www.elsevier.com/locate/npep

Neuropeptides 40 (2006) 77–83

Neuropeptides

Changes in tracheo-bronchial sensory neuropeptide receptorgene expression pattern in rats with cisplatin-induced

sensory neuropathy

Peter Horvath, Zoltan Szilvassy, Barna Peitl *, Judit Szilvassy, Zsuzsanna Helyes,Janos Szolcsanyi, Jozsef Nemeth

DEOEC, Department of Pharmacology, Nagyerdei krt. 98, Debrecen, Hungary

Received 13 July 2005; accepted 26 October 2005Available online 15 December 2005

Abstract

An attenuated neurogenic broncho-constriction underpinned by a decrease in sensory neuropeptide release has been shown to becharacteristic of cisplatin-induced neuropathy. The present work was to explore if beyond neuropeptide release, cisplatin at a treat-ment schedule attaining sensory neuropathy, produced changes in the expression of the receptors of sensory neuropeptides such assomatostatin, calcitonin gene-related peptide (CGRP) and substance P (SP) in bronchial tissue of the rat. Twenty-four Wistar ratswere divided into three groups. The animals in the ‘‘Treatment groups 1 and 2’’ were given cisplatin (1.5 mg kg�1) and mannitol(75 mg kg�1) over 5 days. The rats in the ‘‘Control’’ group were given mannitol + isotonic saline. Four animals from each groupwere used to study the expression pattern of the neuropeptide receptors in bronchial tissue. The levels of somatostatin receptor 4(SSTR 4), neurokinin 1 (NK1), neurokinin 2 (NK2) and CGRP receptor expression were examined by quantitative real time poly-merase chain reaction (RT-PCR) method, 11 and 22 days after the last cisplatin/vehicle dose. The cisplatin treatment significantlyincreased plasma somatostatin immunoreactivity and the expression of SSTR4 receptor detected both on the 11th and 22nd post-treatment days with no change in either CGRP, NK1, and NK2 receptor gene expression or plasma CGRP and substance P levels.We conclude that cisplatin neuropathy is accompanied by an increase in plasma somatostatin immunoreactivity with an increase inSSTR4 expression in rats.� 2005 Elsevier Ltd. All rights reserved.

Keywords: QRT-PCR; Somatostatin; Calcitonin gene-related peptide; Substance P; Radioimmunoassay; Cisplatin; Neuropeptide receptors; Neur-opathy

1. Introduction

Cisplatin (diamino-dichloro-platinum) is chemother-apeutic agent widely used for the treatment of varioustypes of cancer (Bardos et al., 2003). However, the ther-apeutic potential of the drug is strongly limited by itsdiverse side effects such as myelo-suppression, ototoxic-ity, nephrotoxicity and neurotoxicity. As far as the latter

0143-4179/$ - see front matter � 2005 Elsevier Ltd. All rights reserved.

doi:10.1016/j.npep.2005.10.007

* Corresponding author. Tel.: +36 5242 7899.E-mail address: barna.peitl@king.pharmacol.dote.hu (B. Peitl).

is concerned, cisplatin-induced neuropathy is predomi-nantly of peripheral sensory nature characterized by asignificant impairment of the effector function of vagalafferent sensory fibers innervated the bronchial tree(Szilvassy et al., 2000; Horvath et al., 2005). This wasshown to be underpinned by a decreased neuropeptiderelease, namely, a significant decrease in the release ofCGRP, substance P and somatostatin were seen inresponse to electrical field stimulation in bronchial prep-arations from animals, who had been made neuropathyby means of a preceding period of cisplatin treatment(Horvath et al., 2005). The decreased neuropeptide

78 P. Horvath et al. / Neuropeptides 40 (2006) 77–83

release seemed to be physiologically relevant as it paral-leled a strong attenuation in broncho-constrictiveresponses to electrical field stimulation in both guineapigs and rats (Szilvassy et al., 2000; Horvath et al.,2005). Since the decrease in transmission classicallychanges particular neurotransmitter receptors expres-sion, the present work was concerned with the possibil-ity that sensory neuropeptide receptor expression maychange in cisplatin neuropathy (Baluk et al., 1997).

2. Methods

2.1. Ethics

The experiments performed in the present work con-form to European Community guiding principles for thecare and use of laboratory animals. The experimentalprotocol applied has been approved by the local ethicalboards of Universities of Pecs and Debrecen, Hungary.

