Upload
others
View
12
Download
0
Embed Size (px)
Citation preview
Chapter: 4
Mechanism of erythromycin and tetracycline
resistance in lactic acid bacteria isolated from
fermented foods
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 106
4.1. Overview
The aim of the study was to evaluate the acquired erythromycin resistance (ERr) in
all the selected 60 LAB isolates using phenotypic and genotypic tests. Employing
the characteristic macrolide-lincosamide-streptogramin B (MLSB) resistance
double disc diffusion, ‘D’ zone test was performed and the isolates were
categorized as constitutive (cMLSB), inducible (iMLSB), keyhole (KH),
lincosamide (L), intermediate (I), and synergistic intermediate (SI) phenotypes.
The LAB cultures displayed erythromycin minimum inhibitory concentration
(MIC) ranging from 8 to 256 g/ml. For most of the isolates obtained from
traditional fermented foods, the MIC values for erythromycin were lower (8-32
g/ml) when compared with those from fermented dry sausages. Positive PCR
amplifications were obtained for methylase encoding gene, erm(B) in 88% of the
total LAB isolates. Beside erm(B), the macrolide efflux gene, msr(C) was also
found in En. durans, P. pentosaceus, En. lactis and Lb. fermentum. None of the
isolates were positive for erm(A), erm(C) or mef(A). The evaluation of all the ERr
isolates for tetracycline resistance (TCr) displayed MIC values ranging from 8-
256 μg/ml. TCr determinants [tet(M), tet(W), tet(S) tet(O), tet(K) and tet(L)]
demonstrated their presence in Lactobacillus and Pediococcus and Enterococcus
species with simultaneous occurrence of genes with same or different
mechanisms. Besides tet and erm genes, lnu(B) was also detected in one each of
En. faecium and Lb. salivarius isolates. The results of the study underline the
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 107
prevalence of acquired ERr and TC
r in LAB of food origin. In addition, the
detection of diverse phenotypes among LAB indicated the presence of unidentified
ERr genes or mutations in the identified resistance genes. This study signifies
acquired ERr and TC
r genes in LAB isolates that displayed diverse MLSB
phenotypes.
4.2. Introduction
A variety of antibiotics especially the macrolides are currently used in human and
veterinary medicine because of their proven record to cure illness (Landers, 2012).
Their wide spread usage has also resulted in the development of strains resistant to
these life saving antibiotics (Bailey et al., 2008). Three principal mechanisms have
so far been found to be responsible for acquired macrolide resistance in bacteria;
target site modification, active efflux and antibiotic inactivation (Roberts, 2005).
The former, most prevalent mechanism usually depends on a post transcriptional,
methylase-mediated modification of 23S rRNA encoded by erythromycin
ribosomal methylation (erm) genes (Weisblum, 2000). The methylation of the
target (23S rRNA) causes cross-resistance among 3 antibiotic families; macrolides
(eg. erythromycin, azithromycin and clarithromycin), lincosamides (eg,
clindamycin) and group B streptogramins (pristinamycin) (MLSB) that share a
common binding/target site (Lambert, 2012).
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 108
Resistance to macrolides can also occur by a number of different genes
coding for transport (efflux) proteins that pump the antibiotic out of the cell
keeping intracellular concentration of the antibiotic low. Many of these proteins
[mef(A), mef(E), lmr(A), msr(A), msr(B) and msr(C)] are members of major
facilitator superfamily (MFS) or ABC transporter superfamily (Roberts, 2005).
The action of these proteins is characterized with low level resistance to 14- and
15-membered ring macrolides and streptogramins and remains sensitive to
lincosamides (Montanari et al., 2003; Steward et al., 2005). Another resistance
mechanism, inactivation of macrolides mediated by chemical modification
through esterase encoding ere variants confer high level resistance to macrolides
(Roberts, 2008).
The erm mediated resistance can be expressed either constitutively, with
high resistance levels to all the MLS antibiotics (cMLSB phenotype), or inducibly
(iMLSB phenotype) with macrolide induced lincosamide resistance (Montanari et
al., 2003). Similarly, efflux pumps conferring resistance to macrolide and
streptogramin or macrolides alone are characterized with MS and M phenotypes
respectively (Montanari et al., 2003; Steward et al., 2005). An in vitro double disc
diffusion test using erythromycin (15 μg) and clindamycin (2 μg) can distinguish
erm-mediated resistance phenotypes (iMLSB and cMLSB) from that of efflux
mediated M or MS phenotype (Woods, 2009). Resistance to MLSB antibiotics
employing double disc diffusion/D zone test have been well characterized in
Gram-positive pathogens such as Streptococcus agalactiae (Malbruny et al.,
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 109
2004), S. pyogenes (Giovanetti et al., 1999; Giovanetti et al., 2002) and several
clinically important pathogens. However, such studies in LAB isolates from food
origin are limited.
Tetracycline is a group of broad spectrum antibiotics that is continued to be
used for treatment in a variety of Gram-positive and Gram-negative bacterial
infections (Roberts, 2005). Bacterial resistance to these antibiotics is mediated
either by energy-dependant efflux systems or proteins that protect the bacterial
ribosomes or in rare cases through direct inactivation of the antibiotics and/or by
mutation in the 16S rRNA gene that prevent binding of tetracycline to the
ribosome. Due to the association of erythromycin and TCr genes with common
conjugative transposons (e.g. Tn916-Tn1545), ERr genes are often found linked
with TCr genes. The most common coexistence observed are between ribosomal
protection tet genes and mef(A)-msr(D) elements or erm genes detected in
plasmids and chromosomes of a variety of bacteria species (Roberts, 2005; 2008).
A number of initiatives have been recently launched across the globe to
address the bio-safety concerns of starter cultures and probiotic microorganisms.
In order to check for signs of transferable antibiotic resistance (AR) in starter
cultures, minimum inhibitory concentration (MIC) of the antimicrobials expressed
as mg/L or μg/ml should be determined for each of the test antibiotic. It is
essential that such tests are made in a consistent manner using internationally
recognized and standardized methods (EFSA, 2012). In this regard,
“Microbiological breakpoint” has been introduced by studying the distribution of
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 110
MIC values of LAB (Ammor et al., 2007) that have also been updated (EFSA,
2008, EFSA, 2012). When a bacterial strain demonstrates higher resistance to a
specific antibiotic than the other strains of the same taxonomical unit, the presence
of acquired resistance is indicated and additional information is needed on the
genetic basis of the AR (EFSA, 2012). Hence, phenotypic tests are accompanied
by molecular tests that detect specific AR genes using single or multiplex PCR,
real time PCR, hybridization assays and/or DNA microarrays (Ammor et al.,
2007).
In previous chapter, the LAB isolates resistant to high concentrations of
erythromycin (8 and 16 μg/ml) above the standard value (4 μg/ml) were
characterized. Hence, in the present chapter, acquired ERr among the 60 LAB
isolates was determined employing phenotype and genotypic tests. As ERr is often
linked with TCr determinants,
all the test LAB cultures were also evaluated for
phenotypic and genetic evidence for TCr.
4.3. Materials and Methods
4.3.1. Chemicals and Buffers
20 X SSC Solution: 3 M NaCl, 0.3 M Sodium citrate (pH-7.2)
Washing buffer: 0.1 M Maleic acid + 0.15 M NaCl, pH- 7.5, and 0.3% (v/v)
tween-20
Maleic acid buffer: 0.1 M Maleic acid + 0.15 M NaCl, pH- 7.5 (Using
NaOH pellets)
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 111
Blocking solution: 1 X working solution was prepared by diluting 10X
stock of blocking solution (provided with the DIG high prime detection and
labeling kit) with maleic acid buffer.
