123

CHAPTER 5

Characterization of microbial community in

activated sludge by Fluorescence in situ

hybridization technique

124

This chapter describes the application of fluorescently labeled oligonucleotide probes to

identify bacterial isolates in pure culture and to detect bacterial community members

directly in the activated sludge samples under the fluorescent microscope. Hybridization

with sludge samples was performed by domain, group/class, genus and species specific

probes. Nocardioform actinomycete and other filamentous bacteria specific probes were

applied on the bacterial pure cultures isolated from the activated sludge process at Dubai

sewage treatment plant.

5.1 Introduction

The activated sludge process, the most widespread technology for wastewater treatment

in most of the countries at present, is an engineered, enhanced self-purification process

for domestic and municipal wastewater. The engineering intensifies the treatment, but

basic understanding of the microorganisms and their activity under different conditions

are keys for its successful operation. The microbial community members (both

filamentous and non-filamentous bacteria) that cause the most common activated sludge

problems -filamentous bulking and foaming are undesirable in excessive concentration.

According to the filamentous backbone theory proposed by Sezgin et al. (1978), bulking

is due to the excessive growth of filamentous bacteria that interfere with the compaction

and settling of the activated sludge either by producing a very diffuse floc structure or by

growing in profusion beyond the confines of the floc into the bulk medium and bridging

between flocs (Jenkins et al., 1993). Another widespread problems in the activated sludge

is the formation of viscous thick stable foam. Such foam appears as bacterial biomass

floating on the surface of the aeration basin. These viscous foams have been associated

with the presence of the filamentous mycolic acid-containing actinomycetes (mycolata).

125

Such foams are often refereed to as Nocardia foams (Soddell et al, 1995) probably

because the first branching actinomycetes isolated from activated sludge foams was

Nocardia (now Gordona) amarae. However, after that a number of different

actinomycetes have also been isolated and identified from foaming plants including

Nocardia, Rhodococcus, Gordona, Tsukamurella and Mycobacterium, as well as other

gram-positive bacteria such as Microthrix parvicella (De Los Reyes et al., 1997).

In 1975, Eikelboom published a breakthrough paper, defining keys using morphology,

physiology and staining characteristics to identify filamentous organisms in activated

sludge. The Eikelboom keys have been invaluable to wastewater professionals. However,

this identification tool has serious limitations. It was found that one Eikelboom type

might not consist of one single phenotype, and that morphological characters are not

reliable indicators for distinguishing phylogenetic groups because the morphology of

some filaments is known to change (Howarth et al., 1999).

Although it has been widely accepted since the late 1980s that the massive growth

of around 30 different filamentous types is responsible for the decreased settleability of

activated sludge, the effects and contributions of specific filament types or species on

bulking is not known. Filamentous bulking studies have been limited primarily by the

inadequacy and inaccuracy of traditional identification methods that use morphology,

physiology and staining characteristics and the lack of quantitative methods for

determining filamentous biomass in situ. The growth of 16S and 23S ribosomal RNA

sequence databases has enabled researchers to use rRNA-targeted hybridization for

studying activated sludge biomass. Oligonucleotide probes targeting specific domains,

genera, species, or even strains have been developed. These probes can be hybridized

either to isolated nucleic acids immobilized on membrane filters (membrane

126

hybridization or Northern blots) or directly to the rRNA in whole, fixed cells (whole-cell

hybridization or Fluorescent In Situ Hybridization). These phylogenetic methods have the

following advantages compared to the traditional identification methods. (1) Molecular

methods are accurate: unlike morphology, physiology and staining characteristics,

conserved phylogenetic identity does not change over time or under different conditions.

(2) The methods can yield target-specific, quantitative data. Fluorescent In Situ

Hybridization or FISH originated in cytogenetics (Vandekken et al., 1990) and clinical

research (Heitz et al., 1991) and is now applied intensively in environmental

microbiology. The method combines the specificity of nucleic acid sequences with the

sensitivity of detection systems based on fluorochromes. FISH combined with digital

image analysis (use of a digital camera, image analysis software and computer) makes it

possible to obtain not only qualitative information from the samples but also quantitative

data. FISH uses fluorescent dyes for detection. The rRNA probes are conjugated with

fluorochromes and are excited by incandescent light (in epifluorescence microscopy) or a

laser (in confocal laser scanning microscopy). The probe, whose own sequence is

complementary to the target rRNA sequence, will only bind to specific rRNA in target

cells, and the rest of the fluorescent probe will be washed off. The samples are fixed onto

microscopic slides and only the cells containing the target sequence will give a sufficient

signal above background when viewed under a proper light source.

To gain insight into activated sludge bulking, following questions remain to be

answered: For a given activated sludge sample, which filamentous bacteria are dominant?

Under what conditions do certain filaments cause bulking, and to what extent? How does

operation affect the bulking problem? To attempt to answer these questions, culture

dependent and independent studies were undertaken to understand the dominant

127

microbial community members (both filamentous and non-filamentous bacteria)

responsible for the most common activated sludge problems, filamentous bulking and

foaming, and thus for the successful plant operation.

