Cell Cycle Inhibitory Effects of HIV and SIV Vpr and Vpx ... · of HIV-2 and SIV Vpr were not as pronounced as that of HIV-2 ROD Vpr HIV-1 Vpr. In fact, Vpx from HIV-2 and SIV mac

VIROLOGY 230, 103–112 (1997)ARTICLE NO. VY978459

Cell Cycle Inhibitory Effects of HIV and SIV Vpr and Vpxin the Yeast Schizosaccharomyces pombe

CHENGSHENG ZHANG, COLIN RASMUSSEN,*,†,‡,1 and LUNG-JI CHANG

Department of Medical Microbiology and Immunology, *Department of Anatomy and Cell Biology, †Department of Biochemistry,and ‡Department of Oncology, University of Alberta, Edmonton, Alberta, Canada T6G 2H7

Received November 25, 1996; returned to author for revision December 24, 1996; accepted January 23, 1997

The Vpr gene of human immunodeficiency virus type 1 and type 2 (HIV-1, HIV-2) and simian immunodeficiency virus (SIV)encodes a small nuclear protein which is virion-associated and assists nuclear transport of the preintegration complex.Expression of HIV-1 Vpr has been shown to induce differentiation and prevent proliferation of human cells. HIV-1 Vpr hasalso been shown to arrest cell growth and cause morphological defects in yeast. In contrast, the Vpx gene of HIV-2 andSIV, which shares sequence homology with Vpr, does not seem to inhibit proliferation of human cells. It has been suggestedthat the cell cycle arrest effect of Vpr and Vpx is species and cell-type dependent. In this study, we have taken advantageof a conditional expression system to characterize the growth inhibitory effects of Vpr and Vpx of HIV-1, HIV-2, and SIV inthe fission yeast Schizosaccharomyces pombe. Our results show that both Vpr and/or Vpx of HIV-1, HIV-2, and SIV arrestcell growth in S. pombe, and HIV-1 Vpr is more cytotoxic than HIV-2 or SIV Vpr or Vpx. Flow cytometry analysis indicatedthat yeast cells cease proliferating with DNA contents indicative of arrest in G1 and G2 , with some cells showing signs ofoverreplication of DNA. While the observed cell cycle arrest phenotype was not identical to that observed in mammaliancells, there were similarities of growth arrest phenotype caused by Vpr and Vpx in yeast and mammalian cells. Specifically,the observation that yeast and mammalians cell both arrest in G2 with reduced p34/cdc2 kinase activity indicates that Vprand Vpx interact with conserved target(s) in yeast and mammalian cells. The ability to use genetic analysis to elucidate themechanisms involved makes S. pombe an excellent model system in which to study the effects of Vpr and Vpx on cellularfunction. q 1997 Academic Press

INTRODUCTION of either Vpr or Vpx (Franchini and Reitz, 1994; Subbra-manian and Cohen, 1994; Tristem et al., 1992). HIV-1/

The lentiviruses, human immunodeficiency virus type 1 SIVcpz , SIVmad , and SIVsyk contain the Vpr gene only. HIV-(HIV-1) and type 2 (HIV-2), and simian immunodeficiency 2/SIVsm/SIVmac contains both Vpr and Vpx, whereas SIVagmvirus (SIV), have been identified as the etiologic agents encodes Vpx only. Since the Vpr and Vpx proteins areof human acquired immunodeficiency syndrome (AIDS) found in mature virions, it has been thought they play aand simian AIDS, respectively (Levy, 1995). HIV-1, HIV- role in the early phase of the viral life cycle (Aldrovandi2, and SIV contain, in addition to the gag, pol, and env and Zack, 1996; Cohen et al., 1990; Levy, 1995; Yu et al.,structural genes, small open reading frames encoding 1990). Recent studies suggest that Vpr and the matrixthe accessory proteins Tat, Rev, Nef, Vpr and/or Vpx, protein of HIV-1 are required for nuclear migration of theVpu, and Vif (Vaishnav and Wong-Staal, 1991). These preintegration complex (Bukrinsky et al., 1993; Hein-genes are highly conserved between HIV-1, HIV-2, and zinger et al., 1994). Vpr has also been reported to preventSIV and have been found to play important regulatory establishment of chronically infected HIV-1 producer cellroles during viral replication (Subbramanian and Cohen, lines (Planelles et al., 1996; Rogel et al., 1995). This is1994; Trono, 1995). While these accessory proteins have consistent with an earlier report which showed that HIV-been shown to be dispensable for virus replication in 1 Vpr expression could prevent cell division and inducevitro, animal model studies of the SIVmac virus suggest differentiation of a rhabdomyosarcoma cell line (Levy etthese proteins are important in virus replication and al., 1993). More recent studies have shown that HIV-1pathogenesis in vivo (Aldrovandi and Zack, 1996; Desro- Vpr can arrest the cell cycle in G2 phase in mammaliansiers, 1990; Gibbs et al., 1995; Lang et al., 1993; Trono, cells, possibly via inhibition of p34/cdc2 kinase activity1995). (Bartz et al., 1996; He et al., 1995; Jowett et al., 1995;

The Vpr and Vpx genes are related, with all five groups Paxton et al., 1993; Planelles et al., 1996; Re et al., 1995).of primate lentiviruses containing at least one homologue HIV-1 Vpr has also been reported to arrest cell growth

of yeast (Macreadie et al., 1995; Zhao et al., 1996). Inaddition, HIV-2 and SIV Vpr have been shown to cause1 To whom correspondence and reprint requests should be ad-

dressed. Fax: (403) 492-7660. cell cycle arrest in mammalian cells, although the effects

1030042-6822/97 $25.00Copyright q 1997 by Academic PressAll rights of reproduction in any form reserved.

AID VY 8459 / 6a2c$$$181 03-03-97 15:47:55 vira AP: Virology

104 ZHANG, RASMUSSEN, AND CHANG

of HIV-2 and SIV Vpr were not as pronounced as that of HIV-2ROD Vpr5* primer CTCTCTCATATGGCTGAAGCACCAACAHIV-1 Vpr. In fact, Vpx from HIV-2 and SIVmac did not

induce cell cycle arrest in monkey CV-1 or human HeLa 3* primer AAACGGATCCTTATTGCATGTTTCTAGGHIV-2ROD Vpxand 293 cells (Marzio et al., 1995; Planelles et al., 1996).

