CHAPTER 13

GENETIC ENGINEERING

Brain Teaser:• How can a sheep that is 12 years

old have an identical twin that is only 4 years old?

• What is genetic engineering?• Do you eat genetically

engineered foods? If so what types?

• Is it possible for bacteria to produce human insulin?

• What is cloning? Should we clone humans?

SECTION 1 Changing the Living World

Key Concept Questions

• What is the purpose of selective breeding? 

• Why might breeders try to induce mutations?

A New Breed

• The tomatoes in your salad and the dog in your backyard are a result of selective breeding.

• Over thousands of years, humans have developed breeds of animals and plants that have desirable characteristics.

• How do breeders predict the results of crossing individuals with different traits?

What would happen if you crossed the following two breeds of dog?

Great Dane Chihuahua Cross breed

Color Tan, black, white,gray, etc.

Tan, black, white, etc.

Tan/black

Size 70 lbs. 6lbs. 30 lbs.

Type of Coat

short short short

Aggression

med high med

Intelligence

very med med

• Why do a Chihuahua, a golden retriever, a pug, and a great Dane all look so different but are still the same species?

• SELECTIVE BREEDING

–Allowing only those organisms with desired characteristics to produce the next generation

• What types of organisms have been selectively bred by humans?

–horses

–dogs

–cats

–farm animals

–most crop plants

We have been manipulating DNA for generations!

• Artificial breeding

– creating new breeds of animals & new crop plants to improve our food

Animal breeding

Breeding food plants

• “Descendants” of the wild mustard– the “Cabbage family”

Breeding food plants

Evolution of modern corn (right) from ancestral teosinte (left).

A Brave New World

• HYBRIDIZATION

– Crossing dissimilar individuals to bring together the best of both organisms

– hybrids are often hardier than either of the parents

– used widely by farmers

• ex) food-producing crop crossed with disease-resistance crop = disease-resistant, food producing crop

• INBREEDING– Continued breeding of individuals

with similar characteristics• Look at the above pictures• How can you tell that the puppies are

inbred?– They all look identical

• What differences might these puppies have if they were hybrids?

– Different color, fur type, size

• What could be the risks of inbreeding?– most of the members of a breed are

genetically similar– there is a chance that a cross

between these two individuals will bring together two recessive alleles for a genetic defect

– In dogs – blindness, joint deformities, susceptibility to diseases such as parvo virus and cancers

• Would you use hybridization or inbreeding to produce a homozygous individual?

–Inbreeding• How would you make a

heterozygous individual?

–Hybridization

• Selective breeding would be nearly impossible without the wide variation that is found in the natural populations.

• This is one of the reasons biologists are interested in preserving the diversity of plants and animals in the wild

• What can breeders do if they want more variation than naturally exists in nature?

– Breeders can increase the genetic variation in a population by inducing (causing) mutations, which are the ultimate source of genetic variability

• these are mutant bacteria that can digest oil from oil spills

• How are mutations caused?

–radiation

–Chemicals

• Can plants be mutants?

–Yes

• POLYPLOID

–Cells that have many sets of chromosomes

–drugs prevent chromosomal separation during meiosis

–plants can handle this – polyploidy in animals is usually fatal

• A polyploid plant is considered a new species

• Are any of the fruits and vegetables you eat polyploidy?

–bananas and many citrus fruits

Key Concept Questions

• What is the purpose of selective breeding? 

– Allowing only those organisms with desired characteristics to produce the next generation

• Why might breeders try to induce mutations?

– To create new combinations of alleles

SECTION 2 Manipulating DNA

Key Concept Questions

• How do scientists make changes to DNA?

The code is universal

• Since all living organisms… – use the same

DNA

– use the same code book

– read their genes the same way

• How are changes made to DNA?

– Scientists use their knowledge of the structure of DNA and its chemical properties to study and change DNA molecules.

– Different techniques are used to extract DNA from cells, to cut DNA into smaller pieces, to identify the sequence of bases in a DNA molecule, and to make unlimited copies of DNA

• GENETIC ENGINEERING

–Making changes to the DNA code of a living organism

• How do biologists get DNA out of a cell?