5.2. Objectives of the Study

The investigation aimed to find out about the development of the microbial community

structure that was involved in biological removal of wastewater organic pollutants and to

understand how microbial community changes affect overall treatment plant efficiency of

the activated sludge system of Dubai STP. The overall purpose of the study was to

investigate the microbial community and foaming and bulking causing filamentous

bacteria in the activated sludge unit of the sewage treatment plant in Dubai, UAE.

Fluorescence in-situ hybridization ( FISH ) was carried on the mixed liquor and foaming

sludge samples. A series of probes were used to detect the presence of the different

groups and subgroups of bacteria directly within the sludge samples. The abundance of

these groups was obtained numerically through computer analysis of the images taken

when the hybridized samples were examined under the microscope. Moreover, group,

genus and species specific probes were utilized to identify the pure culture isolates from

sludge and foaming samples. The accurate identification and quantification of bulking-

causative organisms may guide future activated sludge modeling and the development of

rational control measures in activated sludge unit of sewage treatment plant in Dubai.

5.3. Materials and methods

5.3.1. Dubai STP

Activated sludge system of Dubai STP from which the samples were extracted, treat

mixed wastewater received mainly from domestic sources. Dubai STP incorporates two

biological treatment stages involving first stage of activated sludge process followed by

128

biological filter stage for the further removal of nutrients like ammonia and remaining

BOD. During the whole period of sampling, treatment plant was overloaded and suffered

heavy foaming problems. Bulking was also observed on two occasions in the month of

January and February, 2007. The measured dissolved oxygen (DO) in all eight aeration

tanks was found to be about 2mg/l. However, a drastic drop in DO up to 0.04 mg/ l was

frequently observed in the distribution tanks (DT) through which treated wastewater

collected from several aeration tanks is combined before passing to the secondary settling

tanks. Due to this reason highly septic conditions prevailed in all the eight secondary

clarifiers. The sampling was started during mild winter month (January) with an average

air temperature of about 25°C and continued till warmer months of May and June with an

average air temperature of 42°C.

5.3.2 Sampling

The samples of mixed liquor and foam (250 ml) were collected from aeration tanks and

secondary clarifier tanks from the activated sludge unit of DSTP located at Al Aweer in

Dubai. Samples were taken on fortnightly basis beginning January, 2007 till June, 2007

spanning between winter and summer period. After collection, samples were stored at

4°C and morphologically characterized within 24 hours of sampling. For the FISH

analysis mixed liquor and foam samples were fixed immediately after collection by

addition of ethanol to a final concentration of 50% (v/v) and in 4% (w/v)

paraformaldehyde according to the procedure described by Schuppler et al., 1998.

5.3.3. Fluorescence In Situ Hybridization

Fluorescence In Situ Hybridization technique was performed on the sludge samples and

pure culture isolates obtained from sludge samples using the methods described in the

previous studies. (Amman, R.I. 1995; Daims et al., 2005). In order to find out the total

129

area occupied by all the bacteria presented in the biomass sample, staining with DAPI (

4,6-diamino-2-phenylindole ) dye was employed. DAPI would stain all the DNA

presented in the sample. Once they were stained, a visual signal would be emitted and

that would be captured by the imaging system. The list of oligonucleotide probes used

in this study and their specificity is given in the table 5.1 and 5.2.

Table 5.1: List of domain and group specific oligonucleotide probes

Probe

name

Percentage

of

Formamide

Sequence of probe

(5` to 3`)

Probe specificity Reference

Eub338 35 GCTGCCTCCCGTAGGA

GT

Domain bacteria Amman et.al (1990)

Eub338II 35 GCAGCCACCCGTAGGT

GT

Domain bacteria

(Planctomycetales) Daims et.al (1999)

Eub338III 35 GCTGCCACCCGTAGGT

GT

Domain bacteria

(Verrucomicrobiale

s)

Daims et.al (1999)

Alpha 1b 25 CGTTCGYTCTGAGCCA

G alpha-

Proteobacteria Manz et.al (1992)

Beta42a 35 GCCTTCCCACTTCGTTT beta-proteobacteria Manz et.al (1992)

Gamma42a 35 GCCTTCCCACATCGTTT gamma-Proteobacteria Manz et.al (1992)

HGC 69a 20 TATAGTTACCACCGCC

GT

gram positive high

G+C content Roller et.al

(1994)

LGC354A 35 TGG AAG ATT CCC TAC TGC

gram positive low

G+C content

(firmicutes)

Meier et

al.,(1999)

LGC354B 35 CGG AAG ATT CCC TAC TGC

gram positive low

G+C content

(firmicutes)

Meier et

al.,(1999)

LGC354C 35 CCG AAG ATT CCC TAC TGC

gram positive low

G+C content

(firmicutes)

Meier

et.al.,(1999)

130

Table 5.2: List of genus and species specific oligonucleotide probes

Probe

name

% of

Formami

de

Sequence of probe

(5` to 3`)

Probe specificity Reference

SNA 45 CATCCCCCTCTACCGTAC

Sphaerotilus natans,

few Leptothrix spp.,

Eikelboom type

1701

Wagner et al.