2.2. Experimental groups and animals

Fifty-two Wistar rats weighing 300–350 g were usedthroughout the experiment. Twenty-four animalsselected for the QRT-PCR and RIA studies were ran-domized into two experimental groups. Control: ani-mals treated with the solvent for cisplatin, 1 mlisotonic NaCl with 75 mg kg�1 mannitol, i.p., once aday over 5 days. The animals in the ‘‘cisplatin-treated’’group were given 1.5 mg kg�1 cisplatin with 75 mg kg�1

mannitol, i.p., once a day over 5 days (Bardos et al.,2003). Four animals of the Control and Cisplatin groupwere used for studying of the expression pattern of theneuropeptide receptors. Total mRNA was isolated 11and 22 days following cisplatin treatment. Thirty-sixanimals were randomized for the measurement of thenerve conduction velocity studies.

2.3. Nerve conduction velocity

This series of experiments was carried out to verify/exclude sensory neuropathy involving unmyelinatedslow conducting �C�-fibers previously shown to play animportant role in the HISS mechanism. Left saphenousnerve conduction velocity was determined in animalsfrom both groups as described (Szilvassy et al., 2000;Nemeth et al., 1999a,b). Briefly, in thiopentone-anaes-thetized animals the nerve was prepared, cleaned of fatand adhering connective tissue and trains of square-wave constant voltage stimuli were applied through apair of platinum electrodes (Experimetria Ltd., UK)placed as high as possible. The intensity, frequencyand number of stimuli varied but the pulse width(500 ls) was kept constant. Another pair of electrodeswas applied approximately 2 cm distal to the stimulating

electrodes for recording the summation action potentialsevoked by the proximal stimulation. The time lagsbetween stimulation and the appearance of correspond-ing �A� and �C� waves were determined, reflecting activa-tion of populations of A- and C-fibers, respectively.Average conduction velocity (m s�1) was calculated bydividing the distance between the stimulating and receiv-ing electrodes by the interval between the end of thestimulatory impulses 20 stimuli and the appearance ofthe corresponding �A� and �C� signals (Janig and Lisney,1989).

2.4. Radioimmunoassay and blood glucose level

Plasma levels of CGRP, substance P (SP), insulin andsomatostatin (SST) were measured by radioimmunoas-say (RIA) developed in our laboratory (Nemeth et al.,1996, 1998, 1999c). Detection limit for the SST and SPwere 1 fmol ml�1 and for CGRP 0.1 fmol ml�1, respec-tively. Blood glucose level was determined by means ofthe glucose oxidase method (Accu-Chek, Roche Diag-nostics, Hungary). Peripheral insulin sensitivity and b-cell function was also determined using homeostasismodel assessment (HOMA-IR = (FPI) · (FPG)/22.5and HOMA-%B = 20 · FPI/FPG-3.5) in fasted animals(16 h period of fasting preceding sampling) as previouslydescribed (Matthews et al., 1985).

2.5. RNA isolation

The excised trachea and the main bronchi were imme-diately placed in RNA Later buffer (Qiagen, Inc.) andkept at �70 �C till processing. Total RNA was isolatedwith the RNA isolation kit according to the manufac-turer protocol. The quality of the prepared RNA wasdetermined by electrophoresis on agarose gel and thequantity was measured by ND1000 (Nanodrop, Inc.)spectrophotometer. Two hundred nanograms totalRNA was used for each single quantitative RT-PCRassay.

2.6. Quantitative real time polymerase chain reaction

Quantitative real time polymerase chain reaction(QRT-PCR) was performed by the SybrGreen detectionmethod. Primers were designed by the Primer 3 onlineprogram (http://frodo.wi.mit.edu/cgi-bin/primer3/pri-mer3_www.cgi). All primers were checked by BLAST,to reduce the possibility of the amplification of othergenes. The primers were:

NK1 forward: tgggcaacgtagtggtgata, reverse: cacg-gctgtcatggagtaga;

NK2 forward: ggagagtcaaccggtgtcat, reverse: ccgag-caccattctgttttt;

CGRP receptor forward: agaacttgaacgccatcacc, re-verse: ggatctcaacagcggtcatt;

Illustrations

(1-5 day)

QR

Treatment period(1-5 day)

QRT-PCR,RIA, NCV

P. Horvath et al. / Neuropeptides 40 (2006) 77–83 79

SSTR4 forward: gccactgtcaaccatgtgtc, reverse: tcttcc-tcagcacctccagt;

Beta 2 microglobulin forward: acttcctcaactgctacg, re-verse: tggtgtgctcattgctat.

