Upload
dulcie-jefferson
View
271
Download
0
Tags:
Embed Size (px)
Citation preview
Characteristics of the Genetic Material
• Any substance which form the heriatable material must fulfill some essential requirements and DNA was found to fulfill them all.
1- It is stable . 2- It is able to carry and transcribe information which are
required to control the processes which give the organism its specificity .( transcription )
3- It is capable of replicating exactly, so that the genetic determinants are transmitted down from cell to cell and from generation to generation unchanged .
4- It is able to mutate to give more variations .
Genome: entire complement of DNA molecules of each organism
Overall function of genome:
-Control the generation of molecules (mostly RNA & proteins) that will regulate the cell function and structure . - Transfer the genetic information from cell to cell ( cell division ) and from generation to generation
without change.
DNA Structure
• DNA is a nucleic acid.• The building blocks of DNA are nucleotides,
each composed of:– a 5-carbon sugar deoxyribose– a phosphate group (PO4)– a nitrogenous base• adenine, thymine, cytosine, guanine
Ribose and DeoxyriboseRibose in RNA
Deoxyribose in DNA
Pyrimidines
NH2
O
N
N NH
N
Guanine
N
N
Adenine
N
N
NH2
N O
NH2
N O
NH2
NCytosine
Purines
Uracil(RNA)CH3
N ON
O
NH
N ON
O
NH
Thymine(DNA)
Nucleosides and Nucleotides
Nucleosid is a base+sugar Nucleotide is nucleoside + phosphateNitrogen base is connected on C-1’ position of sugar
Phosphate commonly on C-5’ of sugar
DNA Structure
• Nucleotides are connected to each other to form a long chain
• phosphodiester bond: Covalent bond between adjacent nucleotides– formed between the phosphate group (attached
to 5’ carbon) of one nucleotide and the 3’ –OH of the of sugar of next nucleotide
– This bond is very strong, and for this reason DNA is remarkably stable.
– DNA can be boiled and even autoclaved without degrading
• The chain of nucleotides has a 5’ to 3’ orientation.
Double Helix of DNA• The clue to the structure of DNA came from two sourses:• the work of Erwin Chargaff and his colleagues in the late 1940s and
Rosalind Franklin and Maurice Wilkins work.• Base composition studies of Erwin Chargaff: 1. The base composition of DNA generally varies from one species to
another. 2. DNA specimens isolated from different tissues of the same species
have the same base composition. 3. The base composition of DNA in a given species does not change
with an organism’s age,nutritional state, or changing environment . 4. In all cellular DNAs, regardless of the species, the number of
adenosine residues is equal to the number of thymidine residues (that is, A T) ,and the number of guanosine residues is equal to cytosine.
• Chargaff’s Rule:• amount of adenine = amount of thymine• amount of cytosine = amount of guanine
Chargaff’s Rule
Double Helix of DNA
Rosalind Franklin and Maurice Wilkins 1950s– Franklin performed X-ray diffraction studies to identify the
3-D structure– discovered that DNA is helical– discovered that the molecule has a diameter of 2nm and
makes a complete turn of the helix every 3.4 nm
X-ray diffraction pattern of DNA. The spots forming across in the center denote a helical structure. The heavy bands at the left and right arise from the recurring bases.
The Watson - Crick Model Of DNA
• 1953 propose double helix model– Right-handed double helix– Chains antiparallel– Bases lie flat, perpendicular to long axis of chain– Bases pair by hydrogen bonds, A with T and C with G
• Two strands are complementary– 10 bases per turn (34 angstroms)
• Now known to be 10.4 or 34.6 degrees turn per bp)– Has a major and minor groove– Is 20 angstroms in diameter
complementary base pairing involve the formation of two hydrogen bonds between adinine and thymine, three hydrogen bonds between gauine and
cytosine.No other paire form in DNA
Schematic model
Space-filling model
The double helix consists of:• 2 sugar-phosphate
backbones• nitrogenous bases
toward the interior of the molecule• bases form
hydrogen bonds with complementary bases on the opposite sugar-phosphate backbone
General structural features
The DNA Double Helix
The double-bonded structure is stabilized by
1. Hydrogen bonding between complementary bases A bonded to T by two hydrogen bonds C bonded to G by three hydrogen bonds
2. Base stacking Within the DNA, the bases are oriented so that the
flattened regions are facing each other
General structural features
The DNA Double Helix
There are two asymmetrical grooves on the outside of the helix 1. Major groove
2. Minor groove
Certain proteins can bind within these grooves They can thus interact with a particular sequence of
bases
General structural features
The DNA Double Helix
Two strands are twisted together around a common axis
There are 10 bases per complete twist The two strands are antiparallel
One runs in the 5’ to 3’ direction and the other 3’ to 5’ The helix is right-handed
As it spirals away from you, the helix turns in a clockwise direction
Coding strand 5’→ 3’.Non-coding strand 3’ → 5’.-Stores genetic code as a linear sequence of bases.
≈ 20 Å in diameter
Human genome ≈ 3.3 x 109 bp
≈ 25,000 genes
DNA Double helix
DNA CharacterizationAbsorption Spectra
• Absorb light in ultraviolet range, most strongly in the 254-260 nm range
• Due to the purine and pyrimidine bases.• Useful for localization, characterization and
quantification of samples
DNA Characterization Denaturation of DNA
• Denaturation involves the breaking of hydrogen bonds– Disrupts the base stacking in the helix and lead to
increased absorbance at 260 nm(Hyperchomic effect)• By increasing temperature slowly and measuring
absorbance at 260 nm as melting profile can be generated– Temperature for midpoint of denaturation is called the Tm – Melting Temperature (Tm): Temperature at which 50% of
the dsDNA is denaturated to ssDNA.
Renaturation of DNA• When ssDNA is cooled graudly hydrogen bonds between bases
can reform and the DNA renatures.• During the renaturation, absorbance at 260nm is decreasing (Hypochromic effect).
TACTCGACATGCTAGCACATGAGCTGTACGATCGTG
Double stranded DNA
TACTCGACATGCTAGCACATGAGCTGTACGATCGTG
Double stranded DNA
Renaturation
TACTCGACATGCTAGCAC
ATGAGCTGTACGATCGTG
Denatured DNA
Denaturation
Single stranded DNA
• Denaturation Can be monitored by measuring absorption absorbance at 260nm.• When 2 strands are separated, absorbance may increase by 30-40%.
For dsDNA, A260=1.0 for 50 µg/mlFor ssDNA and RNA A260=1.0 for 38 µg/ml
Denaturation of DNA
DNA Denaturation
• Factors Affecting Tm
G-C content of sample – Increased G+C gives increased Tm
– 3 vs. 2 hydrogen bonds Presence of intercalating agents (anything that
disrupts H-bonds or base stacking) Salt concentration - Increased ionic strength also increases Tm
pH Length of the molecule
Determination of GC Content
OD260
0
1.0
65 70 75 80 85 90 95Temperature (oC)
Tm = 85 oCTm = 75 oC
Double strande
d DNA
Single stranded DNA
Relatively low GC
content
Relatively high GC content
Tm is the temperature at which half the DNA is melted