The yeast S. pombe has been widely used as a model 5* primer CTCTCTCATATGACAGACCCCAGAGAG3* primer AAACGGATCCTTAGACCAGACCTGGAGGto study the role of a variety of genes in the control of

cell proliferation in eukaryotic cells (Draetta et al., 1987;All PCR products were subcloned into pGEM7Zf(/)Nurse, 1994). Therefore, we reasoned that if expression

and sequenced to ensure that no errors had occurredof Vpr and Vpx proteins in fission yeast could produceduring amplification. The fragments were then excisedobservable phenotypes, it would provide us with an inby digestion with NdeI and BamHI and subcloned intovivo model system with which to study the effects ofthe expression plasmid pREP41. The expression plasmidthese proteins on cell function, especially cell prolifera-pREP41 contains the nmt1 promoter which is repressedtion, and the molecular mechanisms involved. In this re-in the presence of thiamine (Maundrell, 1990). After liga-port, we have studied the effect of HIV-1 Vpr, HIV-2 Vpr/tion into pREP41, each construct was sequenced to en-Vpx, and SIV-Vpr/Vpx expression on cell cycle progres-sure that the orientation and translation start sites weresion in S. pombe. We have found that expression of HIV-correct.1 Vpr in fission yeast blocks cell proliferation with cells

arrested predominantly in the G1 and G2 phases of theCulture and transformation of S. pombecell cycle. In addition HIV-1 Vpr expression was cytotoxic

with cell viability rapidly declining in the presence of The yeast strains used in this study were SP130 (h-,HIV-1 Vpr. In addition, although Vpr expression induced ade6-210, leu1-32) and cdc2-1w and cdc2-3w (Rasmus-polyploidy in yeast as in mammalian cells, the cytotoxic sen and Rasmussen, 1994). The growth medium waseffects in yeast contrasted with previous studies in hu- minimal medium (MM) with or without the supplementsman T cell lines where Vpr expression was found to be of leucine, adenine, and uracil according to the selectioncytostatic rather than cytotoxic (Bartz et al., 1996). Fur- requirements of each particular strain. Standard culturether, although SIV Vpx has been reported to be noncyto- conditions and techniques were used as described (Mor-static in mammalian cells (Paxton et al., 1993; Planelles eno et al., 1991). Strains containing pREP41-based ex-et al., 1996), expression of either HIV-2 Vpr/Vpx or SIV- pression plasmids were routinely grown in medium con-Vpr/Vpx resulted in yeast cell arrest. However, the effect taining 1 mM thiamine–HCl to repress nmt1-dependenton cell viability was not as pronounced as with HIV-1 transcription. To permit expression from the nmt1 pro-Vpr. Expression of the Tat protein produced none of moter, cells were washed with sterile water and thenthese phenotypes, indicating that the effects are specific reinoculated into MM lacking thiamine–HCl. Transfor-to Vpr and Vpx. Thus, these studies indicate that S. mation of S. pombe was carried out by the lithium acetatepombe may be a useful model system with which to procedure as described elsewhere (Moreno et al., 1991).study the processes through which Vpr and Vpx affectcellular function. Western blot analysis of Vpr and Vpx expression

Protein extracts were prepared as described pre-MATERIALS AND METHODSviously (Moreno et al., 1991). For Western blot analysis,

Plasmid construction protein concentrations of extracts were quantified usingthe DC Protein Assay (Bio-Rad). Ten micrograms of pro-The following primer combinations were used to pro-tein from each sample was applied to a 10–20% gradientduce Vpr and Vpx fragments for ligation into the pREP41Tricine–SDS–PAGE gel (NOVEX, Canada). After electro-expression vector. All are listed in the 5*-3* direction.phoresis, the proteins were transferred to nitrocellulosemembranes (Schleicher and Schuell). Filters were air-HIV-1NL4-3 Vpr

5* primer GAGGACATAGGAACAAGCC dried then blocked with 10% dried milk in TBST (50 mMTris, pH 7.5, 150 mM NaCl, 0.3% Tween-20) for 1 hr at3* primer CCCGGATCCTAGGATCTACTGGCTCC

HIV-1NL4-3 Tat room temperature. Filters were then incubated with theprimary antibody (rabbit anti-HIV-1 Vpr, rabbit anti-HIV-15* primer CTCTCTCATATGGAGCCAGTAGATCCT

3* primer AAACGGATCCCTAATCGTACGGATCTGT Tat, rabbit anti-SIV Vpr, or rabbit anti-SIV Vpx) at 1:500to 1:1000 dilution at 47 overnight. This was followed by anSIVMAC239 Vpr

5* primer CAGAGGACATATGGAAGAAAGACCTCC incubation with an HRP-conjugated secondary antibody(Amersham, NA 9340, 1:2000 dilution) at room tempera-3* primer CCCGGATCCCATGCTTCTAGAGGGCGG

SIVMAC239 Vpx ture for 1 hr. After washing the filter, the antibody waslocalized using ECL Western Blotting Detection Reagents5* primer CAGAGGACATATGTCAGATCCCAGGGA

3* primer CCCGGATCCTTATGCTAGTCCTGGAGG (Amersham Life Science).


105INHIBITION OF YEAST CELL CYCLE BY VPR AND VPX

Flow cytometry 18, and 24 hr), an aliquot of culture was harvested, celldensity determined, and approximately 200 cells fromThe cell samples for flow cytometry were preparedeach sample were plated onto thiamine-plus plate. Theas described previously (Alfa et al., 1992). Briefly, yeastplates were incubated at 307 for 4–6 days prior to count-cultures were grown at 307 overnight to a density of 1 1ing colonies.107 cells/ml and cells were collected by centrifugation.

