Hormone and IL-6 Regulation of Antigen Presentation in the Female Reproductive Tract Mucosal Tissues. The Journal of Immunology 155:5566-5573.
Quayle, A. J. 2002. The Innate and Early Immune Response to Pathogen Challenge in the Female Reproductive Tract and the Pivitol Role of Epithelial Cells. Journal of Reproductive Immunology 57:61-79.
Rank, R. G. 1994. Animal models for urogenital infections. Methods in Enzymology 235:83-93.
Rank, R. G. and A. L. Barron. 1987. Specific effect of estradiol on the genital mucosal antibody response in chlamydial ocular and genital infections. Infection and Immunity 55 (9):2317-9.
Rank, R. G., H. J. White, A. J. Hough, Jr., J. N. Pasley and A. L. Barron. 1982. Effect of estradiol on chlamydial genital infection of female guinea pigs. Infection & Immunity 38 (2):699-705.
Rank, R. G., M. M. Sanders and A. T. Kidd. 1993. Influence of the estrous cycle on the development of upper genital tract pathology as a result of chlamydial infection in the guinea pig model of pelvic inflammatory disease. American Journal of Pathology 142 (4):1291-6.
Richardson, J. M., C. Kaushic, C.R. Wira. 1995. Polymeric Immunoglobulin (Ig) Receptor Production and IgA Transcytosis in Polarised Primary Cultures of Mature Rat Uterine Epithelial Cells. Biology of Reproduction 53:488-498.
Robertson, S. A., V.J. Mau, S.N. Hudson, K.P. Tremellen. 1997. Cytokine-Leukocyte Networks and the Establishment of Pregnancy. American Journal of Reproductive Immunology 37:438-442.
Rolle, C. J., C. Y. Wai, R. Bawdon, R. Santos-Ramos and B. Hoffman. 2006. Unilateral twin ectopic pregnancy in a patient with a history of multiple sexually transmitted infections. Infectious Diseases in Obstetrics and Gynecology 14 (3):10306.
Rubin, G. L., H. W. Ory and P. M. Layde. 1982. Oral contraceptives and pelvic inflammatory disease. American Journal of Obstetrics and Gynecology 144 (6):630-5.
Schmidt, M., Renner, C. Löffler. 1998. Progesterone Inhibits Glucocorticoid-Dependent Aromatase Induction in Human Adipose Tissue. Journal of Endocrinology 158:401-407.
120 | P a g e
Seals, R. C., M.C. Wulster-Radcliffe, G.S. Lewis. 2003. Uterine Response to Infectious Bacteria in Estrous Cyclic Ewes. American Journal of Reproductive Immunology 49:269-278.
Sentman, C. L., S.K. Meadows, C.R. Wira, M. Eriksson. 2004. Recruitment of Uterine NK Cells: Induction of CXC Chemokine Ligands 10 and 11 in Human Endometrium by Estradiol and Progesterone. The Journal of Immunology 173:6760-6766.
Shahmanesh, M., M. Brunst, A. Sukthankar, J. H. Pearce and J. S. Gaston. 1999. Peripheral blood T cell proliferative response to chlamydial organisms in gonococcal and non-gonococcal urethritis and presumed pelvic inflammatory disease. Sexually Transmitted Infections 75 (5):327-31.
Shew, M. L., R. McGlennen, N.,Zaidi, M. Westerheim, M. Ireland, and , S. Anderson. 2002. Oestrogen receptor transcripts associated with cervical human papillomavirus infection. Sexually Transmitted Infections 78 (3):210-4. Shlomit, L. and H.Margalit. 1993. Compilation of E. coli mRNA promoter sequences. Nucleic Acids Res. 21, 1507-1516. Skelding, K. A., D.K. Hickey, J.C. Horvat, S. Bao, K.G. Roberts, J.M. Finnie, P.M. Hansbro, K.W. Beagley. 2006. Comparison of Intranasal and Transcutaneous Immunisation for the Induction of Protective Immunity Against Chlamydia muridarum Respiratory Tract Infection. Vaccine 24 (3):355-366.