1 5 161 5 16 27 days

Fig. 1. The schematic representation of the experimental protocol.After the animals were treated with either cisplatin or its solvent over 5days (1–5 day), QRT-PCR, RIA and nerve conduction velocity (NCV)were determined both on the 16th and 27th days.

2.7. Relative quantification of the examined genes

Beta 2 microglobulin (b2m) gene was used as internalcontrol. Only those reactions were included in the quan-titative analysis, which gave a well-defined amplificationproduct both by melting curve analysis and agarose gelelectrophoresis. To compare the different mRNA tran-scription levels, CT values were compared directly. CT

is defined as the number of cycles needed for the fluores-cence signal to reach a specific threshold level of detec-tion, and is inversely correlated with the amount ofspecific template nucleic acid present in the reaction.

We compared the RNA transcription of the exam-ined neuropeptide receptor genes with b2m. DCT wasfirst calculated between the CT values at the 16th and22nd day from samples from cisplatin-treated and con-trol animals. In the second step, we subtracted thechanges in RNA transcription in samples from controlanimals from the changes in samples from cisplatin-trea-ted animals to obtain the DDCT. This indicated changesin RNA transcription caused by cisplatin treatmentbetween the 16th and 22nd day normalized to RNAtranscription changes in the control samples. A highDDCT value, if negative or positive, indicated significantchanges in the RNA transcription level of the testedgene. A positive DDCT value indicated down-regulationof RNA transcription, whereas a negative DDCT indi-cated an up-regulation of the gene�s transcription fol-lowing cisplatin treatment (Radonic et al., 2004).

DDCT11 day¼ðCTreceptor�CTb2mÞ11 day�ðCTreceptor�CTb2mÞcontrol;DDCT22 day¼ðCTreceptor�CTb2mÞ22 day�ðCTreceptor�CTb2mÞcontrol.

ð1Þ

For normalizing the given data we used the 2�DDCT

method (Bernard and Wittwer, 2002).

2.8. Study design

Fig. 1 shows the schematic diagram of the experimen-tal protocol. The animals were treated with cisplatin over5 days to induce sensory neuropathy. The animals treatedwith solvent for cisplatin over 5 days served as the controlgroup. The animals from either group were divided intotwo subgroups; one for QRT-PCR and RIA measure-ments and another one for nerve conduction velocitydetermination. Each animal was fasted overnight beforeblood sampling for plasma CGRP, substance P, somato-statin and insulin as well as fasting blood glucose. Thesedeterminations were done 11 and 22 days after cessationof the cisplatin treatment schedule.

2.9. Exclusion

Only those samples (four from each group) were usedfor QRT-PCR measurements, where the QRT-PCRanalysis of the samples gave a well-defined amplificationproduct both by melting curve analysis and agarose gelelectrophoresis.

2.10. Drugs and chemicals

The chosen primers designed by using the Primer 3online program (see section 2.6) were ultimately pur-chased from Sigma-Aldrich (Budapest, Hungary)Sigma-Aldrich, RNeasy Protect Mini Kit from QiagenInc. Quantitative Real Time Polymerase Chain Reac-tion (KasztelMed, Hungary Budapest) was carriedout by LightCycler PCR machine (Roche Applied Sci-ence). For quantifying mRNA LightCycler RNA Mas-ter SYBR Green I kit was used from Roche AppliedScience (KasztelMed, Hungary Budapest). Cisplatinwas obtained from TEVA-BIOGAL, Debrecen. Chem-icals used for radioimmunoassay determinations, wereas follows: Tyr-a-CGRP was purchased from Bachem,Germany CGRP, substance P, somatostatin antiserumwere a present of Dr. T. Gorcs from the UniversityMedical School of Budapest, Hungary. PolypropyleneRIA tubes were obtained from Merck (Darmstadt,Germany). 125I-labelled tracers were prepared in ourlaboratory (Nemeth et al., 2002).