(1994a)

LDI 35 CTCTGCCGCACTCCAGCT

“Leptothrix

discophora”,

Aquaspirillum

metamorphum

Wagner et al.

(1994a)

LMU 35 CCCCTCTCCCAAACTCTA Leucothrix mucor Wagner et al.

(1994a)

HHY 20 GCCTACCTCAACCTGATT genus

Haliscomenobacter

Wagner et al.

(1994a)

TNI 45 CTCCTCTCCCACATTCTA Thiothrix nivea Wagner et al.

(1994a)

021N 35 TCCCTCTCCCAAATTCTA Eikelboom type

021N

Wagner et al.

(1994a)

MPA60 20 GGATGGCCGCGTTCGACT “Microthrix

parvicella”

Erhart et al.

(1997)

S-G-Gor-

0596-a-A-

22

20 TGCAGAATTTCACAGACG

ACGC genus Gordona

De Los Reyes

et.al. (1997b)

S-S-G.am

0192-a-A-

18

30 CACCCACCCCCATGCAGG Gordona amarae

De Los Reyes

et.al. (1997b)

S-*-Myb-

0736-a-A-

22

30

CAGCGTCAGTTACTACCCA

GAG

De los Reyes et.

al. (1997)

MNP1 50 TTAGACCCAGTTTCCCAGGCT

nocardioform

actinomycetes

Schuppler

et.al.(1998)

Myc657 30 AGTCTCCCCTGYAGTA

Mycobacterium

subdivision (mycolic

acid-containing

actinomycetes)

Davenport et al.

(2000)

131

The steps of Fluorescence In Situ Hybridization technique are outlined as follows:

5.3.3.1 Fixation

Activated sludge samples were fixed in both ethanol and 4% paraformaldehyde within 4-

6 hours after sampling (Amann, 1995). Gram positive and gram negative pure cultures

were fixed in ethanol and 4% paraformaldehyde respectively according to the procedure

described by schuppler et al. in 1998. The fixation protocols are briefly described as

follows:

Ethanol Fixation: Isolates were grown in nutrient broth at 37 °C for 18 hours. 1.5 ml of

the cell culture was then collected in a sterile eppendorf tube. After vortexing the culture

for 5 minutes, the cells were centrifuged at 14,000 rpm for 5 minutes. 750 µl of the

supernatant was then collected and resuspended by vortexing. 375 µl of 100% Ethanol

and 375 µl of 1X Phosphate buffer saline were then added to the cell suspension. The

cells were stored at - 20°C.

Formaldehyde Fixation: About l-1.5 ml of cell culture in exponential phase was

collected in an eppendorf tube. The aggregated flocs were broken by vortexing for about

10 minutes. The cells were centrifuged at 14000 rpm for 5 mins. After removing 750 µl

of supernatant, the cells were resuspend by vortexing and fixed in 750 µL of fixative.

Cells were then incubated at 4 °C for 3hrs. After incubation, the cells were centrifuged at

6000 rpm for 5 mins and the supernatant was decanted. Cells are now washed with

500µL 1X PBS (Phosphate buffered saline), mixed by vortexing and centrifuged at

6000rpm for 5 mins. (repeated twice). Finally, the cells were resuspended in 250 µL of

lX PBS. Equal volume of 96% Ethanol (EtOH) was added and mixed before storing at -

20 °C.

5.3.3.2 Coating of slides

Teflon printed slides with wells of 8mm diameter from Vermicon identification

technology(VIT), Munich, Germany were used (Figure 3.2). These slides were cleaned in

acid alcohol (1 % Concentrated Hydrochloric Acid and 70 % Ethanol) for 2 hours. The

slides were then rinsed in distilled water and placed in Coplin jars containing dilute poly

132

– L – Lysine (0.01%) for 18 hours at 25 °C. The slides were then drained and dried in a

hot air oven for 1 hour at 60 °C.

Figure 5.1: The slides used in the Fluorescence In Situ Hybridization technique.

5.3.3.3 Dehydration and Lysozyme Treatment

10 µl of the ethanol fixed cells were placed in each of the three wells of a slide. The

slides were then air dried for 10 minutes. The cells were then dehydrated in an ethanol

series (50%, 86% and 96% for 3 minutes each) in Coplin jars. The slides were air dried

for 5 minutes. Three Lysozyme treatments were applied; to one set of slides, 2 µl of 50

µM Lysozyme was added to each well, to another set 2 µl of 20 µM Lysozyme and to the

final set no Lysozyme was added to any of the wells. The slides were then air dried for 15

minutes.

5.3.3.4 Hybridization

Genus and Species level probes were used to identify the isolates in this study. The

oligonucleotide probes used are given in Table 3.2. All oligonucleotide probes were

labeled at 5` end by Tetramethyl Rhodamine Isothiocyanate (TRITC) dye. Hybridization

solution was prepared with varying concentrations of Formamide according to the

compositions shown in Table 3.3. The final volume of the solution per slide was 2 ml.

