Chang-Sheng Wang', Joselyn J. Todd, and Lila O. Vodkin* of · Chang-Sheng Wang', Joselyn J. Todd, and Lila O. Vodkin* Plant and Animal Biotechnology Laboratory, Department of Agronomy,

Plant Physiol. (1 994) 105: 739-748

Chalcone Synthase mRNA and Activity Are Reduced in Yellow Soybean Seed Coats with Dominant I Alleles'

Chang-Sheng Wang', Joselyn J. Todd, and Lila O. Vodkin*

Plant and Animal Biotechnology Laboratory, Department of Agronomy, University of Illinois, Urbana, lllinois 61801

The seed of all wild Clycine accessions have black or brown pigments because of the homozygous recessive i allele in combination with alleles at the R and T loci. In contrast, nearly all commercial soybean (GIycine max) varieties are yellow due to the presence of a dominant allele of the I locus (either I or r l ) that inhibits pigmentation in the seed coats. Spontaneous mutations to the recessive i allele occur in these varieties and result in pigmented seed coats. We have isolated a clone for a soybean dihydroflavonol reductase (DFR) gene using polymerase chain reaction. We examined expression of DFR and two other genes of the flavonoid pathway during soybean seed coat development in a series of near- isogenic isolines that vary in pigmentation as specified by combinations of alleles of the I, R, and T loci. The expression of phenylalanine ammonia-lyase and DFR mRNAs was similar in all of the gene combinations at each stage of seed coat development. In contrast, chalcone synthase (CHS) mRNA was barely detectable at all stages of development in seed coats that carry the dominant I allele that results in yellow seed coats. CHS activity in yellow seed coats (I) was also 7- to 10-fold less than in the pigmented seed coats that have the homozygous recessive i allele. It appears that the dominant I allele results in reduction of CHS mRNA, leading to reduction of CHS activity as the basis for inhibition of anthocyanin and proanthocyanin synthesis in soybean seed coats. A further connection between CHS and the I locus i s indicated by the occurrence of multiple restriction site polymorphisms in genomic DNA blots of the CHS gene family in near-isogenic lines containing alleles of the I locus.

Pigmentation of soybean (Glycine max) seed coats is influ- enced by at least three genes, I , R, and T. The I gene (for inhibitor) controls synthesis and spatial occurrence of pigments in the epidermal layer of the seed coat, whereas R and T are responsible for the specific color (reviewed in Bemard and Weiss, 1973; Palmer and Kilen, 1987). The dominant I allele inhibits pigment accumulation, resulting in a yellow seed coat color at maturity, whereas the homozygous, recessive i allele specifies full pigmentation across the entire seed

We are grateful for a graduate fellowship award from the. Na- tional Research Council of Taiwan and the Taiwan Agricultura1 Research Institute (to C.-S.W.), a Brockson Graduate Fellowship Award, Department of Agronomy, University of Illinois (to J.J.T.), and U.S. Department of Agriculture Competitive Grant 90-37321- 5441 (to L.O.V.).

Present address: Department of Agronomy, Taiwan Agricultura1 Research Institute, Taichung, 41301 Taiwan.

* Corresponding author; fax 1-217-333-9817.

coat. The i' and ik alleles have pigment restricted to the hilum and saddle regions of the seed coat, respectively. The domi- nance relations of the four alleles are I > i' > ik > i, where the relative absence of pigment is the dominant form in each heterozygote. Anthocyanin pigments are found in black ( iRT) and imperfect black ( iRt) seed coats (Buzzell et al., 1987). Recently, we showed that polymeric proanthocyanidins are also synthesized in pigmented seed coats with the homozygous recessive i genotype (Todd and Vodkin, 1993). Proan- thocyanidins are not precursors of anthocyanins but are synthesized as polymeric condensation products of leucoanthocyanins, the precursors of anthocyanins. Brown (irT) and buff ( ir t ) seed coats do not contain anthocyanins but they do synthesize proanthocyanidins. The mechanism of inhibition of anthocyanin and proanthocyanidin synthesis by the I allele is unknown.

Spontaneous mutations of the dominant I alleles ( I or 2%) to the recessive i allele have occurred in many soybean varieties, resulting in isogenic lines with pigmented seed coats. A Pro- rich cell wall protein, PRP1, and its mRNA were found to be significantly lower in the spontaneous mutant line T157 (iRt, imperfect black) than in the parent variety Richland (IRt ), which is yellow (Lindstrom and Vodkin, 1991). The reduction of PRPl protein in homozygous recessive i seed coats is also found in a number of other mutant lines or near-isogenic lines that result from backcrossing (Nicholas et al., 1993). Seed coats with it genotypes (imperfect black or buff) are also defective, with splits and cracks in the seed coat structure.

Because procyanidins in pigmented iT genotypes interfere with RNA extraction using many standard protocols, a modified protocol was developed so that RNA could be extracted from a11 genotypes (Wang and Vodkin, 1994). In this report, we obtained high-quality RNA and examined the expression of severa1 key mRNAs involved in flavonoid synthesis in near-isogenic lines containing various combinations of the I , R, and T alleles. We found that PAL and DFR mRNAs were present in seed coats of a11 genotypes. However, CHS mRNA and CHS activity were both reduced substantially in yellow seed coats, indicating that lack of CHS is the primary cause for the inhibition of anthocyanin and proanthocyanin synthesis by the dominant I allele. Southem blots show that polymorphisms are found in the CHS gene family in isolines that carry the I allele. Thus, the I locus represents a complex

Abbreviations: CHS, chalcone synthase; DFR, dihydroflavonol reductase; PAL, phenylalanine ammonia-lyase.

739

www.plantphysiol.orgon June 18, 2020 - Published by Downloaded from Copyright © 1994 American Society of Plant Biologists. All rights reserved.

http://www.plantphysiol.org

740 Wang et al. Plant Physiol. Vol. 105, 1994

and relatively rare example of a dominant allele that affects expression of a specific flavonoid pathway gene.

