Characterization of Esterase A, a Pseudomonas stutzeri A15

Characterization of Esterase A, a Pseudomonas stutzeri A15Autotransporter

Toon Nicolay, Ken Devleeschouwer, Jos Vanderleyden, and Stijn Spaepen

Centre of Microbial and Plant Genetics, KU Leuven, Heverlee, Belgium

Autotransporters are a widespread family of proteins, generally known as virulence factors produced by Gram-negative bacteria.In this study, the esterase A (EstA) autotransporter of the rice root-colonizing beneficial bacterium Pseudomonas stutzeri A15was characterized. A multiple sequence alignment identified EstA as belonging to clade II of the GDSL esterase family. Autolo-gous overexpression allowed the investigation of several features of both autotransporter proteins and GDSL esterases. First, thecorrectly folded autotransporter was shown to be present in the membrane fraction. Unexpectedly, after separation of the mem-brane fraction, EstA was detected in the N-laurylsarcosine soluble fraction. However, evidence is presented for the surface expo-sure of EstA based on fluorescent labeling with EstA specific antibodies. Another remarkable feature is the occurrence of a C-ter-minal leucine residue instead of the canonical phenylalanine or tryptophan residue. Replacement of this residue with aphenylalanine residue reduced the stability of the �-barrel. Regarding the esterase passenger domain, we show the importance ofthe catalytic triad residues, with the serine and histidine residues being more critical than the aspartate residue. Furthermore,the growth of an estA-negative mutant was not impaired and cell mobility was not disabled compared to the wild type. No spe-cific phenotype was detected for an estA-negative mutant. Overall, P. stutzeri A15 EstA is a new candidate for the surface displayof proteins in environmentally relevant biotechnological applications.

Pseudomonas stutzeri A15 is a nitrogen-fixing Gram-negativeendophytic bacterium, isolated from the roots of paddy rice

(56). The P. stutzeri species is very diverse and constitutes 18groups, called genomovars (14). The first sequenced strain of thisspecies is P. stutzeri A1501, which is a reisolate from paddy riceroots after inoculation with P. stutzeri A15 (54). The availability ofthis genome sequence suggested the presence of an autotrans-porter protein called EstA. Both its nature as an autotransporterand its esterase activity are of interest, the latter because esterasesare applied in many biocatalytic applications (5) and the formerbecause autotransporters are used as tools for surface display (18).

Autotransporters are a widespread family of proteins, generallyknown as virulence factors, produced by Gram-negative bacteria(27). They are part of the type V secretion system family, hencetheir alternative name, the type Va secretion system. The type Vsecretion system represents the simplest and most prevalent secre-tion apparatus of Gram-negative bacteria. The typical modularstructure of an autotransporter consists of a single polypeptidecomprising a signal peptide, an N-terminal passenger domain anda C-terminal �-barrel domain, necessary for the anchoring of theprotein to the outer membrane (9). Replacement of the originalpassenger domain by a heterologous protein results in the surfacedisplay of the new passenger. The autotransporter-based technol-ogy for surface display has already been used in the past for differ-ent kinds of proteins (18).

The GDSL family of serine esterases and lipases was only iden-tified recently (45). This family is characterized by the absence ofthe nucleophilic elbow and the presence of a distinct GDSL motifthat differs from the classical GxSxG motif, which is common tomany lipases. The family consists of five clades, of which clades Iand II contain the bacterial GDSL esterases and lipases (1). Asubfamily of the GDSL family was named the SGNH family ofhydrolases because of the four important active-site residues pres-ent in four blocks of homology (24). Although an early classifica-

tion restricted the SGNH family to clade I of the GDSL family (1),clade II was added later on to this family of hydrolases (2).

Recently, the crystal structure of EstA of Pseudomonas aerugi-nosa PAO1 was determined. The globular fold in the structure ofthe passenger domain makes it completely different from otherknown autotransporter passenger domains, possessing a �-helicalstructure (46). EstA of P. aeruginosa differs even more from theclassical autotransporter since it remains covalently attached tothe �-barrel domain after translocation to the cell surface (52).This esterase is one of the best characterized members of clade II ofthe GDSL family (49) and has already been applied for the surfacedisplay of proteins in Escherichia coli (3, 50). Previous work onautotransporters with a GDSL esterase passenger domain andtheir use in biotechnological applications has been reviewed (51).

Here, we characterized the autotransporter esterase A (EstA) ofP. stutzeri A15 both physiologically and biochemically. An estA-negative mutant was checked for its cellular mobility and its abilityto form biofilms. Furthermore, the expression conditions of estAwere examined. At the protein level, we were able to verify severalaspects that are distinctive for members of the family of GDSLesterases on the one hand and for autotransporter proteins on theother hand.

MATERIALS AND METHODSBacterial strains, plasmids, and growth conditions. All of the bacterialstrains and plasmids used in the present study are listed in Table 1. P.

Received 25 November 2011 Accepted 26 January 2012

Published ahead of print 3 February 2012

Address correspondence to Stijn Spaepen, [email protected].

Supplemental material for this article may be found at http://aem.asm.org/.

Copyright © 2012, American Society for Microbiology. All Rights Reserved.

doi:10.1128/AEM.07690-11

0099-2240/12/$12.00 Applied and Environmental Microbiology p. 2533–2542 aem.asm.org 2533

on April 10, 2019 by guest

http://aem.asm

.org/D

ownloaded from

http://dx.doi.org/10.1128/AEM.07690-11

http://aem.asm.org

http://aem.asm.org/

stutzeri A15 was routinely cultured on minimal medium (MMAB) plates(per liter: 5 g of malate, 3 g of K2HPO4, 1 g of NaH2PO4, 1 g of NH4Cl, 0.3g of MgSO4·2H2O, 0.15 g of KCl, 0.01 g of CaCl2, and 0.0025 g ofFeSO4·2H2O). All E. coli strains were cultured on Luria-Bertani (LB)plates. If necessary, antibiotics were added to the medium in final concen-trations of 10 �g ml�1 for tetracycline, 50 �g ml�1 for spectinomycin, and50 �g ml�1 for kanamycin.

For the expression of EstA (and derivatives), Erlenmeyer flasks con-

taining 100 ml of LB and 0.2% L-arabinose (final concentration) wereinoculated with about 5 � 107 CFU of P. stutzeri A15. Cultures weregrown at 30°C and 200 rpm for 24 h without the addition of antibiotics.

Monitoring of growth on different ester substrates (20 �M) as a car-bon source was performed in a BioscreenC (Labsystems Oy) by measuringthe optical density at 600 nm (OD600) every 15 min.

