Upload
others
View
18
Download
0
Embed Size (px)
Citation preview
16
CHAPTER 3
MATERIALS AND METHODS
3.1 CHEMICALS AND GLASSWARE
Analytical grade chemicals (Hi-media and Merck) and Borosil
brand glassware items were used throughout the study.
3.2 CLEANING SOLUTION FOR GLASSWARE
Potassium dichromate - 80.0 g
Distilled water - 300.0 ml
Concentrated sulphuric acid - 400.0 ml
The glassware items were first cleaned with detergent, and then
immersed in the cleaning solution for 12 hrs, washed thoroughly in tap water,
rinsed with distilled water and subsequently dried in an hot air oven were
used throughout the work.
3.3 STERILIZATION
Media and glassware other than petriplates were sterilized in an
autoclave at 15 psi for 20 min. Petriplates were sterilized at 160ºC in hot air
oven overnight. The thermo labile compounds were filter sterilized with a
sintered membrane glass filter (G5 grade) using nylon membrane with 20-40
µm pore size.
17
3.4 MEDIA
3.4.1 Potato Dextrose Agar (PDA)
Peeled potato - 0200.0 g
Dextrose - 0020.0 g
Agar - 0020.0 g
Distilled water - 1000.0 ml
Peeled potato was chopped into thin slices, boiled in 500 ml of
water for 30 min. and the extract was filtered through a strainer. To the
extract, dextrose was added. Agar was melted in the other half of water,
mixed with the extract and the final volume was made up to 1000 ml before
sterilization.
3.4.2 Potato Dextrose Broth (PDB)
PDB was prepared as explained above by avoiding agar.
3.4.3 Potato Sucrose Agar (PSA)
PSA was prepared by adding 20 g of sucrose instead of dextrose in
PDA medium.
3.4.4 Saubroud Dextrose Agar (SDA)
Glucose - 0020.0 g
Neopeptone - 0010.0 g
Agar - 0015.0 g
Distilled water - 1000.0 ml
pH - 6.8-7.0
18
3.4.5 Water agar (WA)
Agar - 0020.0 g
Distilled water - 1000.0 ml
3.4.6 Malt Extract Agar (MEA)
Malt extract - 0025.0 g
Agar - 0020.0 g
Distilled water - 1000.0 ml
3.4.7 Yeast Extract Agar (YEA)
Yeast extract - 0010.0 g
Dextrose - 0010.0 g
Agar - 0015.0 g
Distilled water - 1000.0 ml
3.4.8 Czapek’s Dox Agar (CDA)
Sucrose - 0030.00 g
Sodium nitrate - 0002.00 g
Di-potassium phosphate - 0001.00 g
Magnesium sulphate - 0000.50 g
Potassium sulphate - 0000.50 g
Ferrous sulphate - 0000.01 g
Agar - 0020.00 g
Distilled water - 1000.00 ml
19
3.4.9 Czapek’s Dox Broth (CDB)
CDB was prepared as explained above avoiding agar.
3.4.10 Corn Meal Agar (CMA)
Corn meal - 0020.0 g
Dextrose - 0020.0 g
Agar - 0020.0 g
Distilled water - 1000.0 ml
Corn meal was boiled in half quantity of water for an hour and
filtered through muslin cloth. Dextrose was mixed with the extract. Agar
was melted in other half of water and both were mixed and made up to
1000 ml.
3.4.11 Oat Meal Agar (OMA)
Oats - 0100.0 g
Agar - 0015.0 g
Distilled water - 1000.0 ml
3.4.12 Trichoderma Selective Medium (TSM) (Elad and Chet 1983)
Magnesium sulphate - 0.200 g
Di-potassium hydrogen phosphate- 0.900 g
Potassium chloride - 0.150 g
Ammonium nitrate - 1.000 g
*Chloramphenicol - 0.250 g
20
*Dexon - 0.300 g
*Terractor - 0.200 g
(pentachloro nitrobenzene)
*Benomyl - 0.002 g
*Captan - 0.020 g
Dextrose - 3.000 g
Rose Bengal - 0.150 g
Agar - 20.00 g
Distilled water - 1000 ml
*Added aseptically to the sterilized medium prior to use.
3.4.13 Tea Leaf Extract Agar (Onsando 1992)
Two hundred grams of fresh tea leaf of 2 year old UPASI-3 clone
were macerated in 300 ml of 95% ethanol containing 50 mg potassium
metabisulphate, to stop conversion of catechins to theaflavins and
thearubigins. The leaves were macerated by using a blender for 10 min. at
ambient temperature and were filtered under suction. The filtrate was
evaporated to about 200 ml at 40ºC in a rotary evaporator. The extract was
shaken with 150 ml of ethyl acetate in a separating funnel and the ethyl
acetate layer was concentrated to 10 ml in a rotary evaporator. The
concentrate was then washed with 50 ml of distilled water, evaporated to
dryness and stored in a freezer. Ten grams of leaf powder was dissolved in
1000 ml of distilled water to which 20 g sucrose and 20 g agar were added.