MATERIALS AND METHODS

Plant Material and Cenetic Nomenclature

Clark isolines of Glycine max (L.) Merr. were obtained from the United States Department of Agriculture Soybean Germ- plasm Collections (Department of Agronomy, USDA/ARS, University of Illinois, Urbana, IL). A11 soybean lines used were homozygous at the indicated loci; thus, only one allele is indicated in the text and figures. The isolines used in these studies and their genotypes and seed coat colors were the following: L62-1058 (IRT, yellow seed coat with a gray hilum), L64-2244 (IrT, yellow), L67-1084 (IRt, yellow), L70- 4543 (Irt, yellow), L66-14 (iRT, black), L67-3484 (irT, brown), L68-2073 (iRt, imperfect black), L83-930 (irt, buff), L67-2040 (ir", black stripes on brown). The lines RM30 (iR*T, black), RM55 (ir-m55T, striped), and RM38 (iPT, brown) are derivatives of the unstable r-m allele of the R locus (Chandlee and Vodkin, 1989). A11 of these Clark isolines are also homozygous for the W1 gene that produces purple flowers. Plants were grown in the field or greenhouse. For developmental studies, seeds were divided into the following categories by fresh weight of the entire seed: 25 to 50 mg, 50 to 75 mg, 75 to 100 mg, 100 to 200 mg, 200 to 300 mg, 300 to 400 mg, 400 to 500 mg, and >500 mg. Developing seed of 75 to 100 mg fresh weight corresponds to approximately 27 DAF. Seed coats were dissected from seed, frozen in liquid nitrogen, freeze dried, and stored at -2OOC. Altematively, seed coats were dissected, frozen in liquid nitrogen, and stored at -7OOC for CHS assays.

Cloning PCR Products

Two degenerate primers were designed based on the published DFR gene sequences of maize, snapdragon, and petunia (Schwarz-Sommer et al., 1987; Beld et al., 1989). The 17- base 5' primer has the sequence AATGA(G/A)GT(G/A/T/ C)ATCAAGCC and the 20-base 3' primer has the sequence TACATCCATCC(G/A/T/C)GTCAT(C/T)TT. These sequences represent amino acids 98 and 160 of the DFR sequence from petunia (Beld et al., 1989) and were synthesized on an Applied Biosystems model 380A DNA synthesizer at the University of Illinois Biotechnology Center's Genetic En- gineering Facility. These two primers were used to clone the DFR gene from soybean genomic DNA by a PCR (Mullis and Faloona, 1987).

PCR was conducted in a DNA Thermal Cycler 480 (Perkin- Elmer Cetus, Nonvalk, CT) to amplify a partia1 DFR sequence from genomic DNA of varieties T157 and RM55. The reaction mixture consisted of 10 mM Tris-HC1 (pH 8.2), 1 m~ EDTA- Naz, 10 mM NaCl, 1.5 mM MgC12, 200 NM of each dNTP, 1 p~ degenerate primers, 1 pg of genomic DNA template, and 2.5 units of Taq polymerase (Perkin-Elmer Cetus) in a total volume of 100 pL, The reaction mixture was denatured at 95OC for 3 min and put in an ice bath for 2 min before adding the Taq polymerase and an overlay of 100 PL of sterile mineral oil. PCR was performed with a denaturation step (95OC, 1 min), annealing at various temperatures (37OC,

45OC, 55OC, or 6OOC) for 1 or 2 min, and polymerization (72OC, 3 min) for 32 cycles, then extension at 72OC for 7 min.

DNA fragments of 200 and 1000 bp amplified by PCR were fractionated by 1.2% low-melting point agarose gel and cloned directly into a T-tailed vector, pCRlOOO (Invitrogene, San Diego, CA) (Holton and Graham, 1991; Marchuk et al., 1991). Vector and PCR-amplified product were lig;ated over- night and transformed into Escherichia coli JM109 using DMSO containing transformation solution (Chiing et al., 1989). Putative recombinant plasmids were extracted for restrictioin analysis by the "10-min mini prep method" (Zhou et al., 1990). DNA was further treated for sequencing by 2 pL of RNase (10 mg/mL) at 37OC for 30 min, phenoll chloroform extraction, and precipitation with sodium acetate and ethanol. Finally, plasmid DNA was redissolved in H 2 0 and precipitated with 0.4 M NaCl and 6.5% PEG on ice for at least 30 min. The DNA precipitate was collected by cen- trifugaticin and the pellet was dissolved in H20. The DNA was denatured for sequencing using 0.1 volume of 2 N NaOH at room temperature for 5 min and the DNA waj reprecipi- tated by ethanol at -7OOC for 30 min followed by centrifugation. Plasmid DNAs were sequenced by the dideoxynucle- otide chain-tennination method using a Sequenase Version 2.0 kit (United States Biochemical). The 200-bp soybean clone pDFR2OO was identified as a DFR sequence.

Probes for PAL, CHS, DFR, and PRPl

The P,4L probe is a 3.3-kb SstI fragment from a genomic clone (pl'lOSs3.3) containing a soybean PALl gene (Frank and Vodkin, 1991) isolated by screening a soybem genomic library with a Phaseolus vulgaris PAL gene. The probe for CHS was a 2.0-kb HindIII fragment prepared frorri a genomic CHS subclone, pC2H2.0, which was isolated wiíh a P. vulgaris gene and identified by sequence data to have 90% sequence similarity to the P. vulgaris gene (Frank and Vodkin, 1988). The PAL and CHS DNA fragments usecl as probes were further purified from agarose gels using Geneclean I1 silica beatds (Bio 101, La Jolla, CA). A 200-bp DFR fragment was purified by digestion of pDFR200, the PCR clone from genomic DNA, with EcoRI or HindIII and KpnL A 94-bp gene-specific probe for PRPl cell-wall protein gene was purified by digestion of cDNA clone pB1-3 with BstNI and EcoRI (Hong et al., 1989; Lindstrom and Vodkin, 1991). Purified DNA fragments were labeled with [CI -~~PI~ATP by random primer reaction (Feinberg and Vogelstein, 1983).

RNA Extiraction and RNA Cel-Blot Analysis

Total RNAs used in these experiments were extracted from the seed coats of Clark isolines with different combinations of homozygous I, R, and T alleles. It is very difficult to extract high-quality RNA from seed coats of soybean varieties with iRT (black) or irT (brown) genotypes because thesc? seed coats produce large amounts of procyanidins. These polyphenolic compounds bind both proteins and RNA (Nich olas et al., 1993; Todd and Vodkin, 1993) and interfere with extraction, leading to RNA with altered absorbance spectra m d elèctro- phoretic mobility. A modification of the the phencll extraction method that uses a combination of BSA, polyvinylpolypyr-



Expression of Flavonoid Pathway Genes in Soybean Seed Coats 74 1

rolidone, heparin, and proteinase K was developed for RNA extraction from the seed coats of the iT genotypes (Wang and Vodkin, 1994). This method was used to extract RNA from a11 genotypes used in these experiments, resulting in RNAs that showed no noticeable difference in quality between genotypes and developmental stages, as determined by absorbance spectra, ethidium bromide staining of rRNA, and mRNA hybridization.