2.11. Data analysis

Data of RT-PCR measurements are expressed bymeans of ± standard error of the mean (SEM). Changeswere significant if the expression level differed more thantwo times from corresponding control values. The dataobtained from RIA measurements are expressed asmeans of ± SEM and analyzed by ANOVA followedby Student�s t-test supplemented with appropriate posthoc evaluation. In case of data normalization failure,the possibilities for further statistics were left by usingMan–Whitney�s U-test. Changes considered significantat p 6 0.05.

0

5

10

15

0

1

2

3

4

5

6

7

8

*

22 day after

*

*

a

b

c

Control 11 day aftertreatment treatment

0

5

10

15

20

25

30

35

Subs

tanc

e P

(fm

ol m

l-1)

CG

RP

(fm

ol m

l-1)

Som

atos

tatin

(fm

ol m

l-1)

Fig. 2. Effect of cisplatin treatment on plasma substance P (a), CGRP(b) and somatostatin (c) levels (n = 8). Results are means ± SEM.*p 6 0.05 vs. control (mannitol + isotonic saline).

80 P. Horvath et al. / Neuropeptides 40 (2006) 77–83

3. Results

3.1. Nerve conduction velocity

Table 1 shows that cisplatin, at the treatment sche-dule applied, produced a significant decrease in nerveconduction velocity in both fast conducting myelinated�A� and slow conducting unmyelinated �C�-fibers deter-mined either 11 or 22 days following cisplatin treatment(Table 1).

3.2. Plasma somatostatin, CGRP and substance P levels

It is seen in Fig. 2, that plasma somatostatin immu-noreactivity significantly increased 11 and 22 days aftercisplatin treatment. Plasma CGRP level exhibited only atransient increase, whereas plasma substance P did notreveal any change.

3.3. Plasma insulin and glucose level

Table 2 shows the effect of 5 day solvent/drug admin-istration on plasma insulin and glucose levels in controland cisplatin-treated rats. Both plasma insulin and fast-ing blood glucose levels remained unaffected by cisplatintreatment. In accordance with these results, the HOMA-IR and HOMA-%B did not show any significant differ-ence between the control and Cisplatin-treated group(Table 2).

3.4. RT-PCR measurements

On the 16th day of the experiment the expression ofthe NK1, NK2 and CGRP receptor mRNAs increased3.22 ± 1.29, 2.78 ± 1.14 and 1.31 ± 0.14 times the con-trol level, respectively. On the 27th day of the experi-ment the expression level of the NK1, NK2 andCGRP receptor mRNA decreased to 0.69 ± 0.28,0.91 ± 0.24 and 0.62 ± 0.07 times to the control, respec-tively (i.e., the difference is non-significant as comparedby the 0 day control values). On the other hand, theexpression pattern of SSTR4 mRNA is completely dif-ferent from the above mentioned neuropeptides recep-tors mRNA expression pattern. We found a significantincrease not only at the 16th day, but also at the

Table 1The effect of cisplatin treatment (1.5 mg kg�1) on the nerve conductionvelocity (NCV) of the myelinated Ad and unmyelinated C-fibers

NCV in A-fibers(m s�1)

NCV in C-fibers(m s�1)

Control 23.8 ± 3.5 0.77 ± 0.111 day after treatment 15.8 ± 2.9* 0.48 ± 0.1*

22 day after treatment 17.4 ± 3.2* 0.53 ± 0.2*

* Significant (p 6 0.05) differences of the corresponding controlvalue.

27th day as well. The expression level of the mRNA ofthe SSTR4 increased 4.41 ± 2.48 times on the 16th dayand 7.72 ± 2.66 times on the 27th day (Fig. 3).