Construction of an estA mutant. PCR with the primers AI2977 andAI2978 (Table 2) on genomic DNA of P. stutzeri A15 generated an estA

TABLE 1 Bacterial strains and plasmids used in this study

Strain or plasmid Relevant characteristicsa Source or reference(s)

StrainsE. coli BL21(DE3) F� ompT gal dcm lon hsdSB(rB

� mB�) �(DE3 [lacI lacUV5-T7 gene 1 ind1 sam7 nin5]) Invitrogen

E. coli Top10 mcrA �(mrr-hsdRMS-mcrBC) �lacX74 deoR recA1 araD139�(ara-leu)7697 galK rpsLendA1 nupG

Invitrogen

P. stutzeri A15 Wild type, isolated from rice rhizosphere soil 47, 56P. stutzeri A15 estA A15 estA::kan This study

PlasmidspET28a� T7 promoter; Kmr NovagenpET28a�-estA pET28a� containing estA in XbaI and XhoI This studypHERD26T pBAD promoter, Tcr, pRO-1600 ori, pBR322 ori, oriT 28pHERD26T-estA pHERD26T containing estA in EcoRI and XbaI This studypHERD26T-estA S37A pHERD26T-estA containing S37A mutation This studypHERD26T-estA D304A pHERD26T-estA containing D304A mutation This studypHERD26T-estA H307L pHERD26T-estA containing H307L mutation This studypHERD26T-estA L636F pHERD26T-estA containing L636F mutation This studypLAFR3 IncP1, Tcr 38pLAFR3-PestA-gusA pLAFR3 containing the estA promoter region fused to gusA This studypRK2073 Spr, Tra�, Mob�, ColE1 replicon 12pUC4K Origin of Kmr gene (kan) 42pUC19 Apr, ColE1 replicon 55pSUP202 Tcr, ColE1 replicon, oriT 36pSUP202-Km-estA pSUP202 containing the kan gene of pUC4K flanked by parts of the estA gene and

promoter regionThis study

a Tcr, tetracycline resistance; Apr, ampicillin resistance; Spr, spectinomycin resistance; Kmr, kanamycin resistance.

TABLE 2 Primers used in this study

Primer Sequence (5=–3=)a Description

AI2647 ATCGTCTAGAAATAATTTTGTTTAACTTTAAGAAGGAGGGAGATACCCCCGTGCAAAG

Forward primer estA in pET28a� with XbaI restriction site

AI2648 AGCTCTCGAGCAGATCCAAGGCCAGCGAC Reverse primer estA in pET28a� with XhoI restriction siteAI2977 CGATAAGCTTGCGGTTGAGCAGCAAATCAAG Forward primer estA mutant with HindIII restriction siteAI2978 ACTGGAATTCCAGATCCAAGGCCAGCGAC Reverse primer estA mutant with EcoRI restriction siteAI2979 ACTGGAATTCGTAAGAGATACCCCCGTGCAAAG Forward primer estA in pHERD26T with EcoRI restriction siteAI2980 ACTGTCTAGACTACAGATCCAAGGCCAGC Reverse primer estA in pHERD26T with XbaI restriction siteAI3192 CGATAAACGGCGACTCCATC Reverse primer 1 L636F mutationAI4623 ATCGGGATCCTTTGCACGGGGGTATCTCC Reverse primer estA promoter with BamHI restriction siteAI4624 ATCGCTGCAGCTGGGACGGTCTATTCGCAG Forward primer estA promoter with PstI restriction siteAI5083 CGCATCGCTCAGCGCGTCGCCGAATACGATG Forward primer 1 S37A mutationAI5084 CATCGTATTCGGCGACGCGCTGAGCGATGCG Reverse primer 2 S37A mutationAI5085 CGCTCAGGAAGTTGAACGTCG Forward primer 2 S37A mutationAI5086 ACGGCGTCACACTTTGCTATG Reverse primer 1 S37A mutationAI5087 GCGGTGGTGGGAAGCACGGCGTCGTTG Forward primer 2 H307L mutationAI5088 CAACGACGCCGTGCTTCCCACCACCGC Reverse primer 1 H307L mutationAI5089 TTGGGTAACGCCAGGGTTTTC Forward primer 1 D304 and H307L mutationAI5090 GCTACATCATCGTTTCCGATCTGC Reverse primer 2 D304 and H307L mutationAI5091 GGGATGCACGGCGGCGTTGAACAGCAGGC Forward primer 2 D304A mutationAI5092 GCCTGCTGTTCAACGCCGCCGTGCATCCC Reverse primer 1 D304A mutationAI5350 GTCGCTGGCCTTGGATTTTTAGTCTAGAGTCGACC Reverse primer 2 L636F mutationAI5351 GGTCGACTCTAGACTAAAAATCCAAGGCCAGCGAC Forward primer 1 L636F mutationa New codons are underlined in mutagenic primers, and restriction sites are italicized.

Nicolay et al.

2534 aem.asm.org Applied and Environmental Microbiology


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org

http://aem.asm.org/

fragment of 2.3 kb. A 1.0-kb part of this fragment was replaced with the1.2-kb kanamycin resistance cassette of pUC4K. The initial cloning stepswere performed in pUC19. The final construct was ligated to the suicideplasmid pSUP202, generating pSUP202-Km-estA. This vector was intro-duced into P. stutzeri A15 by triparental conjugation with the helper plas-mid pRK2073. Transconjugants resulting from double homologous re-combination between the wild-type estA allele and the estA::kan allelewere selected for kanamycin resistance and sensitivity to tetracycline. Suc-cessful inactivation was checked by PCR, Western blot, and esterase ac-tivity assays.

Construction of an estA promoter gusA fusion. The estA promoterregion was amplified with PCR using the primers AI4623 and AI4624(Table 2). This fragment was fused to the gusA gene and cloned intopLAFR3, resulting in pLAFR3-PestA-gusA. The construct was verified bysequencing (Macrogen) and mobilized to P. stutzeri A15 by triparentalconjugation.

Site-directed mutagenesis of residues in EstA. Primers used for thesite-directed mutagenesis are depicted in Table 2. All mutations were ver-ified by DNA sequencing (Macrogen). Finally, the plasmids were mobi-lized into P. stutzeri A15 by triparental conjugation.

EstA overexpression and antibody generation. The open readingframe (ORF) of estA was amplified by using the primers AI2647 andAI2648. The resulting PCR fragment was cloned into pET28a� at theXbaI/XhoI sites, generating pET28a�-estA. Expression was induced at anOD600 of 0.5 by the addition of IPTG (isopropyl-�-D-thiogalacto-pyranoside) to a final concentration of 0.4 mM. Bacterial cells were har-vested 3 h after induction. After centrifugation, EstA was extracted frombacterial cells by using a 3% sodium dodecyl sulfate (SDS) buffer. Here-after, EstA was purified using Ni2�-NTA agarose (Qiagen) essentially ac-cording to the instructions provided by the manufacturer. The purifiedEstA was used for the generation of a rabbit polyclonal anti-EstA serum(Eurogentec). After testing, the best dilution of the serum appeared to be1:2,000.

SDS-PAGE and Western blotting. Unless otherwise stated, proteinsamples were heated for 10 min at 70°C before separation by SDS-PAGEon a 12% polyacrylamide gel (Pierce protein gel; Thermo Scientific) usinga running buffer (Tris-HEPES-SDS; 120 V and 75 min at 16°C) and theNuPAGE system (Invitrogen). After electrophoresis, the proteins weretransferred onto polyvinylidene fluoride membranes (Invitrogen) by elec-troblotting (30 V and 50 min at 16°C), and the membranes were incubatedwith rabbit polyclonal anti-EstA serum. The proteins that reacted with theprimary antibody were visualized using alkaline phosphatase-conjugatedgoat anti-rabbit IgG secondary antibodies (Sigma) (6).

For the detection of the outer membrane marker protein OprF, cross-reacting rabbit polyclonal anti-OmpA serum was used in a 1:12,000 dilu-tion (overall protein sequence similarity of 27% between E. coli K-12OmpA and P. stutzeri A1501 Op F).