Table 5.3: The composition of the hybridization solutions used in this study

Solution 20 %* 25 %* 30%* 35 %* 40 %*

Formamide 400 µl 500 µl 600 µl 700 µl 800 µl

5 M NaCl 360 µl 360 µl 360 µl 360 µl 360 µl

1 M Tris-Hcl 40 µl 40 µl 40 µl 40 µl 40 µl

10% SDS 2 v 2 µl 2 µl 2 µl 2 µl

Distilled Water 1198 µl 1098 µl 998 µl 898 µl 798 µl

133

Abbreviation: NaCl – Sodium Chloride, SDS – Sodium Dodesyl Sulphate, Tris

hydroxymethyl aminomethane. *The percentages refer to varying concentrations of

formamide.

The probe mixes were prepared with 9 µl of hybridization solution and 1 µl of the

respective probe. The positive control well contained EUB Probe for all samples. To the

middle well, test probe listed in the table 2.1 and 2.2 was added. The Negative Control

well had only 10 µl of hybridization solution alone added. The slides were then placed in

hybridization chambers with the trays containing the remaining 1.90 ml of hybridization

solution. The chambers were covered with aluminium foil before being placed in the

incubator. The slides were incubated at 46° C for 18 hours.

5.3.3.5 Washing

Washing solutions of varying Formamide concentrations were prepared according to the

composition displayed in Table 5.4. The final volume was 30 ml per each slide.

Table 5.4: Composition of the washing solutions

Solution 20% 25% 30% 35% 40%

1M Tris HCl 1 ml 1 ml 1 ml 1 ml 1 ml

5 M NaCl 2.15 ml 1.58 ml 1.02 ml 0.7 ml 0.46 ml

0.5 M EDTA 0.5 ml 0.5 ml 0.5 ml 0.5 ml 0.5 ml

Distilled Water 26.35 ml 26. 92 ml 26.35 ml 27.48 ml 28.04 ml

Abbreviation used: NaCl – Sodium Chloride, SDS – Sodium Dodesyl Sulphate, Tris

hydroxymethyl aminomethane.

The washing solutions were pre-warmed at 48°C for 30 minutes in a water bath. The

hybridization solution containing trays were then removed carefully without tilting the

slides. The chambers were filled with 30 ml of respective washing solutions and the

slides were replaced. The chambers were incubated in the inverted position for 20

minutes at 48 °C. The slides were rinsed in distilled water followed by air drying until

dry. 4',6-diamidino-2-phenylindole (DAPI) stain was applied to some of the negative

wells for the visualization of DNA and air dried.

134

5.3.3.6 Viewing of the slides:

The hybridized bacteria were visualized by epifluorescence microscopy at 1,000X

magnification on a Nikon Eclipse 80i (Japan) microscope equipped with a 100-W

mercury lamp and filter sets G-2E/C for TRITC, QD605 (excitation wavelength, 540 to

565 nm; dichroic wavelength, 565 nm; emission, 605-655 band pass) and B-2E/C for

FITC (excitation wavelength, 465 to 495 nm; dichroic wavelength, 505 nm; emission,

515-555 band pass). Nonhybridized bacteria were hardly detectable and were identified

by phase-contrast microscopy. Images were captured and analyzed using ProgResC5

digital camera system (JENOPTIK, Germany) (Figure 5.2). Pictures were processed as

tagged-image file format (TIFF) files on a personal computer running Image-J software,

version 1.42 (developed by Wayne Rasband, Research Services Branch, National

Institute of Mental Health, Bethesda, Maryland, USA. http://rsb.info.nih.gov/ij/)

Figure 5.2: The Nikon eclipse 80i (Japan) Fluorescent Microscope and The Progress C5,

Jenoptik (Germany) Digital camera used in this study (Manipal University, Dubai

Campus lab).

135

Once microscopic observation was done, the image was recorded and analyzed with the

aid of a computer program. The program used was Metamorph version 4.6r8 by universal

imaging Corp. The program would calculate the area from which the fluorescence signal

was recorded. The final result was presented in terms of the percentage calculated when

this area was divided by the total area of the field of observation. For each glass well, a

total of 12 fields of observations were made so as to observe the fluorescence signal of 1

tagged probe presented in the well, the percentages were averaged so as to reduce the

experimental errors. The method of calculation is described in Appendix 15.

5.4. Results and Discussion

5.4.1. Optimization of oligonucleotide probes

In the beginning all the probes used in this study were optimized with their target

microorganism in pure cultures. All the bacteria used were representative of their

group/class, genus and species. In order to get best fluorescence signal (hybridization)

different formamide concentration was used in hybridization solution. The target

organisms used and their hybridization with various probes are listed in the Table 5.5.

136

The florescence images of reference cultures hybridized by their respective probes are

shown the figure 5.3

Table 5.5: In situ hybridization of reference strains by 16S rRNA targeted probes

Species Source

Hybridization with probe

Eub-mix HGC69a LGC-mix ALF1b BET42a GAM42a

FA*(35%) (25%) (35%) (20%) (35%) (35%)

Escherichia coli MTCC + + + + + +

Pseudomonas

fluorescens

MTCC

103

+ + + + + +

Salmonella

typhimurium

MTCC

98

+ + + + + +

Shigella Lab

isolate

+ + + + + +

Bacillus subtilis MTCC

121

+ + + + + +

Staphylococcus

aureus

MTCC

96

+ + + + + +

Streptococcus

sp.