–cell is opened (cell fractionation) and the DNA is separated from the other cell parts

• RESTRICTION ENZYMES

–Enzyme used to cut DNA in certain parts of the sequence

Cutting DNA• DNA “scissors”

– enzymes that cut DNA

– restriction enzymes

• used by bacteria to cut up DNA of attacking viruses

– cut DNA at specific sites

• enzymes look for specific base sequences

GTAACGAATTCACGCTTCATTGCTTAAGTGCGAAGTAACG|AATTCACGCTTCATTGCTTAA|GTGCGAA

Many uses of restriction enzymes…

• Now that we can cut DNA with restriction enzymes…– we can cut up DNA from different people…

or different organisms… and compare it

– why?• forensics• medical diagnostics• paternity• evolutionary relationships • and more…

• Does it make sense for a biologist to work with a 1 meter long piece of DNA?

– No

• It is difficult for researchers to study a single copy of a gene so they make more copies

• POLYMERASE CHAIN REACTION

– Technique that allows molecular biologists to make many copies of DNA

• Biologist adds primers to each end of a segment of DNA they want to copy – these small pieces on the end are called primers

• DNA polymerase looks for these primers as a place to begin copying

• DNA is heated to separate the strands• DNA is then cooled and DNA polymerase

hooks on• DNA polymerase makes a copy and the

cycle continues until the biologist has the desired amount of DNA

• Fig 13-8 p. 325

Comparing cut up DNA

• How do we compare DNA fragments?

– separate fragments by size

• How do we separate DNA fragments?

– run it through a gelatin

– gel electrophoresis

• How does a gel work?

Gel electrophoresis

• A method of separating DNA in a gelatin-like material using an electrical field

– DNA is negatively charged

– when it’s in an electrical field it moves toward the positive side

+–

DNA

“swimming through Jello”

• A mixture of DNA fragments is placed at one end of a porous gel, and an electric voltage is applied to the gel.

• When the power is turned on, DNA molecules, which are negatively charged, move toward the positive end of the gel

• DNA moves in an electrical field…

– so how does that help you compare DNA fragments?

• size of DNA fragment affects how far it travels

–small pieces travel farther

–large pieces travel slower & lag behind

Gel electrophoresis

+–

DNA

“swimming through Jello”

Gel Electrophoresis

longer fragments

shorter fragments

powersource

completed gel

gel

DNA &restriction enzyme

wells

-

+

http://207.207.4.198/pub/flash/4/electrophoresis.swf

• How do researchers figure out the sequence of the DNA?

–they use fluorescent markers and gel electrophoresis

Running a gel

1 2

cut DNA with restriction enzymes

fragments of DNAseparate out based

on size

3

Stain DNA– ethidium

bromide binds to DNA

– fluoresces under UV light

– DNA is placed in a test tube with an enzyme that can make a complimentary strand of DNA

– A supply of nucleotide bases – ATGC – is added

– A small amount of one of the bases that has been labeled with dye is also added

– The enzyme adds the bases along the strand and when it adds a labeled base the strand stops being made

–This is repeated with the other three labeled bases

–All of the fragments are put into a gel electrophoresis gel

–The dye color codes the fragments so biologists know which pieces are which

• What can biologists do now that they have separated the DNA into fragments?

– RECOMBINANT DNA

• DNA molecules produced by combining DNA from different sources, even different organisms

• DNA synthesizers – “machines”- enzymes are added to combine sections of DNA together

• What role does gel electrophoresis play in the study of DNA?

–It enables scientists to separate and analyze DNA fragments, to compare genomes of different individuals and organisms, and to identify a specific gene

Key Concept Questions

• How do scientists make changes to DNA?

– Through genetic engineering

SECTION 3 Cell Transformation

Key Concept Questions

• What happens during cell transformation?

• How can you tell if a transformation experiment has been successful?

Sneaking In

You probably have heard of computer viruses. Once inside a computer, these programs follow their original instructions and override instructions already in the host computer. Scientists use small “packages” of DNA to sneak a new gene into a cell, much as a computer virus sneaks into a computer.

Go to Section:

• What is cell transformation?

–During transformation, a cell takes in DNA from outside the cell. This external DNA becomes part of the cell’s DNA (remember the heat-killed disease causing bacteria in mice?)