Cell fractionation. Cultures of P. stutzeri were harvested (4,000 � gfor 12 min at 4°C) and washed with 10 ml of Tris-buffer (50 mM Tris, pH8). A 350-mg pellet was stored at �80°C and thereafter used for cell frac-tionation. The pellet was resuspended in 14 ml of lysis buffer (50 mM Tris,10 mM MgSO4, 0.4 U of DNase/ml, phenylmethylsulfonyl fluoride; pH 8)after thawing on ice. Sonication (Branson Digital Sonifier 250; three son-ication rounds of 4-min intermittent sonication with an amplitude of20%) on ice disrupted the cells. Subsequently, the cellular debris wasremoved by centrifugation (4,000 � g for 12 min at 4°C). The supernatant(the total lysate [TL]) was centrifuged (48,000 � g for 1 h at 4°C), resultingin a new supernatant fraction (cytoplasmic and periplasmic fraction[CPP]). The pellet was washed twice with 1 ml of Tris buffer and resus-pended in 1 ml of Tris buffer (total membrane fraction [TM]). In the caseof a separation between the inner membrane and outer membranes, theTM fraction was diluted 14 times in Tris buffer containing 1% N-lauryl-sarcosine (sarcosyl, final concentration) and incubated for 30 min at 20°C.A final centrifugation step (48,000 � g for 1 h at 4°C) separated the sar-cosyl-soluble fraction (SSF), the supernatant, from the pellet containing

the outer membrane fraction (OM). The OM was washed twice with 1 mlof Tris buffer and resuspended in 1 ml of Tris buffer. Unless otherwiseindicated, TM and OM samples were diluted 14 times before loading themonto SDS-PAGE gels to compare the band intensities over all of the frac-tions.

Esterase activity assays. Cells were harvested by centrifugation, andthe pellet was resuspended in 0.85% NaCl to obtain an OD600 of 1.5. A95-�l portion of the buffer (100 mM morpholinepropanesulfonic acid,0.85% NaCl; pH 7) containing 4 mM p-nitrophenyl butyrate was added to5 �l of the bacterial solution. The esterase activity was measured by mon-itoring the OD410 at 37°C. For measuring the membrane-bound esteraseactivity, 5 �l of TM fraction was used.

�-Glucuronidase assays. �-Glucuronidase activity was measuredquantitatively by using the substrate p-nitrophenyl-�-D-glucuronide andcalculated according to the method of Miller (23). Qualitative promoteranalysis under nitrogen fixation conditions was performed in tubes con-taining semisolid minimal medium without nitrogen (0.17% agar) and 50or 500 �g of 5-bromo-4-chloro-3-indolyl-�-D-glucuronic acid/ml at30°C.

Swimming and swarming. The swimming and swarming behavior ofP. stutzeri A15 was examined on plates containing MMAB plus 1% bacte-riological peptone and 0.5% agar for the swarm plates and 0.3% agar forthe swim plates. A bacterial suspension was dropped onto the plates,which were incubated at 37°C.

Biofilm formation. Biofilm formation was measured quantitativelyusing the adapted Calgary device (7). A lid with pegs was placed in a96-well plate filled with 150 �l of medium and 10 �l of bacterial suspen-sion. After incubation at a fixed temperature, with or without mediumreplacement, pegs were developed using crystal violet as described previ-ously (16). Biofilm formation was measured at an OD570.

Fluorescence microscopy and image analysis. Samples (250 �l) fromP. stutzeri A15 cultures were harvested by centrifugation (3,300 � g for 5min), and the pellet was resuspended in 18 �l of phosphate-bufferedsaline (PBS) and 2 �l of rabbit polyclonal anti-EstA serum. After 1 h ofincubation at 20°C, 300 �l of PBS was added. The sample was then cen-trifuged (3,300 � g for 5 min) and washed with another 300 �l of PBS. Thepellet was resuspended in 18 �l of PBS and 2 �l of fluorescein isothiocya-nate (FITC)-conjugated goat anti-rabbit IgG secondary antibody. After 1h of incubation at 20°C and the addition of 300 �l of PBS, the sample waswashed twice with 300 �l of PBS. Finally, the pellet was resuspended in100 �l of PBS and 0.15% propidium iodide (PI). Samples were kept in thedark for 15 min before analysis with an inverted microscope (Eclipse Ti;Nikon), applying detectors and filter sets for monitoring the FITC and PI.The images were analyzed in ImageJ (MacBiophotonics). Cells with adisrupted cell membrane (i.e., a high PI intensity) were left out of theanalysis. For the intact cells, the intensity of the FITC was used to con-struct frequency-based curves. For each condition, at least 289 intact cellswere analyzed.

In silico analysis. A FASTA file of the annotated proteins of P. stutzeriA15 was generated using HAMAP on the Expasy website (http://hamap.expasy.org/). The BOMP server (4) was used to search for outer mem-brane proteins, which were verified using the HHOmp server (30) (cutoffvalue of 95%). Sequence patterns were identified by using Geneious (11).

Multiple sequence alignments were generated in Geneious (11) usingthe CLUSTAL W algorithm. The alignment was further adapted with theGeneDoc program for publication (26).

RESULTSSequence analysis of estA/EstA. The nucleotide sequence of theestA gene of P. stutzeri A15 consists of 1,911 bp and is not part of anoperon structure. A putative Shine-Dalgarno sequence (AGGAG)is situated 8 bp upstream of the GTG start codon, and many pu-tative RpoN consensus sequences (GGN10GC) were identified.The gene encodes for a preprotein of 636 amino acids. The P.stutzeri A15 autotransporter protein (ABP80765), EstA, shares 48%

Characterization of P. stutzeri A15 EstA

April 2012 Volume 78 Number 8 aem.asm.org 2535


http://aem.asm

.org/D

ownloaded from

http://aem.asm.org

http://aem.asm.org/

identity with the amino acid sequence of the well-characterized P.aeruginosa EstA (AAB61674) (46, 49, 52). In silico analysis using Sig-nalP and the NCBI Conserved Domains server recognized the pres-ence of a 23-residue long N-terminal signal peptide sequence, an N-terminal situated passenger domain, a GDSL hydrolase domain, anda C-terminal located autotransporter �-barrel domain. An �-helicallinker domain connects the passenger domain and the �-barrel do-main (Fig. 1A).

Construction and phenotypic characterization of an estAmutant. An estA mutant of P. stutzeri A15 was constructed byreplacement of an internal fragment of the estA gene by a kana-mycin resistance marker. Western blot analysis of the TM fractionderived from the A15 wild type and estA mutant (see Fig. S1A inthe supplemental material) confirmed the PCR-based verificationof the estA mutant. Western blot analysis showed that the expres-sion of the protein in wild-type A15 is low under the conditionstested and is clearly absent in the estA mutant. Moreover, compar-ison of the esterase activity of the TM fractions revealed a signifi-cant difference between the wild type and the estA-negative P.stutzeri A15 (see Fig. S1B in the supplemental material).

Growth experiments did not reveal any growth differences be-tween the wild-type and the estA-negative P. stutzeri A15 onMMAB, LB, or minimal medium with different esters as a carbonsource. Both strains showed minor growth on (�)-ethyl-L-lactate,ethyl hexanoate and ethyl caprylate but were not able to grow on

minimal medium with several other ester substrates as a carbonsource (data not shown). To further assess the impact of knockingout the estA gene, the estA mutant was compared to the wild-typestrain for cell motility and biofilm formation. These characteris-tics, i.e., less motility and less biofilm formation for the estA mu-tant, have been demonstrated for the well-studied P. aeruginosaestA mutant (49). However, no differences could be observed be-tween the wild-type A15 and the estA mutant for swimming orswarming. The impact on biofilm formation could not be testedsince neither the P. stutzeri A15 wild type nor the estA-negativemutant showed reproducible biofilm formation under variousconditions tested (data not shown).