Total RNA was extracted from 50 to 100 mg of lyophilized seed coats. Ethidium bromide (400 ng) was added to each 1O-pg sample of total RNA that was electrophoresed in 1.2% agarose/3% formaldehyde gels (Maniatis et al., 1982). After photography, the gels were soaked in 1 0 ~ SSC (1.5 M NaCl, 0.15 M sodium citrate) for 30 min, then blotted onto nitrocellulose membranes by capillary action with 1OX SSC over- night. The RNA was cross-linked to the filter with UV radiation by a UV-Crosslinker (Stratagene). Prehybridization was conducted in solution containing 5X SSC (0.75 M NaCl, 75 mM sodium citrate), 5% dextran sulfate, 20 mM sodium phos- phate (pH 6.8), 1% SDS, and 100 g / m L denatured calf thymus DNA at 68OC for 1 h. Then, the specific [a-3ZF']dATP- labeled DNA probe was added to the hybridization mixture at 2 X 107 cpm/mL and hybridized at 68OC for 16 h. Filters were washed two times with low-stringency solution (2X SSC, 0.5% SDS, and 0.2% sodium pyrophosphate) at room temperature for 30 min, and with high-stringency solution (0.1X SSC, 0.5% SDS, and 0.2% sodium pyrophosphate) at 68OC for 1 h. Exposures were made at -7OOC on Hyper-Film (Amersham) or XAR5 (Kodak) x-ray film with an intensifying screen (DuPont).

Genomic DNA Gel-Blot Analysis

Soybean genomic DNA was isolated from lyophilized leaves following the procedures of Dellaporta et al. (1983) with minor modifications. Phenanthroline (10 mM) was added to the extraction buffer as a nuclease inhibitor, the hexadecyltrimethylammonium bromide step was eliminated, and DNA was purified by CsCl gradient centrifugation. Ge- nomic DNA (10 pg) was digested with the following restriction enzymes: AvaI, BamHI, BstN1, DruI, EcoRI, HaeIII, HindIII, HhaI, HpuII, MspI, SauSAI, SphI, and SsfI. Restricted DNAs were electrophoresed in 0.7% agarose gels, blotted onto nitrocellulose paper by capillary action with 1OX SSC (Maniatis et al., 1982), and cross-linked to the nitrocellulose paper with UV radiation. Prehybridization was conducted in 6X SSC, 5X Denhardt's solution, 0.5% SDS, 100 pg/mL denatured calf thymus DNA at 68OC for at least 1 h, followed by hybridization with 5 x 107 cpm/mL radiolabeled probe in the same buffer ovemight at 68OC. Blots were washed two times for 30 min in low-stringency solution (2X SSC, 0.5% SDS, 0.2% pyrophosphate) at room temperature and then with high-stringency solution (0.1X SSC, 0.5% SDS, 0.1% sodium pyrophosphate) at 6OoC for 1 h or until the back- ground was low. Then they were autoradiographed.

Assay of CHS Activities in Seed Coat Extrads

Extracts for CHS assays were prepared using either 100 mg of fresh seed coats or 25 mg of freeze-dried seed coats

dissected from immature seed. Seed coats were homogenized at 4OC in a prechilled mortar with 1.2 mL of 50 m~ KH2P04 buffer (pH 8.0) containing 20 m~ ascorbic acid. After centrifugation for 10 min at 12,00Og, the supematant served as the enzyme source and was kept on ice at a11 times. Only seed coats from Clark isolines (IRt or iRt) that did not contain procyanidins were assayed, since procyanidins precipitate proteins and interfere with extraction (Todd and Vodkin, 1993).

For the CHS assay a11 substrates were stored frozen at -7OOC. [2-'4C]Malonyl-CoA was obtained from Amersham (1.85 GBq/mmol). The 4-coumaroyl-COA (0.55 mg/mL) was a gift from Richard Dixon (Noble Foundation, Stillwater, OK). The assay buffer consisted of 360 m~ KHJ'O, containing 5.6 m~ DTT and the assay was conducted essentially as described (Edwards and Kessmann, 1992). Fifty microliters of crude enzyme was added to a mixture containing 10 pL of [2-'4C]malonyl-CoA, 15 pL of 4-coumaroyl-CoA, and 25 pL of assay buffer. Incubation was camed out for 30 min at 37OC and was terminated by adding 20 pL of 1.5 mg/mL solution of naringenin. The phenolics were extracted with 200 p L of ethyl acetate. For product separation, TLC was performed with the ethyl acetate fraction containing naringenin chalcone. Ethyl acetate was spotted on SigmaCell Type 100 cellulose plates and developed in one dimension in 30% acetic acid. Following development, TLC plates were analyzed using a PhosphorImager (Molecular Dynamics, Sun- nyvale, CA). Quantitation was accomplished using I4C stand- ards. Additionally, the TLC plates were subjected to autora- diography for visualization of product spots on x-ray film (Hyper-Film, Amersham). Total soluble protein was assayed with the Bradford reagent according to instructions of the supplier (Bio-Rad).

RESULTS

lsolation of a Soybean DFR Sequence by PCR

DFR is responsible for one of the later steps in the flavonoid pathway, namely the conversion of dihydroflavonols into flavan-3,4-cis-diols (the leucoanthocyanins), which are the precursors of both proanthocyanidins and anthocyanidins (Stafford, 1990). DFR has been cloned from severa1 species including maize, snapdragon, and petunia (Schwarz-Sommer et al., 1987; Beld et al., 1989). The DFR sequences from these species are only approximately 65% identical at the nucleotide and amino acid level. We chose to isolate a soybean DFR sequence by PCR using regions of similarity between the maize, petunia, and snapdragon genes to design degenerate primers as described in 'Materials and Methods." The primers are predicted to amplify a 200-bp region of a DFR gene, assuming that there are no inbons within the 200-base region in soybean.

Figure 1 shows the PCR products using the two degenerate primers with soybean genomic DNA at different annealing temperatures. The most intense product is a 1000-bp fragment produced with 37OC, 45OC, and 55OC annealing temperatures. Based on the size of the genes in the other three species, a fragment of 200 bp is expected to be amplified with these two primers. A fragment of 200 bp is found but it




1 2 3 4 5 6 7 8 1 2 3 4 5 6 7 8

tic

1000

200

1000

200 ti37 45 55 60 37 45 55 60

Annealing Temperature ('C)37 45 55 60 37 45 55 60

Annealing Temperature (°C)

Figure 1. Amplification of putative DFR sequences from soybean.Left, One microgram of genomic DMA from variety T157 (A) orRM55 (B) was amplified using the degenerate DFR primers and PCRconditions as outlined in "Materials and Methods" with the anneal-ing temperatures shown. PCR products from soybean genomicDNA using primers designed to amplify a DFR sequence. Right,The PCR-amplified products from the gel on the left were blottedto nitrocellulose and probed with pDFR200, a clone representing aspecific 200-bp amplified product.

is much lower in abundance in the reaction products thanthe 1000-bp DNA. Both size fragments were cloned. Figure1 also shows that the 200-bp fragment is not related to the1000-bp fragment, since there is no cross-hybridization be-tween them. Figure 2 shows that the 200-bp amplified DNArepresents a soybean DFR gene with approximately 65%sequence similarity to the other three genes. The internalsequence of the 1000-bp clone (data not shown) is not relatedto DFR except for the sequence of the 5' and 3' primers, andit does not match any known gene present in the DNAsequence data bases. Thus, the degenerate primers were

useful for amplification of a DFR sequence from soybean.However, the reaction products also contained a nonrelatedand more abundant 1000-bp fragment.