3.4.14 Starch Casein Nitrate Agar (SCNA)
Starch soluble - 1.5000 g
Casein - 0.0450 g
21
Potassium nitrate - 0.3000 g
Sodium chloride - 0.3000 g
Magnesium sulphate heptahydrate - 0.0075 g
Calcium carbonate - 0.0030 g
Ferric sulphate - 0.0015 g
Distilled water - 1000.0 ml
3.4.15 King’s B agar
Peptone - 30.00 g
Di-potassium hydrogen orthophosphate - 02.25 g
Magnesium sulphate heptahydrate - 02.25 g
Glycerol - 5.000 ml
Agar - 15.00 g
Distilled water - 1000 ml
3.4.16 Carrot Extract Agar (CEA)
Carrot - 0400.0 g
Agar - 0020.0 g
Distilled water - 1000.0 ml
Carrot was chopped into thin slices, boiled in 500 ml of water for 30
min. and the extract was filtered through a strainer. Agar was melted in the
other half of water, mixed with the extract and the final volume was made up
to 1000 ml before sterilization.
22
3.4.17 Carrot Extract Broth (CEB)
CEB was prepared as explained above by avoiding agar.
3.4.18 Nutrient Agar (NA)
Peptic digest of animal tissue - 5.000 g
Sodium chloride - 5.000 g
Beef extract - 1.500 g
Yeast extract - 1.500 g
Agar - 15.00 g
3.5 STAIN
3.5.1 Lacto phenol cotton blue
Cotton blue (1% aqueous solution) - 002.00 g
Phenol crystals - 020.00 g
Lactic acid - 020.00 g
Glycerin - 040.00 g
Distilled water - 1000.0 ml
3.6 SURVEY OF BIRD’S EYE SPOT DISEASE
A survey was conducted in different districts of southern Indian tea
plantations to study the incidence of bird’s eye spot disease and clonal
susceptibility. The occurrence of the disease incidence was recorded directly
on the bush canopy using a quadrate method as described by Sanjay et al
(2008). A wooden frame of 30 x 30 cm size was placed over the plucking
table at random sites. Number of infected and uninfected intact leaves, cut
23
leaves, bare stalks, and young shoots in 30 cm2 areas was counted and the
percentages were individually calculated. Percent disease incidence (PDI) was
calculated using the formula PDI = (IL+CL+BS+YS)/4, where, IL = disease
incidence on intact leaves; CL = disease on cut leaves; BS = disease on bare
stalk; and YS = disease on young shoot (all on percentage basis).
A total of 13344 ha were covered during the survey in which 38
clones and seedlings were subjected to estimate individual clonal
susceptibility to C. theae infection. The fields were divided into sectors of
1000 bushes and 100 bushes were assessed from each sector. Since there was
a wide variation in the PDI in different planting districts, the susceptibility of
the clones/jats were classified based on the rating given in the Table 3.1.
Table 3.1 Susceptibility rating of the clones/jats in various planting
districts of southern India
PDI Planting districts of
southern India Low Moderate High
Anamallais, High Range
Chikmagalur, Nilgiris, Nilgiri –
Wynaad, Central Travancore
and Wynaad
< 30 30 - 60 > 60
3.7 PATHOGEN: ISOLATION AND VIRULENCE ANALYSIS
3.7.1 Isolation
The pathogen, Cercospora theae Petch was isolated from bird’s eye
spot disease affected tea leaves collected from different agro-climatic zones of
southern India. Diseased specimens were surface sterilized with 0.1%
24
mercuric chloride and infected portions were cut carefully under aseptic
condition and subsequently inoculated onto PDA medium. Actively growing
mycelial tips of the fungus were transferred to PDA medium and purified by
repeated sub-culturing and finally transferred to PDA slants. Three isolates of
the pathogen designated as KC10, MC24 and VC38 were used for the
laboratory experiments. The cultures were further identified as C. theae with
the scientist of UPASI Tea Research Institute, Valparai, Tamil Nadu, India.
All the experimental studies were carried out in triplicates and mean value
were recorded throughout the study.
3.7.2 Virulence analysis
Pathogenicity of the isolates was confirmed through Koch’s
postulates. Two year old potted plants of susceptible clone (UPASI-9) were
inoculated with the pathogen mycelium after making wounds in the leaf
portion with a sterile scalpel. Mycelial discs were kept on the wound portion,
sprinkled with sterile water, covered with moist cotton and wrapped with
polythene sheet. The plants were kept in a greenhouse at UPASI Tea
Research Institute, Valparai, to develop the disease.
3.8 MORPHOLOGY OF THE PATHOGEN
3.8.1 Culture characteristics
The growth of C. theae isolates were studied both in solid (PDA and
CEA) and liquid (PDB and CEB) media. Linear growth of the pathogen and
colony morphology were recorded in solid culture medium. In liquid culture,
mycelial mats were harvested at different time intervals, dried in an oven at
80ºC overnight and the mycelial dry weight was recorded. Conidial
production of C. theae isolates were induced by slide culture method
(Aneja 2003). The cover slip containing distinct mycelium and conidia was
25
stained with lactophenol cotton blue to study its morphology. Conidial
features like its shape, size and septate nature were observed with the help of
a Leica photomicroscope (Germany) fitted with an ocular meter.
3.8.2 Life cycle of the pathogen
Life cycle of the pathogen was studied in vitro using fresh tea leaves
of susceptible UPASI 9 clone. The detached healthy leaves were taken in a
conical flask containing moist cotton and were sterilized twice in alternate
days. The sterilized leaves were then wounded with the help of a fine sterile
needle and the spore suspension was sprayed over the wounded ventral
surface of the leaves using a sterilized glass atomizer. The inoculated flasks
were incubated at room temperature (25±2°C) with sufficient moisture
provided in the wet cotton. Various parameters like time taken to cover the
entire leaf and number of perithecia per leaf were observed periodically.