Analysis of estA expression. Previously, the estA gene wasshown to be upregulated 2.4-fold in a global transcriptional anal-ysis under nitrogen fixation conditions. However, that study didnot detect a downregulation in the case of nitrogen excess condi-tions (53).

In order to further unravel the expression of the estA gene, theestA promoter was fused to the gusA gene, resulting in pLAFR3-PestA-gusA. The glucuronidase activity of P. stutzeri A15(pLAFR3-PestA-gusA) was tested in both LB and MMAB at different points ofthe growth phase. In none of these conditions was glucuronidaseactivity detected. Furthermore, the estA promoter activity wastested under nitrogen fixation conditions. No blue color could be

FIG 1 (A) Schematic overview depicting the structural elements of EstA from P. stutzeri A15 and in mutated residues in the present study. (B) Multiple sequencealignment of characterized autotransporters belonging to clade II of the GDSL esterase family. The alignment was made using the CLUSTAL W algorithm inGeneious (11). Only the passenger domain and the �-helical linker domain are shown, as indicated in panel A. Conserved sequence blocks (I, II, III, IIIa, and V)for clade II of the GDSL family have been boxed and named (2). “o” and “Œ” symbols indicate the residues of the catalytic triad and oxyanion hole, respectively.The �-helical region is indicated by an “�” underneath the alignment. This region was determined based on the crystal structure of EstA from P. aeruginosa (46).Strains: PSEstA, Pseudomonas stutzeri A15 EstA (ABP80765); PAEstA, Pseudomonas aeruginosa PAO1 EstA (AAB61674); XVEstE, Xanthomonas vesicatoria EstE(AAP49217); PLLipI, Photorhabdus luminescens LipI (CAA47020); STApeE, Salmonella enterica serovar Typhimurium ApeE (AAC38796); SLEstA, Serratialiquefaciens EstA (AAO38760).

Nicolay et al.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org

http://aem.asm.org/

observed, a result indicative of an undetectable promoter activityunder this condition (data not shown).

Comparative analysis of EstA of P. stutzeri A15. Based on amultiple sequence alignment with autotransporters belonging toclade II of the GDSL esterase family, the A15 autotransporter EstAwas classified as a member of clade II and thus included in theSGNH superfamily (2). Figure 1B shows the multiple sequencealignment where all consensus blocks characteristic for clade II ofthe GDSL family (labeled I, II, III, IIIa, and V) have been boxed(2). In addition, the residues of the catalytic triad (S37, H307, andD304) and the oxyanion hole (S37, G116, and N164) have beenmarked (residue numbering starting at the GTG start codon).

The C-terminal amino acid residue of the A15 EstA is a leucineresidue. This is remarkable since it was shown that the C terminusof autotransporters share a conserved motif that ends with either atryptophan or a phenylalanine residue (17, 22). Examination ofthe C-terminal residue of 17 EstA homologues in Pseudomonasspp. revealed that all except three homologues contained a C-ter-minal phenylalanine residue. Only the amino acid sequences ofthe EstA homologues of the closely related P. stutzeri LMG11199and P. stutzeri DSM4166 and the homologue of Pseudomonasmendocina NK-01 share a leucine residue at the C terminus (seeTable S1 in the supplemental material).

Furthermore, the C-terminal signature sequence of different(putative) outer membrane proteins of P. stutzeri A15 was verified(Fig. 2). As expected, most of the inspected outer membrane pro-teins have a phenylalanine as the C-terminal residue. Remarkably,however, a leucine residue replaces as frequently as a tryptophanresidue the canonical C-terminal phenylalanine residue. In addi-tion, the C-terminal signature sequences fall apart in two distinctcategories. The first category of analyzed sequences follows the

classical signature sequence for outer membrane �-barrels as pre-viously identified (39, 44). This sequence motif consists of a phe-nylalanine (or tryptophan) residue as the C-terminal amino acid,a tyrosine or a hydrophobic residue at position 3, and hydropho-bic residues at positions 5, 7, and 9 starting from the C terminus(Fig. 2A). The new category contains a tyrosine at position 6 andhydrophobic residues at positions 2, 4, 8, 9, and 10 starting fromthe C-terminal end (Fig. 2B).

Cloning and expression of estA. The estA gene was cloned inpHERD26T. The pHERD vector series are pBAD-based shuttle vec-tors for the expression of genes in Pseudomonas spp. (28). After theconstruction, pHERD26T-estA was conjugated to P. stutzeri A15.This strain allowed the EstA protein to be expressed at a levelsufficient for biochemical analysis. After the optimization of theexpression conditions, we compared the viabilities of the wild-type A15, the wild-type strain containing the empty pHERD26Tvector, and the wild-type strain containing the pHERD26T-estAvector. Hereto, after 24 h of induction, culture samples wereplated out, and CFU were counted. Cultures were also stainedwith PI. No significant differences between the different strainscould be found for these experiments (data not shown).

Cellular localization and proper folding of EstA. To investi-gate the presence of EstA in the membrane fraction, membraneswere prepared from P. stutzeri A15(pHERD26T-estA). A Westernblot analysis with anti-EstA antibodies showed the clear occur-rence of EstA in the TL and the TM fractions. In the CPP fraction,only a small amount of EstA could be detected. An identical West-ern blot but developed with anti-OmpA antibodies revealed thatthe majority of the outer membrane marker protein OprF waspresent in the membrane fraction although a small but detectableamount could still be found in the CPP fraction (see Fig. S2 in thesupplemental material).

To examine the folding of the EstA protein in the TM fraction,the heat modifiability was tested. The TM fraction of P. stutzeriA15(pHERD26T-estA) was incubated at different temperaturesduring the sample preparation for SDS-PAGE. Using Westernblotting with anti-EstA antibodies, the EstA protein could be vi-sualized as three bands with different apparent molecular masses(Fig. 3A). The upper band, �90 kDa, represents the entirely un-folded protein. The middle band of �75 kDa, which becomesvisible when lowering the incubation temperature to 60°C, repre-sents EstA with a correctly folded �-barrel. However, when theincubation temperature was decreased even more, the lower bandof �55 kDa became the predominant form of EstA. The mostobvious explanation is that it represents EstA with both the pas-senger and the �-barrel in a correctly folded state. Altogether, thisindicates that EstA in the TM fraction is in its native conforma-tion.