Expression of Anthocyanin Genes in SoybeanSeed Coats during Development

We examined expression of several genes involved in thesynthesis of flavonoids during the development of seed coatsfrom near-isogenic isolines of the variety Clark. All lines arehomozygous at the indicated loci. The genotype IRt producesyellow seed coats at maturity and iRt produces imperfectblack seed coats. Figure 3 compares the abundance of PAL,CHS, and DFR mRNAs from the two genotypes at variousdevelopmental stages. The PAL probe hybridizes to a 2.4-kbtranscript that is expressed at all stages and appears toincrease in abundance during development. There is no no-ticeable difference in PAL mRNA expression between IRtand iRt isolines with yellow and imperfect black seed coatcolor, respectively.

CHS mRNA of the soybean seed coat is a 1.4-kb transcript.An obvious difference was found in CHS transcripts in thesetwo isogenic lines for all developmental stages. The levels ofCHS mRNA are much lower in the yellow seed coats (IRt)than in the imperfect black (iRt) seed coats. CHS transcriptlevels were highest in the very early stage (25-75 mg) of seeddevelopment and decreased thereafter during developmentof the imperfect black seed coats (iRt),

A soybean DFR sequence hybridizes to a 1.5-kb transcriptthat is the same size as those reported in petunia, snapdragon,and maize (Beld et al., 1989). In contrast to PAL, DFR mRNAlevels are highest in the young seed coats (25-50 mg) anddecrease as the seed coats mature. No obvious visible differ-ence in developmental expression of DFR was found between

SEED FRESH WEIGHT (MG)

50DFE200 AATQAAGTGATCAASCCTACAATAAATGGGGTACTAQACATCATGAAAGCAM341 .................A.....TG.C..TA.GT.QA.......T...T.PH396 ........A........A...G.CCGO..AA.G...AG......TO..T.ZHA1 .... .O. .A. ...... .3. .GO.QG.A. . .A.QA. .AG.......COO. .

100DFR200 ATGCTTGAAGGCAAAAACTGTGCGAAGGCTAATATTCACGTCCTCAGCCGAH341 ....Q..C.A........C..CAAO.AAT.C..C.....CA.A..T.GT.PH396 . . .TOCT. .A.. .. .C. .A.. .AAO.... .OO.T. .. . .T. .A. .T. .T.ZHA1 . ...AA.G....CGGC..C.....GC.CA.CG.C.....T.....C....

DFR200 OAACCCTCAACOTTATTGAGCGCCAAAAGCCCaTTTTCGACQAC——ACAAH341 .G. .TG.A. .T.. .GAA. .A.A. . .0. .A. .A. .C.AT. .T. .A---. . .PH396 ....T...O.T..OCAA. ...AA. ....AC——. ... .T.T.. .CAO. .CZMA1 .0. .GO. ... .C.GOAG. .A. .G. .G.Q. . . .. .C.A. .... .G——OA.

150DFH200 TGCTGGAGTGACGTTGAGTTT————TGCCGTAGAGTTAAGATGACCGGAAM341PH396ZMA1

GAT.CC..... .A.G.AT. .C————ATTAACTCCAAA. . A. . . . .T. . .A.......C...T.G..C..CATATA...--..-..--....... .A. ..A......CC.....C..C..C————......C.C..C............

200DFR200 TGGATOTAAH341 ........PH396 ........ZHA1

Figure 2. Comparison of the soybean DFR200 sequence to DFRsequences from snapdragon (AM341), petunia (PH396), and maize(ZMA1). Dots indicate the same sequence, and dashes are includedto maximize the alignment.

-1.5

Figure 3. Expression of anthocyanin pathway gene expression dur-ing seed-coat development of Clark isolines with genotypes IRt(yellow) and iRt (imperfect black). RNAs were extracted from seedcoats dissected from seed of the indicated fresh weight range andgenotype. Total RNAs (10 ^g/lane) were fractionated on formalde-hyde agarose gels, blotted to nitrocellulose membranes, and hy-bridized with probes specific for PAL (A), CHS (B), or DFR (C). www.plantphysiol.orgon June 18, 2020 - Published by Downloaded from

Copyright © 1994 American Society of Plant Biologists. All rights reserved.


Expression of Flavonoid Pathway Genes in Soybean Seed Coats 743

Genotype of Clark Isollne

^ac t. as i. oc as t C.

(A)PAL -2.4

(C)DFR -1.6

Figure 4. Effect of genotype on expression of anthocyanin pathwaygenes in soybean seed coats. RNAs were extracted from seed coatsof immature seeds (25-50 mg fresh weight) of Clark isolines withthe indicated genotypes. Total RNAs (10 jig/lane) were fractionatedon formaldehyde agarose gels, visualized by UV, blotted to nitro-cellulose membranes, and hybridized with probes specific for PAL(A), CHS (B), or DFR (C). The same RNA preparations were usedfor all three gels. One lane containing RNA from the genotype ;V*Twas spliced from each autoradiograph because of a very weakhybridization signal that resulted from RNA degradation as indi-cated by ethidium bromide staining. The pattern of PAL, DFR, andCHS expression in the if*T seed coats is similar to that of the otherseven lines containing the homozygous recessive / genotype asdetermined by independent extractions and RNA blots (Fig. 6 anddata not shown).

homozygous recessive j allele (Fig. 4). However, there is nomajor difference between the DFR transcript level within thefour isolines of the / genotype and the eight isolines of the igenotype in combination with the R and T genes. The resultssuggest that both R and T genes, which influence soybeanseed coat color, have no effect on expression of the DFRgene.

CHS Activity Is Reduced in Yellow (lt) Compared toPigmented (it) Seed Coats

We assayed the levels of CHS activity to determine whetherthe reduction in mRNA as detected on the RNA gel blots wasreflected in the activity of the enzyme in developing seedcoats. Figure 5 shows that CHS activity per microgram ofsoluble protein is significantly lower in seed coats with thedominant / allele (yellow) than in the pigmented seed coatswith the recessive i allele. The reduction in CHS activity wasfound in seed coats from two developmental stages of 50 to100 mg and 200 to 300 mg. Interestingly, the lyophilizedseed coats have a higher activity of CHS than did the seedcoats stored frozen at -70°C, indicating that lyophilizationwas an effective method of long-term storage of the seedcoats for CHS activity.