4. Discussion

The animals treated with cisplatin exhibited sensoryneuropathy characterized by a significant decrease innerve conduction velocity in unmyelinated C-fibers.The treatment schedule applied has previously beenshown to significantly decrease the release of sensoryneuropeptides in response to electrical field stimulationin bronchial preparations from rats that has been sus-pected to underlie an attenuation of non-adrenergic,non-chlonergic broncho-constriction (Horvath et al.,2005). The major original finding of the current work,

Table 2Shows that cisplatin neuropathy did not modify glucose homeostasis as determined by the measurement of the fasting plasma insulin and glucoselevels and as expressed by HOMA-IR and HOMA-%B

Solvent-treated group Cisplatin-treated group

16th day 27th day 16th day 27th day

Plasma insulin (lU ml�1) 9.4 ± 1.4 9.5 ± 0.5 9.6 ± 1.2 9.5 ± 0.4Plasma glucose (mmol l�1) 4.5 ± 0.1 5.1 ± 0.2 5.7 ± 1.0 6.0 ± 1.0HOMA-IR 1.9 ± 0.1 2.1 ± 0.0 2.4 ± 0.1 2.5 ± 0.1HOMA-%B 180.4 ± 19.4 120.6 ± 14.3 88.3 ± 10.1 75.8 ± 6.9

0

1

2

0

5

10

15

0

1

2

3

4

5

*

a

c

d

b

Rel

ativ

e am

ount

of

mR

NA

of

NK

1

0

1

2

3

4

5

Rel

ativ

e am

ount

of

mR

NA

of

NK

2

Rel

ativ

e am

ount

of

mR

NA

of

CG

RP

*

*

*

Rel

ativ

e am

ount

of

mR

NA

of

SST

R4

22 day after Control 11 day aftertreatment treatment

Fig. 3. Changes in the expression pattern of NK1 (a), NK2 (b), CGRP (c) and somatostatin (SSTR4) receptors (d) induced by cisplatin neuropathy(n = 4). The results are means ± SEM. �*� indicates that changes in receptor expression exceed at least two times that obtained in samples fromanimals treated with mannitol + isotonic saline (control).

P. Horvath et al. / Neuropeptides 40 (2006) 77–83 81

however, is that cisplatin-induced sensory neuropathybeyond decreasing sensory neuropeptide release, inducesselective over-expression of SSTR4 with no change inthe expression of either CGRP or NK1 and NK2 recep-

tors in rat bronchial tissue. Moreover, this occurred inparallel with a significant increase in plasma somato-statin immunoreactivity with no change in plasmaCGRP and substance P levels.

82 P. Horvath et al. / Neuropeptides 40 (2006) 77–83

Bronchial tissue is densely innervated by unmyeli-nated sensory fibers containing substance P, CGRP,somatostatin and neurokinin A (Lundberg et al., 1983,1984). These fibers originate from the vagus nerve withcell bodies in jugular, nodose and dorsal root ganglia(Springall et al., 1987). As far as the regulatory role ofthese fibers in broncho-motility is concerned, it is closelylinked to the so-called sensory effector function of thesefibers. The essence of this particular function is thatthese fibers release their neurotransmitters into adjacentareas subsequent to activation attained by various stim-uli such as an increase in extracellular K+ concentration,decrease in pH (tissue acidosis) or electrical stimulationeither with or without involvement of local reflexes(Szolcsanyi, 1996; Szolcsanyi et al., 1998; Nemethet al., 2003). The neurotransmitters, once released, pro-duce various responses, for example, in case of CGRPand substance P, changes in vascular tone and perme-ability and/or broncho-constriction (Lundberg et al.,1983, 1984). As a methodological approach, these sen-sory nerve terminals locate in bronchial mucosa superfi-cially enough to release neurotransmitters in response toelectrical field stimulation at parameters selective forneural elements in sufficient quantities both to be detect-able by analytical methods and to induce marked, pre-dominantly NANC broncho-constrictory responses.This enabled our former experimental paradigm ofstudying neurogenic broncho-motiliy in relation to sen-sory neuropeptide release in cisplatin neuropathyin vitro (Szilvassy et al., 2000; Horvath et al., 2005).Since sensory neuropeptides play a major modulatoryrole in NANC bronchial motility, previous studies antic-ipated that a decreased availability of excitatory neuro-peptides to be released by field stimulation wereresponsible for the feeble NANC contractile responsesin bronchial preparations from cisplatin-treated animalssimilar to sensory neuropathy associated with advanceddiabetes (Nemeth et al., 1999b; Szilvassy et al., 2002).Interestingly, a decreased sensory neuropeptide releasefrom bronchial tissue occurred in parallel with a signif-icant increase in plasma somatostatin immunoreactivity,whereas plasma levels of the other sensory neuropep-tides such as CGRP and substance P did not changein neuropathy produced by either diabetes or neuro-toxic doses of cisplatin as revealed by the results of thepresent work (Szilvassy et al., 2002). As far as theexplanation for the increased plasma level of somato-statin in our diabetes models is concerned, we postu-lated that it resulted from hyperglycemia, since therelease mechanism of somatostatin from pancreaticdelta cells regulated by ATP-sensitive potassiumchannels resembles that seen for insulin in beta cells(Nemeth et al., 1999b; Szilvassy et al., 2002). Never-theless, cisplatin neuropathy did not modify blood glu-cose level; therefore the cisplatin neuropathy-inducedrelative hypersomatostatinaemia (elevated plasma levels