In order to separate the inner and the outer membrane frac-tions after membrane preparation, the detergent sarcosyl was ap-plied. This detergent is used to achieve a selective solubilization ofthe inner membrane proteins (13). Surprisingly, the EstA proteincould be detected in the SSF fraction, but it was almost completelyabsent in the OM fraction. In contrast, the outer membranemarker protein OprF could be detected in the OM fraction (seeFig. S2 in the supplemental material). To confirm the results, theinitial centrifugation step for the removal of cell debris was re-placed by a centrifugation step at 14,800 � g. Also, the subsequentcentrifugation steps at 48,000 � g were replaced with ultracentrif-ugation steps at 140,000 � g to optimize the separation of the

FIG 2 Amino acid sequence alignment of C-terminal residues of 41 OMPs ofP. stutzeri A15. OMPs were detected with the BOMP server (4) and verifiedusing HHOmp (30) with a cutoff value of 95%. Sequence patterns were con-structed in Geneious (11). (A) Thirty-one OMPs containing the classical C-terminal signature sequence for OMPs with hydrophobic residues at positions3, 5, 7, and 9 relative to the C-terminal residue. Apart from the classical phe-nylalanine or tryptophan residue (39), the C-terminal residue can be a leucineresidue in P. stutzeri A15. (B) Ten OMPs of P. stutzeri A15 containing analternative C-terminal signature sequence with hydrophobic residues at thepositions 2, 4, 6, 8, 9, and 10 relative to the C-terminal residue. Again, theC-terminal amino acid can be a leucine residue.




http://aem.asm

.org/D

ownloaded from

http://aem.asm.org

http://aem.asm.org/

different fractions. The different fractions were analyzed by West-ern blotting with anti-EstA antibodies and anti-OmpA antibodies(Fig. 4). These results confirmed the earlier results that EstA ispresent in the SSF fraction, although OprF was mostly present inthe OM fraction. Together, these data show that EstA is present inthe total membrane (TM) fraction of P. stutzeri A15 but that it canbe extracted using the detergent sarcosyl.

Characterization of the sarcosyl solubility of EstA. To furtherevaluate the effect of sarcosyl on EstA stability, different concen-trations of sarcosyl were added to the TM fraction of P. stutzeriA15(pHERD26T-estA) prior to sample preparation for SDS-PAGE. Hereafter, Western blotting was conducted with anti-EstAantibodies (Fig. 5A). The EstA is visible as two bands. In the ab-sence of sarcosyl, the upper band is present, representing the fullydenatured protein. When the concentration of sarcosyl increases,a remarkable shift takes place to the middle band, which repre-sents EstA with a correctly folded �-barrel.

To test the nature of this effect, proteins in the TM fractionwere denatured by SDS and heating prior to the addition of sar-cosyl and preparation of samples for SDS-PAGE. In contrast to theuntreated TM fraction, where EstA was present as the middle band

in the presence of sarcosyl, the EstA in the denatured samplescould only be detected as the upper band (Fig. 6).

Role of the C-terminal leucine. Since the C-terminal phenyl-alanine has been implicated in the stability of outer membraneproteins (10), we changed the C-terminal leucine residue into aphenylalanine residue (pHERD26T-estA L636F) and tested thestability of the EstA mutant by assessing the heat modifiability(Fig. 3B). The shift in electrophoretic mobility is seen at a lowertemperature compared to the wild-type EstA (Fig. 3A), indicatinga lower stability of the �-barrel. As expected, no difference is ob-served in the shifting temperature between the middle and thelower band, which presumably means that the stability of the pas-senger domain is not affected.

Furthermore, the effect of the addition of different percentagesof sarcosyl to the TM fraction of P. stutzeri A15(pHERD26T-estAL636F) was examined. Compared to the wild-type EstA, the shiftfrom the upper band to the lower band was observed at muchhigher concentrations (Fig. 5). This result could indicate a lowerstability as well as a decreased sarcosyl solubility. Therefore, SSFand OM fractions were prepared from both P. stutzeriA15(pHERD26T-estA) and P. stutzeri A15(pHERD26T-estAL636F) using different concentrations of sarcosyl. The results didnot show a difference in sarcosyl solubility between wild-type EstA

FIG 3 Heat modifiability of EstA in the TM fraction of P. stutzeriA15(pHERD26T-estA) (A) and P. stutzeri A15(pHERD26T-estA L636F) (B).TM fractions were prepared for SDS-PAGE but incubated at different temper-atures. After SDS-PAGE, Western blotting was performed with anti-EstA an-tibodies.

FIG 4 Sarcosyl solubility of EstA from P. stutzeri A15(pHERD26T-estA). Pro-teins of the total lysate (TL), the cytoplasmic and periplasmic (CPP) fraction,the total membrane (TM) fraction, the sarcosyl soluble fraction (SSF), and theouter membrane (OM) fraction were prepared by ultracentrifugation (see thetext) and analyzed with SDS-PAGE. Subsequently, Western blotting was per-formed with anti-EstA (upper part) and anti-OmpA (lower part) antibodies.EstA and OprF are indicated with arrows.

FIG 5 Effect of sarcosyl on the TM fraction of P. stutzeri A15(pHERD26T-estA) (A) and P. stutzeri A15(pHERD26T-estA L636F) (B). The TM fractionwas incubated with 0% (lane 1), 1.25% (lane 2), 2.5% (lane 3), 3.75% (lane 4),and 5% (lane 5) sarcosyl (final concentration) and analyzed by SDS-PAGE.Subsequently, Western blotting was performed with anti-EstA antibodies.

FIG 6 Effect of sarcosyl on untreated and denatured TM fractions of P. stutzeriA15(pHERD26T-estA). TM fractions were incubated 10 min at 70°C plus 2%SDS (final concentration) (Heat/SDS �) or at room temperature (Heat/SDS�). Hereafter, 5% sarcosyl (final concentration) was added (Sarcosyl �) oromitted (Sarcosyl �). Sample preparation for SDS-PAGE was done at 70°C(Inc. Temp. 70) or 50°C (Inc. Temp. 50). Subsequently, Western blotting wasperformed with anti-EstA antibodies.

Nicolay et al.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org

http://aem.asm.org/

and EstA L636F (see Fig. S3 in the supplemental material), indi-cating that the observed effects upon addition of sarcosyl are likelydue to a lower stability of EstA L636F compared to the wild-typeEstA. Together, these data reveal that replacement of the C-termi-nal leucine residue into the more canonical phenylalanine residuedecreases the stability of the EstA �-barrel.

Examination of the surface exposure of EstA. The surface ex-posure of EstA was verified by fluorescent labeling of EstA onintact cells of P. stutzeri A15 and P. stutzeri A15(pHERD26T-estA).After growth, the cells were probed with polyclonal anti-EstA an-tibodies and then fluorescently labeled using FITC-conjugatedanti-rabbit IgG antibodies. In addition, cells were stained with PIto be able to discriminate cells with a damaged membrane struc-ture in the analysis. Representative fluorescence images were an-alyzed using ImageJ. The fluorescence intensity of individual cellson representative images was measured and used to construct fre-quency-based curves (Fig. 7). These curves show a clear shift to-ward higher intensities with P. stutzeri A15(pHERD26T-estA)compared to P. stutzeri A15 and P. stutzeri A15(pHERD26T). Thisresult indicates the cell surface display of at least a part of theexpressed EstA in cells with intact membranes.

Mutational analysis of the catalytic triad of the esterase.Since A15 EstA is a member of clade II of the bacterial GDSLesterases, the esterase activity of the protein was investigated. Ini-tial experiments with A15(pHERD26T-estA) revealed an esteraseactivity that was cell associated and not secreted into the culturesupernatant (see Fig. S4 in the supplemental material). Further,the role of the different residues in the putative catalytic triad (Fig.1), was investigated by site-directed mutagenesis. Starting frompHERD26T-estA, three different mutations were introduced re-placing the catalytic serine, aspartate, and histidine residues intothe more inert alanine, alanine, and leucine residues, respectively.