Figure 5 and Table I show that the reduction in CHSactivity in the nonpigmented seed coats (It) is approximately7- to 10-fold less compared to the pigmented seed coats (it).Thus, the reduction in CHS mRNA in yellow seed coats isreflected in the activity of the enzyme in the developing seedcoats.

the yellow seed coats (IRt) and the imperfect black seed coat(iRt) isoline.

Expression of Anthocyanin Genes in Seed Coats ofSoybean Isolines with Combinations of the /, R, andT Alleles

We compared 12 Clark isolines containing various combi-nations of the I, R, and T alleles to determine whether therewere any other genotypic effects on expression of the threeanthocyanin pathway genes. Total RNA was extracted fromyoung seed coats of the 25- to 50-mg seed weight range andanalyzed by RNA blotting using the PAL, CHS, and DFRprobes. Both PAL and DFR mRNAs are expressed in allgenotypes. In contrast, Figure 4 shows that the four isolineswith the dominant / allele had much lower levels of CHSmRNA compared to all eight Clark isolines with the i geno-type. These results indicate that transcripts of the CHS genewere barely detectable in the seed coats of genotypes con-taining the dominant 1 allele, which also inhibits anthocyaninsynthesis. The difference in CHS expression is dependentonly on the allele at the / locus and is independent of any Ror T alleles present.

In contrast to the CHS gene, the level of DFR mRNA wasslightly lower in the seed coats of a genotype containing the

// it It it It50-100 mg 50-100 mg 200-300 mg 200-300 mg 50-75 mg

FrozenSeed Coat*

LyophilizedSeed Coats

Figure 5. Histogram comparing CHS activity in Clark isolines withgenotypes IRt (yellow) and iRt (imperfect black). The seed coatswere frozen in liquid nitrogen and stored at —70°C or were lyoph-ilized and stored before extraction. Total soluble protein was ex-tracted from immature seed coats dissected from seed of theindicated fresh weight range and genotype. CHS was assayed asdescribed in "Materials and Methods" and error bars were deter-mined from three independent experiments. www.plantphysiol.orgon June 18, 2020 - Published by Downloaded from



744 Wang et al. Plant Physiol. Vol. 105,1994

Table I. CHS activities in immature soybean seed coats of differentgenotypes

Genotype(Phenotype) Sample Description' pmol deoxychalcone/Mg

total soluble protein1"

lt (Yellow) Frozen, 50-100 mg 0.013 ± 0.006;'t (Imperfect black) Frozen, 50-100 mg 0.087 ± 0.050;t (Yellow) Frozen, 200-300 mg 0.025it (Imperfect black) Frozen, 200-300 mg 0.273 ±0.109lt (Yellow) Lyophilized, 50-75 mg 0.037it (Imperfect black) Lyophilized, 50-75 mg 0.432 ±0.151

a Seed coats were dissected from seed of the indicated weightrange and genotype and stored at —70°C or lyophilized beforeuse. b so values were calculated from three independent ex-periments.

PRP1 mRNA Is Also Affected by Seed Color Genotype

We have previously shown that the protein and RNA fora specific cell-wall protein, PRP1, is higher in developingseed coats of Richland (IRt, yellow) than in the spontaneousmutant isoline, T157 (iRt,), which has imperfect black andstructurally defective seed coats (Lindstrom and Vodkin,1991). We examined expression of the PRP1 mRNA in the12 Clark isolines using the modified extraction method thatis effective for all genotypes, including black (i'RT) and brown(iRT), which produce procyanidins. Figure 6 shows that theamount of PRP1 mRNA is higher in all of the / isolines(yellow) than in the pigmented lines with the homozygousrecessive i allele. The higher level of PRP1 mRNA in yellowseed coats is the opposite of the effect of this genotype onexpression of CHS, which is reduced in the yellow seed coatsas shown when the same RNA samples are analyzed (Fig. 6).Table II shows a summary of the influence of seed-coatgenotype on seed-coat color, structure, procyanidin content,and CHS mRNA and activity levels as contrasted to PRP1mRNA and protein levels. The mRNA abundance for thecell-wall PRP1 protein is an average of 50% less in allpigmented isolines with the homozygous recessive i geno-type. Seed-coat structure is also defective in those isolinesthat carry the double recessive it combination, implying anepistatic interaction of cell-wall proteins and flavonoids withseed-coat structure.

CHS Genomic DNA Polymorphisms in Near-lsogenic Lines

Soybean genomic DNA extracted from Clark isolines wasdigested with 12 restriction enzymes and hybridized with aCHS probe. Figure 7A shows that multiple DNA polymor-phisms were found between I and i genotypes as illustratedfor DNA cleaved with Hindlll, Sphl, and Hhul. For example,two bands of approximately 11.0 and 2.3 kb are found in thegenotypes containing the dominant / allele but do not appearin the genotypes containing the recessive i allele, except forthe iRt isoline (Fig. 7A, lane 11). Similarly, restriction frag-ment-length polymorphisms in the CHS pattern of the /versus ;' genotypes digested with Sphl and Hhal are apparent.Polymorphisms between 1 and i genotypes were also foundwith Aval, BamHI, BsfNl, Oral, EcoRI, Hpall, Mspl, and Ssfl(data not shown). In contrast, no polymorphisms were found

between any of the isolines digested with six of the sameenzymes and probed with PAL (data not shown) or DFRsequences (Fig. 7B). CHS consists of a small multigene familyof at least seven members (Akada et al., 1993); PAL is likelyto be a small multigene family of approximately three mem-bers (Frank and Vodkin, 1991), and Figure 7B shows thatDFR may also consist of three genomic sequences in soybeanas it does in petunia (Beld et al., 1989).

The variety Clark has the genotype i'RT (yellow seed coatwith black hilum) and was used as the recurrent parent inthe backcrosses that created the isolines with various /, R,and T combinations. The four Clark isolines containing thedominant / gene each have the same nonrecurrent parent asthe source of the / allele, and each shows the same restrictionprofiles (Fig. 7A). The fact that the variant CHS pattern ofthe nonrecurrent parent was maintained during creation ofthese isolines indicates a linkage between the / allele and thevariant CHS bands. Likewise, the source of seven of eightClark isolines containing the recessive i allele traces to thesame spontaneous mutation of f to i in Clark. The source ofthe i allele in the other line (genotype iRt) traces to anindependent spontaneous mutation of the i1 allele to i inClark. Interestingly, this is the only isoline that has a differentpattern (Fig. 7A, lane 11). We have confirmed that the pattern

Qonotype ol Clark Isoline

>- K -« i. et * 3

(A)PRP1

(C)CHS

Figure 6. Opposite effects on PRP1 cell-wall protein and CHSmRNAs by the / locus. RNAs were extracted from seed coats ofimmature seeds (25-50 mg fresh weight) of Clark isolines with theindicated genotypes. Equal loadings of RNA were judged by ethid-ium bromide staining. A, PRP1 mRNAs detected in 1 /tg of totalseed coat RNAs; B, ethidium bromide staining of 1 /ig of total RNA;C, CHS mRNAs detected in 10 /ig of total RNA; D, ethidium bromidestaining of 10 11% of total RNA. The molecular masses are indicatedin kb.