Detection buffer: 0.1 M Tris-HCl + 0.1 N NaCl, pH-9.5.
4.3.2. Materials
Nylon membrane was purchased from Sigma Aldrich, USA. Whatman filter paper
No.1 and No.3 were from Whatman, Germany. Dig High prime DNA labeling and
detection kit II for dot-blot were procured from Roche Inc. Germany, U.V cabinet,
Model No: E/340/OC, Superfit Laboratory Instruments, Mumbai, India. U.V
Spectrophotometer: UV1800ENG240V, SOFT, Shimadzu corporation, Japan,
Oligo Nucleotide primers were procured from Sigma Aldrich, Bangalore.
4.3.3. Bacterial strains
The bacteria strains used in this particular investigation include 60 LAB isolates
that were identified in previous chapter. The Micrococcus luteus ATCC 9341
strain was used as clindamycin sensitive culture. All LAB cultures were grown
under static condition at 37 °C while M. luteus was grown in Brain Heart Infusion
(BHI) broth at 37 °C under shaking.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 112
4.3.4. Antibiotics
Tetracycline antibiotic powder was procured from Hi-Media, (India). Stock
solution of tetracycline was prepared using methanol. Hi-comb strips of
erythromycin and tetracycline with a range of 4, 8, 16, 32, 64, 128, and 256 g as
well as individual discs of erythromycin (15 μg), clindamycin (2 μg) and
pristinamycin (15 μg) rokitamycin (15) were procured from Hi-Media, India Pvt
Ltd.
4.3.5. Disk diffusion test
The double disk/D zone test with erythromycin (15 g) and clindamycin (2 g)
was performed to evaluate the phenotypes of the ERr LAB as described previously
(Seppala et al., 1993). Briefly, 1% inoculum from the overnight grown culture was
inoculated either into fresh MRS broth in case of Lactobacillus, Pediococcus and
Leuconostoc cultures or BHI broth for Enterococcus and allowed to grow for 4-5
h. The resulting log phase cultures were used for D zone test. Using sterile cotton
swabs culture was inoculated onto MRS/BHI agar medium in three directions. The
agar plates were then allowed to dry for 5 to 10 min. Using sterile forceps, the
erythromycin and clindamycin discs were placed with 2 mm apart and the plates
were incubated at 37 °C overnight. After incubation period, plates were observed
for growth or inhibition zone in presence of the antibiotic and blunting of the
clindamycin inhibition zone near the erythromycin disc is an indicative of
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 113
inducible type of MLSB (iMLSB) resistance. Growth in presence of clindamycin
and erythromycin with no inhibition zone is indicative of constitutive type of
MLSB (cMLSB) resistance. Susceptibility to clindamycin with no blunting of the
zone indicates M resistance phenotype.
In order to determine cross resistance among MLS antibiotics, multiple disc
diffusion test was performed by placing MLS discs of erythromycin (15 μg),
clindamycin (2 μg), rokitamycin (15 μg), and pristinamycin (15 μg) adjacent with
2 mm apart. Similarly, to investigate the inducible nature of streptogramin
antibiotics, triple disc test was performed by placing clindamycin (2 μg) at the
center of the agar plate. Pristinamycin and erythromycin discs of 15 μg
concentration each were placed on either side of clindamycin disc.
4.3.6. Determination of minimum inhibitory concentrations
The minimum inhibitory concentration (MIC) is defined as the lowest antibiotic
concentration that inhibits the visible growth after overnight incubation (Phillips et
al., 1991). MIC test was performed with erythromycin and tetracycline antibiotics
for all the 60 isolates using the agar dilution, Hi-comb strip and microbroth
dilution methods. All the tests were performed thrice in duplicates.
4.3.6.1. Agar dilution method
The agar dilution method was followed as per the protocol described by Rosander
et al. (2008). Briefly, the isolates were grown in MRS broth overnight at 37 °C.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 114
The resulting culture was diluted to 105 CFU/ml and 2 l of each culture was
spotted onto MRS agar supplemented with either erythromycin or tetracycline at
concentrations of 4, 8, 16, 32, 64, 128, 256 and 512g/ml. A control plate was
kept with no added antibiotic in the medium and the growth of the culture was
compared in presence and absence of antibiotic. After adsorption of the drops, the
plates were incubated under microaerophilic condition at 37 °C for 24 h and the
changes in the growth were recorded.
4.3.6.2. Hi Comb/E-strip method/ Disc diffusion test
The MIC values of erythromycin for the selected LAB isolates was determined
using the Hi-comb strips of erythromycin and tetracycline which contained discs
with concentrations ranging from 0.5 to 512 g. The log phase test cultures were
inoculated onto MRS/BHI agar plates using the protocol described in section
4.3.5. The culture was allowed to dry and the Hi-comb strips were placed and
incubated overnight at 37 °C under microaerophilic conditions.
4.3.6.3. Microbroth dilution method
The MIC determination by microbroth dilution was performed according to the
method followed by CLSI, (2004). Briefly, a single colony of culture was
inoculated into fresh MRS broth and incubated at 37 °C overnight. The optical
density (OD) of the culture at 625 nm (OD 625) was adjusted to 0.2 in fresh MRS
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 115
broth and the suspension was diluted 500 times using the same medium. One
hundred microlitres of this dilution was then transferred to microtitre plate
containing 100 l of MRS broth supplemented with appropriate amount of
erythromycin or tetracycline with a range of 0, 4, 8, 16, 32, 64, 128, 256 and
512g/ml. The microtitre plates were then incubated at 37 °C for 24 h. Post
incubation, the growth was recorded at OD 625 nm. MRS broth containing no
culture served as control.
4.3.7. Detection of ERr and TC
r genes by PCR
Detection of ERr and TC
r in LAB isolates was determined by PCR analysis using
specific primers for the known antibiotic resistance genes (Table 4.3.7.1 and
4.3.7.2). The genes responsible for MLSB resistance were analyzed using the
primers specific for methylases viz. erm(A), erm(B), erm(C) and erm(T); and,
efflux genes- mef(A), msr(A) and msr(C) (Table 4.3.7.1). For TCr determinants,
initially PCR was carried out for tet genes encoding ribosomal protection proteins
(RPP) using degenerative primers DI and DII. Incase, the RPP genes getting
amplified with DI and DII, additional PCR assays were performed with primers
specific to tet(M), tet(W), tet(S) and tet(O). In addition to RPP tet genes, isolates
were also tested for tetracycline efflux genes tet(K) and tet(L) (Table 4.3.7.2). The
reaction mixture was composed of 10 mM primer each (forward and reverse), 0.2
mM dNTPs mix, 2.5 μl of 1X PCR buffer, 2.5 mM MgCl2, 4 l containing 10 ng
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 116
of genomic DNA as template and 1 Unit of Taq DNA polymerase. The reaction
mixtures were subjected to PCR with the following conditions; initial denaturation
at 95°C for 5 mins, followed by 35 cycles of 95 °C for 40 sec, annealing
temperature (as provided in Table 4.3.7.1 and 4.3.7.2) for 40 sec and extension at
72 °C for 1 min and final extension at 72 °C for 5 min. Details of primer sequence
and expected amplicon sizes are given in Table 4.3.7.1 and 4.3.7.2. PCR
amplifications were checked electrophoretically on 1% agarose gel and visualized
by ethidium bromide staining.