After conjugation to P. stutzeri A15, the stability of the mutantproteins in the TM fraction was tested by assessing the heat mod-ifiability (Table 3). The shift from the lower band to the middleband, presumably indicative for the passenger domain stability,occurred at lower temperatures for all mutant proteins comparedto the wild-type EstA. As expected, no differences could be ob-served in stability of the �-barrel domain of the mutant proteins.Furthermore, the effect of addition of sarcosyl was verified but no

differences could be observed between the wild-type and mutantEstA proteins (data not shown).

The esterase activities of both TM fractions and intact cellsexpressing the wild-type EstA or a mutant protein were compared,using p-nitrophenyl butyrate as a substrate (Fig. 8). Although thepicture is similar, differences are most pronounced for the TMfractions. The activity of all TM fractions derived from cells ex-posing a mutant version of the protein at their cell surface is low-ered compared to cells expressing the wild-type EstA. The activityof S37A and H307L mutants is reduced drastically compared tothe wild-type EstA and drops to the level of the activity of thenegative control. However, the D304A mutant still showed a sig-nificant higher esterase activity than the negative control, al-though the activity is also severely affected in regard to the wild-type EstA.

DISCUSSION

In this study we have studied physiological and biochemical as-pects of the autotransporter EstA of P. stutzeri A15. In order to

FIG 7 Cell surface display of EstA, represented as frequency-based curves ofFITC intensities of individual cells of P. stutzeri A15 (light gray diamonds),P. stutzeri A15(pHERD26T) (dark gray squares), and P. stutzeri A15(pHERD26T-estA) (black triangles). EstA was detected via primary polyclonalanti-EstA antibodies and secondary FITC-conjugated antibodies. PI was usedto exclude cells with damaged membranes from the analysis.

TABLE 3 Heat modifiability of wild-type EstA and mutant proteins inthe catalytic triad (EstA S37A, D304A, and H307L)a

Protein

Temp (°C)

Passenger domain �-Barrel

EstA (wild type) 40–50 60–70EstA (S37A) 30–40 60–70EstA (D304A) 20–30 60–70EstA (H307L) 20 60–70a TM fractions were prepared for SDS-PAGE but incubated at different temperatures.After SDS-PAGE, Western blotting was performed using anti-EstA antibodies. Thetemperatures at which the passenger domain or the �-barrel becomes unfolded areindicated. The shift of the lower band (�55 kDa) to the middle band (�75 kDa) wasscored as the unfolding of the passenger domain. The �-barrel unfolding temperaturewas characterized by the shift of the middle band (�75 kDa) to the upper band (�90kDa).

FIG 8 Relative esterase activity of whole cells (open bars, lowercase) or totalmembrane fractions (gray bars, uppercase) of P. stutzeri A15(pHERD26T)(�), P. stutzeri A15(pHERD26T-estA) (EstA), P. stutzeri A15(pHERD26T-estA S37A) (S37A), P. stutzeri A15(pHERD26T-estA D304A) (D304A), and P.stutzeri A15(pHERD26T-estA H307L) (H307L), using p-nitrophenyl butyrateas a substrate. The data represent the means of three independent repeats �95% confidence intervals. The significance level (P � 0.05) as determined witha Student-Newman-Keuls test is indicated with a letter code.




http://aem.asm

.org/D

ownloaded from

http://aem.asm.org

http://aem.asm.org/

define a physiological role for EstA, an estA-negative mutant wasconstructed. In accordance with the GDSL esterase autotrans-porter-negative mutants of P. aeruginosa (49), Moraxella ca-tarrhalis (43), and Serratia liquefaciens MG1 (31), this P. stutzeriA15 mutant strain did not show general growth defects comparedto the wild-type A15 strain. P. aeruginosa rhamnolipid-dependentcellular motility and biofilm formation are affected in an EstA-deficient mutant (49). Although the rhamnolipid synthesis genesare absent in P. stutzeri A15, these phenotypic traits were tested forthe EstA-deficient A15. Both the P. stutzeri A15 wild type and theestA-negative mutant did not generate biofilm under the exam-ined conditions. On the other hand, cell motility was shown to beunaffected in the estA-negative mutant, as is the case for the estA-negative mutant in S. liquefaciens MG1 (31). Also, for an estP-negative mutant of Pseudomonas putida KT2440, no phenotypicdifference with the wild-type strain was observed (34, 51).

Based on our results, it can be concluded that the estA gene isnot essential for growth and exhibits a low but detectable expres-sion under standard laboratory conditions. Therefore, we ad-dressed the question under which physiological conditions EstA isrelevant for A15. A global transcriptional analysis of nitrogen fix-ation showed the estA gene as one of the upregulated genes (53). Inspite of this, a promoter fusion could not confirm the promoteractivity under these conditions. Overall, the EstA autotransporteris most likely necessary in a specific in vivo situation. The presenceof genes encoding type V secretion systems in most endophytespoints in this direction (29). Comparably, almost all autotrans-porter proteins, such as EstA of P. aeruginosa, are virulence-re-lated factors in pathogenic bacteria (9).

The autologous overexpression of EstA allowed us to investi-gate different aspects typical for members of the family of GDSLesterases on the one hand and for autotransporter proteins on theother hand. Importantly, the expression of the autologous EstA atmoderate levels did not have a detrimental effect on the cell via-bility of A15.

We showed that EstA is part of the total membrane fraction. Inthis fraction, we verified the heat modifiability of the �-barreldomain. �-Barrels are characterized by their extreme stability inthe presence of SDS. Denaturation normally takes places when thetemperature is raised in combination with SDS, resulting in dif-ferent electrophoretic mobilities between the correctly folded anddenatured forms (25). This general characteristic for �-barrel pro-teins is also frequently used to assess the folding state of autotrans-porter translocator domains (15, 33, 37, 40, 48). Next to this, wediscovered a third form of EstA showing a different electropho-retic mobility. The most logical explanation for this extra form, isa heat modifiability of the passenger domain. A similar phenom-enon was observed by Szabady et al. for EspP. At lower incubationtemperatures, EspP migrates as a diffuse band, and this was as-signed to the conformational variance of the passenger domain ofEspP (40).

In an attempt to further confirm the cellular location, we cameacross the sarcosyl solubility of the EstA. To our knowledge, this isthe first characterization of a sarcosyl soluble outer membraneprotein. This detergent is known to solubilize selectively the innermembrane (and inner membrane proteins) of E. coli (13). How-ever, its use is more general since it has also been used to purify theouter membrane proteins of P. stutzeri strains (41) and is also usedto solubilize the inner membrane in autotransporter-based re-search (19, 35). An unspecific negative effect of sarcosyl on the cell

envelope of P. stutzeri A15 cannot explain our results since theouter membrane marker protein OprF could be clearly visualizedin the outer membrane fraction. In support of our finding, sarco-syl has been shown to remove several minor proteins from theouter membrane of E. coli compared to sucrose gradient centrif-ugation (8).