3.9 PHYSIOLOGY AND BIOCHEMISTRY OF THE PATHOGEN
Physiology of the pathogen was studied in vitro with reference to
the abiotic factors and nutritional requirements of the pathogen, while the
biochemical aspects were studied in terms of estimating cellular constituents
in the mycelium.
3.9.1 Physiology of the pathogen
3.9.1.1 Effect of various abiotic factors on the growth of Cercospora theae
Influence of different abiotic factors such as pH (4.0 to 6.5),
temperature regimes (15 to 35ºC) and light spectra (UV light, White
fluorescent, dark, diffused day light under room condition and direct sun
light) on the growth of C. theae were studied for all the three isolates at
suitable in vitro conditions in both solid and liquid media at specific intervals.
26
3.9.1.2 Nutritional requirement of Cercospora theae
Influence of various nutrients like different media, organic and
inorganic compounds were studied over the growth of C. theae. Media
classified under natural, semi-synthetic and synthetic media were employed
for the study. Effect of inorganic elements such as carbon and nitrogen and
organic compounds such as amino acids and vitamins were studied by
replacing them in the basal medium with various sources. The basal medium
used was CDB/CDA.
3.9.1.2.1 Different natural, semi synthetic and synthetic media
The pathogen was subjected to nine different media namely, tea leaf
extract agar, water agar and oat meal agar (natural), carrot extract agar, potato
sucrose agar, potato dextrose agar and corn meal agar (semi synthetic) and
saubroud dextrose agar and yeast extract agar (synthetic media) were
incubated for 12 days and the linear growth of the pathogen was measured at
different time intervals.
3.9.1.2.2 Carbon and nitrogen sources
Seven different carbon compounds viz., glucose and fructose
(monosaccharide), maltose and sucrose (oligosaccharides) and carboxy
methyl cellulose (CMC), pectin and starch (polysaccharides) and seven
different nitrogenous compounds viz., ammonium nitrate and di-ammonium
sulphate (ammoniacal nitrogen), sodium nitrate and potassium nitrate
(inorganic nitrogen) and yeast extract, casein hydrolysate and urea (organic
nitrogen) were used under this study. Mycelial dry weight was recorded at
various incubation periods.
27
3.9.1.2.3 Amino acids
Alanine (simple amino acids), serine (hydroxyl amino acid),
methionine (sulphur containing amino acid), aspartic acid and glutamic acid
(acidic group), asparagines (amides), arginine (basic group) and proline
(heterocyclic amino acid) were selected for the study. Stock solutions were
prepared and required quantities of the solution were added to the medium so
as to get the final concentration of 100 ppm. Amino acid free medium served
as the control. The fungal mycelial mats were harvested on 12th day and the
dry weight was recorded.
3.9.1.2.4 Vitamins
Thiamine (B1), riboflavin (B2), pantothenic acid (B3), nicotinic acid
(B5), biotin (B7), folic acid (B9) and ascorbic acid (C) were used for the study.
Stock solutions of the vitamins were filter sterilized and incorporated into the
medium so as to get 100 ppm in the medium. Vitamin free medium served as
the control. Dry weight was recorded by harvesting fungal mats.
3.9.2 Biochemistry of the pathogen and the host
3.9.2.1 Estimation of organic compounds
Various organic compounds in the pathogen as well as healthy and
infected tea leaves were estimated following standard procedures and
expressed on dry matter basis.
3.9.2.1.1 Preparation of ethanol extract (Mahadevan and Sridhar 1996)
One g fresh weight of the fungal mycelium/plant material (leaf
tissue) was ground with 5 ml of hot 80% ethanol. The homogenate was
centrifuged at 5,000 rpm for 20 min. the supernatant was evaporated to
28
dryness over a boiling water bath and the residue was made up to 100 ml with
distilled water.
3.9.2.1.2 Estimation of chlorophyll and carotenoids (Harborne 1993)
Healthy and infected leaves (500 mg) were ground separately with
80% aqueous acetone using a chilled pestle and mortar. The aqueous layer
was transferred to a clean test tube. The process was repeated until the residue
turned into pale white. The acetone layer with chlorophyll and carotenoid
contents was made up to known volume and these contents were determined
using a UV-VIS spectrophotometer (Hitachi, Japan) at 662 and 645 nm for
chlorophyll and 470 nm carotenoids estimation.
3.9.2.1.3 Estimation of total sugars (Dubois et al 1956)
One ml of the culture filtrate/ethanol extract was mixed with 1 ml of
5% phenol in water (w/v). Five ml of concentrated sulphuric acid was added
to it rapidly and allowed to stand for 10 min. followed by placing in a water
bath for 20 min. at 30ºC. The characteristics yellow orange colour was
measured at 490 nm in a spectrophotometer. Reagents without culture filtrate
served as blank. The amount of sugar was determined with reference to
glucose as standard.
3.9.2.1.4 Estimation of reducing sugar (Miller 1959)
Equal volume of culture filtrate/ethanol extract and dinitrosalicylic
acid reagent (DNS-1000 mg, phenol crystals- 200 mg, sodium sulfite- 50 mg
and 1% sodium hydroxide in 100 ml) was taken and boiled in a water bath for
15 min. and then amended with 1 ml of 40% Rochelle salt (sodium potassium
tartarate), when it was warm. The solution was cooled under running tap
water and the absorbance was read at 575 nm.