4.3.8. DOT BLOT EXPERIMENT
The Dot-blot hybridization was performed employing the non-radioactive labeling
method using digoxygenin labeling and detection kit method. All the procedures
were followed according to the manufacturer’s instructions (Roche Inc. Germany).
4.3.8.1. Labeling of the probe
DNA fragment of PCR product was purified using high pure PCR product
purification kit. The purified product was quantified using spectrophotometric
method. To 10 μl of 3 μg/μl concentration template DNA (PCR product), 16 μl of
nuclease free water was added in a reaction vial. The template DNA was
denatured by heating in a boiling water bath for 10 mins and quickly chilled on
ice. To the denatured DNA, 4 μl of the DIG-High prime labeling mixture
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 117
Table 4.3.7.1: Primers used in detecting erythromycin and clindamycin resistance genes
Gene Primer
pair
Sequence
5’ 3’
Annealing
temperature
(°C)
Expected
amplicon
(bp)
Reference
erm(A) ErmA-FW TCTAAAAAGCATGTAAAAGAA 52 645 Sutcliffe et al., (1996)
ErmA-RV CTTCGATAGTTTATTAATATTAGT
erm(B) ErmB-FW CATTTAACGACGAAACTGGC 55 405 Jensen et al., (1999)
ErmB -RV GGAACATCTGTGGTATGGCG
erm(C) ErmC-FW TCAAAACATAATATAGATAAA 52 642 Sutcliffe et al., (1996)
ErmC -RV GCTAATATTGTTTAAATCGTCAAT
msr(A/B) MsrA/B-FW-1 GCAAATGGTGTAGGTAAGACAACT 52 399 Sutcliffe et al., (1996)
MsrA/B-RV-2 ATCATGTGATGTAAACAAAAT
msr(A) MsrA -FW-3 GGCACAATAAGAGTGTTTAAAGG 40 939 Ojo et al., (2006)
MsrA -RV-4 AAGTTATATCATGAATAGATTGTCCTGT
T
msr(C) MsrC -FW AAGGAATCCTTCTCTCTCCG 55 343 Werner et al., (2001)
MsrC -RV GTAAACAAAATCGTTCCCG
lnu(B) LnuB-FW CCTACCTATTGTTTGAA 44 944 Gygax et al., (2006)
LnuB-RV ATAACGTTACTCTCCTATTC
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 118
Table 4.3.7.2: Primers used in detecting specific tetracycline resistance genes
N=A, C, G and T; R= A and G; W= A and T; Y= C and T
Gene Primer
pair
Sequence
5’ 3’
Annealing
temperature
(°C)
Expected
amplicon
(bp)
Reference
RPP DI GAYACNCCNGGNCAYRTNGAYTT 45 1,083 Clermont et al., (1997)
DII GCCCARWANGGRTTNGGNGGNACYTC
tet(M) DI GAYCANCCNGGNCAYRTNGAYTT 55 1,513 Clermont et al., (1997)
TetM-RV CACCGAGCAGGGATTTCTCCAC
tet(S) TetS-FW ATCAAGATATTAAGGAC 55 573 Charpentier et al., (1993)
TetS-RV TTCTCTATGTGGTAATC
tet(O) TetO-FW AATGAAGATTCCGACAATTT 55 781 Sougakoff et al., (1987)
TetO-RV CTCATGCGTTGTAGTATTCCA
tet(K) TetK-FW TTATGGTGGTTGTAGCTAGAAA 55 348 Gevers et al., (2003a)
TetK-RV AAAGGGTTAGAAACTCTTGAAA
tet(L) TetL-FW GTMGTTGCGCGCTATATTCC 55 696 Gevers et al., (2003a)
TetL-RV GTGAAMGRWAGCCCACCTAA
tet(W) TetW-FW GAGAGCCTGCTATATGCCAGC 57 168 Masco et al., (2006)
TetW-RV GGGCGTATCCACAATGTTAAC
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 119
(containing random primer mix (5X), 1U/μl Klenow polymerase, labeling
grade 1mM dATP, 1mM dCTP, 1mM dGTP, 0.65 mM dTTP, 0.35 mM DIG-
11-dUTP, alkali labile and 5 X stabilized reaction buffer in 50% (v/v) glycerol)
were added. The labeling mixture was vortexed gently and centrifuged briefly.
The mixture was then incubated for 1 hr to overnight at 37 °C. The reaction
was terminated by heating at 65 °C for 10 min. The digoxygenin labeled DNA
was stored at -20 °C until use.
4.3.8.2. Fixation
Five to 10 μl of the test DNA (Total or plasmid) containing 10 ng to 0.1 μg/μl
was denatured by heating in a boiling water bath for 10 min and quickly chilled
on ice. The DNA was centrifuged briefly and 5 μl of the denatured DNA was
spotted onto Nylon membrane and allowed to dry. The nylon membrane was
then placed on 3 mm thick Whatman filter paper soaked in 10 X SSC. The
DNA was then cross linked by exposing the wet nylon membrane to 254 nm
UV for 5 to 10 min. The membrane was then rinsed briefly using sterile
distilled water and allowed to air dry completely.
4.3.8.3. Pre-Hybridization
Appropriate volume (10 ml/ 100 cm2) of hybridization solution was pre-heated
at 37 to 42 °C. To the dried membrane taken in a container, the pre-heated
hybridization solution was added and incubated at 37 to 42 °C for 30 min with
gentle agitation. The appropriate hybridization temperature was calculated
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 120
according to GC content and percentage of the probe to the target according to
the following equation.
Tm = 49.82+0.41 (%G+C) – 600/length of hybrid in base pairs
Tm = Tm – 20 to 25 °C
4.3.8.4. Hybridization
Five microlitres (25 ng/μl) of DIG-labeled DNA probe was denatured in
boiling water and quickly chilled on ice/ice water. The denatured DNA probe
was added to the pre heated DIG hybridization buffer (3.5 ml/100 cm2) and
mixed gently by avoiding formation of bubbles. The pre-hybridization solution
was poured off from the container and the hybridization solution containing
denatured DNA probe was added to the membrane. Hybridization at 42 °C was
carried out for 4 h to overnight with gentle agitation.
4.3.8.5. Stringency washes
The hybridization solution was poured off and the membrane was washed
twice for 5 min under constant agitation with ample amount of 2 X SSC and
0.1% SDS. This was followed by 15 min washing with 0.5 X SSC and 0.1%
SDS at 65 to 68° C.
4.3.8.6. Immunological detection
All washings were performed at room temperature under constant agitation.
Post hybridization and stringency washes were carried out following brief
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 121
rinsing of membrane for 5-10 min in washing buffer. The membrane was then
incubated for 30 min in ample amount of blocking solution. The
antidigoxygenein-alkaline phosphatase (anti DIG-AP) was centrifuged at
10,000 rpm for 5 min before each use. The anti DIG-AP was diluted to 5000
times by adding appropriate volume 1 X blocking solution. The mixture
(blocking solution containing anti-DIG antibody) was then added to the
membrane and incubated for 30 min under gentle agitation. The solution was
then poured off from the membrane and washed twice for 15 min using ample
amount of washing buffer.