The cells were fixed with 70% ethanol and kept at 47 untilRESULTSuse. For FACS analysis, an aliquot of the fixed cells

(about 3 1 106) was collected and washed once with 1Construction of thiamine-conditional Vpr and Vpx

ml of 50 mM sodium citrate (pH 7.0). The cells wereexpression plasmids

resuspended in 0.5 ml, 50 mM sodium citrate containing0.1 mg/ml RNaseA, and incubated in a 377 water bath To engineer the Vpr and Vpx expression vectors, wefor 2 hr. After incubation, 0.5 ml 50 mM sodium citrate amplified the Vpr gene of the clone HIV-1NL4-3 and thecontaining 2 mg/ml propidium iodide was added to the Vpr and Vpx genes of HIV-2ROD and SIVMAC239 by PCR.cells. The DNA content was determined by FACScan The PCR products were subcloned into pGEM7Zf(/) andanalysis and the data was analyzed using the CellFit sequenced to ensure there were no errors due to theprogram (Becton–Dickinson). PCR. Each fragment was then excised by digestion with

NdeI and BamHI and cloned into the plasmid pREP41,Histone H1 kinase assay3* to the thiamine-repressible nmt1 promoter. pREP41

The yeast protein extract was made as described contains the S. cerevisiae LEU2 gene which comple-above. Cells were lysed using glass beads in a lysis ments the leu1-32 mutation of S. pombe. These plasmidsbuffer composed of 25 mM Tris, pH 8.0, 10 mM MgCl2 , were transformed into the S. pombe strain SP130 (which15 mM EGTA, 0.1% Triton X-100, 0.1 mM NaF, 60 mM b- carries the leu1-32 mutation) and transformants were se-glycerophosphate, 15 mM p-nitrophenylphosphate, 0.1 lected by their ability to grow on minimal medium lackingmM Na orthovanadate, 0.1 mM PMSF, 1 mg/ml leupeptin, leucine. The medium also contained thiamine to prevent10 mg/ml soybean trypsin inhibitor, 1 mg/ml aprotinin, 10 expression of Vpr or Vpx in case their presence wasmg/ml TPCK. Immulon-2 plates (Fisher Scientific) were lethal to S. pombe.coated with a solution of 5 mg p13, purified as describedpreviously (Rasmussen and Rasmussen, 1994) in 100 HIV-1 Vpr, HIV-2 Vpr/Vpx, and SIV Vpr/Vpx arrestml, 50 mM sodium carbonate buffer, pH 9.6, and then S. pombe proliferationincubated at room temperature overnight. The wells were

To determine if expression of either Vpr or Vpx wouldwashed once with PBS, then blocked with PBS con-affect cell proliferation of S. pombe, yeast cells containingtaining 3% BSA for 1 hr at room temperature. To preparethe Vpr or Vpx expression plasmids were grown on me-samples for assay, 200 mg of total protein were mixeddium with or without thiamine. When grown on MM /with an equal volume of PBS containing 1% BSA. Thethiamine (which prevents expression), normal size yeastfinal volume was approximately 100–250 ml. The assaycolonies were formed from yeast cells transformed withsamples were added to the p13-coated microwells andeither the empty pREP41 vector, HIV-1 tat, HIV-1 Vpr, HIV-incubated at room temperature with slow constant shak-2 Vpr or Vpx, and SIV Vpr or Vpx (Fig. 1A). On plates lackinging for at least 5 hr. The cells were washed three timesthiamine (which permits expression), control yeast cellswith PBS / 0.2% Triton X-100 and then washed oncetransformed with the control plasmid formed normal sizewith kinase assay buffer (50 mM Tris, pH 7.4, 10 mMcolonies. However, there were no colonies formed by yeastMgCl2 , 1 mM DTT, plus protease and phosphatase inhibi-expressing HIV-1 Vpr and smaller than normal coloniestors as in the extraction buffer). To start the assay, 100formed by yeast expressing SIV Vpr or Vpx (Fig. 1B), orml of assay buffer containing 8.3 mg histone H1, 10 mMHIV-2 Vpr or Vpx (not shown). These results suggest thatATP, 2.5 mCi [g32P]ATP was added to each well and thenVpr and Vpx inhibit cell proliferation in S. pombe, and thethe microtiter plate was incubated for 30 min at 307. Thelack of colonies observed when HIV-1 Vpr was expressedreaction was stopped by adding 35 ml of 21 SDS–PAGEsuggested that the presence of this protein had a moresample buffer. Fifteen microliters was spotted onto 3MMpronounced effect on cell proliferation.paper, incubated for 10 min in 10% TCA and 40 mM

Because both Vpr and Vpx caused arrested growth,sodium pyrophosphate, washed three times with 5%each strain was characterized to examine the effect onTCA, followed by a brief rinse in 95% ethanol. The filterscell proliferation kinetics. Exponentially growing cells cul-were air dried and quantified by liquid scintillation spec-tured in MM / thiamine were washed in sterile watertrometry.and inoculated into fresh MM //0 thiamine at a density

Viability assays of 1 1 105 cells/ml. Cell numbers were then determinedat various times. The normal generation time of SP130Cells were grown in thiamine-plus or thiamine-minus

medium at 307. At different time points (0, 6, 9, 12, 15, cells at 307 in minimal medium is about 3 hr. The genera-



at different time points and HIV-1 Vpr or SIV Vpr or Vpxexpression was detected by Western blot as describedunder Materials and Methods. The immunoblot resultsindicated that Vpr and Vpx could be detected within 9 hrafter switching cells into medium lacking thiamine, andthe levels of expression were constant for at least 24 hr(Fig. 3). Since cell proliferation rates showed differencebeginning at 9 hr, these results indicate that the arrestof cell proliferation we observed is coincident with Vpror Vpx expression.

When examined by phase microscopy, cells express-

FIG. 1. Expression of Vpr and Vpx inhibits cell growth in S. pombe.S. pombe transformed with pREP41, pREP41-HIV-1-Vpr, pREP41-SIV-Vpr, or pREP41-SIV-Vpx were plated onto MM agar with ot withoutthiamine and incubated at 307 for 3–6 days. The plates are labeledas follows: (1) pREP41-SIV-Vpr; (2) pREP41; (3) pREP41-HIV-1-Vpr; (4)pREP41-SIV-Vpr. (A) Cells grown in the presence of thiamine (repress-ing conditions). (B) Cells grown in the absence of thiamine (expressingconditions).

tion time of HIV-1 Vpr-, HIV-2, and SIV Vpr- or Vpx- condi-tionally expressing strains grown in the presence of thia-mine (i.e., not expressing) was similar to that of the wild-type strain as expected (Figs. 2B and 2C). However, inthe absence of thiamine, expression of HIV-1 Vpr causeda complete arrest of cell proliferation within 9–12 hr (Fig.2A), whereas cells expressing HIV-2 Vpr or Vpx (Fig. 2B),or SIV Vpr or Vpx (Fig. 2C), showed a reduced rate ofproliferation starting at 9 hr and eventual cessation ofproliferation by 30 hr after switching to conditions thatpermit expression. The growth kinetics of cells express-