Table II. Effect of seed color genotype on CHS and cell-wall protein gene expression Chalcone Synthaseb PRPlb.'

Procyanidin" Seed-Coat

Seed-Coat Color Seed-Coat

Cenotype Structure RNA Activity RNA Protein

/ ,, - -d Yellow Normal No 10-15 10-15 1 O0 1 O0 i, R, T Black Normal Yes 1 O0 ND' -50 ND i, r, T Brown Normal Yes 1 O0 ND -50 N D i, R, t lmperfect black Defective No 1 O0 1 O0 -50 20-50 i, r, t Buff Defective No 1 O0 N D -50 20-50

a Presence of procyanidins that interfere with protein and RNA extraction (data from Todd and Vodkin, 1993). Approximate values are relative to the highest level as 100. RNA data were determined from densitometry of autoradiographs including those of Figure 6. Protein data were determined by immunoblotting of equal amounts of total protein (Lindstrom and Vodkin, 1991; Nicholas et al., 1993). Either dominant or recessive alleles at the R and T loci. e ND, Not determined.

in iRt is similar to the parent source of the i allele (data not shown).

DlSCUSSlON

CHS mRNA and Activity Are Reduced in Yellow Seed Coats

I, R, and T are three genes involved in the pigmentation of the epidermal layer of the soybean seed coat. Immature seed coats of Clark are green until Chl begins to degrade when the seed fresh weight is approximately 300 mg, leading to a yellow seed coat at maturity in plants with the dominant I or i' genotypes. Visible anthocyanins that begin to accumulate coincident with Chl degradation result in black ( iRT) or imperfect black ( iRt) mature seed coats in plants with the homozygous recessive i genotype (Buzzell et al., 1987). Brown (irT) and buff (irt) do not contain anthocyanins but do contain polymeric procyanidin and propelargonidin, respectively (Todd and Vodkin, 1993).

Neither the I , R, or T genes have been cloned and only the T gene is defined at the biochemical level. The T gene is thought to encode a microsomal 3' flavonoid hydroxylase (Buzzell et al., 1987; Todd and Vodkin, 1993) because the major anthocyanins (cyanidin-3-monoglucoside) and proanthocyanidins (procyanidin) that are present in T soybean seed coats have hydroxyl groups at the 3' position of the flavonoid B ring. The R gene is likely to act at a step specific to the anthocyanin pathway because procyanidins are present in both black ( iRT) and brown (irT) seed coats (Todd and Vodkin, 1993), but anthocyanins are absent in brown (irT) and buff (irt) seed coats (Todd and Vodkin, 1993). Little is known about the anthocyanin-forming enzymes that act just after leucoanthocyanin production in plants. Phenotypic expression of the R and T alleles are hypostatic (or subordi- nate) to the I allele. Thus, the I gene could be a regulatory gene that inhibits the anthocyanin and proanthocyanidin pathway by inhibiting key enzymes in the flavonoid pathway.

Sequences representing soybean PAL and CHS have been cloned (Frank and Vodkin, 1988, 1991; Akada et al., 1993) and we report isolation of a soybean DFR sequence using PCR (Figs. 1 and 2). We then examined the expression of mRNAs for these three genes, PAL, CHS, and DFR, whose functions have been well characterized in the flavonoid and

anthocyanin pathways in order to determine whether the I , R, or T alleles affect their expression during seed-coat development. PAL catalyzes the conversion of Phe to cinnamic acid, a common precursor for many secondary products in plants, including lignins, flavonoids, phytoalexins, and anthocyanins. In soybean, PAL mRNA was expressed at the early stages of seed-coat development and the expression level increased slightly as seed coats matured (Fig. 3). In soybean isolines containing the homozygous recessive i allele, CHS mRNAs were more highly expressed in the early stages of seed-coat development and then decreased as the seed coats matured. Similarly, DFR transcripts exhibited a pattem similar to that of CHS in both IRt and iRt isolines during seed-coat development. The presence of PAL, CHS, and DFR at high levels, even in the young seed coats of i genotype before accumulation of visible anthocyanins, is consistent with the fact that the proanthocyanidin pathway is active even in the very young seed coats of a11 genotypes that are pigmented (Todd and Vodkin, 1993).

We found a major difference between the levels of CHS mRNAs in a11 isolines that contained the dominant I allele (yellow) versus the recessive i allele (pigmented) (Figs. 3 and 4). In a11 cases, CHS mRNA was significantly reduced in seed coats with the dominant I allele, which results in yellow seed coats devoid of anthocyanins and proanthocyanins. The reduction in CHS mRNA was also correlated with a 7- to 10-fold reduction in the levels of enzymic activity (Fig. 5; Table I).

Our data suggest that the primary reason for the lack of anthocyanin pigments in the yellow soybean seed coats is because of the reduction of CHS mRNA and activity. CHS catalyzes a critica1 step in the flavonoid biosynthetic pathway by condensing three molecules of malonyl-COA with one molecule of 4-coumaroyl-COA to form naringenin chalcone, the first 15-carbon intermediate of the pathway (Stafford, 1990). CHS is often a rate-limiting step in the pathway and is the first enzyme committed to the flavonoid pathway. The reduction of CHS mRNA and CHS activity was apparent at a11 stages of seed-coat development, even when seed coats are very young and proanthocyanidins are accumulating but before anthocyanins are synthesized. Lower levels of CHS mRNA and CHS activity in seed coats with the dominant I allele could lead to a deficit of naringenin chalcone as a substrate for subsequent enzymic steps of the flavonoid,




Gmotype of Clark Itolin* B Genotype of Clark Isollne

as i* as t et as as v. a: ^E E Kt >- i.