4.3.8.7. Detection/blot development
The washing buffer from the membrane was removed and equilibrated for 5-10
min with detection buffer. To the fresh detection buffer, appropriate volume of
color substrate was added. The mixture was added to the membrane and
incubated in dark without shaking. The membrane was observed intermittently
for the detection of any color development. The reaction was stopped when the
desired spot intensities were achieved by washing the membrane for 5 min with
50 ml of sterile water or TE buffer. The results obtained were documented by
photography or using gel-documentation system.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 122
4.3.9. Determination of clindamycin resistance
4.3.9.1. Clindamycin inactivation test
The clindamycin resistant strains were subjected to modified Hodge test for
detection of lincosamide nucleotidyltransferase (lnu) activity (Noyal et al.,
2009). An overnight culture suspension of clindamycin sensitive M. luteus
ATCC 9341 adjusted to 0.5 O.D600 was inoculated using a sterile cotton swab
on the surface of a BHI agar medium. After drying, 2 µg clindamycin disk was
placed at the center of the plate and the test strain was streaked from the edge
of the disk to the periphery of the plate in four different directions. The plates
were incubated overnight at 37 °C. The presence of a ‘cloverleaf shaped’ zone
of inhibition due to lincosamide nucleotidyltransferase production by the test
strain was considered as positive.
The clindamycin inactivation test was also evaluated using the overlay
assay. Test LAB isolates were streaked on to BHI agar medium supplemented
with 2 μg/ml of clindamycin. Two percent of an overnight culture suspension
of clindamycin sensitive M. luteus ATCC 9341 adjusted to 0.5 O.D 600 was
inoculated to BHI soft agar and overlaid onto the streaked LAB test cultures.
The growth of M. luteus around the test culture was considered positive.
4.3.9.2. Detection of clindamycin resistance gene by PCR
The genomic DNA isolated was used as a template in PCR amplification
reaction for lnu(B) [lin(B)] employing gene specific primers as given in Table
4.3.7.1. PCR analysis was carried out as follows: 35 cycles of amplification
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 123
including 30 sec of denaturation at 94 °C, 40 sec of annealing at 44 °C and 40
sec of elongation at 72 °C.
4.3.10. Gene sequencing and nucleotide accession numbers
For determining the nucleotide sequences of antibiotic resistance determinants,
the PCR amplified products were purified using PCR purification kit, DNA
sequencing and its subsequent analysis was performed as described in chapter 3
(section 3.2.2.7.4).
The antibiotic resistance genes identified in the bacterial isolates
reported in this study were deposited in the GenBank with the following
accession numbers. The msr(C) sequence fragments identified in cultures CHS-
3E, ABM-1, KOV-3E, and RM-3-2 were deposited with accession numbers
HQ651919 to HQ651922, respectively. The erm(B) gene sequences identified
from cultures CHS-1E and IB8-3 were deposited under accession no
HQ651923 and HQ651924, respectively. Similarly, the tet(W), tet(M) and
tet(L) partial DNA sequences have been deposited under the accession numbers
HQ651925 (CH1-1-T32), HQ651926 (CHS-1E) and HQ651927 (IB4-2B).
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 124
4.4. Results
Macrolides, lincosamides and streptogramin antibiotics although structurally
distinct, they share a common mode of action and similar antibacterial spectra.
These antibiotics block the translation process by binding to the 23S rRNA,
close to the peptidyl transferase centre of the 50S ribosomal subunit (Lambert,
2012). Hence in the present study, the mechanism of resistance was
investigated among the native isolates.
4.4.1. MLSB phenotypes of ERr LAB
The principal mechanism of MLS resistance includes the 1) target
modification: encoded by 21 different erm genes. Regardless of erm gene, the
phenotype can be constitutive (cMLSB) when the methylation enzyme is
continuously produced or inducible (iMLSB) when an inductor (usually
macrolides) is necessary for the function of the methylase enzyme. 2) Efflux
system that reduces the cellular concentration of the antibiotic and results in the
M phenotype. 3). Antibiotic inactivation by enzymes and is responsible for
different phenotypes such as MLSB + SA and L phenotype in Gram-positive
bacteria. Such phenotypes are usually detected with a double disc diffusion test
using erythromycin (15 μg) and clindamycin (2 μg) discs.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 125
4.4.1.1. Diversity in MLSB phenotype
With the aim of identifying the type of resistance, double disc diffusion test
was performed and diverse MLSB phenotypes were observed among the LAB
isolates as shown in Fig 4.4.1.1.1 to 4.4.1.1.3. Among the Lactobacillus
isolates, Lb. salivarius and Lb. reuteri isolated from fermented dry sausages
displayed cMLSB phenotype (Fig 4.4.1.1.1 c). Among the 4 Lb. fermentum
cultures, 2 strains (RM3-1 and RM3-2) of raw milk origin showed cMLSB
phenotype while other two strains (C-1 and C-3) isolated from curd were
found sensitive with large zones around clindamycin and erythromycin (Fig
4.4.1.1.1 a and b).
In case of enterococci, diverse phenotypes were observed (Fig 4.4.1.1.2).
One En. lactis and 13 En. durans isolates with erythromycin intermediate and
clindamycin resistance were assigned to lincosamide (L) phenotype. A total of
6 isolates with 3 each of En. durans and En. faecium were assigned to cMLSB
phenotype and 1of En. durans was assigned to iMLSB phenotype. When
erythromycin and clindamycin discs were placed side by side, an enhancement
of zone of inhibition between the two discs was observed in few isolates (1 of
En. durans, 2 of En. faecium and the sole En. casseliflavus). This erythromycin
induced clindamycin susceptibility was designated as keyhole (KH) phenotype
with its resemblance to a keyhole pattern. One En. lactis with low level
resistance to erythromycin and sensitive to clindamycin was assigned to M
phenotype. Three enterococcal isolates (1 of En. durans and 2 of En. faecium)
with similar inhibition zone size to erythromycin and clindamycin without any
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 126
change in the zone shape were assigned as intermediate (I) phenotype. In
addition, 3 isolates that displayed intermediate phenotype with erythromycin
induced clindamycin susceptibility were assigned to intermediate synergistic
(IS) phenotype.
Similar to results obtained with Enterococcus isolates, phenotypic variation
was also observed among strains of P. pentosaceus. As shown in Fig 4.4.1.1.3,
few isolates were found sensitive to both clindamycin and erythromycin.
However, majority of the isolates were found with MS phenotype a
characteristic of efflux system mechanism. It was only two isolates that
displayed cMLSB resistance phenotype. In addition, few isolates that were
isolated from naturally fermented foods showed L phenotype which was
similar to that observed among Enterococcus isolates.
Figure 4.4.1.1.1. D Zone test phenotypes of Lactobacillus cultures. a and b: Sensitive
phenotype (ER-S, CL-S), c: cMLSB phenotype. Right: Clindamycin (2-μg), Left:
Erythromycin (15-μg).
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 127
Figure 4.4.1.1.2. Diverse phenotypes among enterococci cultures. a: Keyhole phenotype,
b: cMLSB phenotype, c: Intermediate (ER-I, CL-S), d: Sensitive phenotype (ER-S, CL-S), e:
L phenotype (ER-I, CL-R), f: Synergistic sensitive phenotype. Right: Clindamycin (2-μg),
Left: Erythromycin (15-μg).
Figure 4.4.1.1.3. Different phenotypes among Pediococcus pentosaceus cultures. a:
Sensitive phenotype (ER-S, CL-S), b: cMLSB phenotype, c: MS phenotype (ER-I, CL-S), d:
L phenotype (ER-S, CL-I). I: Intermediate, L: lincosamide, MS: Macrolide and
Streptogramin, ER: erythromycin, CL: Clindamycin. Right: Erythromycin (15-μg), Left:
Clindamycin (2-μg).