FIG. 2. Growth kinetics of cells expressing Vpr or Vpx. Cells wereing HIV-1 Tat was the same in medium with or withoutgrown in liquid MM with or without thiamine at 307. An aliquot of thethiamine (Fig. 2A), indicating that the effects on cell prolif-cell culture was collected every 3 hr and cell density determined. The

eration were specific to Vpr and Vpx proteins and not initial cell innoculum was 11 105 cells/ml. (A) Growth kinetics of SP130due to simply expressing viral proteins. cells alone, cells containing the Tat expression plasmid (//0 thiamine),

and cells containing the HIV-1 Vpr expression plasmid (//0 thiamine).Western blot analysis of Vpr and Vpx expression(B) Growth kinetics of cells containing the HIV-2 Vpr or Vpx expression

To confirm the correlation between cell growth arrest plasmids (//0 thiamine). (C) Growth kinetics of cells containing theSIV Vpr or Vpx expression plasmids (//0 thiamine).and Vpr or Vpx expression, yeast extracts were prepared



cycle but permits cell growth to continue, similar to pre-viously described cell division cycle (cdc) mutants.

Expression of HIV-1 Vpr is lethal in S. pombe

Since expression of Vpr and Vpx arrested cell prolifera-tion in S. pombe, we were interested in determiningwhether there were additional effects on cell viability. Toaddress this, expression of HIV-1 Vpr, HIV-2, and SIV Vpror Vpx was induced by growth in minimal medium lackingthiamine for different lengths of time. Cells were thenplated onto MM / thiamine medium to again repressVpr or Vpx expression. As a control, cells were treated

FIG. 3. Western blot analysis of Vpr and Vpx expression. Cells grownin the same way except they remained in MM/ thiaminein MM were harvested at different times following shift to thiamine-for all parts of the experiment. The number of viablefree medium. Total protein extracts were prepared and protein levels

determined by Western blot analysis. Data are shown for HIV-1 Vpr, cells was determined by counting the number of coloniesSIV Vpr, and SIV Vpx. Similar induction kinetics were observed for HIV- formed.1 Tat expression (not shown). The results show that cells expressing HIV-1 Vpr rap-

idly lose viability, with essentially no viable cells re-maining after 15 hr in thiamine-free medium (Fig. 5). Thising HIV-1 Vpr, HIV-2 Vpr, Vpx, or SIV Vpr showed an

increased cell length (Fig. 4). Staining of nuclei with pro- corresponds to about 6 hr of Vpr expression. In contrast,expression of Vpr or Vpx from HIV-2 or SIV showed muchpidium iodide indicated that arrested cells contain a sin-

gle nucleus (not shown). These data suggest that expres- less of a cytotoxic effect on S. pombe than did expressionof HIV-1 Vpr. After 24 hr of incubation, about 50% of thesion of Vpr or Vpx proteins arrests the nuclear division

FIG. 4. Morphology of cells expressing Vpr or Vpx. Exponentially growing cells grown in MM / thiamine were used to inoculate MM with orwithout thiamine. Cells were incubated for a further 18 hr, and then collected and fixed for microscopic examination. The samples were as follows:(A) HIV-1 Vpr cells / thiamine. SIV-Vpr and -Vpx cells have an identical phenotype in medium containing thiamine (repressing conditions) and soare not shown. (B) HIV-1 Vpr cells 0 thiamine. (C) SIV Vpr cells 0 thiamine. (D) SIV Vpx cells 0 thiamine.



t Å 6 hr, HU was added to the culture. At t Å 10 hr, cellswere washed in sterile water and inoculated into mediumlacking HU and thiamine to release them from the S-phase block, but maintain Vpr or Vpx expression. At t Å20 hr samples were taken and prepared for flow cytome-try. To establish that the HU treatment results in cellcycle arrest, a sample of HIV-1 Vpr cells was taken at tÅ 10 hr (i.e., 4 hr in HU), prior to removal of the HU (Fig.7A). As a control for recovery from the HU treatment,cells containing the HIV-1 Vpr expression vector weregrown in the presence of thiamine for the entire experi-ment, which included a 10-hr recovery period after re-FIG. 5. Viability of cells expressing Vpr or Vpx. Cells were grown in

MM with or without thiamine at 307. An aliquot of cells was collected moval of the HU (Fig. 7B). The results show that theand 200 cells plated onto MM agar containing thiamine. Visible colo- control cells, in which Vpr expression was repressed,nies were counted after 3–6 days and the data shown in the graph. were able to recover from HU treatment and progressThe control sample is cells containing the HIV-1 Vpr expression plasmid

through the cell cycle establishing a normal, predomi-grown on plates containing thiamine (repressing conditions).nantly G2/M distribution of cells (compare Figs. 6C and

cells were still viable (Fig. 5). These data indicate thatexpression of HIV-1 Vpr in S. pombe is lethal, while ex-pression of HIV-2 or SIV Vpr or Vpx has a less severe,although significant effect on cell survival.

Vpr and Vpx arrest the cell cycle at two points

In order to determine the point of cell cycle arrest inVpr or Vpx expressing cells, we used flow cytometry todetermine the DNA content in control cells or cells ex-pressing Vpr or Vpx. The flow cytometry controls includednitrogen starvation, which arrests cells predominantly inG1 and glucose starvation, which arrests cells predomi-nantly in G2 (Figs. 6A and 6B). Control HIV-1 Vpr cellsgrown in the presence of thiamine shown the normaldistribution DNA contents with most cells being in theG2 phase of the cell cycle (Fig. 6C). Cells containing theHIV-1 Vpr or SIV Vpr or Vpx expression vectors, andgrown in the absence of thiamine for 18 hr, showed cellswith DNA contents characteristic of both G1 , and G2/Mcells, indicating that Vpr and Vpx expression blocks cellcycle progression at two distinct points (Figs. 6D–6F). Inaddition, cells expressing HIV-1 Vpr also showed signsof extra DNA replication as evidenced by the peak ofcells with DNA contents in excess of the G2/M peak (Fig.6D). This effect was not observed in cells expressing SIVVpr or SIV Vpx (Figs. 6E and 6F).