Slepenkin, A., V. Motin, L. M. de la Maza and E. M. Peterson. 2003. Temporal expression of type III secretion genes of Chlamydia pneumoniae. Infection and Immunity 71 (5):2555-62.
Smith, S. M., G. B. Baskin and P. A. Marx. 2000. Estrogen protects against vaginal transmission of simian immunodeficiency virus. Journal of Infectious Diseases 182 (3):708-15.
Sonnex, C. 1998. Influence of ovarian hormones on urogenital infection. Sexually Transmitted Infections 74 (1):11-9.
Stephens, R. S., E. A. Wagar and U. Edman. 1988. Developmental regulation of tandem promoters for the major outer membrane protein gene of Chlamydia trachomatis. Journal of Bacteriology 170 (2):744-50.
Stephens, R. S., S. Kalman, C. Lammel, J. Fan, R. Marathe, L. Aravind, W. Mitchell, L. Olinger, R. L. Tatusov, Q. Zhao. 1998. Genome sequence of an obligate intracellular pathogen of humans: Chlamydia trachomatis. Science 282 (5389):754-9.
Stern, J. E., S. Gardner, D. Quirk, C.R. Wira. 1992. Secretory Immune System of the Male Reproductive Tract: Effects of Dihydrotestosterone and Estradiol on IgA and Secretory Component Levels. Journal of Reproductive Immunology 22:73-85.
121 | P a g e
Stern, J. E., C.R. Wira. 1985. The Secretory Immune System in the Uterus of the Pregnant Rat: Production of Secretory Component by Uterine Tissues. Journal of Reproductive Immunology 7:77-87.
Stern, J. E., C.R. Wira. 1988. Progesterone Regulation of Secretory Component (SC): Uterine SC Response in Organ Culture Following In Vivo Hormone Treatmen. Journal of Steroid Biochemistry 30 (1-6):233-237.
Storz J. and L.A. Page. 1971. Taxonomy of the Chlamydiae: reasons for classifying organisms of the genus Chlamydia, family Chlamydiaceae, in a separate order, Chlamydiales ord. nov. International Journal of Systematic Bacteriology 21: 332-334.
Su, H. and H. D. Caldwell. 1998. Sulfated polysaccharides and a synthetic sulfated polymer are potent inhibitors of Chlamydia trachomatis infectivity in vitro but lack protective efficacy in an in vivo murine model of chlamydial genital tract infection. Infection and Immunity 66 (3):1258-60.
Sugarman, B. and P. Agbor. 1986. Estrogens and Chlamydia trachomatis. Proceedings of the Society for Experimental Biology and Medicine 183 (1):125-31.
Sullivan, D. A., G.S. Richardson, D.T. MacLaughlin, C.R. Wira. 1984a. Variations in the Levels of Secretory Component in Human Uterine Fluid During the Menstrual Cycle. Journal of Steroid Biochemistry 20 (1):509-513.
Sullivan, D. A., C.R. Wira. 1981. Estradiol Regulation of Secretory Component in the Female Reproductive Tract. Journal of Steroid Biochemistry 15:439-444.
Sullivan, D. A., C.R. Wira. 1984b. Hormonal Regulation of Immunoglobulins in the Rat Uterus: Uterine Response to Multiple Estradiol Treatments. Endocrinology 114:650-658.
Sweet, R. L., D. V. Landers, C. Walker and J. Schachter. 1987. Chlamydia trachomatis infection and pregnancy outcome. American Journal of Obstetrics and Gynecology 156 (4):824-33.
Sweet, R. L., M. Blankfort-Doyle, M. O. Robbie and J. Schacter. 1986. The occurrence of chlamydial and gonococcal salpingitis during the menstrual cycle. Journal of the American Medical Association 255 (15):2062-4.
Sydney IVF. 2006. Reproduction in Women: Conceptions and Misconceptions. In Sydney IVF's Guide to Assisted Conception, 4.
Tait, A. S., C. L. Butts, and E. M Sternberg. 2008. The role of glucocorticoids and progestins in inflammatory, autoimmune, and infectious disease. Journal of Leukocyte Biology 84 (4):924-31.