The C-terminal signature motif as identified for outer mem-brane proteins of E. coli ends with either a tryptophan or a phe-nylalanine residue (39). Our results demonstrate that this motif isnot entirely identical in P. stutzeri A15. Among other outer mem-brane proteins in A15, EstA contains a leucine residue at the Cterminus. This is in line with the finding that the C-terminal se-quence shows a species specificity (32). Altering the C-terminalleucine residue into the more canonical phenylalanine residue de-creased instead of increased the stability of EstA. This is in contrastwith the results obtained for the trimeric autotransporter YadA ofYersinia enterocolitica. Here, substitution of the C-terminal tryp-tophan into a phenylalanine residue did not have an effect ontrimeric stability or biogenesis of the protein (21). By looking intothe C-terminal region of different (putative) outer membraneproteins of P. stutzeri A15 in more detail, we found a variation inthe previously identified C-terminal signature sequence (21, 32).Instead of the appearance of hydrophobic residues at positions 3,5, 7, and 9 starting from the C terminus, these residues could alsobe present at the positions 2, 4, 6, 8, and 10.

Apart from the autotransporter characteristics, the passengerdomain was studied. Instead of the �-helical fold, present in mostautotransporter passenger domains, the crystal structure of theclosely related EstA of P. aeruginosa revealed a passenger domainwith a completely different secondary structure (46). This auto-transporter is also atypical in another way since it is not cleaved offafter translocation to the cell surface (49, 52). We could also showthis feature for EstA of P. stutzeri A15 since no esterase activity wasdetected in the culture supernatant. Furthermore, the crystalstructure of the P. aeruginosa EstA provided insight into the cata-lytic triad of this enzyme and all members of clade II of the GDSLesterases, to which the A15 EstA belongs. To our knowledge, how-ever, the catalytic triad of E. coli thioesterase I (TAP), a member ofclade I of the GDSL family, is the only bacterial catalytic triad forwhich there is mutational evidence (20). Furthermore, the cata-lytic activity of the serine residue in the P. aeruginosa EstA catalytictriad was confirmed by mutational analysis (49). Our mutationalanalysis confirmed experimentally that S37, D304, and H307 arethe catalytic triad residues. In addition, the data revealed the in-volvement of the residues of the catalytic triad in the stability ofthe passenger domain. The serine and histidine residues are abso-lutely necessary for the catalytic function of the protein, the aspar-tate residue is of less importance. These findings are partly inaccordance with the results for E. coli thioesterase I (TAP) (20).For this enzyme it was shown that the histidine residue was themost important, and a small residual activity in the serine mutantcould be shown. Also, the aspartate residue was not essential.

On the whole, these results make EstA of P. stutzeri A15 asuitable candidate for surface display of proteins in biotechnolog-ical applications with environmental relevance. In addition, P.stutzeri strains represent good candidates for use in such condi-tions since they have been shown to be involved in many environ-ment-related processes (14).

Nicolay et al.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org

http://aem.asm.org/

ACKNOWLEDGMENTS

The polyclonal anti-OmpA antibodies were a gift from Y. D. Stierhof andH. Schwarz. The pHERD26T vector was a gift from H. D. Yu (MarshallUniversity).

This study was supported by the Interuniversity Attraction Poles (IAPP6/27). T.N. and S.S. receive doctoral and postdoctoral fellowship grants,respectively, from Research Foundation Flanders (FWO-Vlaanderen).

REFERENCES1. Akoh CC, Lee GC, Liaw YC, Huang TH, Shaw JF. 2004. GDSL family of

serine esterases/lipases. Prog. Lipid Res. 43:534 –552.2. Asler IL, et al. 2010. Probing enzyme promiscuity of SGNH hydrolases.

Chembiochem 11:2158 –2167.3. Becker S, et al. 2005. A generic system for the Escherichia coli cell-surface

display of lipolytic enzymes. FEBS Lett. 579:1177–1182.4. Berven FS, Flikka K, Jensen HB, Eidhammer I. 2004. BOMP: a program

to predict integral �-barrel outer membrane proteins encoded within ge-nomes of Gram-negative bacteria. Nucleic Acids Res. 32:W394 –W399.

5. Bornscheuer UT. 2002. Microbial carboxyl esterases: classification, prop-erties and application in biocatalysis. FEMS Microbiol. Rev. 26:73– 81.

6. Burnette WN. 1981. Western blotting: electrophoretic transfer of pro-teins from sodium dodecyl sulfate-polyacrylamide gels to unmodifiednitrocellulose and radiographic detection with antibody and radioiodi-nated protein A. Anal. Biochem. 112:195–203.

7. Ceri H, et al. 1999. The Calgary biofilm device: new technology for rapiddetermination of antibiotic susceptibilities of bacterial biofilms. J. Clin.Microbiol. 37:1771–1776.

8. Chopra I, Shales SW. 1980. Comparison of the polypeptide compositionof Escherichia coli outer membranes prepared by two methods. J. Bacteriol.144:425– 427.

9. Dautin N, Bernstein HD. 2007. Protein secretion in Gram-negative bac-teria via the autotransporter pathway. Annu. Rev. Microbiol. 61:89 –112.

10. de Cock H, Struyvé M, Kleerebezem M, van der Krift T, Tommassen J.1997. Role of the carboxy-terminal phenylalanine in the biogenesis ofouter membrane protein PhoE of Escherichia coli K-12. J. Mol. Biol. 269:473– 478.

11. Drummond AJ, et al. 2011. Geneious, v5.4. Biomatters, Auckland, NewZealand.

12. Figurski DH, Helinski DR. 1979. Replication of an origin-containingderivative of plasmid RK2 dependent on a plasmid function provided intrans. Proc. Natl. Acad. Sci. U. S. A. 76:1648 –1652.

13. Filip C, Fletcher G, Wulff JL, Earhart CF. 1973. Solubilization of cyto-plasmic membrane of Escherichia coli by ionic detergent sodium-laurylsarcosinate. J. Bacteriol. 115:717–722.

14. Garcia-Valdes E, Mulet M, Lalucat J. 2010. Insights into the lifestyles ofPseudomonas stutzeri, p 177–198. In Ramos JL, Filloux A (ed), Pseudomo-nas, vol 6. Springer, New York, NY.

15. Jain S, Goldberg MB. 2007. Requirement for YaeT in the outer membraneassembly of autotransporter proteins. J. Bacteriol. 189:5393–5398.

16. Janssens JCA, et al. 2008. Brominated furanones inhibit biofilm forma-tion by Salmonella enterica serovar Typhimurium. Appl. Environ. Micro-biol. 74:6639 – 6648.

17. Jose J, Jahnig F, Meyer TF. 1995. Common structural features of Iga1protease-like outer-membrane protein autotransporters. Mol. Microbiol.18:378 –380.

18. Jose J, Meyer TF. 2007. The autodisplay story, from discovery to biotech-nical and biomedical applications. Microbiol. Mol. Biol. Rev. 71:600 – 619.

19. Lattemann CT, Maurer J, Gerland E, Meyer TF. 2000. Autodisplay:functional display of active beta-lactamase on the surface of Escherichiacoli by the AIDA-I autotransporter. J. Bacteriol. 182:3726 –3733.

20. Lee LC. 2006. Functional role of catalytic triad and oxyanion hole-forming residues on enzyme activity of Escherichia coli thioesterase I/pro-tease I/phospholipase L-1. Biochem. J. 397:69 –76.

21. Lehr U, et al. 2010. C-terminal amino acid residues of the trimeric auto-transporter adhesin YadA of Yersinia enterocolitica are decisive for its rec-ognition and assembly by BamA. Mol. Microbiol. 78:932–946.

22. Loveless BJ, Saier MH. 1997. A novel family of channel-forming, auto-transporting, bacterial virulence factors. Mol. Membr. Biol. 14:113–123.