11kb-»

Hind III

2.3kb-» »-«.• .«•1

Hind III

Hhal

••ssfttt i t i i

'•BillI!Sstl

« » % « » « | | t « w * t « *

Figure 7. Association of / locus alleles with polymorphisms in the CHS gene family. Cenomic DMA was extracted fromClark isolines with the indicated genotypes, digested with the indicated restriction enzyme, transferred to nitrocellulose,and probed with the CHS clone (A) or the DFR sequence (B). The arrows mark polymorphisms found in the CHSrestriction patterns.

proanthocyanin, and anthocyanin pathways. Thus, althoughDFR mRNA is expressed to an equal or greater extent in the/ seed coats compared to i genotypes, little substrate is likelyto be available for action of the DFR enzyme in the yellowseed coats.

An Unusual Relationship between CHS and theDominant / Alleles

CHS is encoded by a small gene family in many plantspecies. In soybean, there are at least seven closely relatedgenes in the culrivar Williams (f genotype), of which six havebeen isolated and sequenced (Akada et al., 1993). Some ofthe soybean CHS genes are linked as a cluster within a 10-kb genomic region (Akada et al., 1991). Most of the genesshare 90% or greater nucleotide similarity but very little isknown about the tissue-specific expression of each memberof the CHS gene family.

Defined genetic loci are known to encode CHS in otherplants. For example, the nivea locus in snapdragon (Antir-rhinum majus) encodes CHS, and recessive alleles result inwhite flowers (Sommer et al., 1988). The dominant natureand pattern forms conditioned by the soybean 1 locus aredifficult to explain if the / locus encodes a seed-coat-specific

member of the CHS gene family. However, two semidomi-nant alleles of the nivea locus in snapdragon were derivedfrom structural alterations caused by the action of the Tam3transposable element at the nivea locus. The semidominantniv-525 allele has a 207-bp inverted duplication of the pro-moter and 5' transcribed region of the nivea gene (Coen andCarpenter, 1988), and the niv-572 allele carries three trun-cated copies of the nivea gene with one of these invertedrelative to the other two (Bollmann et al., 1991). The semi-dominant nature of these alleles is not due to antisense RNAproduction but is speculated to be due to direct interaction orrecognitions between alleles by an unknown mechanism,perhaps similar to transvection phenomena in Drosophila orco-suppression of gene activity in transgenic plants (Napoliet al., 1990; Bollmann et al., 1991).

Alternatively, the J gene could be a regulatory gene of theanthocyanin pathway and other seed coat mRNAs. In yellowseed coats with the dominant / allele, the cell-wall proteinPRP1 and its mRNA are more abundant than pigmented seedcoats with the homozygous recessive i allele (Lindsrrom andVodkin, 1991; Nicholas et al., 1993). Compared to PRP1, the/ allele has the opposite effect on CHS transcripts that areless abundant in all isolines containing the / allele comparedto the recessive i allele (Fig. 6; Table II). The effect of www.plantphysiol.orgon June 18, 2020 - Published by Downloaded from




anthocyanin genes on cell-wall proteins and seed-coat structure in soybeans is unusual. Defined anthocyanin pathway mutations in maize, snapdragon, and petunia have not been shown to affect the structural integrity of pericarp, aleurone, or flower tissues.

The maize R, B, Lc, and Cl loci are regulatory genes of the anthocyanin pathway that encode transcriptional activators that likely bind 5' sequences of the target genes (Cone et al., 1986; Paz-Ares et al., 1987; Chandler et al., 1989; Ludwig et al., 1989). The C1 locus regulates expression of severa1 structural genes in the anthocyanin pathway including C2 (CHS), A1 (DFR), and Bzl (UDP-flavonoid glucosyltransferase). Al- though C1 is normally a transcriptional activator, the dominant C1 -I (inhibitor) allele produces an altered protein that putatively behaves like a repressor of expression of the target loci (Paz-Ares et al., 1990). Despite these parallels, the soybean I locus results in reduced CHS mRNAs but does not reduce DFR expression. The regulatory genes Delila and Eluta in snapdragon do not affect CHS gene expression in flowers but do regulate expression of later steps of the pathway including flavanone 3-hydroxylase, DFR, and UDP-flavonoid glucosyltransferase (Martin et al., 1991). Thus, there are a number of differences between the control of pigmentation in soybean seed coats and maize aleurone and flower systems.

Polymorphisms found in CHS genes are associated with the I and i alleles. The enzyme HindIII does not cleave within the coding region and its pattem is representative of individ- ual genes or gene clusters (Akada et al., 1991). Two additional HindIII restriction fragments of approximately 11 and 2.3 kb were found in the I genotypes but were absent in the i genotypes (Fig. 7). Interestingly, significant differences in CHS DNA polymorphism were also found between DNAs of the I genotype and the i genotype with 10 of the 12 restriction enzymes tested. These multiple-restriction-site polymorphisms indicate large duplications, deletions, or inser- tions near one or more of the CHS genes. The CHS restriction polymorphisms in the isolines also trace to the nonrecurrent parent source of the I or i allele. This indicates either a physical linkage of a CHS gene to the I locus or the possibility that I encodes a CHS gene or represents a structural change very close to a CHS gene. We are currently testing the linkage of CHS and I in progeny of crosses and are examining the correlations in changes of CHS restriction polymorphisms in spontaneous mutations of the dominant I or i' alleles to the recessive i form that results in pigmented seed coats.

In summary, our results point to an unusual method of regulation of pigmentation in soybean seed coats by the I locus. The dominant I locus leads to a reduction in CHS mRNA and enzymic activity leading to yellow seed coats as the primary biochemical lesion. The genomic DNA blots of near-isogenic lines indicate either that there is a physical linkage of I and CHS genes or that I encodes a CHS gene. However, the genetic and regulatory mechanism is more complicated than a simple mutation of a CHS gene leading to a recessive allele with a colorless phenotype because the absence of color is dominant and alleles of the I locus condition pattems of pigmentation on the seed coat. AI1 commercially used soybean varieties carry either the I or i' alleles that specify yellow seed coats except for the rare spontaneous reversions to a recessive i allele. Thousands of

existing accessions of wild annual and perennial Glycine species are pigmented and none are colorless, indicating that the original occurrence of the mutation (I or i') resulting in the colorless phenotype was actively selected by human intervention during domestication of Glycine and does not survive in natural populations.

ACKNOWLEDCMENT

We are indebted to Dr. Richard Dixon of the Samuel Roberts Noble Foundation (Ardmore, OK) for the gift of 4-coumaroyl-COA.

Received December 7, 1993; accepted March 1, 1994. Copyright Clearance Center: 0032-0889/94/105/0739/10.