29
3.9.2.1.5 Estimation of non-reducing sugar (Mahadevan and Sridhar 1996)
One ml of culture filtrate/ethanol extract was taken and evaporated
to dryness on a water bath. To this, one ml of distilled water and NH2SO4
were added and the mixture was hydrolyzed by heating at 49ºC in a water
bath for 30 min. The reducing sugar present in the hydrolysate was estimated
by measuring the absorbance at 575 nm.
3.9.2.1.6 Estimation of total nitrogen (AOAC 1990)
One ml of culture filtrate/ one g of powdered leaf were taken with 3
ml of salicylic acid (3.2%) in concentrated sulphuric acid and a pinch of
sodium thiosulphate was added. Digestion was carried out on a hot plate after
adding 5 ml of hydrogen peroxide till it become colourless. The contents were
neutralized with 5% sodium hydroxide and 10% sodium potassium tartarate
and Nessler’s reagent. The solution was measured at 420 nm using
ammonium sulphate as a standard.
3.9.2.1.7 Estimation of total amino acids (Moore and Stein 1948)
Equal volume of culture filtrate/ethanol extract and ninhydrin
reagent (100 mg of stannous chloride was dissolved in 500 ml of 0.2 M citrate
buffer (pH 5.0) and this solution was added to 20 g of ninhydrin in 500 ml of
methyl cellosolve) was added and mixed thoroughly followed by heating for
20 min. in a boiling water bath. Five ml of the diluents (n-propanol and
distilled water, 1:1 v/v) was added to the mixture and cooled in running tap
water. The purple colour solution was read at 560 nm. Ethanol (80%) served
as the reagent blank and glycine as the standard.
30
3.9.2.1.8 Estimation of protein (Lowry et al 1951)
One g fresh weight of the fungal tissue/one ml of ethanol
extract/culture filtrate were ground and mixed in 5 ml of 0.1 M phosphate
buffer (pH 7.0). The homogenate was centrifuged at 15,000 rpm for 20 min.
(Protein precipitate solution was prepared by mixing of 2 g of sodium
carbonate, 400 mg of sodium hydroxide and 100 ml of distilled water.
Solution B was prepared by mixing solution A with 100 mg of sodium
potassium tartarate, 500mg of copper sulphate and 100ml of distilled water).
One ml each of the sample, 10% trichloroacetic acid, 0.1 N NaOH
was mixed with 5 ml of protein precipitate solution. They were shaken well
and incubated for 10 min. at room temperature. Then 0.5 ml of Folin phenol
reagent was added and kept for 30 min. for colour development. OD was read
at 650 nm against a reagent blank and the amount of protein was calculated
from the standard curve prepared using 50-500 µg concentration of bovine
serum albumin.
3.9.2.1.9 Estimation of total lipids (Folch et al 1957)
Total lipids were estimated gravimetrically. Five grams of chopped
leaves/fungal tissue were homogenized in chloroform: methanol mixture
(2:1 v/v) using homogenizer. Twenty volumes (w/v) of the solvent mixture
were added to the homogenate in a separating funnel and 0.2 ml of 0.88%
sodium chloride solution were added. The mixture was left undisturbed
overnight to separate the phases. The lower phase containing lipid in
chloroform was collected and weighed.
3.9.2.1.10 Estimation of total polyphenols (Bray and Thorpe 1954)
One ml of Folin-ciocalteu reagent (1:1 dilution) was added to 1 ml
of the ethanol extract followed by 2 ml of 20% Na2CO3 and the mixture was
31
heated in a boiling water bath for 1 min. The blue colour developed was
diluted to 25 ml with distilled water and read at 725 nm. Ethanol (80%)
served as the reagent blank and catechol as the standard.
3.9.2.1.11 Estimation of total catechins (Swain and Hillis 1959)
Two ml of ethanol extract was mixed with 6.5 ml of vanillin reagent
(1 g vanillin was dissolved in 100 ml of 70% v/v sulphuric acid). This mixture
was diluted to 10 ml with distilled water and shaken well in a cold water bath.
Exactly after 15 min., the absorbance of red colour was read at 500 nm
against reagent blank. Standard calibration curve was prepared using known
quantities of catechins.
3.10 ASSAY OF ENZYMES
The enzymes produced by C. theae were assayed in the culture
filtrate, where the carbon and nitrogen sources of the basal medium (CDB)
were replaced by respective substrates. In order to elicit the secretion of
specific enzymes, 2% of carboxy methyl cellulose (CMC), starch, sucrose and
pectin were replaced for inducing CMCase, amylase, invertase and pectinase.
In case of enzyme preparation for protease, sodium nitrate in CDB medium
was replaced with 1% casein. The mycelium was harvested twice using
Whatman No. 1 filtration, the filtrate was subjected to centrifugation at 12000
rpm for 5 min. The supernatant was then filter sterilized using Rivera vacuum
filtration unit (0.2 µm pore filter membrane). The filtered extract was then
used as the respective enzyme source. Reaction mixture with heat-killed
enzyme served as the blank. The enzyme changes in host plants due to
C. theae infection were also studied.
Enzyme activity was measured using micromole release of
sugar/aromatic residues released per min. against glucose/tyrosine as a
32
standard. One unit activity is the amount of enzyme releasing 1 µM of
reducing sugar/aromatic residues from substrate, where 1 Kat is expressed as
6.107 enzyme unit/ml/min.