–Fig 13-9 p. 327

– foreign DNA is joined to a small circular molecule known as a PLASMID – small circular piece of DNA

• GENETIC MARKER – A gene that makes it possible to

distinguish bacteria that carry the plasmid from those that don’t

– Ex) Bacteria that produce human insulin (video clip #1)

Transforming bacteria

Bacterial DNA

• Single circular chromosome

– only one copy = haploid

– no nucleus

• Other DNA = plasmids!

bacteriachromosome

plasmids

There’s more…• Plasmids

– small extra circles of DNA– carry extra genes that bacteria can use– can be swapped between bacteria

• bacterial sex!!• rapid evolution = antibiotic resistance

– can be picked up from environment

How can plasmids help us?• A way to get genes into bacteria easily

– insert new gene into plasmid– insert plasmid into bacteria = vector– bacteria now expresses new gene

• bacteria make new protein

+

transformedbacteriagene from

other organism

plasmid

cut DNA

recombinantplasmid

vectorglue DNA

Grow bacteria…make more

growbacteria

harvest (purify)protein

transformedbacteria

plasmid

gene fromother organism

+

recombinantplasmid

vector

– gene from plasmid is transferred to a bacteria called agrobacterium – often used to introduce foreign DNA

– plant cells with cell walls removed are grown in a Petri dish

– the bacteria with foreign DNA is introduced

Plant Cell Transformation

• Without a cell wall the plant cells can take up the DNA

• Inside the plant cell, the bacteria insert the plasmid into plant DNA

• Plant cells can then grow into an entire plant

• If transformation is successful, the recombinant DNA is integrated into one of the chromosomes of the cell

– most egg cells are big enough to inject DNA into

– enzymes in nucleus help insert the DNA into the chromosomes

– The foreign DNA have a marker on them so researchers can tell if the DNA was incorporated

– Another method is to “knock out” part of the host DNA and insert foreign DNA

– Fig. 13-11 (video Clip #3)

Transforming Animal Cells

• How might this technique be used to treat disorders caused by a single gene?

– The mutated gene causing the disorder can be replaced by the normal gene

• If a human patient’s bone marrow cells were removed, altered genetically, and reimplanted, would the change be passed on to the patient’s children?

– No, the change involves body cells not reproductive cells

Key Concepts 13-3

• What happens during cell transformation?

– During transformation, a cell takes in DNA from outside the cell. This external DNA becomes part of the cell’s DNA

• How can you tell if a transformation experiment has been successful?

– The cell that has been altered will produce the new protein

SECTION 4 Applications of Genetic

Engineering

Key Concept

• How are transgenic organisms useful to human beings?

• How are cloning and stem cell research related?

The Good With the Bad

The manipulation of DNA allows scientists to do some interesting things. Scientists have developed many transgenic organisms, which are organisms that contain genes from other organisms. Recently, scientists have removed a gene for green fluorescent protein from a jellyfish and tried to insert it into a monkey.

Go to Section:

Can we mix genes from one creature to another?

YES!

How do we do mix genes?• Genetic engineering

– find gene– cut DNA in both organisms– paste gene from one creature into other

creature’s DNA– insert new chromosome into organism– organism copies new gene as if it were its

own– organism reads gene as if it were its own– organism produces NEW protein:

Remember: we all use the same genetic code!

• TRANSGENIC

– An organism that contains genes from other organisms

• How are transgenic organisms useful to human beings?

– Genetic engineering has spurred the growth of biotechnology, a new industry that is changing the way we interact with the living world

Transgenic microorganisms

• Bacteria – reproduce rapidly• produce many useful substances for

health and industry• human insulin can be produced by

bacteria – this makes insulin easy to get and the person is less likely to have an allergic reaction

• these bacteria could be made to produce cancer-fighting chemicals

Transgenic animals

• mice have been developed with immune systems similar to humans

• researchers can study the diseases in mice that affect human immune systems

• livestock with extra copies of growth hormone gene – they grow faster, bigger, and with less fat

Transgenic plants

• plants contain natural insecticide so pesticides do not need to be used – fewer crops will be destroyed so farmers won’t need as much land to grow healthy crops

• these plants may soon produce human antibodies that can be used to fight disease

• rice can now grow with extra vitamin A in it – important for billion’s of the world’s people

CLONING

Cloning• A clone is an organism or piece of genetic

material that is genetically identical to one that was preexisting

• Making a clone in a lab is called cloning, but the process does also occur in nature.