Because we observed evidence of yeast cells accumu-FIG. 6. Flow cytometric analysis of Vpr and Vpx expressing cells.lated not only in G2/M but also in the G1 phase of cell

Cells were grown as indicated below prior to preparation for flowcycle, we wanted to determine if Vpr or Vpx expressioncytomtery as described under Materials and Methods. The position ofprevents progression through S phase. To do this wethe 1N (G1 DNA content) and 2N (G2 DNA content) peaks are shown

established a culture of cells in which Vpr or Vpx expres- by the gray bars. Controls for 1N and 2N peaks are shown in parts Asion had just reached maximal levels (which normally and B. The control for exponentially growing S. pombe (plasmid con-

taining cells grown in thiamine containing medium) is shown in C.takes 9 hr under the conditions we have used in thisExperimental cultures (D–F) were washed in sterile water then placedstudy), and which had been grown for 4 hr in the pres-into thiamine-free MM for 18 hr prior to preparation for flow cytometry.ence of hydroxyurea (HU) in order to arrest cells in early(A) HIV-1 Vpr cells grown in nitrogen limiting medium (enriches for G1

S-phase. To do this, cells containing the HIV-1 Vpr or cells). (B) HIV-1 Vpr cells grown in glucose limiting medium (enrichesSIV Vpr or Vpx vectors were switched to thiamine-free for G2 cells). (C) HIV1 Vpr / thiamine. (D) HIV1 Vpr 0 thiamine. (E)

SIV Vpr 0 thiamine. (F) SIV Vpx 0 thiamine.medium at t Å 0 hr to permit Vpr or Vpx expression. At



in S. pombe, we asked whether p34/cdc2 activity wasinhibited by either Vpr or Vpx expression. To test this,H1 kinase assays were carried out as described underMaterials and Methods to measure p34/cdc2 kinase ac-tivity in control cells and cells expressing HIV-1 Vpr orSIV Vpr or Vpx. The expression of HIV-1 Vpr or SIV Vpr orVpx caused similar decreases in p34/cdc2 kinase activity(Fig. 8). These results also suggest that the cell cyclearrest we have observed is associated with a loss ofp34/cdc2 kinase activity.

The activity of p34/cdc2 in S. pombe is positively regu-lated by the cdc25 protein phosphatase, and negativelyregulated by the wee1 and mik1 kinases (Nurse, 1994).Since we observed a decrease in p34/cdc2 activity incells expressing Vpr or Vpx, we wondered whether mu-tants of p34/cdc2, which fail to respond correctly to eithercdc25 or wee1/mik1, might be resistant to Vpr expres-sion. The HIV-1 Vpr expression plasmid was transformedinto three p34/cdc2 mutant strains, one which fails torespond to cdc25 (cdc2-3w), and one which fails to re-spond to wee1 (cdc2-1w), and the third in which the mik1gene has been deleted (cdc2-1w, Dmik1). The resultsshowed that these three mutants, like strains with a nor-mal cdc2 gene, were growth arrested by HIV-1 Vpr ex-pression (Fig. 9). Similar results were observed by trans-formation of these mutant yeast with HIV-2 Vpr or Vpx

FIG. 7. Effect of Vpr or Vpx expression on cell cycle progressionand SIV Vpr or Vpx (data not shown), indicating that Vprafter hydroxyurea synchronization. Cells were grown in the presenceor Vpx does not act directly through any of these cdc2or absence of thiamine and synchronized in S phase with hydroxyurea

as described under Materials and Methods. Cells cycle progression regulators.following removal of hydroxyurea was monitored by flow cytometry. Asdescribed, the timing of HU removal and shifting to thiamine-free me-

DISCUSSIONdium were coordinated so that the onset of expression of the Vpr orVpx proteins (which takes 9 hr) preceded removal of HU by 1 hr. Cells

In the present study we have found that expression ofwere incubated a further 10 hr following removal of HU. (A) HIV-1 Vprcells / thiamine after 4 hr in HU (early S phase arrest). (B) HIV-1 Vpr HIV-1 Vpr or HIV-2 and SIV Vpr or Vpx results in cellcells/ thiamine, 10 hr after removal of HU (control for ability to recover cycle arrest in the yeast S. pombe. In addition, expressionfrom HU treatment and resume cell cycle progression). (C) HIV-1 Vpr of HIV-1 Vpr results in a rapid loss of viability. Thesecells0 thiamine, 10 hr after removal of HU. (D) SIV Vpr cells0 thiamine,10 hr after removal of HU. (E) SIV Vpx cells 0 thiamine, 10 hr afterremoval of HU.

7B). In contrast, cells allowed to express HIV-1 Vpr orSIV Vpr or Vpx had a significant fraction of the populationwith DNA contents indicative of cells either in G1 or veryearly S phase (Figs. 7C–7E), suggesting that the pres-ence of Vpr or Vpx attenuates progression through S-phase.

Suppression of p34/cdc2 kinase activity in yeastexpressing HIV-1 Vpr or SIV Vpr or Vpx

FIG. 8. Effect of Vpr and Vpx expression of p34/cdc2 kinase activity.The primary regulators of G1/S and G2/M progression Cell extracts were prepared from exponentially growing cells. Samples

are indicated along the y-axis. Samples listed as ‘‘0 thiamine’’ werein eukaryotic cells are the cyclin-dependent kinasesintially grown in medium containing thiamine, harvested by centrifuga-(cdks) of which p34/cdc2 of S. pombe is the prototypetion, washed in sterile water, then reinoculated in MM lacking thiamine(Broek et al., 1991; Nurse, 1994). In mammalian cells thisand incubated for 15 hr prior to preparing extracts. H1 kinase assays

enzyme is apparently inactivated by the expression of were performed as described under Materials and Methods. The levelHIV-1 Vpr (He et al., 1995; Re et al., 1995). Since p34/ of activity in SP130 cells alone was set as 100% and all samples are

scaled relative to this level.cdc2 is required for both the G1/S and G2/M transitions