Thejls, H., J. Gnarpe, O. Lundkvist, G. Heimer, G. Larsson and A. Victor. 1991. Diagnosis and prevalence of persistent chlamydia infection in infertile women: tissue culture, direct antigen
122 | P a g e
detection, and serology. Fertility and Sterility 55 (2):304-10.
Tsai, M.-J., J.H. Clark, W.T. Schrader, B.W. O'Malley. 1998. Hormones and Hormone Action: Mechanisms of Action of Hormones that Act as Transcription-Regulatory Factors. In Williams Textbook of Endocrinology, ed. J. D. Wilson, Foster, D.W., Kronenberg, H.M., Larsen, P.R., 55-94. Philadelphia: W.B.Saunders.
Tsavachidou, D., M.N. Liebman. 2002. Modeling and Simulation of Pathways in Menopause. Journal of the American Medical Informatics Association 9 (5):461-471.
Wallace, P. K., G.R. Yeaman, K. Johnson, J.E. Collins, P.M. Guyre, C.R. Wira. 2001. MHC Class II Expression and Antigen Presentation by Human Endometrial Cells. Journal of Steroid Biochemistry and Molecular Biology 76:203-211.
Walker, N. J. 2002. A technique whose time has come. Science 296 (5567):557-9. Wang, S. P. and J. T. Grayston. 1991. Serotyping of Chlamydia trachomatis by indirect fluorescent-antibody staining of inclusions in cell culture with monoclonal antibodies. Journal of Clinical Microbiology 29 (7):1295-8.
Washington, A. E., S. Gove, J. Schachter and R. L. Sweet. 1985. Oral contraceptives, Chlamydia trachomatis infection, and pelvic inflammatory disease. A word of caution about protection. Journal of the American Medical Association 253 (15):2246-50.
White, H. D., K.M. Crassi, A.L. Givan, J.E. Stern, J.L. Gonzalez, V.A. Memoli, W. Green, C.R. Wira.1997. CD3+ CD8+ CTL Activity Within the Human Female Reproductive Tract. The Journal of Immunology 158:3017-3027.
Wira, C. R. and R. M. Rossoll. 1995. Antigen-presenting cells in the female reproductive tract: influence of sex hormones on antigen presentation in the vagina. Immunology 84 (4):505-8.
Wira, C. R., J.E. Bodwell, R.H. Prabhala 1991. In Vivo response to Secretory Component in the Rat Uterus to Antigen, IFN-γ, and Estradiol. The Journal of Immunology 146 (6):1893-1899.
Wira, C. R., J.V. Fahey, V.M. Abrahams, R.M. Rossoll. 2003. Influence of Stage of the Reproductive Cycle and Estradiol on Thymus Cell Antigen Presentation. Journal of Steroid Biochemistry and Molecular Biology 84:79-87.
Wira, C. R., J.V. Fahey, C.L. Sentman, P.A. Pioli, L., Shen. 2005a. Innate and Adaptive Immunity in Female Genital Tract: Cellular Responses and Interactions. Immunological Reviews 206:306-335.
Wira, C. R., K.S. Grant-Tschudy, M.A. Crane-Godreau. 2005b. Epithelial Cells in the Female Reproductive Tract: a Central Role as Sentinels of Immune Protection. American Journal of Reproductive Immunology (AJRI) 53:65-76.
123 | P a g e
Wira, C. R., E. Hydee, C.P. Sandoe, D. Sullivan, S. Spencer. 1980. Cellular Aspects of the Rat Uterine IgA Response to Estradiol and Progesterone. Journal of Steroid Biochemistry 12:451-459.
Wira, C. R., M.A. Roche, R.M. Rossoll. 2002. Antigen Presentation by Vaginal Cells: Role of TGFβ as a Mediator of Estradiol Inhibition of Antigen Presentation. Endocrinology 143:2872-2879.
Wira, C. R., R.M. Rossoll, C. Kaushic. 2000. Antigen-Presenting Cells in the Female Reproductive Tract: Influence of Estradiol on Antigen Presentation by Vaginal Cells. Endocrinology 141:2877-2885.