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 128
4.4.1.2. Cross resistance among MLS antibiotics
In recent past with development of resistance to erythromycin, newer
macrolides have been developed that have remarkable pharmacokinetic
properties. However, the resistance mechanisms that operate against
erythromycin also apply to the newly discovered macrolides. In addition, with
the increase in complexity of target modification mediated (erm genes)
resistance, there is a cross resistance among MLSB antibiotics. In view of this,
multiple disc diffusion test was performed to investigate cross resistance
among different MLSB antibiotics and the results are shown in Fig. 4.4.1.2.1. In
this test, the streptogramin group of antibiotic i.e. pristinamycin was found to
induce clindamycin resistance in one En. durans (IB8-3) culture. The observed
phenotype was similar to that of iMLSB phenotype with erythromycin induced
clindamycin resistance. In addition to this, most of the resistance phenotypes
between lincosamides and streptogramins were similar with those observed
between macrolides and lincosamides.
4.4.1.3. Macrolide and streptogramin induced resistance to lincosamide
Pristinamycin antibiotic that belongs to streptogramin B antibiotics has a
similar mode of action as that of macrolides and lincosamides. Unlike
macrolides, pristinamycin is a non-inducing antibiotic. However,
prisitnamycin was found to induce clindamycin resistance in iMLSB phenotype
En. faecium isolate. With this observation, further aim was to evaluate such
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 129
phenotype in other isolates. Thus, enterococci and P. pentosaceus cultures
showing novel phenotypes in double disc diffusion test (erythromycin and
clindamycin) were subjected to triple disc diffusion using erythromycin,
clindamycin, and pristinamycin. The results obtained are shown in Fig.
4.4.1.3.1. The phenotypic results observed with pristinamycin and clindamycin
were similar to those obtained with erythromycin and clindamycin. In addition
to the D zone phenotype, the novel phenotype such as KH, L, I and IS
phenotypes observed with clindamycin and pristinamycin were similar to those
identified using erythromycin and clindamycin.
Figure 4.4.1.2.1. Multiple disc diffusion test for MLSB cross resistance. C: clindamycin
(2 μg), E: erythromycin (15 μg), R: Roxithromycin (15 μg) and P: pristinamycin (15 μg)
Figure: 4.4.1.3.1. Triple disc diffusion test phenotypes of enterococci.. a: iMLSB
phenotype, b: Synergistic phenotype, c: L phenotype. L: lincosamide. Right: Erythromycin
(15-μg), Center: Clindamycin (2-μg) and Left: Pristinamycin (15-μg).
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 130
4.4.2. Antimicrobial resistance determination
Recognition of bacterial isolates with acquired AR can be made by determining
the MIC value of a particular antibiotic. In order to determine the acquired
resistance to erythromycin, all the selected 60 LAB isolates were subjected to
MIC test using disc diffusion (Hi-comb strip method), microbroth and agar
dilution methods. As ERr is often found linked with TC
r, the test isolates were
also evaluated for acquired TCr. As per the FEEDAP panel report (EFSA,
2005), isolates were categorized as resistant to tetracycline, if the MIC values
reach 32 g/ml for Lb. plantarum, 8 g/ml for other Lactobacillus species, 16
g/ml for Enterococcus species and 4 g/ml for Pediococcus and Leuconostoc
species. Similarly, 4 g/ml of erythromycin concentration is considered as
breakpoint for all the above LAB isolates. Table 4.4.2.1. shows the range of
MIC values obtained for erythromycin and tetracycline using the test LAB
strains. These results are the mean values obtained with microbroth, agar
dilution and disc diffusion methods.
According to the FEEDAP panel criterion, erythromycin MIC values
(MIC range from 8-16 g/ml) obtained for Pediococcus, Leuconostoc,
Lactobacillus and Enterococcus isolated from the naturally fermented foods
indicated intermediate resistance. However, two En. faecium strains isolated
from idli batter displayed higher MIC values (256 g/ml). The MIC values of
erythromycin and tetracycline for Lactobacillus species such as Lb. salivarius
and Lb. reuteri isolated from fermented dry sausages exhibited a higher degree
of resistance to both the antibiotics.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 131
Table 4.4.2.1. The range of MIC’s among LAB isolates for erythromycin and tetracycline
Source Species
Total
number
of isolates
Erythromycin Tetracycline
MIC values
(μg/ml)
Breakpoints (μg/ml) MIC values
(μg/ml)
Breakpoints (μg/ml)
CLSI
(2007)
EFSA
(2008)
CLSI
(2007)
EFSA
(2008)
Fermented dry
sausage
Lb. salivariusa
3 64-256 ≥1 --- 256 ≥1 ---
Lb. reuteria 2 256-512 ≥1 1 256- >512 ≥1 1
Dairy products, raw
milk and traditional
foods
Lb. fermentuma
4 8-32 ≥1 1 8-64 ≥1 1
Lb. plantaruma
1 32 ≥1 1 128 ≥1 1
En. faecium
b
9 8-256 ≥8 4 16-512 ≥8 4
En. durans
b
22 16-32 ≥8 4 16-32 ≥8 4
En. lactis
b
2 32 ≥8 4 16 ≥8 4
En. casseliflavus
b
1 32 ≥8 4 8 ≥8 4
P. pentosaceus
a
15 8-32 ≥1 1 8-128 ≥1 1
Leu. mesenteroides
a
1 32 ≥1 1 8 ≥1 1
a-Erythromycin and tetracycline resistance Breakpoints defined by CLSI (2007) for Streptococcus b-Erythromycin and tetracycline resistance Breakpoints defined by CLSI (2007) for Enterococcus
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 132
Among the 15 P. pentosaceus strains analyzed for ERr, 5 isolates showed
an MIC of 8 g/ml, while values of 16-32 g/ml were observed among the
remaining 10 isolates. For tetracycline, variation in their susceptibility was
observed wherein 7 strains exhibited an MIC of 128 g/ml, 6 with 64 g/ml and
two strains were found to be sensitive to tetracycline.
4.4.3. Detection of ERr and TC
r genes
With the aim of determining the genetic basis of acquired ERr
and TCr with the
observed phenotypic results, all the selected 60 LAB were subjected to PCR
amplification studies. The PCR results obtained are shown in Table 4.4.3.1 and
4.4.3.2. When all the isolates were analyzed for the presence of erm methylase
genes, a positive amplification of the expected size of nearly 400 bp for erm(B)
was obtained in all the isolates irrespective of the species and the genus except for
3 strains of P. pentosaceus and 2 strains of E. durans strains (Fig 4.4.3.1). No PCR
amplification of the expected size was obtained when analyzed for erm(A) and
erm(T) and erm(C) genes. The sequence of erm(B) gene identified in LAB isolates
also showed maximum identity with erm(B) associated with Tn916, Tn2010 and
Tn5253 like transposons of Streptococcus pneumoniae.