severe effect than HIV-1 Vpr in human 293 cells (Marzioet al., 1995) and expression of SIVagm Vpx has a moresevere effect on CV-1 cells than on HeLa cells (Planelleset al., 1996). Thus, it might initially be surprising thatexpression of all these proteins should affect cell prolifer-ation in a simpler eukaryote such as S. pombe. It should,however, be noted that many of the proteins that regulatecell proliferation in yeast can be functionally comple-mented by human homologues (Moreno et al., 1991;Nurse, 1994). Thus, the ability of Vpr and Vpx proteins toaffect cell proliferation might be mediated via the basiccell cycle control machinery. Our observation that p34/cdc2 kinase activity is significantly reduced in cells ex-pressing SIV Vpr or Vpx, which do not have the sameviability loss as cells expressing HIV-1 Vpr, and whichstill continue to grow (resulting in elongated cdc-likecells), is consistent with this hypothesis. Furthermore,the fact that these proteins have different effects de-pending on cell type helps explain in part why we seesome differences in the phenotype caused by expressionof Vpr and Vpx in S. pombe. In addition, levels of expres-sion may have a significant impact on apparent pheno-type, especially given that HIV-1 Vpr appears to be cyto-toxic when expressed in yeast. Expression levels mayalso explain the differences between our results and aprevious study examining the consequences of HIV-1 Vprexpression in S. pombe (Zhao et al., 1996), since thisprevious study used a different version of the nmt1 pro-moter than we have used in the present study. The useof promoters with different transcription rates would bea useful approach to clarifying this issue.FIG. 9. Genetic analysis of Vpr-dependent inhibition of cell prolifera-

tion. Strains of S. pombe with normal or a mutant cdc2 allele were The varying effects of the HIV and SIV proteins on thetransformed with the pREP41-HIV-1-Vpr expression plasmid to deter- S. pombe cell cycle is also consistent with the classifica-mine if the cell cycle inhibitory effect was mediated through the known

tion of the primate lentiviruses, in which HIV-1 and HIV-p34/cdc2 regulators, cdc25, wee1, or mik1. (A) Cells grown with thia-2/SIVmac have been divided into two distinct phylogeneticmine (repressing conditions). (B) Cells grown without thiamine (ex-lineages (Franchini and Reitz, 1994). Our finding that thepressing conditions). (1) SP130 cells (normal cdc2 gene); (2) cdc2-1w

(defective response to wee1); (3) cdc2-3w (defective response to HIV and SIV proteins differ with regard to how cytotoxiccdc25); (4) cdc2-1w, Dmik1 (defective response to wee1 and deletion they are in S. pombe may be a consequence of differ-of mik1).

ences in their normal functions in vivo with regard totheir respective roles in the viral life cycle and cellularpathogenesis, as compared to the HIV-1 Vpr protein.results are consistent with previous studies in which HIV-

1 Vpr was reported to cause cell cycle arrest in both These results are also consistent with the recent reportthat SIVmac provirus lacking either Vpr or Vpx are stillmammalian cells and in yeast (He et al., 1995; Jowett et

al., 1995; Macreadie et al., 1995; Re et al., 1995; Rogel capable of producing AIDS in rhesus monkeys, while theVpr/Vpx double mutant is severely attenuated in pathoge-et al., 1995; Zhao et al., 1996). Here, we have extended

the studies to include HIV-2 and SIV Vpr and Vpx and nicity in vivo (Gibbs et al., 1995), and with a report ofindependent functions of HIV-2 and SIV Vpr and Vpx withdemonstrate that all these lentiviral proteins inhibit yeast

cell proliferation. While HIV-2 and SIV Vpr and Vpx also respect to nuclear import and cell cycle arrest in mamma-lian cells (Fletcher et al., 1996). It would be interestingcause cell cycle arrest, they are not as cytotoxic as HIV-

1 Vpr in S. pombe. to express both SIV Vpr and Vpx coincidentally, in orderto determine whether a more severe phenotype, analo-Previous studies suggested that the cell cycle arrest

effects of Vpr and Vpx could be species-specific. Expres- gous to HIV-1 Vpr, is produced. These studies are cur-rently in progress.sion of HIV-1 Vpr in HeLa cells, which are of human

origin, has a more severe effect than does expression in Although Vpr and Vpx have been shown to block cellcycle in mammalian cells, the cytological consequencesCV-1 cells, which are of simian origin (Planelles et al.,

1996). Accordingly, expression of SIVmac239 Vpr has a less of their expression are still uncertain. In contrast to a



recent study suggesting that HIV-1 Vpr is primarily cyto- dramatically inactivated in human cells and in yeast ex-pressing HIV-1 Vpr (He et al., 1995; Re et al., 1995; Zhaostatic in human Jurkat T cell line (Bartz et al., 1996), our

data demonstrates that HIV-1 Vpr is highly cytotoxic in et al., 1996). Future studies will have to address whetheror not these proteins can directly affect p34/cdc2 kinaseS. pombe, with complete loss of the ability to proliferate

with a few hours. Neither SIV Vpr nor Vpx were this activity.The inducible yeast expression system has also beencytotoxic, producing at most an approximately 50% loss

of viability. Furthermore, we do not anticipate that this is proven to be informative as we have been able to deter-mine that HIV-1 Vpr does not act simply via cdc25, wee1,due to residual Vpr since all samples contained maximal

levels of Vpr at the time they were plated onto repressing or mik1, direct regulators of p34/cdc2 in S. pombe. Theseresults may indicate that Vpr and Vpx do indeed actmedium. It is not clear what the basis of this difference

is, but possible explanations include differences in levels directly on p34/cdc2, that they act through a novel path-way, or that multiple actions occur which cannot be re-of expression and reversibility of target protein interac-

tion. If mammalian cells arrested by Vpr do eventually solved via a simple epigenetic explanation. Other possi-ble pathways include interaction with cycling regulatorslose viability, it might be reasonable to propose that Vpr

plays an important role in the depletion of HIV-1-infected such as protein phosphatases type 2A (PP2A), whichacts as an inhibitor of cell entry into mitosis (Kinoshitacells, which normally occurs in vivo. Regardless, our re-

sults demonstrate that expression of Vpr and Vpx in S. et al., 1990) and regulates cytokinesis (Wera et al., 1995).Future studies should address these questions. Towardpombe will provide a useful model system in which to

better understand the role of these proteins. that end we have recently been able to produce ex-tragenic suppressers that survive in the presence of HIV-In mammalian cells, HIV-1 Vpr and SIV Vpr have been

shown to arrest the cell cycle after DNA replication, likely 1 Vpr. The isolation of the genes responsible for thisresistance to Vpr expression may define in vivo targetsin G2 phase (Bartz et al., 1996; He et al., 1995; Jowett et

al., 1995; Re et al., 1995). In our study, we have shown of this protein, and improve our understanding of HIVpathogenesis.that in S. pombe HIV-1 Vpr, HIV-2 Vpr or Vpx, and SIV