of somatostatin) should be attributed to othermechanisms.

The most striking original finding of the presentwork, however, is that hypersomatostatinaemia seen inanimals with cisplatin-induced neuropathy is accompa-nied by an increased expression of SST4 receptors, atleast in bronchial tissue. These receptors have beenshown to mediate anti-inflammatory and analgesiceffects underpinned by a suppression of neuropeptiderelease with no influence on insulin secretion (Helyeset al., 2001; Pinter et al., 2002; Olias et al., 2004). Takenthe increased SSTR4 expression together with hyperso-matostatinaemia it is strongly suggested that cisplatinmight be of particular importance as a therapeutic toolin patients with painful endocrine tumors.

Acknowledgments

This work was supported by grants from the Hungar-ian Ministry of Education (OTKA T043467, T046244,D45922) and Ministry of Health (ETT-03597/2003 andETT-585/2003, NKFP 3900/0/27/117T/01). Jozsef Ne-meth was supported by the Szechenyi fellowship fromthe Hungarian Ministry of Education.

References

Baluk, P., Bowden, J.J., Lefevre, P.M., McDonald, D.M., 1997.Upregulation of substance P receptors in angiogenesis associatedwith chronic airway inflammation in rats. Am. J. Physiol. 273,L565–L571.

Bardos, G., Moricz, K., Jaszlits, L., Rabloczky, G., Tory, K., Racz, I.,Bernath, S., Sumegi, B., Farkas, B., Literati-Nagy, B., Literati-Nagy, P., 2003. BGP-15, a hydroximic acid derivative, protectsagainst cisplatin- or taxol-induced peripheral neuropathy in rats.Toxicol. Appl. Pharmacol. 190, 9–16.

Bernard, P.S., Wittwer, C.T., 2002. Real-time PCR technology forcancer diagnostics. Clin. Chem. 48, 1178–1185.

Helyes, Z., Pinter, E., Nemeth, J., Keri, G., Than, M., Oroszi, G.,Horvath, A., Szolcsanyi, J., 2001. Anti-inflammatory effect ofsynthetic somatostatin analogues in the rat. Br. J. Pharmacol. 134,1571–1579.

Horvath, P., Szilvassy, J., Nemeth, J., Peitl, B., Szilasi, M., Szilvassy,Z., 2005. Decreased sensory neuropeptide release in isolatedbronchi of rats with cisplatin-induced neuropathy. Eur. J. Phar-macol. 507, 247–252.

Janig, W., Lisney, S.J., 1989. Small diameter myelinated afferentsproduce vasodilatation but not plasma extravasation in rat skin. J.Physiol. 415, 477–486.

Lundberg, J.M., Martling, C.R., Saria, A., 1983. Substance P andcapsaicin-induced contraction of human bronchi. Acta Physiol.Scand. 119, 49–53.

Lundberg, J.M., Hokfelt, T., Martling, C.R., Saria, A., Cuello, C.,1984. Substance P-immunoreactive sensory nerves in the lowerrespiratory tract of various mammals including man. Cell TissueRes. 235, 251–261.

Matthews, D.R., Hosker, J.P., Rudenski, A.S., Naylor, B.A., Treacher,D.F., Turner, R.C., 1985. Homeostasis model assessment: insulinresistance and beta-cell function from fasting plasma glucose andinsulin concentrations in man. Diabetologia 28, 412–419.

P. Horvath et al. / Neuropeptides 40 (2006) 77–83 83

Nemeth, J., Helyes, Z., Gorcs, T., Gardi, J., Pinter, E., Szolcsanyi, J.,1996. Development of somatostatin radioimmunoassay for themeasurement of plasma and tissue contents of hormone. ActaPhysiol. Hung. 84, 313–315.