In addition to erm(B), several isolates were tested positive for msr(A) when
PCR was performed with the primer pair 1 and 2 (msrA/B) (Table 4.4.3.1, Fig
4.4.3.2). Interestingly, sequence analysis of the amplified product (399 bp)
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 133
exhibited 99% homology with the msr(C) gene of En. faecium (GenBank
accession no. AF313494.1). A homology of 61.1% was also observed for msr(A)
of Enterococcus species (accession no: DQ068449.1). Multialignment sequence
analysis of msr(A) and msr(C) indicated a high homology for the primer binding
regions (Fig 4.4.3.3) justifying the PCR amplification of msr(C) when msr(A)
gene specific primers (Primer pair 1 and 2) were used. The Lb. reuteri, Lb.
salivarius isolates from fermented dry sausages, Lb. planatrum from ice cream,
and the Leu. mesenteroides from curd did not show any amplification of msr(A).
To investigate the genetic basis of TCr, initial evaluation was performed
using the degenerative primers (DI and DII) for the ribosomal protection proteins
(RPP) encoding genes. Of all the isolates, only five Lactobacillus species such as
1 of Lb. plantarum, 1 of Lb. reuteri, 3 of Lb. salivarius and 1 of En. faecium
exhibited a positive amplification (Fig 4.4.3.4). Performance of PCR with primers
specific for RPP genes such as tet(W), tet(M), tet(O) and tet(S), showed a positive
amplification for tet(W) gene in all the six isolates. Along with tet(W) gene,
tet(M) was found in 3 strains of Lb. salivarius and 1 of En. faecium (Fig 4.4.3.5a
and b). One of Lb. salivarius strain also exhibited a positive amplification for
tet(O) (Fig 4.4.3.5c). None of the isolates were positive for tet(S).
In addition to the RPP genes, the efflux gene tet(L) was detected in the sole
Lb. plantarum (I2) and 1 Lb. salivarius (CH2-2). The two efflux genes tet(L) and
tet(K) were found in combination in 1 Lb. fermentum (C-3) and 6 P. pentosaceus
isolates (Fig 4.4.3.6). Additionally, tet(K) alone was detected in one isolate of P.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 134
Table 4.4.3.1: Distribution of erythromycin resistance genes among LAB isolates of fermented foods
pentosaceus (IB3-3), while tet(L) alone was found in 2 isolates of P. pentosaceus
and 15 isolates of En. durans strains. The sole ERr Leu. mesenteroides isolate
encountered in this study did not carry any of the TCr determinants analyzed.
Similar to erm(B), the BLAST analysis of the tet(M) showed maximum identity
with the transposons such as Tn916, Tn5253 and Tn2010 of pathogenic bacteria
such as Streptococcus parauberis, Staphylococcus aureus and Clostridium difficle.
Erythromycin resistance genes
Source Species
Total
number of
isolates
erm(B)
msr(C)
Fermented dry
sausage
Lb. salivarius
3 3
---
Lb. reuteri 2 2 ---
Dairy products, raw
milk and traditional
foods
Lb. fermentum
4 3
4
Lb. plantarum
1 1 ---
En. faecium
9 8 8
En. durans
22 20 18
En. lactis
2 2 2
En. casseliflavus
1 1 1
P. pentosaceus
15 12 8
Leu. mesenteroides
1 1 ---
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 135
Figure- 4.4.3.1. PCR amplification of erm(B) gene among LAB isolates. M: 10 kb marker,
Lanes 1 and 2: Lb. salivarius, Lanes 3 & 4: Lb. reuteri; Lanes 5-7: Lb. fermentum; Lane 8: Lb.
plantatum; Lanes 9-18: En. durans; Lanes 19-23 En. faecium; Lanes 24 and 25: En. casseliflavus
and En. lactis; Lanes 26-32: P. pentosaceus.
Figure 4.4.3.2. PCR amplification of msr(C) in LAB isolates using msr(A) gene specific
primers. M: 10-Kb marker. Lanes 1-4, En. faecium (Curd and Idli batter isolates); Lanes 5-9, En.
durans; Lanes 10-13, Lb. fermentum; Lanes 14-21, P. pentosaceus; Lanes 22 and 23, Lb.
salivarius and Lb. reuteri respectively.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 136
Figure 4.4.3.3. Multiple sequence alignment of msr(A) and msr(C) gene sequences. The
shaded regions (green) indicate the primer (forward and reverse) binding regions of both the
genes. The sequence alignment was performed using multalin programme.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 137
Table 4.4.3.2: Distribution of tetracycline resistance genes among LAB isolates of fermented foods
Tetracycline resistance genes
Source Species Total number of
isolates tet(W) tet(M) tet(O) tet(K) tet(L)
Fermented dry
sausage
Lb. salivarius
3 3 3 1 --- 1
Lb. reuteri 2 1 --- --- --- ---
Dairy products, raw
milk and traditional
foods
Lb. fermentum
4 --- --- --- 1 1
Lb. plantarum
1 1 --- --- --- 1
En. faecium
9 1 1 --- --- 1
En. durans
22 --- --- --- --- 15
En. lactis
2 --- --- --- --- ---
En. casseliflavus
1 --- --- --- --- ---
P. pentosaceus
15 --- --- 7 8
Leu. mesenteroides
1 --- --- --- --- ---
-----: Not detected;
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 138
Figure- 4.4.3.4. Genotypic detection of tetracycline resistance using degenerative primers
of RPP encoding genes. M: 10 kb Marker, Lane 1: Lb. salivarius CHS-1E; Lanes 2-4: En.
durans; Lane 5 & 6: Lb. salivarius CH7-1E and CHS-2E respectively; Lane 7: Lb. reuteri CH2-2,
Lane 8: P. pentosaceus IB4-2B; Lane 9: En. faecium IB6-2B; Lane 10: En. lactis
Figure 4.4.3.5. PCR amplification of RPP genes using gene specific primers. a: tet(M) (1.4
kb), b: tet(W) (0.182 bp), c: tet(O) (1.2 kb). Lane 1: CHS-1E; Lane 2: CH7-1E, Lane 3: CH1-1,
Lane 4: IB6-2B, Lane 5: CH2-2 and Lane 6: I2.
Figure-4.4.3.6. PCR amplification of tetracycline efflux genes. a: tet(K) and b: tet(L). Lane 1-
8: P. pentosaceus (IB3-3, IB4-2A, IB4-2B, IB4-5, IB6-2A, 3, 4 and 8), Lane 9: Lb. fermentum
(C-1), Lane 10: Lb. plantarum (I2).
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 139
4.4.4. Dot-blot analysis of msr(C) gene in LAB
The representative LAB isolates that were positive for msr(C) gene through PCR
were subjected to dot-blot analysis using the probe of msr(C) gene. As shown in
Fig 4.4.4.1, all the En. durans were found to be positive. However, negative or a
weak signal was observed among few En. faecium and P. pentosaceus isolates that
were found positive with PCR analysis. Among the Lactobacillus cultures, only
Lb. fermentum that were isolated from raw milk were found positive. None of
those obtained from fermented dry sausage gave a positive signal and these results
were consistent with that of the PCR analysis.
Figure 4.4.4.1. Dot-blot analysis of ERr LAB using msr(C) gene probe. Isolates 1-4: P.
pentosaceus; 5-13: En. durans; 14-16: En. faecium; 17 and 18: Lb. fermentum.