Vpr or Vpx arrested cell proliferation both at G1/S andG2/M. Since we have observed a decline in p34/cdc2 ACKNOWLEDGMENTSkinase activity in yeast cells expressing these various

We thank R. Sherburne for assistance with electron microscope, P.proteins, the difference may be attributable to p34/cdc2. Dickie and Ellen Shibuya for discussing the manuscript, and A. HudsonIn mammalian cells, the direct homologue of p34/cdc2, for editorial assistance. We thank Dr. J. C. Kappes for anti-HIV-1 Vpr

and anti-HIV-2 Vpx antisera, Dr. L. O. Arthur for anti-SIV Vpx antisera,cdc2Hs (also known as cdk1), regulates the transitionDr. K. Peden for HIV-2ROD plasmid, and Dr. P. Luciw for SIVmac239 plasmid.from G2 to M phase, while G1/S progression is predomi-The following reagent was obtained through the AIDS Research andnantly controlled by cdk2. However, in S. pombe, p34/Reference Reagent Program, Division of AIDS, NIAID, NIH: HIV-1BH10

cdc2 regulates both cell cycle transitions (Atherton-Fess- Vpr and HIV-2ROD Vpx antisera from Dr. L. Ratner, and HIV-1BH10 Tatler et al., 1993; Moreno et al., 1991). Our observations antiserum from Dr. B. Cullen. This work is contributed equally by the

laboratories of C. Rasmussen and L.-J. Chang. Both are Researchwould therefore suggest that p34/cdc2, or cdc2Hs in hu-Scholars of Alberta Heritage Foundation for Medical Research andman cells, might be the target, directly or indirectly, ofsupported by grants from National Health Research and DevelopmentVpr and Vpx. Thus, while the observed cell cycle arrestProgram (6609-1936-AIDS to L.-J.C.), Medical Research Council of Can-

phenotypes may not be identical to that observed in ada (MT-12314 to L.-J.C.; MT-11531 to C.R.), and the AIDS Networkmammalian cells, there are clear similarities of growth Research Trust Fund of Alberta (to L.-J.C.). Dr. Rasmussen is also a

Medical Research Council of Canada Scholar.arrest phenotype caused by Vpr and Vpx expression inyeast and mammalian cells. Specifically, the observationthat yeast and mammalians cell both arrest in G2 with REFERENCESreduced p34/cdc2 kinase activity indicates that Vpr and

Aldrovandi, G. M., and Zack, J. A. (1996). Replication and pathogenicityVpx interact with conserved target(s) in yeast and mam- of human immunodeficiency virus type 1 accessory gene mutants inmalian cells. SCID-hu mice. J. Virol. 70, 1505–1511.

Alfa, C., Fantes, P., Hyams, J., McLeod, M., and Warbrick, E. (1992).We have also observed changes in cell size and DNA‘‘Experiments with Fission Yeast—A Laboratory Manual.’’ Coldcontent in Vpr and Vpx expressing S. pombe. SimilarSpring Harbor Laboratory Press, Cold Spring Harbor, NY.observation has been reported in Jurkat T cells express-

Atherton-Fessler, S., Parker, L. L., Geahlen, R. L., and Piwnica-Worms,ing HIV-1 Vpr (Bartz et al., 1996). Increase in nuclear size H. (1993). Mechanism of p34/cdc2 regulation. Mol. Cell. Biol. 13,and ploidy have been observed in S. pombe carrying 1675–1685.

Bartz, S. R., Rogel, M. E., and Emerman, M. (1996). Human immunodefi-mutations in the mitotic cdk’s due to decoupling S phaseciency virus type 1 cell cycle control: Vpr is cytostatic and mediatesfrom mitosis (Broek et al., 1991; Hayles et al., 1994). TheG2 accumulation by a mechanism which differs from DNA damageelongated cells and S phase staggering in yeast express-checkpoint control. J. Virol. 70, 2324–2331.

ing Vpr or Vpx mimic the phenotype of the yeast mitotic Broek, D., Bartlett, R., Crawford, K., and Nurse, P. (1991). Involvementcdk mutants. In addition, our data are consistent with of p34/cdc2 in establishing the dependency of S phase on mitosis.

Nature 349, 388–393.previous studies in which p34/cdc2 was observed to be



Bukrinsky, M. I., Haggerty, S., Dempsey, M. P., Sharova, N., Adzhubei, A. C., and Azad, A. A. (1995). A domain of human immunodeficiencyvirus type 1 Vpr containing repeated H(S/F)RIG amino acid motifsA., Spitz, L., Lewis, P., Goldfarb, D., Emerman, M., and Stevenson,

M. (1993). A nuclear localization signal within HIV-1 matrix protein causes cell growth arrest and structural defects. Proc. Natl. Acad.Sci. USA 92, 2770–2774.that governs infection of non-dividing cells. Nature 365, 666–669.

Cohen, E. A., Dehni, G., Sodroski, J. G., and Haseltine, W. A. (1990). Marzio, P. D., Choe, S., Ebright, M., Knoblauch, R., and Landau, N. R.(1995). Mutational analysis of cell cycle arrest, nuclear localization,Human immunodeficiency virus vpr product is a virion-associated

regulatory protein. J. Virol. 64, 3097–3099. and virion packaging of human immunodeficiency virus type 1 Vpr.J. Virol. 69, 7909–7916.Desrosiers, R. C. (1990). The simian immunodeficiency viruses. Ann.

Rev. Immunol. 8, 557–578. Maundrell, K. (1990). nmt1 of fission yeast. J. Biol. Chem. 265, 10857–10864.Draetta, G., Bizuela, L., Potashkin, J., and Beach, D. (1987). Identification

of p34 and p13, human homologs of the cell cycle regulators of Moreno, S., Hayles, J., and Nurse, P. (1991). Molecular Genetic Analysisof Fission Yeast Schizosaccharomyces pombe. Methods Enzymol.fission yeast encoded by cdc2/ and suc1/. Cell 50, 319–325.