Nemeth, J., Gorcs, T., Helyes, Z., Oroszi, G., Kocsy, T., Pinter, E.,Szolcsanyi, J., 1998. Development of a new sensitive CGRPradioimmunoassay for neuropharmacological research. Neurobi-ology (Bp) 6, 473–475.

Nemeth, J., Szilvassy, Z., Than, M., Oroszi, G., Sari, R., Szolcsanyi, J.,1999a. Decreased sensory neuropeptide release from trachea of ratswith streptozotocin-induced diabetes. Eur. J. Pharmacol. 369, 221–224.

Nemeth, J., Than, M., Sari, R., Peitl, B., Oroszi, G., Farkas, B.,Szolcsanyi, J., Szilvassy, Z., 1999b. Impairment of neurogenicinflammatory and anti-inflammatory responses in diabetic rats.Eur. J. Pharmacol. 386, 83–88.

Nemeth, J., Oroszi, G., Than, M., Helyes, Z.S., Pinter, E., Farkas, B.,Szolcsanyi, J., 1999c. Substance P radioimmunoassay for quanti-tative characterization of sensory neurotransmitter release. Neu-robiology (Bp) 7, 437–444.

Nemeth, J., Oroszi, G., Jakab, B., Magyarlaki, M., Szilvassy, Z., Roth,E., Farkas, B., 2002. 125I-labelling and purification of peptidehormones and bovine serum albumin. J. Radioanal. Nucl. Chem.251, 129–133, Ref Type: Generic.

Nemeth, J., Helyes, Z., Oroszi, G., Jakab, B., Pinter, E., Szilvassy, Z.,Szolcsanyi, J., 2003. Role of voltage-gated cation channels andaxon reflexes in the release of sensory neuropeptides by capsaicinfrom isolated rat trachea. Eur. J. Pharmacol. 458, 313–318.

Olias, G., Viollet, C., Kusserow, H., Epelbaum, J., Meyerhof, W.,2004. Regulation and function of somatostatin receptors. J.Neurochem. 89, 1057–1091.

Pinter, E., Helyes, Z., Nemeth, J., Porszasz, R., Petho, G., Than,M., Keri, G., Horvath, A., Jakab, B., Szolcsanyi, J., 2002.Pharmacological characterisation of the somatostatin analogueTT-232: effects on neurogenic and non-neurogenic inflammationand neuropathic hyperalgesia. Naunyn Schmiedebergs Arch.Pharmacol. 366, 142–150.

Radonic, A., Thulke, S., Mackay, I.M., Landt, O., Siegert, W.,Nitsche, A., 2004. Guideline to reference gene selection forquantitative real-time PCR. Biochem. Biophys. Res. Commun.313, 856–862.

Springall, D.R., Cadieux, A., Oliveira, H., Su, H., Royston, D., Polak,J.M., 1987. Retrograde tracing shows that CGRP-immunoreactivenerves of rat trachea and lung originate from vagal and dorsal rootganglia. J. Auton. Nerv. Syst. 20, 155–166.

Szilvassy, J., Sziklai, I., Racz, T., Horvath, P., Rabloczky, G.,Szilvassy, Z., 2000. Impaired bronchomotor responses to fieldstimulation in guinea-pigs with cisplatin-induced neuropathy. Eur.J. Pharmacol. 403, 259–265.

Szilvassy, J., Sziklai, I., Horvath, P., Szilasi, M., Nemeth, J., Kovacs,P., Szilvassy, Z., 2002. Feeble bronchomotor responses in diabeticrats in association with decreased sensory neuropeptide release.Am. J. Physiol. Lung Cell Mol. Physiol. 282, L1023–L1030.

Szolcsanyi, J., 1996. Capsaicin-sensitive sensory nerve terminals withlocal and systemic efferent functions: facts and scopes of anunorthodox neuroregulatory mechanism. Prog. Brain Res. 113,343–359.

Szolcsanyi, J., Helyes, Z., Oroszi, G., Nemeth, J., Pinter, E., 1998.Release of somatostatin and its role in the mediation of theanti-inflammatory effect induced by antidromic stimulation ofsensory fibres of rat sciatic nerve. Br. J. Pharmacol. 123, 936–942.