3.10.1 Carbohydrases
3.10.1.1 CMCase (Zaldivar et al 2001)
The CMCase or � -1-4-endoglucanase activity was assayed for all
the three isolates of C. theae. The reaction mixture containing equal volume
of crude enzyme, 1% solution of CMC in 0.05 M potassium buffer (pH 6.0)
and 0.03% sodium azide was determined for CMCase activity at various time
intervals ranging from 15, 30, 60, 90 and 120 min. Absorbance was read at
540 nm.
3.10.1.2 Amylase and Invertase (Narayanan and Shanmugasundaram 2004).
The enzyme-substrate complex was prepared with the addition of
1M acetate buffer at pH 6 and pH 5 respective to amylase and invertase in the
ratio of 1:1:2. The mixture was incubated at 37�C for 24 hrs. Equal volume of
the reaction mixture and DNS reagent was added to stop the reaction and
absorbance was measured at 540 nm.
3.10.1.3 Pectinase (Neukon 1960)
The reaction mixture containing 4 ml of 1% polygalacturonic acid,
1 ml of 0.01M calcium chloride and 4 ml of crude enzyme was incubated at
50ºC for 4 hrs. The enzyme reaction was stopped and the excess substrate
were precipitated by adding 0.6 ml each of 9% zinc sulphate and 0.5N sodium
hydroxide. Three ml of TBA (0.04 M), 1.5 ml of HCl (1N) and 0.5 ml of
distilled water was added to 5 ml of reaction mixture. The tubes were placed
33
in a boiling water bath for 30 min. and the absorbance was read at 515 nm
using D-Galacturonic acid as the standard.
3.10.2 Protease (Mahadevan and Sridhar 1996)
The enzyme-substrate complex was prepared by adding 0.1M
phosphate buffer (pH 7) in the ratio of 1:2:1. It was incubated in water bath at
40˚C and subsequently 1 ml each of the reaction mixture and 5%
trichloroacetic acid were added. After centrifugation at 2000 rpm for
20 min. equal volume of the supernatant, folin-phenol reagent and 20%
sodium carbonate were taken and absorbance was read at 650 nm.
3.10.3 Preparation of enzyme extract/acetone powder from tea leaves
(Umbreit et al 1972)
The healthy and infected tea leaves of UPASI 9 were collected and
ground (5 g leaf) separately with chilled (25 ml) 0.1 N phosphate buffer. The
leaf extract was filtered using Whatman No. 1 filter paper and centrifuged at
2000 rpm for 30 min. The supernatant was used as the enzyme source.
Similarly acetone powder was prepared by homogenizing five gram leaves in
25 ml of pre-chilled acetone. The homogenate was filtered and the residue
was dried and used for enzyme assays.
3.10.4 Chitinase (Miller 1959)
Colloidal chitin prepared using the methods of Berger and Reynolds
(1958) was used as the substrate. 1% chitin was prepared by dissolving
0.20 g of colloidal chitin in 20 ml of 50 mM acetate buffer (pH 6). The
enzyme-substrate mixture was prepared in the ratio of 10:3 and incubated in
water bath at 40ºC. 2.4 ml aliquots were withdrawn and 1.2 ml of DNS
reagent was added to stop the reaction and measured at 585 nm.
34
3.10.5 DNase
Calf thymus DNA (0.05%) in 0.05 M phosphate buffer (pH 6.5) was
used as substrate. The reaction mixture was added in the ratio of 1:2 along
with 2 ml of 0.2% MgC12. Absorbance was measured by stopping the
reaction with 0.5 ml of 2.5% chilled perchloric acid at 260 nm. DNase activity
was measured by increasing in 1.0 absorbance per hour as one unit.
3.10.6 Extraction of crude enzyme (Neish 1961)
Acetone powder (0.5 g) of each healthy and infected leaves were
suspended in 10 ml of phosphate buffer (pH 7.0) and extracted over night at
4ºC. The extract was centrifuged at 2,500 rpm for 30 min. and the clear
supernatant was used as the enzyme extract.
3.10.7 Oxidative enzymes
3.10.7.1 Polyphenol oxidase (PPO) and Peroxidase activity (PO)
(Gregory and Bendall 1973)
The assay mixture (6 ml) containing 300 µM phosphate buffer
(pH 6.8), 5 µM pyrogallol, 50 µM H2O2, and 1 ml enzyme extract was diluted
to 100 fold. The reaction was allowed to proceed for 5 min. at 25ºC and was
stopped by adding 0.5 ml 5% (v/v) H2SO4. The amount of purpurogallin
formed was determined at 420 nm. One unit of peroxidase or polyphenol
oxidase activity was the amount of purpurogallin formed which increased the
absorbance by 0.1 min.
3.10.7.2 Catalase (Kar and Mishra 1976)
Five milliliters of the assay mixture contained: 300 µM of phosphate
buffer (pH 6.8), 100 µM of H2O2, and 1 ml enzyme extract. After incubation
35
at 25ºC for 1 min., the reaction was stopped by adding 10 ml of 2%
(w/v) H2SO4 and the residual H2O2 was titrated against 0.01N KMnO4 until a
faint purple colour persists. One unit of catalase activity is the amount of
enzyme which breaks 1 µM of H2O2 per min.