MTCC

389

+ + + + + +

Nocardia

asteriodes

ATCC

3377

+ + + + + +

(+ = positive hybridization; - = negative hybridization)

*FA= Formamide concentration in hybridization solution

137

A B

C D

E F

Figure 5.3: Whole cell hybridization of bacterial pure cultures by TRITC labeled probes.

A) E.coli cells by Gam42a probe B) Salmonella typhimurium cells by Gam42a probe C)

Nocardia sp by HGC62a probe; Low GC probe bound to D) Bacillus subtilis, E)

Staphylococcus aureus F) Streptococcus sp. Bar=10µm applies to all photomicrographs.

138

5.4.2. Microbial community Profile in activated sludge system of Dubai STP

In total 24 mixed liquor and foam samples ( fixed with either ethanol or

paraformaldehyde) collected from aeration and secondary settling tanks of Dubai STP

over a period of six months were used in FISH analysis using domain, group, genus and

species specific 16S rRNA targeted oligonucleotide probes. The direct microscopic

examinations of all these samples have shown a large number of filamentous bacteria

during the study period (Chapter 3). According to the Eikelboom identification key the

dominant filamentous bacteria were found to be Nocardioform actinomycetes, Thiothrix,

Sphaerotilus, Eikelboom Type 021N and Nostocoida limicola type I species. Initially

DAPI staining was applied to all mixed liquor and foam samples. DAPI stains the entire

DNA in the biomass sample regardless of whether they are from living or dead cells. The

Eub338 mix (I-III) labeled at 5` by TRITC (which targets the entire domain bacteria

group that has adequate 16S rRNA for hybridization with the probes) was applied to

sludge samples. Table 5.6 revealed that approximately 79.1- 92.9 % of the microbes

stained by DAPI, were targeted by Eub338 mix (I-III). Thus only 7.1-21.9% of the

microbes consisted of dead cells as they lacked sufficient 16S rRNA. This would mean

that the samples were extracted during the exponential phase and they provided valid

results when FISH was conducted on them, since most of the cells in the samples had

adequate 16S rRNA.

Month of sampling

: Jan-07 Feb-

07

March-

07

April-

07

May-

07

June-

07 % of cells stained

by DAPI 100 100 100 100 100 100

% of cells targeted

by Eub338Imix.

TRITC

92.6

± 4.0

82.4

±5.4

92.9

±4.6

90.3

±6.8

81.1

±12.3

79.1

±14.6

Table 5.6: Percentage of cells targeted by Eub338 mix with respect to DAPI

139

Population profile in DSTP over a period of six months

(%with respect to DAPI)

0

10

20

30

40

50

60

70

80

90

Jan’07 Feb’07 Mar’07 Apr’07 May’07 Jun’07

Month

%

Eub338Mix.tritc

Beta42a.tritc

Gamma42a.tritc

LGC354Mix.tritc

Alpha1b.tritc

HGC69a.tritc

Fig 5.4: Population profile in Dubai STP over a period of six months

The Figure 5.4 gives overall average pattern of FISH results obtained for the bacterial

population abundance and their changes in the DSTP activated sludge process over the

period of six months. The numerical values obtained out of FISH analysis are presented

in Appendix 15. From the Fig 5.4, the percentages of bacteria belonging to several groups

like alpha, beta, gamma class of Proteobacteria including gram positive population of

Low G+C and High G+C group remained almost constant irrespective to treatment plant

conditions. In total of 24 samples of mixed liquor, the major bacterial groups identified in

descending order of their frequency of occurrence were: gamma class of proteobacteria,

High G+C group, beta class of proteobacteria, Low G+C group and alpha class of

proteobacteria. In addition, a more specific MNP1 probe (Schuppler et al., 1998) targeted

at the majority of Nocardioform actinomycetes group was applied to the mixed liquor

140

samples. However, quantitative data obtained with MNP1 probe was not included in

comparing the FISH results obtained by group specific probes on bacteria population. In

total six group specific probes were applied to the mixed liquor samples obtained from

aeration tanks and secondary settling tanks. Tables 5.7 and 5.8 indicate that hybridization

with all six probes gave positive result in the mixed liquor samples from aeration tanks

and secondary settling tanks.

Table 5.7: In situ hybridization of sludge samples from aeration tanks by rRNA

targeted probes

Sampling

period

(day/mo/year)

Sample

ID

Hybridization with probe

Eub-mix HGC69a LGC-mix ALF1b BET42a GAM42a

FA*(35%) (25%) (35%) (20%) (35%) (35%)

17/1/07 AT1 + + + + + +

30/1/07 AT2 + + + + + +

15/2/07 AT3 + + + + + +

28/2/07 AT4 + + + + + +

14/3/07 AT5 + + + + + +

29/3/07 AT6 + + + + + +

15/4/07 AT7 + + + + + +

30/4/07 AT8 + + + + + +

16/5/07 AT9 + + + + + +

30/5/07 AT10 + + + + + +

15/6/07 AT11 + + + + + +

29/6/07 AT12 + + + + + + (+ = positive hybridization; - = negative hybridization) FA= Formamide concentration in

hybridization solution

141

Table 5.8: In situ hybridization of samples from secondary settling tanks by rRNA

targeted probes

Sampling

period

(day/mo/year)