4.4.5. Clindamycin resistance phenotype of LAB isolates
Apart from the target modification and efflux pumps responsible for resistance to
MLSB antibiotics, enzymatic inactivation mechanism can be specific to one
particular group or an individual antibiotic. Likewise lnu(B) confers antibiotic
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 140
inactivation mediated resistance to lincosamide and clindamycin. Thus in order to
understand the clindamycin resistance observed among several isolates with
diverse phenotypes, the antibiotic inactivation test was performed using
clindamycin sensitive M. luteus ATCC 9341. Among the Lactobacillus cultures
that displayed cMLSB phenotype, one Lb. salivarius isolate (CHS-2E) was found
positive with clover leaf formation. As shown in Fig 4.4.5.1A, the clindamycin
sensitive M. luteus was found growing around the streaked culture displaying the
clindamycin inactivation ability of the isolate. Similar results were also obtained
with cMLSB phenotypic strain En. faecium IB6-2B. All the other LAB isolates
were found negative. Similar results were also obtained with the overlay test
wherein the clindamycin sensitive M. luteus ATCC 9341 was found growing
around the cultures; CHS-2E (Fig 4.4.5.1.B) and IB6-2B (Fig 4.4.5.1. C) that were
streaked on BHI agar supplemented with clindamycin.
4.4.6. Genotypic detection of clindamycin resistance
To identify the cause of clindamycin resistance that was observed with the
phenotypic test, all the isolates were screened for the presence of lnu(B) gene. The
two isolates that were detected positive with the phenotypic clindamycin
inactivation gave an expected amplicon of 944 bp (Fig 4.4.6.1). The sequencing
analysis of the obtained PCR product had 99% similarity with that of the
lincosamide nucleotidyltransferase encoding gene lnu(B) detected among several
pathogens.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 141
Figure 4.4.5.1. Clindamycin inactivation test: A: Clover leaf test (Modified Hodge test). B &
C: Overlay test with Lactobacillus and Enterococcus test cultures respectively.
Figure-4.4.6.1. PCR analysis of clindamycin inactivating lnu(B) gene. M: 10 kb marker, lane
1: En. faecium IB6-2B and lane 2: Lb. salivarius CHS-2E.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 142
4.5. Discussion
The clinical implications of a positive D zone test commence with the cross
resistance among three antibiotic families (macrolides, lincosamides and type B
streptogramins) that share a common target (Woods, 2009). In the present
investigation, the findings indicated diverse MLS phenotypes among fermented
food isolates of LAB. Among the test isolates, cMLSB phenotypes were clearly
distinguishable from other phenotypes. This phenotype was also substantiated with
the positive erm(B) PCR results.
Among the enterococci and P. pentosaceus isolates considered in the
present study, majority of the cultures displayed L phenotype showing resistance
to clindamycin and intermediate resistance to erythromycin. The presence of
functional erm(B) would result in either cMLSB or iMLSB phenotype. However,
the observations made with these isolates indicated the reduced translation of
erm(B) gene which results with mutations in the Shine-Dalgarno sequences
(Srinivasan et al., 2011). Thus, this L phenotype observed among these
enterococcal isolates is independent of erm(B) gene.
Another unique phenotype we observed was the erythromycin induced
clindamycin sensitivity resembling the keyhole phenotype recently detected
among clinical isolates of Str. agalactiae (Srinivasan et al., 2011). In order to
determine the clindamycin resistance observed among the keyhole and L
phenotype isolates, the clindamycin inactivation test was performed along with
cMLSB isolates. However, none of the isolates with either L or keyhole phenotype
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 143
were positive. Instead, two isolates such as En. durans strain IB6-2B and Lb.
salivarius CHS-2E with cMLSB phenotype inactivated clindamycin and this
resistance was confirmed with the detection of lnu(B) gene. Srinivasan et al.
(2011) observed keyhole phenotype among isolates that were either erm(B) and/or
lnu(B) positive or negative. It was postulated that this phenotype could be due to
erm(B) or lnu(B) variants. This statement could be only partially agreed as we
could not observe any clindamycin inactivation among the isolates with keyhole
phenotype. However, molecular studies are further required to elucidate the
mechanism involved for such resistance phenotypes. Although implications of the
keyhole phenotype in LAB isolates are unknown, it is possible that clinically
important enterococcal isolates can respond to erythromycin and clindamycin
combination therapy.
In an attempt to determine cross resistance among the MLS antibiotics,
multiple disc diffusion tests were performed with MLS antibiotics. Interestingly,
we could detect an unusual pristinamycin inducible clindamycin resistance in
iMLSB En. durans strain IB8-3. This phenotype was similar to that observed with
erythromycin and clindamycin. Such type of induction has never been observed
between lincosamides and streptogramin antibiotics. In general, only 14- and 15-
membered macrolides are effective as inducers (Leclercq and Courvalin, 1991).
The specificity of induction is thought to be related to the mode of action of the
various macrolides. However, induction of erm(C) gene through non inducing
macrolides such as ketolides has been described (Bailey et al., 2008). Such
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 144
induction changes have also been reported in mutants of Staphylococcus aureus
where lincosamides could act as inducers indicating that resistance by ribosomal
methylation is crossed among MLS antibiotics. Such inducible resistance is
common among those isolates carrying erm genes. These observations illustrate
the considerable and apparently increasing complexity of resistance demonstration
among this group of antibiotics.
It is often the case, that erm(B) is found associated with mobile genetic
elements due to which it is found in multiple genera (Roberts 2008). The erm(B)
gene identified in LAB isolates of this study also showed maximum identity with
erm(B) associated with, Tn916, Tn2010 and Tn5253 like transposons of
Streptococcus pneumoniae. LAB are usually susceptible to macrolide group of
antibiotics (Ammor et al., 2007). However, the understanding of resistance to
these antibiotics in LAB comes with the detection of erm(B) in P. acidilactici
(Rojo-Bezares et al., 2006; Danielsen et al., 2007) and lactobacilli (Egervarn et al.,
2009, Devirgiliis et al., 2010, Toomey et al., 2010). In the recent time, a lot of
attention has been drawn to enterococci as reservoirs as they readily develop
antibiotic resistance in response to selective pressure (Wilcks et al., 2005).
Although reports are available indicating the presence of erm(B) in enterococci of
clinical origin, little is known for its occurrence in the food isolates of this genus
and also the industrially important species, P. pentosaceus. In the present
investigation, we have identified erm(B) in different species of Enterococcus and
several strains of P. pentosaceus isolated from the naturally fermented cereals and
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 145
dairy products. Probably, this is the first study to report the presence of erm(B)
gene in P. pentosaceus. These observations indicated that LAB acquired erm(B)
gene associated with either of the above mentioned transposons from other
pathogenic bacteria.
The msr(C) gene detected in En. faecium (Portillo et al. 2000; Hummel et
al., 2007b; Liu et al., 2009) has been reported to be an indigenous gene of this
species alone (Portillo et al., 2000). On the contrary, Werner et al. (2001) did not
detect msr(C) gene in all tested En. faecium cultures. The investigation
demonstrated the presence of msr(C) gene in LAB species viz. En. durans, En.
lactis, and En. casseliflavus, P. pentosaceus and Lb. fermentum. It should be
pointed out that this is the first report indicating the prevalence of msr(C) gene in
LAB other than En. faecium. The presence of msr(C) in different species of LAB
might represent a gene that has been acquired horizontally. However, sequencing
the regions surrounding the msr(C) gene is required to reveal the presence of
elements suggesting horizontal movement of this gene. As we could not
authenticate the presence of either msr(C) or msr(A) with the obtained PCR
amplicon, different sets of primers specific for msr(C) and msr(A) (Primer pair 3
and 4) were used where the resulting products differ in their amplicon size. None
of the isolates were positive for msr(A) indicating the prevalence of msr(C) in
LAB isolated from naturally fermented foods, dairy products and raw milk.