• 1997 Dolly a cloned sheep was created

How do you clone an animal?

1. A donor cell is taken from a sheep’s udder. The nucleus of the cell will provide the genetic material for the cloned lamb

2. An egg cell is taken from a second sheep. The nucleus of the cell is removed. This cell does not supply any genetic material for the cloned lamb

3. The donor cell (with the nucleus) and the egg cell (without a nucleus) are fused using an electric shock

4. The fused cell begins dividing normally, forming an embryo. The embryo is placed in the uterus of a foster mother

5. The embryo develops normally into a lamb, Dolly. Dolly is a clone of the sheep that donated the udder cell

6. Dolly then went on to have a lamb of her own (the natural way)

7. Not a very reliable way - It took 246 failures before Dolly was created

• Is Dolly considered a transgenic animal?

–No, she does not have any DNA sequences from a different organism

Using Stem Cells • A stem cell is a cell that can continuously divide

and differentiate into various tissues.• Some stem cells have more potential to

differentiate than others.• Adults’ bodies have some multipotent cells that

can be removed, frozen or cultured, and used for medical treatments.

• The cells of new embryos have more potential uses.

• The use of embryos for stem cell research poses ethical problems.

• An alternative source of embryonic stem cells is through SCNT (somatic cell nuclear transplant).

What are Stem Cells?

Stem Cells are extraordinary because:

• They can divide and make identical copies of themselves over and over again (Self-Renewal)

• Remain Unspecialized with no ‘specific’ function or become . . . .

• Specialized (Differentiated) w/ the potential to produce over 200 different types of cells in the body.

The Major Types of Stem Cells

A. Embryonic Stem Cells

• From blastocysts left over from In-Vitro Fertilization in the laboratory

• From aborted fetuses

B. Adult Stem Cells

• Stem cells have been found in the blood, bone marrow, liver, kidney, cornea, dental pulp, umbilical cord, brain, skin, muscle, salivary gland . . . .

http://commons.wikimedia.org/wiki/Image:Stem_cells_diagram.png

Advantages and Disadvantages to Embryonic and Adult Stem Cells.

Embryonic S.C. Adult S.C.

“Pluripotent”

(can become any cell)

“Multipotent”

(“can become many but not any”)

Stable. Can undergo many cell divisions.

Less Stable. Capacity for self-renewal is limited.

Easy to obtain but blastocyst is destroyed.

Difficult to isolate in adult tissue.

Possibility of rejection?? Host rejection minimized

Reprinted with permission of Do No Harm. Click on image for link to website.

Why is Stem Cell Research So Important to All of Us?

Stem cells allow us to study how organisms grow and develop over time.

Stem cells can replace diseased or damaged cells that can not heal or renew themselves.

We can test different substances (drugs and chemicals) on stem cells.

We can get a better understanding of our “genetic machinery.”

What Human Diseases are Currently Being Treated with Stem Cells?

• Parkinson’s Disease

• Leukemia (Bone Marrow Transplants)

• Skin Grafts resulting from severe burns

Stem Cell Therapy has the Potential to:

• Regenerate tissues/organs

• Cure diseases like diabetes, multiple sclerosis, etc.

Why the Controversy Over Stem cells?

• Embryonic Stem cells are derived from extra blastocysts that would otherwise be discarded following IVF.

• Extracting stem cells destroys the developing blastocyst (embryo).

-Questions for Consideration-Is an embryo a person?Is it morally acceptable to use

embryos for research?When do we become “human beings?”

Key Concept Questions• How are transgenic organisms useful to human

beings?

– Genetic engineering has spurred the growth of biotechnology, a new industry that is changing the way we interact with the living world

• How are cloning and stem cell research related?

– Cloning can produce organisms that are genetically identical to preexisting individuals. Stem cells can be used to grow new tissues.