Fletcher, T. M., Brichacek, B., Sharova, N., Newman, M. A., Stivahtis, 194, 795–823.Nurse, P. (1994). Ordering S phase and M phase in the cell cycle. CellG., Sharp, P. M., Emerman, M., Hahn, B. H., and Stevenson, M. (1996).

Nuclear import and cell cycle arrest functions of the HIV-1 Vpr protein 79, 547–550.Paxton, W. R., Connor, R. I., and Landau, N. R. (1993). Incorporation ofare encoded by two separate genes in HIV-2/SIVsm. EMBO J. 15,

6155–6165. Vpr into human immunodeficiency virus type 1 virions: requirementsfor the p6 region of gag and mutational analysis. J. Virol. 67, 7229–Franchini, G., and Reitz, J. M. S. (1994). Phylogenesis and genetic com-

plexity of the nonhuman primate retroviridae. AIDS Res. Human Re- 7237.Planelles, V., Jowett, J. B. M., Li, Q.-X., Xie, Y., Hanh, B., and Chen, I. S. Y.troviruses 10, 1047–1060.

Gibbs, J. S., Lackner, A. A., Lang, S. M., Simon, M. A., Sehgal, P. K., (1996). Vpr-induced cell cycle arrest is conserved among primatelentiviruses. J. Virol. 70, 2516–2524.Daniel, M. D., and Desrosiers, R. C. (1995). Progression to AIDS in

the absence of a gene for vpr or vpx. J. Virol. 69, 2378–2383. Rasmussen, C., and Rasmussen, G. (1994). Inhibition of G(2)/M progres-sion in Schizosaccharomyces pombe by a mutant calmodulin kinaseHayles, J., Fisher, D., Woollard, A., and Nurse, P. (1994). Temporal order

of S phase and mitosis in fission yeast is determined by the state II with constitutive activity. Mol. Biol. Cell. 5(7), 785–795.Re, F., Braaten, D., Franke, E. K., and Luban, J. (1995). Human immuno-of the p34/cdc2-mitotic B cyclin complex. Cell 78, 813–822.

He, J., Choe, S., Walker, R., Di Marzio, P., Morgan, D. O., and Landau, deficiency virus type 1 Vpr arrests the cell cycle in G2 by inhibitingthe activation of p34/cdc2-cyclin B. J. Virol. 69, 6859–6864.N. R. (1995). Human immunodeficiency virus type 1 viral protein R

(vpr) arrests cells in the G2 phase of the cell cycle by inhibiting p34/ Rogel, M. E., Wu, L. I., and Emerman, M. (1995). The human immunodefi-ciency virus type 1 vpr gene prevents cell proliferation during chroniccdc2 kinase activity. J. Virol. 69, 6705–6711.

Heinzinger, N. K., Bukinsky, M. I., Haggerty, S. A., Ragland, A. M., Kewal- infection. J. Virol. 69, 882–888.Subbramanian, R. A., and Cohen, E. A. (1994). Molecular biology of theramani, V., Lee, M., Gendelman, H. E., Ratner, L., Stevenson, M., and

Emerman, M. (1994). The Vpr protein of human immunodeficiency human immunodeficiency virus accessory proteins. J. Virol. 68, 6831–6835.virus type 1 influences nuclear localization of viral nucleic acids in

nondividing host cells. Proc. Natl. Acad. Sci. USA 91, 7311–7315. Tristem, M., Marshall, C., Karpas, A., and Hill, F. (1992). Evolution ofthe primate lentiviruses: evidence from vpx and vpr. EMBO J. 11,Jowett, J. B., Planelles, V., Poon, B., Shah, N. P., Chen, M.-L., and Chen,

L. S. (1995). The human immunodeficiency virus type 1 vpr gene 3405–3412.Trono, D. (1995). HIV accessory proteins: leading roles for the support-arrests infected cells in the G2 / M phase of the cell cycle. J. Virol.

69, 6304–6313. ing cast. Cell 82, 189–192.Vaishnav, Y. N., and Wong-Staal, F. (1991). The biochemistry of AIDS.Kinoshita, N., Ohkura, H., and Yanagida, M. (1990). Distinct, essential

roles of type 1 and 2A protein phosphatases in the control of the Ann. Rev. Biochem. 60, 577–630.Wera, S., Fernandez, A., Lamb, N. J. C., Turowski, P., Hemmings-Mieszc-fission yeast cell division cycle. Cell 63, 403–415.

Lang, S. M., Weeger, M., Stahl-Hennig, C., Coulibaly, C., Hunsmann, zak, M., Mayer-Jaekel, R. E., and Hemmings, B. A. (1995). Deregula-tion of translational control of the 65-kDa regulatory subunit (PR65a)G., Muller, J., Muller-Hermelink, H., Fuchs, D., Wachter, H., Daniel,

M. M., Derosiers, R. C., and Fleckenstein, B. (1993). Importance of of protein phosphatase 2A leads to multinucleated cells. J. Biol.Chem. 270, 21374–21381.vpr for infection of Rhesus monkeys with simian immunodeficiency

virus. J. Virol. 67, 902–912. Yu, X. F., Matsuda, M., Essex, M., and Lee, T. H. (1990). Open readingframe vpr of simian immunodeficiency virus encodes a virion-associ-Levy, D. N., Fernandes, L. S., Williams, W. V., and Weiner, D. B. (1993).

Induction of cell differentiation by human immunodeficiency virus 1 ated protein. J. Virol. 64, 5688–5693.Zhao, Y., Cao, J., O’Gorman, M. R. G., Yu, M., and Yogev, R. (1996).vpr. Cell 72, 541–550.

Levy, J. A. (1995). Pathogenesis of Human Immunodeficiency Virus in- Effect of human immunodeficiency virus type 1 protein R (vpr) geneexpression on basic cellular function of fission yeast Schizosacchar-fection. Microb. Rev. 57, 183 – 289.

Macreadie, I. G., Castelli, L. A., Hewish, D. R., Kirkpatrick, A., Ward, omyces pombe. J. Virol. 70, 5821–5826.


Documents

Cell Cycle Inhibitory Effects of HIV and SIV Vpr and Vpx ... · of HIV-2 and SIV Vpr were not as pronounced as that of HIV-2 ROD Vpr HIV-1 Vpr. In fact, Vpx from HIV-2 and SIV mac