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 146
Despite the presence of erm(B) and msr(C) genes in several LAB isolates
from dairy products and cereal based foods, the MIC for erythromycin was low
and displayed diverse phenotypes. However, 1 En. faecium strain with iMLSB
phenotype showed high MIC value of 256 μg/ml. Such variation was also
observed in methylase encoding genes in Mycoplasma spp where the level of
expression dropped when cultivated in absence of erythromycin. However, a
second group of cells carrying homogenous MLS resistance expressed stable
resistance when grown in absence of erythromycin (Wiesblum, 1995a). Previous
studies have also shown that Enterococcus isolates carrying msr(C) displayed low
level resistance to erythromycin (Portillo et al., 2000). However, this was disputed
by disruption of msr(C) gene that resulted in two to eight fold increase in the
susceptibility to erythromycin (Singh et al., 2001). Hence, systematic studies need
to be conducted to reveal the appropriate role of msr(C) gene in exerting antibiotic
resistance in LAB and inducible resistance of erm(B) gene in all these isolates. On
the other hand, Lactobacillus cultures isolated from fermented dry sausages
harboring only erm(B) were highly resistant to erythromycin. These isolates
displayed cMLSB phenotype that results due to mutation in the leader peptide of
erm genes rendering continuous expression of these genes. Such resistant mutants
are selected with either tylosin, lincomycin or carbomycin that are used as growth
promoters in animal husbandry and poultry (Weibslum, 1995b). These resistant
bacteria present in the intestines of such farm animals subsequently contaminate
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 147
the meat products even when hygiene regulations are respected (Gevers et al.,
2003c).
The genetic basis of TCr in these isolates was investigated for the common
tet genes viz. tet(W), tet(M), tet(O) tet(S) tet(K) and tet(L). The resistance levels
conferred by these TCr genes varied among the LAB isolates. The three L.
salivarius strains carrying tet(W), tet(M), tet(O) and tet(L) and L. plantarum (I2)
harboring tet(W) and tet(L) displayed MIC value of 256 and 128 μg/ml
respectively. Similarly in case of Lb. reuteri (CH2-2) and En. faecium (IB6-2b)
harboring tet(W) and tet(L), tet(M), and tet(W), respectively, MIC values of 512
μg/ml was observed. However, reduced level of resistance was observed in En.
durans and P. pentosaceus isolates harboring only tet(L) gene which could be due
to its [tet(L)] low expression levels. Similar observations were made in previous
studies in Lb. sakei Rits 9, where the expression levels of tet(L) was low compared
to tet(M) but elevated in presence of low concentrations of tetracycline (Ammor et
al., 2008b). Thus, it appears that RPP genes confer high level TCr compared to
efflux genes as observed in Lactobacillus species harboring tet(W) and tet(M)
genes (Gevers et al., 2003a,b, Egervarn et al., 2009). However, in contrast,
Bifidobacterium species isolated from dairy products and humans harboring
tet(W) displayed low level of resistance to tetracycline (Florez et al., 2006,
Gueimonde et al., 2010). Similarly, among the 3 Streptococcus suis isolates
carrying tet(M), tet(O) and tet(L) genes, only one strain showed MIC of 256 μg/ml
while the other 2 strains had MIC values of 64 μg/ml (Hoa et al., 2011). These
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 148
observations indicated that simultaneous expression of RPP and efflux genes in
LAB results in higher level resistance to tetracycline. Difference in resistance
pattern was also observed among the isolates carrying tet(K) and tet(L) where the
isolates carrying the both tet(K) and tet(L) or tet(K) alone showed higher
resistance to tetracycline compared to those carrying tet(L) alone. Thus expression
studies are essential to elucidate the tolerance levels of all these genes to relate
with different levels of resistance to tetracycline they confer.
The tet(W) gene which is common in human and animal intestinal bacteria
was found to be less widely distributed in lactobacilli and so far only been
reported in Lb. crispatus, Lb. johnsonii, Lb. paracasei and Lb. reuteri (Egervarn et
al., 2009). The present investigation reports for the first time its [tet(W)]
prevalence in Lb. plantarum (I2) and Lb. salivarius (CH7-1E) along with tet(O).
TCr in Pediococcus spp such as P. acidilactici and P. pentosaceues have been
reported previously (Swenson et al., 1990; Tankoic et al., 1993; Danielsen et al.,
2007; Klare et al., 2007). Although, these reports illustrated higher resistance to
tetracycline, no tet genes were detected through PCR analysis. Hence, TCr in this
genus was thought to be an intrinsic characteristic (Danielsen et al., 2007).
However, tet(L) was detected in one P. parvulus strain isolated from wine (Rojo-
Bezares et al., 2006). The present study reports the membrane associated proteins
encoding efflux genes, tet(K) and tet(L) rendering resistance to tetracycline in P.
pentosaceus. The detection of tet genes in this species is a novel finding. Recent
studies on TCr in food isolates of Enterococcus have reported tet(L) to be
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 149
predominant followed by tet(M) and tet(K) in En. faecium and En. faecalis
(Wilcks et al., 2005; Hummel et al., 2007b) and tet(M) in En. durans (Huys et al.,
2004). Similarly in our study, tet(L) was the frequently found TCr gene among the
Enterococcus species. The frequency of RPP genes in these isolates was low with
tet(M) detected only in one En. faecium strain. This difference in the occurrence of
tet genes in enterococci can be more clearly explained taking into consideration a
large number of isolates and from different sources. The simultaneous occurrence
of tet genes such as tet(M)/ tet(W)/ tet(O)/ tet(L) in Lb. salivarius, tet(K)/ tet(L) in
P. pentosaceus, and tet(M)/ tet(L) in Lb. plantarum are in agreement with the
previous reports of Gram-positive bacteria containing multiple tet genes that either
have the same or different modes of action (Chopra and Roberts, 2001).
4.6. Conclusion
The present study illustrated that several acquired genes encoding for tetracycline
and ERr are found among LAB isolated from various foods especially the naturally
fermented foods (Idli and Dosa batter). The diverse MLSB phenotypes observed
among LAB indicate the prevalence of novel ERr or mutations in the existing
genes. The prevalence of TCr genes in several of these ER
r isolates demonstrated
that resistance genes encoding to both antibiotics (erythromycin and tetracycline)
are linked. The erm(B) and RPP genes isolated in LAB showed high homology
with those associated with different transposons. These observations indicated that
Chapter 4 Phenotype and genotype of ER and TC resistance
Surya Chandra Rao, T 150
LAB has acquired the transposons that carried the resistance genes. The detection
of lnu(B) in food isolates of LAB indicated the prevalence of lincosamide
resistance genes in addition to ERr and TC
r genes. Further, the overlay assay
performed in this study can be employed for detecting the inactivation mechanism
among ART bacteria. In recent years, the question of antibiotic resistance in non-
pathogenic bacteria has been contemplated by the Scientific Panel on Additives
and Products or substances used in the Animal Feed (FEEDAP) of the European
Commission. In order to reduce the development of resistance, selective criteria
should also be applied to bacteria in human food, especially in case of starter
cultures where attempts are being made to promote them as probiotics. The results
of this study underline the prevalence of acquired ERr and TC
r genes in species
belonging to Lactobacillus, Pediococcus, Enterococcus and Leuconostoc. Thus, a
due selection and screening process have to be followed before using
environmental LAB strains as a new starter cultures or probiotic strains.