3.10.8 Phenolic enzymes
3.10.8.1 Phenylalanine ammonia lyase (PAL) and Tyrosine ammonia
lyase (TAL) activity (Koukol and Conn 1961)
The reaction mixture contained enzyme source, 20 µM of
L-phenylalanine/ tyrosine and 100 µM of borate buffer ( pH 8.8), in a
final volume of 2.0 ml. It was incubated without shaking for 1 hr at 40ºC
and was stopped by addition of 0.1 ml of 5 M HCl. The acidified reaction
mixture was extracted with 5 ml of ether; an aliquot of the ether phase was
evaporated. The residue was dissolved in 0.05 M NaOH, and the absorbance
was read at 268 nm and 333 nm, trans-cinnamic acid and trans-coumaric acid
as the standards; respectively. Enzyme activities were expressed as µg
cinnamic and coumaric acid formed mg-1 protein min-1.
3.11 TEA QUALITY PARAMETERS
3.11.1 Estimation of physiological parameters
Physiological parameters such as net photosynthetic rate (Pn),
Transpiration rate (Tr) and stomatal conductance (Sc) were measured in
healthy and infected shoots using portable infrared gas analyzer
(ADC LCA-3, UK) and an open type parkinson leaf chamber (ADC PLC-3)
under field condition without detaching the leaves. Water use efficiency was
calculated from the ratio between net Pn rate and Tr rate as per the method of
Rajkumar et al (1998).
36
3.11.2 Preparation of samples
The disease infected and healthy shoots (three leaves and a bud) of
tea were collected from the experimental plots for the present study. 2.5 kg of
leaf samples were withered separately under room temperature for 16 h for
reducing the moisture to 60-65%. The withered leaves were passed into a
miniature crush, tear, and curl (CTC) manufacturing unit for four times. The
resultant tea dhool was allowed to ferment (oxidize) at 90% RH in a humidity
chamber. The fermented tea is subjected to firing at 140ºC to 150ºC to a final
moisture content of 3%. The final product was then subjected to analysis for
various quality parameters. Tea infusion was made by extracting 4 g of dry
tea powder in 200 ml of boiling water for 10 min.
3.11.3 Estimation of Theaflavins (TF) and Thearubigins (TR)
(Obanda et al 2001).
Equal volume of tea infusion and ethyl acetate were mixed and four
solutions were made from this mixture. Solution A (1:5 ratio of organic layer
and methanol), solution B (1:10:11 ratio of aqueous layer, distilled water and
methanol), solution C (1:1 ratio of organic layer and 2.5% sodium
bi-carbonate) and solution D (1:1:3:7 ratio of aqueous layer, oxalic acid,
distilled water and methanol). Optical densities were measured at 460nm and
TF percentage was calculated using suitable formula.
3.11.4 Estimation of Highly polymerized substances (HPS) and Total
liquor colour (TLC) (Angayarkanni et al 2002)
Equal volume of infused tea was mixed with iso-butyl methyl ketone
and after sufficient mixing; two phases were allowed to separate.
1 ml of the aqueous layer was eluted with 9 ml of ethanol and its absorbance was
37
read at 380 and 460 nm respectively for estimating HPS and TLC. HPS and TLC
percentage was calculated as per the formula of Angayarkanni et al (2002).
3.11.5 Estimation of Total soluble solids (TSS) and Crude fiber (CF)
(AOAC 1990)
TSS and CF were estimated gravimetrically using tea infusion. CF
was estimated by digesting the infusion with equal volume of 1.25% H2SO4
for 30 min. and further subjected to digestion with 1.25% NaOH solution.
3.11.6 Estimation of flavor index (Likens and Nickerson 1964)
Volatile Flavour Compounds (VFC) was extracted from the black
tea samples by simultaneous distillation extraction method. The concentrated
extract was analyzed using gas chromatography (GC) (Perkin-Elmer Auto
System XL). About 2.0 g of made tea sample were analyzed through a
headspace sampler (Turbomatrix 16) using a flame ionization detector (FID).
A 60m x 0.25 cm i.d. capillary column made of polyethylene glycol
(HP-Innowax) was used. The compounds were identified by comparison of
their GC retention times with those of authentic chemicals (Sigma). The
flavour indeed was calculated from the flavour profile (Obanda and Owuor
1995), which is the ratio of the sum of VFC group II to that of VFC group I.
3.12 MOLECULAR CHARACTERIZATION OF THE PATHOGEN
3.12.1 Genetic diversity of the pathogen
3.12.1.1 Genomic DNA extraction by CTAB method (Saha et al 2000)
Seven day old C. theae isolates grown on PDB at 25ºC were taken
for the present study. 250 mg of the mycelium was ground well after freezing
in liquid nitrogen. Five ml of preheated CTAB extraction buffer (2% CTAB,
38
1.4 M NaCl, 20 mM EDTA (pH 8.0), 100 mM Tris-Hcl (pH 8.0), 0.3%
2-mercaptoethanol) was added and incubated at 65ºC for 90 min. After
cooling, equal volume of chloroform: isoamyl alcohol (24:1) mixture was
added. The supernatant containing the DNA was separated by centrifuging at
10000 rpm for 10 min.
About 25 µl of RNase A (10 mg/ml) was mixed and the DNA was
precipitated by adding 0.6 volume of cold isopropanol. After centrifugation at
10000 rpm for 10 min. at 4ºC, the pellet was washed twice with 70% ethanol
and dissolved in 100 µl of TE buffer. The DNA was quantified using a UV
spectrophotometer and the DNA sample was stored at 4ºC.
3.12.1.2 Amplification of rDNA (White et al 1990).
The internal transcribed spacer (ITS) regions between the small
(18S) and large (28S) nuclear DNA were amplified by PCR using the
primers ITS1 (5´TCCGTAGGTGAACCTTGCGG3´) and ITS4
(5´TCCTCCGCTTATTGATATGC3´) supplied by Sigma Genosys, USA.