Wira, C. R., R.M. Rossoll, R.C. Young, 2005c. Polarised Uterine Epithelial Cells Preferentially Present Antigen at the Basolateral Surface: Role of Stromal Cells in Regulating Class II-Mediated Epithelial Cell Antigen Presentation. The Journal of Immunology 175:1795-1804.
Wira, C. R., R.M. Rossoll. 1995. Antigen-Presenting Cells in the Female Reproductive Tract: Influence of the Estrous Cycle on Antigen Presentation by Uterine Epithelial and Stromal Cells. Endocrinology 136 (10):4526-4534.
Wira, C. R., R.M. Rossoll. 2003b. Oestradiol Regulation of Antigen Presentation by Uterine Stromal Cells: Role of Transforming Growth Factor- Production by Epithelial Cells in Mediating Antigen-Presenting Cell Function. Immunology 109:398-406.
Wira, C. R., C.P. Sandoe. 1987. Specific IgA and IgG Antibodies in the Secretions of the Female Reproductive Tract: Effects of Immunisation and Estradiol on Expression of this Response in vivo. The Journal of Immunology 138 (12):4159-4164.
Wira, C. R., J.E. Stern, E. Colby. 1984. Estradiol Regulation of Secretory Component in the Uterus of the Rat: Evidence for Involvement of RNA Synthesis. The Journal of Immunology 133 (5):2624-2628.
Wira, C. R., D.A. Sullivan, C.P. Sandoe. 1983. Epithelial Cell Involvement in the Estradiol-Stimulated Accumulation of IgA in the Rat Uterus. Journal of Steroid Biochemistry 19 (1):469-474.
Wira, C. R., D.A. Sullivan. 1985. Estradiol and Progesterone Regulation of Immunoglobulin A and G and Secretory Component in Cervicovaginal Secretions of the Rat. Biology of Reproduction 32:90-95.
World Health Organisation (WHO). 2006. Chlamydia trachomatis. http://www.who.int/vaccine_research/documents/new_vaccines/en/index3.html#chlamydia (accessed 9th August).
124 | P a g e
Wyrick, P. B., C. H. Davis, J. E. Raulston, S. T. Knight and J. Choong. 1994. Effect of clinically relevant culture conditions on antimicrobial susceptibility of Chlamydia trachomatis. Clinical Infectious Diseases 19 (5):931-6.
Yamazaki, T., T. Hagiwara, T. Kishimoto, N. Sasaki, S. Takahashi, O. Ishihara, P. Wangroongsarb, M. Kusum and P. Sirivongrangsan. 2005. Distribution of Chlamydia trachomatis serovars among female prostitutes and non-prostitutes in Thailand, and non-prostitutes in Japan during the mid-90s. Japanese Journal of Infectious Diseases 58 (4):211-3.
Yang, L., Y. Hu, Y. Hou. 2006. Effects of 17β-Estradiol on the Maturation, Nuclear Factor Kappa B p65 and Functions of Murine Spleen CD11c-Positive Dendritic Cells. Molecular Immunology 43:357-366.
Yeaman, G. R., P.M. Guyre, M.W. Fanger, J.E. Collins, H.D. White, W. Rathburn, K.A. Orndorff, J. Gonzalez, J.E. Stern, C.R. Wira. 1997. Unique CD8+ T Cell-Rich Lymphoid Aggregates in Human Uterine Endometrium. Journal of Leukocyte Biology 61:427-435.
Zhang, D. J., H. Fan, G. McClarty and R. C. Brunham. 1995. Identification of the Chlamydia trachomatis RecA-encoding gene. Infection and Immunity 63 (2):676-80.
Zhang, J. P. and R. S. Stephens. 1992. Mechanism of C. trachomatis attachment to eukaryotic host cells. Cell 69 (5):861-9.
Zhong, G. and R. C. Brunham. 1992. Antigenic analysis of the chlamydial 75-kilodalton protein. Infection and Immunity 60 (3):1221-4.