LITERATURE CITED

Akada S, Kung SD, Dube SK (1991) The nucleotide sequence of gene 1 of the soybean chalcone synthase multigene family. Plant Mo1 Biol 1 6 751-752

Akada S, Kung SD, Dube SK (1993) Nucleotide sequence and putative regulatory elements of a nodule-development-specific member of the soybean (Glycine max) chalcone synthase multigene family, GMchs 7. Plant PhysiollO2 321-323

Beld M, Martin C, Huits H, Stuitje AR, Gerats AGM (1989) Flavonoid synthesis in Petunia hybrida: partia1 characterization of dihydroflavonol-4-reductase genes. Plant Mo1 Bioll3 491-502

Bernard RL, Weiss MG (1973) Qualitative genetics. Zn BE Caldwell, ed, Soybeans: Improvement, Production and Uses, Ed 1. American Society of Agronomy, Madison, W1, pp 117-149

Bollmann J, Carpenter R, Coen ES (1991) Allelic interactions at the nivea locus of Antirrhinum. Plant Cel l3 1327-1336

Buzzell RI, Buttey BR, MacTavish DC (1987) Biochemical genetics of black pigmentation of soybean seed. J Hered 7 8 53-54

Chandlee JM, Vodkin LO (1989) Unstable expression of a soybean gene during seed coat development. Theor Appl Genet 77:

Chandler VL, Radicella,.JP, Robbins RP, Chen J, Turks D (1989) Two regulatory genes of the maize anthocyanin pathway are homologous: isolation of B utilizing R genomic sequences. Plant Celll: 1175-1183

Chung CT, Niemela SL, Miller, RH (1989) One-step preparation of competent Escherichia coli: transformation and storage of bacterial cells in the same solution. Proc Natl Acad Sci USA 8 6 2172-2175

Coen ES, Carpenter R (1988) A semidominant allele, niv-525, acts in trans to inhibit expression of its wild-type homologue in Antir- rhinum majus. EMBO J 7: 877-883

Cone KC, Burr FA, Burr B (1986) Molecular analysis of the maize anthocyanin regulatory locus CZ. Proc Natl Acad Sci USA 8 3

Dellaporta SL, Wood J, Hicks JB (1983) A rapid DNA miniprepar- ation. Version 11. Plant Mo1 Biol Rep 2 21-42

Edwards R, Kessmann H (1992) Isoflavonoids, phytoalexins, and their biosynthetic enzymes. In SJ Gurr, MJ McPhersen, DJ Bowles, eds, Molecular Plant Pathology: A Practical Approach, Vol 2. IRL Press, Oxford, UK, pp 45-62

Feinberg AP, Vogelstein B (1983) A technique for radiolabeling DNA restriction fragments to high specific activity. Ana1 Biochem

Frank RL, Vodkin LO (1988) Identification of chalcone synthase and phenylalanine ammonia lyase genes in soybean. Soybean Genetics Newsletter 15: 181

Frank RL, Vodkin LO (1991) Sequence and structure of a phenylalanine ammonia-lyase gene from Glycine max. DNA Sequence 1:

Holton TA, Graham MW (1991) A simple and efficient method for direct cloning of PCR products using ddT-tailed vectors. Nucleic Acids Res 19: 1156

Hong JC, Hagao RT, Key JL (1989) Developmentally regulated expression of soybean proline-rich cell wall protein genes. Plant Cell 1: 937-943

587-594

9631-9635

132 6-13

335-346




Lindstrom JT, Vodkin LO (1991) A soybean cell wall protein is affected by seed color genotype. Plant Cel l3 561-571

Ludwig SR, Habera LF, Dellaporta SL, Wessler SR (1989) Lc, a member of the maize R gene family responsible for tissue-specific anthocyanin production, encodes a protein similar to transcriptional activators and contains the myc-homology region. Proc Natl Acad Sci USA 86: 7092-7096

Maniatis T, Fritsch EF, Sambrook J (1982) Molecular Cloning: A Laboratory Manual. Cold Spring Harbor Laboratory Press, Cold Spring Harbor, NY

Marchuk D, Drumm M, Saulino A, Collins FC (1991) Construction of T-vectors, a rapid and general system for direct cloning of unmodified PCR products. Nucleic Acids Res 1 9 1154

Martin C, Prescott A, Mackay S, Bartlett J, Vrijlandt E (1991) Control of anthocyanin biosynthesis in flowers of Antirrhinum majus. Plant J 1: 37-49

Mullis KB, Faloona FA (1987) Speafic synthesis of DNA in vitro via a polymerase-catalyzed chain reaction. Methods Enzymoll55

Napoli C, Lemieux C, Jorgensen R (1990) Introduction of a chimeric chalcone synthase gene into petunia results in reversible co- suppression of homologous genes in truns. Plant Cell2 279-289

Nicholas CD, Lindstrom JT, Vodkin, LO (1993) Variation of proline rich cell wall proteins in soybean lines with anthocyanin mutations. Plant Mo1 Biol21: 145-156

Palmer RG, Kilen TC (1987) Qualitative genetics and cytogenetics.

335-350

In JR Wilcox, ed, Soybeans: Improvement, Productiori, and Uses, Ed 2. American Society of Agronomy, Madison, WI, pp 135-209

paz-Ares J, Ghosal D, Saedler H (1990) Molecular aniilysis of the CI-I alllele of Zea mays: a dominant mutant of the regulatory CI

Paz-Ares J, Ghosal D, Wienand U, Peterson PA, Saeldler H (1987) The regplatory c l locus of Zea mays encodes a protein with homology to myb proto-oncogene products and with stnictural simi- larities to transcriptional activators. EMBO J 5 829-82i3

Schwarz-Sommer ZS, Shepherd N, Tacke E, Gierl A, Rhode W, Leclerc'q L, Mattes M, Berndtgen R, Peterson PA, Saedler H (1987) Influence of transposable elements on the síructure and function of the AI gene of Zea mays. EMBO J 6 287-1294

Sommer IH, Bonas U, Saedler H (1988) Transposon-incluced alterations in the promoter region affect transcription of lhe chalcone synthase gene in Antirrhinum majus. Mo1 Gen Genet 211: 49-55

Stafford 13A (1990) Flavonoid Metabolism. CRC Press, Boca Raton,

Todd JJ, 'Yodkin LO (1993) Pigmented soybean (Glyciiie max) seed coats accumulate proanthocyanidins during development. Plant PhysiollOZ 663-670

Wang CS,, Vodkin LO (1994) Extraction of RNA from tissues containing high levels of procyanidins that bind RNA. P:lant Mo1 Biol Rep 12: 132-145

Zhou C, Yang Y, Jong AY (1990) Mini-prep in ten rninutes. Bio- Techniques 8: 13-14

~OCUS. EMBO J 9 315-321

FL, pp 123-46



Documents

Chang-Sheng Wang', Joselyn J. Todd, and Lila O. Vodkin* of · Chang-Sheng Wang', Joselyn J. Todd, and Lila O. Vodkin* Plant and Animal Biotechnology Laboratory, Department of Agronomy,