PCR amplification was performed in 50 µl volumes containing 100 ng of
template DNA with 0.5 mM of each primer, 0.2 mM of each dNTP, 2 units of
Taq DNA polymerase and 5 ml of 10X DNA polymerase buffer.
Amplification was performed in a thermal cycler (Lark, India) with an initial
denaturation step at 94ºC, 1 min. at 55ºC and 2 min. at 72ºC with final
extension at 72ºC for 7 min. PCR products were separated by electrophoresis
in 1.4% agarose gels, stained with ethidium bromide, and the results were
documented by using gel documentation system (Alpha innotech, USA).
3.12.1.3 Restriction analysis of ITS region.
Restriction enzyme digestion analysis was performed using 15 µl of
the amplified PCR product. The following seven enzymes were used: AluI,
39
EcoRI, SmaI, HaeIII, TaqI, BamHI and Sau3A. The restriction fragments
were separated on 2% agarose gel and documented as above.
3.12.2 Proteomics studies
3.12.2.1 Quantification of intra-cellular proteins of Cercospora theae
Seven days old grown C. theae culture was lyophilized and
subjected to three different extraction protocols for protein extraction. To 0.4
ml of sodium dodecyl sulphate (SDS)/ Urea/Trichloro acetic acid (TCA)
extraction buffer, 10 mg of lyophilized mycelial powder was mixed separately
and boiled for 2 min. and vortexed for 1 min. The mixture was then
centrifuged at 15000 rpm for 20 min. at 4°C. Equal volume of acetone was
mixed to the supernatant and centrifuged at 6000-7000 rpm for 30 min.; the
resulting pellet was dissolved in 100 µl of TE Buffer.
3.12.2.2 Polyacrylamide Gel Electrophoresis (PAGE) (Laemmli 1970)
3.12.2.2.1 Reagents
Solution A was prepared by mixing of 29 g of acrylamide and 1g
bis-acrylamide in 100 ml water and solution B contained 1.5 M Tris-HCl
(pH 8.8). Solution C contained 0.5 M Tris-HCl (pH 6.8). Ammonium
persulphate (APS) solution was prepared by taking 20 mg of ammonium
persulphate in 200 µl of distilled water. N, N, N´,N´, Tetramethyl- ethane-
1,2-diamine (TEMED) was added as such for polymerization of gel. Sample
loading buffer (4X) was set up by mixing of 0.25 M Tris-HCl (pH 6.8), 8%
SDS, 40% glycerol, 20% �-mercaptoethanol and 0.5% bromophenol blue.
Electrode buffer (10X) contained 0.25 M Tris base (pH 6.8),
1.92 M glycine and 1% SDS. 1X electrode buffer was used for running gels.
Staining solution was suitably prepared with 250 mg of coomassie brilliant
40
blue (R 250) in 40 ml of acetic acid. Similarly, destaining solution contained
acetic acid, methanol and water in the ratio of 10:40:50.
3.12.2.2.2 Procedure
Electrophoresis was carried out in a vertical mini-gel unit in a
discontinuous buffer system using 7% acrylamide gel. The gels were cast
using the constituents as given below. The stacking gel was poured and the
comb was placed on the top. The comb was carefully removed from the slots
after polymerization of the stacking gel and the slots were rinsed with
electrode buffer. Samples prepared from the isolates of C. theae were loaded.
After the electrophoretic run, the gel was stained overnight and destained.
Protein molecular marker having molecular weight ranges from 116 to 14.4
(Kda) was used for the determination of molecular weight of the unknown
sample. Composition of separating and stacking gels used were given as
follows.
Composition Separating gel (7%) Stacking gel (4.5%)
Water
Solution A
Solution B
Solution C
SDS (10% w/v)
APS (10%)
TEMED
4.55 ml
2.10 ml
2.25 ml
-
0.1 ml
0.1 ml
0.01 ml
1.80 ml
0.45 ml
-
0.75 ml
0.04 ml
0.03 ml
0.003 ml
3.13 IN VITRO SCREENING OF FUNGICIDES
The list of fungicides screened in vitro and their nature are given in
the Table 3.2. The fungicides were tested at various concentrations by
Poisoned food technique. Appropriate quantity of the test fungicides were
41
mixed with PDA medium and inoculated with 5 mm mycelial disc of the
pathogen. The percent inhibition of the pathogen was calculated over control
as per the method of Adams and Wong (1991).
3.14 IN VITRO SCREENING OF BIOCONTROL AGENTS
One each of popular biocontrol agent from each category of microbe
covering Pseudomonas fluorescens (KSR11) belonging to bacteria;
Trichoderma atroviride (MTCC 9641) belongs to fungi and Streptomyces
sannanensis from actinomycetes group were tested against the C. theae
isolates. Dual culture (Huang and Hoes 1976) and antibiosis (Dennis and
Webster 1971) methods were adopted to screen the above antagonists against
the pathogen. Toxic metabolite(s) extracted from the biocontrol agents was
assayed against C. theae and its percentage inhibition was calculated.