23. Miller JH. 1972. Experiments in molecular genetics. Cold Spring HarborLaboratory, Cold Spring Harbor, NY.

24. Molgaard A, Kauppinen S, Larsen S. 2000. Rhamnogalacturonan acetyl-

esterase elucidates the structure and function of a new family of hydrolases.Struct. Fold Des. 8:373–383.

25. Nakamura K, Mizushima S. 1976. Effects of heating in dodecyl-sulfatesolution on conformation and electrophoretic mobility of isolated majorouter membrane proteins form Escherichia coli K-12. J. Biochem. 80:1411–1422.

26. Nicholas KB, Nicholas HB, Dearfield DWII. 1997. GeneDoc: analysisand visualization of genetic variation. EMBNET News 4:1– 4.

27. Nishimura K, Tajima N, Yoon Y-H, Park S-Y, Tame JRH. 2010. Auto-transporter passenger proteins: virulence factors with common structuralthemes. J. Mol. Med. 88:451– 458.

28. Qiu DR, Damron FH, Mima T, Schweizer HP, Yu HD. 2008. P-BAD-based shuttle vectors for functional analysis of toxic and highly regulatedgenes in Pseudomonas and Burkholderia spp. and other bacteria. Appl.Environ. Microbiol. 74:7422–7426.

29. Reinhold-Hurek B, Hurek T. 2011. Living inside plants: bacterial endo-phytes. Curr. Opin. Plant Biol. 14:435– 443.

30. Remmert M, Linke D, Lupas AN, Söding J. 2009. HHomp: predictionand classification of outer membrane proteins. Nucleic Acids Res. 37:W446 –W451.

31. Riedel K, Talker-Huiber D, Givskov M, Schwab H, Eberl L. 2003.Identification and characterization of a GDSL esterase gene located prox-imal to the swr quorum-sensing system of Serratia liquefaciens MG1. Appl.Environ. Microbiol. 69:3901–3910.

32. Robert V, et al. 2006. Assembly factor Omp85 recognizes its outer mem-brane protein substrates by a species-specific C-terminal motif. PLoS Biol.4:1984 –1995.

33. Sauri A, et al. 2009. The Bam (Omp85) complex is involved in secretionof the autotransporter haemoglobin protease. Microbiology 155:3982–3991.

34. Schell S. 2009. Physiologie, Sekretion, und Biotechnologie Zweier Auto-transporterproteine aus Pseudomonas Spezies. Ph.D. thesis. Heinrich-Heine-Universität, Düsseldorf, Germany.

35. Schultheiss E, et al. 2008. Esterase autodisplay: enzyme engineering andwhole-cell activity determination in microplates with pH sensors. Appl.Environ. Microbiol. 74:4782– 4791.

36. Simon R, Priefer U, Puhler A. 1983. A broad host range mobilizationsystem for in vivo genetic engineering: transposon mutagenesis in Gram-negative bacteria. Biotechnology 1:784 –791.

37. Soprova Z, et al. 2010. A conserved aromatic residue in the autochaper-one domain of the autotransporter Hbp is critical for initiation of outermembrane translocation. J. Biol. Chem. 285:38224 –38233.

38. Staskawicz B, Dahlbeck D, Keen N, Napoli C. 1987. Molecular charac-terization of cloned avirulence genes from race 0 and race 1 of Pseudomo-nas syringae pv. glycinea. J. Bacteriol. 169:5789 –5794.

39. Struyvé M, Moons M, Tommassen J. 1991. Carboxy-terminal phenylal-anine is essential for the correct assembly of a bacterial outer membraneprotein. J. Mol. Biol. 218:141–148.

40. Szabady RL, Peterson JH, Skillman KM, Bernstein HD. 2005. An un-usual signal peptide facilitates late steps in the biogenesis of a bacterialautotransporter. Proc. Natl. Acad. Sci. U. S. A. 102:221–226.

41. Tattawasart U, Maillard JY, Furr JR, Russell AD. 2000. Outer membranechanges in Pseudomonas stutzeri resistant to chlorhexidine diacetate andcetylpyridinium chloride. Int. J. Antimicrob. Agents 16:233–238.

42. Taylor LA, Rose RE. 1988. A correction in the nucleotide sequence of theTn903 kanamycin resistance determinant in pUC4K. Nucleic Acids Res.16:7762.

43. Timpe JM, Holm MM, Vanlerberg SL, Basrur V, Lafontaine ER. 2003.Identification of a Moraxella catarrhalis outer membrane protein exhibit-ing both adhesin and lipolytic activities. Infect. Immun. 71:4341– 4350.

44. Tommassen J. 2010. Assembly of outer-membrane proteins in bacteriaand mitochondria. Microbiology 156:2587–2596.

45. Upton C, Buckley JT. 1995. A new family of lipolytic enzymes. TrendsBiochem. Sci. 20:178 –179.

46. van den Berg B. 2011. Crystal structure of a full-length autotransporter. J.Mol. Biol. 396:627– 633.

47. Vermeiren H, et al. 1999. The rice inoculant strain Alcaligenes faecalis A15 isa nitrogen-fixing Pseudomonas stutzeri. Syst. Appl. Microbiol. 22:215–224.

48. Wagner JK, Heindl JE, Gray AN, Jain S, Goldberg MB. 2009. Contri-bution of the periplasmic chaperone Skp to efficient presentation of theautotransporter IcsA on the surface of Shigella flexneri. J. Bacteriol. 191:815– 821.

49. Wilhelm S, Gdynia A, Tielen P, Rosenau F, Jaeger KE. 2007. The




http://aem.asm

.org/D

ownloaded from

http://aem.asm.org

http://aem.asm.org/

autotransporter esterase EstA of Pseudomonas aeruginosa is required forrhamnolipid production, cell motility, and biofilm formation. J. Bacteriol.189:6695– 6703.

50. Wilhelm S, et al. 2007. Functional cell-surface display of a lipase-specificchaperone. Chembiochem 8:55– 60.

51. Wilhelm S, Rosenau F, Kolmar H, Jaeger K-E. 2011. Autotransporterswith GDSL passenger domains: molecular physiology and biotechnologi-cal applications. Chembiochem 12:1476 –1485.

52. Wilhelm S, Tommassen J, Jaeger K-E. 1999. A novel lipolytic enzymelocated in the outer membrane of Pseudomonas aeruginosa. J. Bacteriol.181:6977– 6986.

53. Yan YL, et al. 2010. Global transcriptional analysis of nitrogen fixationand ammonium repression in root-associated Pseudomonas stutzeriA1501. BMC Genomics 11:11.

54. Yan YL, et al. 2008. Nitrogen fixation island and rhizosphere competencetraits in the genome of root-associated Pseudomonas stutzeri A1501. P.Natl. Acad. Sci. U. S. A. 105:7564 –7569.

55. Yanisch-Perron C, Vieira J, Messing J. 1985. Improved M13 phagecloning vectors and host strains: nucleotide sequences of the M13mp18and pUC19 vectors. Gene 33:103–119.

56. You CB, et al. 1983. Associative nitrogen fixation of Alcaligenes faecaliswith rice plant. Biol. Nitrogen Fix. Newsl. Sydney Univ. 11:92–103.

Nicolay et al.



http://aem.asm

.org/D

ownloaded from

http://aem.asm.org

http://aem.asm.org/

Documents

Characterization of Esterase A, a Pseudomonas stutzeri A15