Sample

ID

Hybridization with probe

Eub-mix HGC69a LGC-mix ALF1b BET42a

GAM42a

FA*(35%) (25%) (35%) (20%) (35%)

(35%)

17/1/07 SST1 + + + + + +

30/1/07 SST 2 + + + + + +

15/2/07 SST 3 + + + + + +

28/2/07 SST 4 + + + + + +

14/3/07 SST 5 + + + + + +

29/3/07 SST 6 + + + + + +

15/4/07 SST 7 + + + + + +

30/4/07 SST 8 + + + + + +

16/5/07 SST 9 + + + + + +

30/5/07 SST

10

+ + + + + +

15/6/07 SST

11

+ + + + + +

29/6/07 SST

12

+ + + + + +

(+ = positive hybridization; - = negative hybridization; +/-= partial or weak signal) *FA= Formamide concentration in hybridization solution

5.4.3. Populations detected

All the mixed liquor samples (foam and activated sludge) were hybridized by EUBmix

(I-III) probes during the FISH analysis along with different probes. The figure 5.5

indicates the major dominant filamntous bacteria observed in the foam and mixed liquor

samples. In the course of the study, it was found that there were at least three distinct

filamentous bacteria that were targeted by GAM42a, HGC69a and Alpha1b probes.

However, the filamentous bacterial population targeted by GAM42a and HGC69a were

always observed in all the samples during the whole period of study.

Population of the group targeted by Gamma 42a

The three major morphotypes of bacteria targeted by Gamma 42a were large filaments,

cocci with a size of about 2-3 µm and single cell rods (Fig 5.6). They were suspected to

142

belong to the gamma-Proteobacteria group. In all 24 analyzed sludge samples, probe

Gam42a identified long branched irregular filaments and the population of these

filaments remained constant. The larger cocci targeted by Gam42a probe were found to

be in 20 of the 24 samples. These cocci were observed in cluster arrangement on most of

the occasion. The small long and short rods targeted by Gam42a probe were found to be

scattered throughout the sludge samples and were always observed in all the samples.

These could be the bacteria belonging to the enterobacteriacae family. These sludge

samples were also hybridized by various genus and species-specific probes for

filamentous gram negative bacteria like SNA (Sphaerotilus natans), LD1 (Liptothrix

discophora), LMU (Leucothrix mucor), HHY (Haliscomenobacter), TN1 (Thothrix

nivea) and 021N (Eikelboom type 021N). These probes failed to detect any filamentous

and nonfilamntous populations in the sludge and foam samples.

Population of the group targeted by Alpha 1b

The three major morphotypes of bacteria targeted by Alpha1b were small irregular

filaments, cocci with tetrad arrangement and single cell rods (Fig 5.7). They probably

belonged to alpha-Proteobacteria group. In 10 out of 24 analyzed sludge samples, probe

Alpha 1b identified small-branched irregular filaments and the population of these

filaments was not observed in all the samples. However, the tetrad cocci were found in 20

out of 24 samples and were hybridized by Alpha 1b on consistent basis.

Population of the group targeted by Beta 42a

The bacteria targeted by Beta 42a probe were mostly small rods and small cocci with a

size of 1-2 µm (Fig 5.8). They probably belonged to beta-Proteobacteria group. In all 24

analyzed sludge samples, probe Beta 42a identified small rods and population of these

cells remained constant. The small cocci targeted by Beta 42a probe were found to be in

16 of the 24 samples. These cocci were observed in cluster arrangement on most of the

occasion like the cocci targeted by Alpha 1b probe. The small or long rods shaped cells

targeted by Beta 42a probe were found in grouped arrangement within the sludge

samples.

143

Population of the group targeted by LGC mix:

The LGC mix probe targeted mostly large or small spore bearing rods and cocci with a

size of 2-3 µm. In at least 20 out of 24 analyzed sludge samples, LGC mix probe

identified long or small rods and the populations of these rods were found to scattered

throughout the sample. The cocci targeted by LGC probe were found in 18 of the 24

samples. These cocci occurred in clusters or diplococci/streptococci/staphylococci

arrangement on most of the occasions. However, quantitatively LGC probe targeted quite

a small percentage of the bacterial population in comparison to other probes like

GAM42a, HGC69a, Alpha 1b, Beta 42a and MNP1.

144

A B

C D

E F

Figure 5.5 Whole cell rRNA targeted fluorescence in situ hybridization of eubacterial

community in activated sludge samples in Dubai STP. A, B, C, D, E and F: mixed

liquor/foam samples hybridized by TRITC–labeled EUB 338mix probe) Bar =10 µm and

applies to all photomicrographs. Original magnification: 1000X

145

A B

C D

E F

Figure 5.6 Whole cell rRNA targeted fluorescence in situ hybridization of Gamma

subclass of proteobacteria in activated sludge samples in Dubai STP. A, C and E:

sludge samples hybridized by TRITC–labeled Gamma42a probe) and B,D and F:

phase contrast images of the same. For each panel, identical field were viewed by

epifluorescence microscopy. Bar =10 µm and applies to all photomicrographs.