Table 3.2 List of fungicides
No. Fungicides Common
Name
Mode of
action IUPAC Name
1. Bavistin
50% WP
Carbendazim
Systemic
2- (methoxycarbonlamino) –
benzimidazole
2. Bordeaux
mixture
Bordeaux
mixture
Contact
Mixture of copper sulphate and
calcium hydroxide
3. Calixin
25% EC
Tridemorph
Systemic
N-Tridecyl-2,6 -
dimethylmorpholine
4. Contaf 5 EC Hexaconazole Systemic (RS) -2-(2,4-dichlorophenyl)-1-
(1H-1,2,4-triazole-1-yl)
hexan-2-ol
5. Dithane
M-45 80% WP
Mancozeb
Contact Magnesium, Zinc ethylene
bisdithiocarbamate
6. Fytolan
50% WP
Copper
oxychloride
Contact Copper oxychloride
7. Kocide
50% WP
Copper
hydroxide
Contact Copper hydroxide
42
3.14.1 Mass production and mode of application (Sanjay et al 2008)
Two types of preparations of biocontrol agents such as talc and
vermicompost-based formulations were evaluated under field condition. Talc
based preparation was made by mixing the cultures with sterilized
commercial talc along with CMC (0.5%). In order to prepare vermicompost
based bioformulations, the cultures were mass multiplied in sterilized
commercial vermicompost and allowed to grow for 14 days. For field
application, the product was soaked in 2.0 lit. distilled water in a bucket and
allowed to stand overnight. Bacterial and actinomycetes antagonists were
diluted with water in the ratio of 1:4 and 250 ml from this was mixed with one
kg of vermicompost for final field application.
Spraying of fungicides and bioformulations was carried out using a
knapsack sprayer with a spray volume of 300 lit. ha-1 covering one row on
either side. The spore load in both the preparations was adjusted to 1 x 108
cfu/gm of sample. Leaf samples were collected periodically from the
experimental plots for the enumeration of biocontrol agents to know their
survival. Enumeration of Trichoderma, Pseudomonas, Bacillus and
Streptomyces species was carried out using TSM, NA, and SCNA media
respectively following dilution plate technique (Kuster and Williams 1964;
Elad and Chet 1983).
3.15 IN VITRO SCREENING FOR NANOPARTICLE PRODUCTION
Efficient biocontrol agents used for field studies were subjected to
analyze for the synthesis of silver and gold nanoparticles, after confirmation
using UV-VIS spectroscopy, X-Ray diffraction (XRD), Fourier Transform
Infra Red (FTIR), Energy Dispersive X-ray (EDX) and Scanning Electron
Microscope (SEM). Moreover, the nanoparticles were evaluated against
43
C. theae isolates for their antifungal activity and stability of efficacy for a
period of one year.
The biocontrol agents were grown at a temperature of 25±3°C., for
72 hours. The biomass was separated and washed thrice with sterile distilled
water. Ten grams of microbial biomass was mixed with a 1000 ml aqueous
solution of 1 mM silver nitrate and chloroauric acid separately. The mixture
was placed in a 100 rpm rotating shaker at 28°C for 120 hrs. The reduction of
silver and gold ions was routinely monitored at different time intervals by
collecting the aqueous layer and subsequently subjected to read at continuous
wavelength of 300-800 nm.
3.15.1 Efficacy of nanoparticles to control Cercospora theae
The culture filtrates obtained from biocontrol agents after the
synthesis of gold and silver nanoparticles were collected and tested against
C. theae isolates. The filtrate was added at 10% concentration to the PDA and
inoculated with the pathogen and percent inhibition was calculated. The
culture filtrates were preserved under 4ºC for a period of one year and
its activity against C. theae was checked every six months interval in order
to study the stability and antagonist activity against C. theae imparted by the
nanoparticles.
3.16 MANAGEMENT OF BIRD’S EYE SPOT DISEASE
Fields with an early history of bird’s eye spot disease were selected
based on the survey conducted by Gnanamangai and Ponmurugan (2010).
Experiments were conducted in naturally infected tea fields in Valparai tea
estate, Tamil Nadu state, India, lying at elevation of 1035 m above sea level.
Experimental plots were laid out in a randomized block design and consisted
of 50 plants per plot with three replicates. The promising fungicides and
44
biocontrol agents screened under in vitro were evaluated for three consecutive
disease seasons (February-August) from the year 2008 to 2010. Moreover, the
standard cultural operations were adopted (Hudson et al 1998), except for the
treatments under investigation.
The occurrence of bird’s eye spot disease incidence was recorded
directly on the bush canopy as described in section 3.6. The green leaf yield
was converted to made tea in kg ha-1 by the formula, yield = green leaf yield
in kg x 13,000 x 0.225/number of bushes in the experimental plot, where
13,000 is the total bush population per hectare and 0.225 is the conversion
factor for green leaf (22.5% out turn) to made tea (Ponmurugan and Baby
2007a). Recovery of the treated bushes were monitored by assessing
plucking surface of the bush, plucking points containing three leaves and a
bud, internodal length (average of 1-3 internodes), leaf moisture and dry
matter contents using the method adopted by Balasubramanian et al (2010).
Moreover, biochemical, physiological and quality parameters were estimated
in the leaves collected from experimental plots as per the standard procedures
mentioned above.
3.17 STATISTICAL ANALYSIS
All the data were statistically evaluated using SPSS 17.0 statistical
package (SPSS, Inc. Chicago, IL). Moreover, the data obtained were also
subjected to analysis of variance (ANOVA) and Duncan’s Multiple Range
test with LSD. The significant means were segregated by critical difference
(CD) at various levels of significance. The standard error (SE) and coefficient
of variance analysis (CV) were also calculated (Gomez and Gomez 1984).