Original magnification: 1000X

146

A B

C D

Figure 5.7 Whole cell rRNA targeted fluorescence in situ hybridization of Alpha

subclass of proteobacteria in activated sludge samples in Dubai STP. A and C: sludge

samples hybridized by TRITC–labeled ALF1b probe. B and D: phase contrast images of

the same. For each panel, identical field were viewed by epifluorescence microscopy. Bar

=10 µm and applies to all photomicrographs. Original magnification: 1000X

147

A B

C D

Figure 5.8 Whole cell rRNA targeted fluorescence in situ hybridization of Beta subclass

of proteobacteria in activated sludge samples in Dubai STP. A, C: sludge samples

hybridized by TRITC–labeled BET42a probe. B and D: phase contrast images of the

same. For each panel, identical field were viewed by epifluorescence microscopy. Bar

=10 µm and applies to all photomicrographs. Original magnification: 1000X

148

Population of the group targeted by HGC 69a

The gram-positive high G+C bacteria were targeted by HGC 69a. This group of bacteria

contained filamentous bacteria population that was not targeted by Gamma 42a and

Alpha 1b. It was noted that the population of this group of high G+C bacteria remained

dominant throughout the sampling period. This was probably because of the foaming

observed in the treatment plant throughout the study period. Most of the bacteria targeted

by HGC69a were either branched filaments or long, medium or small size curved rods

(Fig. 5.9). The filamentous morphotype was the dominant gram positive bacteria in all

foam and mixed liquor samples. All 24 samples gave positive hybridization with

HGC69a probe indicating that the population belonging to the High GC group was the

most significant microbial community in the sewage treatment plant at Dubai. This

observation suggests that these bacteria play an important role in the activated sludge

process of wastewater treatment.

Population of the group targeted by MNP1

In situ hybridization using the nocardioform-specific oligonucleotide probe MNP1

(Schuppler et al. 1998) was performed to identify populations of nocardioform

actinomycetes in the activated sludge from the Dubai sewage treatment plant. For this

study, identical fixed foam and sludge samples were used which had been used

previously in hybridization with HGC69a probe. In situ hybridization with probe MNP1

resulted in the detection of two populations with different morphologies (Fig. 5.10). One

morphotype represented typical branched filaments of nocardioform actinomycetes,

whereas the other morphotype comprised short irregular rods (Fig. 5.10 f). Both

populations simultaneously hybridized with probe HGC69a confirming that the bacteria

belong to the group of actinomycetes. These results are similar to the study conducted by

Schuppler et al. (1998) using MNP1 probe. The sludge samples containing nocardioform

populations detected by probe MNP1 and HGC69a were further analyzed by

hybridization with the Gordona amarae and genus Gordona specific probes (Table 5.2).

These two probes failed to detect bacterial populations in the activated-sludge sample

from the Dubai sewage treatment plant indicating that Gordona amarae was not the

dominant foam causing bacteria in DSTP.

149

A B

C D

E F

Figure 5.9 Whole cell rRNA targeted fluorescence in situ hybridization of High G+C

bacterial group in activated sludge samples in Dubai STP. A, C and E: sludge samples

hybridized by TRITC–labeled HGC69a probe. B, D and F: phase contrast of the same.

For each panel, identical field were viewed by epifluorescence microscopy. Bar =10 µm

and applies to all photomicrographs. Original magnification: 1000X

150

A B

C D

E F

Figure 5.10 Whole cell rRNA targeted fluorescence in situ hybridization of

Nocardioform actinomycetes group in activated sludge samples in Dubai STP. A, B, C,

D, E and F: sludge samples hybridized by TRITC–labeled MNP1 probe. Bar = 10µm and

applies to all photomicrographs. Original magnification: 1000X

151

5.4.4. FISH based detection of Nocardioform actinomycetes pure cultures in Dubai STP

Fluorescent in situ hybridization (FISH) using HGC, MNP1 (specific to nocardioform

actinomycetes group) and Gordona amarae specific probe was performed to detect

nocardioform actinomycetes in pure cultures isolated from the foaming activated sludge

samples. The oligonulceotiode probe hybridization was performed at 46°C and other

conditions were followed according to the procedure described by Schuppler et al., 1998.

No non-specific hybridization was observed for the Nocardioform genera specific probe.

Again, two morphotypes of nocardioforms actinomycetes (single cell rods and branched

filaments) were isolated from both foam and mixed liquor samples. Identification of pure

cultures of suspected nocardioform isolates was performed using HGC, MNP1, Myc657

S-G-Gor- 0596-a-A-22 and S-S-G.am 0192-a-A-18 oligonucleotide probe (Table 5.10

and Figure 5.11 and 5.12). In total out of 16 isolates 10 isolates were simultaneously

hybridized by both HGC 69a and MNP1 indicating that the these isolates were indeed

Nocardioform actinomycetes members. As many as eight of these were able to hybridize

with Myc657 probe. Figure 5.13 shows hybridization of isolates FB05 and FB14 by

TRITC labeled Myc657 probe.

Table 5.9: In situ hybridization of filamentous isolates by group, genus and species

specific probes (+ Hybridization; - No hybridization)

Sl.

No

Isolate

Code

Hybridization with probes

HGC69a

MNP1

Myc657

S-G-Gor-

0596-a-A-22

S-S-G.am

0192-a-A-18

1 FB01 - - - - -

2 FB02 - - - - -

3 FB03 - - - - -

4 FB04 + + + - -

5 FB05

+

+ + - -

6 FB06 + + + - -

7 FB07 + + + - -

8 FB08 - - - - -

9 FB09 - - - - -

10 FB10 + + + - -

152

11 FB11 + + - - -

12 FB12 + + + - -

13 FB13 - - - - -

14 FB14 + + + - -

15 FB15 + + + - -

16 FB16 + + - - -

However, these ten isolates failed to hybridize with Gordona amarae and genus Gordona

specific probe. Several Nocardioform isolates initially exhibited filamentous form

however on repeated sub-culturing started to exhibit single cell form or the mixed

filamentous and non-filamentous morphotypes. However, both these forms were

successfully detected by whole cell in situ hybridization using HGC69a as well as MNP1

probes. These observations suggest that the single cell and filamentous forms of

nocardioform bacteria isolated from foam and sludge samples could be different

morphotypes of same nocardioform species. However, more detailed study regarding

exact identity of these two morphotyes using 16S r-RNA based approach needs to be

conducted.

A B

153

C D

Figure 5.11 Detection of Nocardioform actinomycetes from activated sludge bacterial

isolates hybridized by TRITC–labeled MNP1 probe. A) FB04; B) FB05; C) FB06; D)

FB07; Bar =10 µm and applies to all photomicrographs. Original magnification: 1000X

154

A B

C D

E F

Figure 5.12 Detection of Nocardioform actinomycetes from activated sludge bacterial

isolates hybridized by TRITC–labeled MNP1 probe. A) FB10; B) FB11; C) FB12; D)

FB14; E) FB15; F) FB16. Bar =10 µm and applies to all photomicrographs. Original

magnification: 1000X

155

A B

C D

Figure 5.13 Detection of mycolic acid-containing actinomycetes isolates hybridized by

TRITC–labeled Myc657 probe. A) FB05 hybridized by Myc657 probe B) Identical field

of DAPI stained FB05 C) FB14 hybridized by Myc657 probe D) Identical field of DAPI

stained FB14. Bar =10 µm and applies to all photomicrographs. Original magnification:

1000X

156

5.5 CONCLUSION

This study evaluated the microbial community structure in the activated sludge system of

Dubai STP. The population changes of the major groups like proteobacteria (alpha, beta

and gamma), High GC, Low GC and other groups of microbes were analyzed using

FISH. The samples tested were taken from foaming sludge and mixed liquor of activated

sludge system and a nocardioform actinomycete group member was found to be

dominating in the system. This group of suspected nocardioform actinomycete belonged

to the High GC group of bacteria that was targeted by HGC69a and MNP1. However,

this group of nocardioform actinomycete exhibited both branched and single cell

morphotypes. The second largest dominating group belonged to Gamma sub-class of

proteobacteria. Majority of the bacteria targeted by Gam42a probe were filamentous in

their morphology indicating that they were probably Thiothrix or Type 021N or both.

Specific probes such as SNA (Sphaerotilus natans), LDI (Leptothrix sp), LMU

(Leucothrix sp), HHY (Haliscomenobacter sp), TNI (Thiothrix), 021N (Type 021N) and

MPA60 (Microthrix parvicella) failed to hybridize in the sludge samples. However, a few

of these filaments were observed in the samples. The sludge samples containing

nocardioform populations detected by probe MNP1, Myc657 and HGC69a were further

analyzed by hybridization with the Gordona amarae and genus Gordona specific probes.

These two probes failed to detect bacterial populations in the activated-sludge sample

from the Dubai sewage treatment plant indicating that Gordona amarae was not the

dominant foam causing bacteria in Dubai STP.

In total out of 16 pure culture isolates 10 were successfully hybridized by both

HGC69a and MNP1 indicating that these isolates were nocardioform actinomycetes

157

members. At least eight isolates hybridized with Myc657 probe indicating that these

isolates were mycolic acid containing actinomycetes. However, all the isolates failed to

hybridize with Gordona amarae and genus Gordona specific probe meaning that none of

these isolates belonged to Gordona genus.

It is recommended that this research should be furthered in a number of ways. Firstly a

clone library shall be developed base on the samples obtained. The community DNA

shall be extracted and the 16S rRNA genes are amplified through Polymerase Chain

Reaction (PCR). These genes are later isolated through cloning and plating techniques,

thus creating a clone library. This clone library will be subjected to Denaturing Detergent

Gradient Gel Electrophoresis (DDGE) screening and DNA sequencing. With the rRNA

sequences known, new specific probes will be designed for FISH to further the

investigation. These new probes together with those presently available will help to

reveal the intricate structures present in the filamentous and non-filamentous microbial

community in Dubai Sewage treatment plant.