CbrA Is a Stationary-Phase Regulator of Cell Surface Physiology … · library was mated into KEG2016, and cbrA::Tn5 complementing clones were selected for on LB containing antibiotics

JOURNAL OF BACTERIOLOGY, June 2006, p. 4508–4521 Vol. 188, No. 120021-9193/06/$08.00�0 doi:10.1128/JB.01923-05Copyright © 2006, American Society for Microbiology. All Rights Reserved.

CbrA Is a Stationary-Phase Regulator of Cell Surface Physiologyand Legume Symbiosis in Sinorhizobium meliloti†

Katherine E. Gibson, Gordon R. Campbell,‡ Javier Lloret,§ and Graham C. Walker*Department of Biology, Massachusetts Institute of Technology, Cambridge, Massachusetts 02139

Received 15 December 2005/Accepted 23 March 2006

Sinorhizobium meliloti produces an exopolysaccharide called succinoglycan that plays a critical role inpromoting symbiosis with its host legume, alfalfa (Medicago sativa). We performed a transposon mutagenesisand screened for mutants with altered succinoglycan production and a defect in symbiosis. In this way, weidentified a putative two-component histidine kinase associated with a PAS sensory domain, now designatedCbrA (calcofluor-bright regulator A). The cbrA::Tn5 mutation causes overproduction of succinoglycan andresults in increased accumulation of low-molecular-weight forms of this exopolysaccharide. Our results suggestthe cbrA::Tn5 allele leads to this succinoglycan phenotype through increased expression of exo genes requiredfor succinoglycan biosynthesis and modification. Interestingly, CbrA-dependent regulation of exo and exs genesis observed almost exclusively during stationary-phase growth. The cbrA::Tn5 mutant also has an apparent cellenvelope defect, based on increased sensitivity to a number of toxic compounds, including the bile saltdeoxycholate and the hydrophobic dye crystal violet. Growth of the cbrA mutant is also slowed under oxidative-stress conditions. The CbrA-regulated genes exsA and exsE encode putative inner membrane ABC transporterswith a high degree of similarity to lipid exporters. ExsA is homologous to the Escherichia coli MsbA protein,which is required for lipopolysacharide transport, while ExsE is a member of the eukaryotic family ofABCD/hALD peroxisomal membrane proteins involved in transport of very long-chain fatty acids, which area unique component of the lipopolysaccharides of alphaproteobacteria. Thus, CbrA could play a role inregulating the lipopolysaccharide or lipoprotein components of the cell envelope.

The gram-negative soil bacterium Sinorhizobium meliloti es-tablishes a symbiotic relationship with the alfalfa legume(Medicago sativa) by eliciting formation of a specialized plantorgan, the nodule, within which bacteria establish a chronicintracellular infection that ultimately leads to nitrogen fixation(13). The successful symbiosis produces elongated nodules ofthe indeterminate type that reflect continuous bacterial inva-sion of new nodule cells within the plant. These nodules arealso pink in coloration as a result of plant leghemoglobinproduction, which is responsive to the bacterial capacity toreduce dinitrogen. Nodule formation and bacterial nitrogenfixation is the result of a highly regulated and complex devel-opmental process that requires continuous communication be-tween the two symbiotic partners.

A number of bacterial requirements for the S. melilotichronic host infection have been characterized (65). For in-stance, production of Nod factor in response to specific fla-vonoids exuded from host roots into the soil is essential forinitial recognition and interaction between the bacterium andthe root hairs of its host (36, 56). Ultimately, metabolic re-quirements for nitrogen fixation within the host depend in parton a group of fix and nif regulatory genes responsible forsensing the microaerobic environment within the nodule and

activating genes that encode the nitrogenase enzyme and spe-cialized respiratory complex (32). However, there are impor-tant developmental events between the initiation of noduleformation and the activation of nitrogenase gene expressionthat are less well understood.

Throughout symbiotic development, the S. meliloti cell sur-face is in intimate association with its host. Not surprisingly,then, several cell surface components play important rolesin promoting nodulation, including the exopolysaccharides(EPSs), lipopolysaccharides (LPSs), K antigen, and cyclic �-(1,2)-glucans (33). Succinoglycan, also called EPS I, is an exopoly-saccharide that plays a critical role in S. meliloti nodulation;thus, the genes involved in the production, modification, andsecretion of succinoglycan have been well characterized (40,62). Succinoglycan is a polymer of repeating octasaccharidesubunits (one galactose and seven glucose residues) that can bemodified with succinyl, acetyl, and pyruvyl substituents (1, 69).The succinoglycan monomer is polymerized to various degrees,leading to production of low-molecular-weight (LMW) forms(monomers, dimers, and trimers) and high-molecular-weight(HMW) forms (several hundred monomers) of succinoglycan(47, 90). S. meliloti mutants unable to produce succinoglycancan elicit nodule organogenesis, but these aberrantly small andwhite nodules are devoid of bacteria (49). This is becausesuccinoglycan is required for initiation and extension of theinfection threads that allow bacterial invasion into the plantroots (19).

While the complete absence of succinoglycan productionprevents nodulation, it has become clear that specific modifi-cations to the succinoglycan are also important. For instance,an exoH mutant unable to succinylate the EPS is also incapableof promoting normal infection thread growth (19, 48). Simi-

* Corresponding author. Mailing address: Department of Biology,Massachusetts Institute of Technology, Cambridge, MA 02139. Phone:(617) 253-6711. Fax: (617) 253-2643. E-mail: [email protected].

† Supplemental material for this article may be found at http://jb.asm.org/.

‡ Present address: Department of Molecular and Cell Biology, Uni-versity of California—Berkeley, Berkeley, CA 94720.

§ Present address: Departmento de Biologia, Darwin 2, UniversidadAutonoma de Madrid, 28049 Madrid, Spain.

4508

on Novem

ber 3, 2020 by guesthttp://jb.asm

.org/D

ownloaded from

https://crossmark.crossref.org/dialog/?doi=10.1128/JB.01923-05&domain=pdf&date_stamp=2006-06-15

http://jb.asm.org/

larly, an exoZ mutant defective in acetylation of succinoglycan(71) has decreased efficiency of infection thread initiation andelongation (19). It has also been suggested that LMW forms ofsuccinoglycan are more effective at promoting root hair inva-sion than HMW forms (6, 82, 84). While succinoglycan pro-duction is critical during early root hair invasion, there areindications that succinoglycan biosynthetic genes are down-regulated during the later stages of bacterial developmentwithin plant cells (5, 70). Insight into how S. meliloti regulatesthe production and modification of succinoglycan is thereforefundamental to our understanding of the physiological require-ments for symbiosis.

A component of the cell envelope that plays a later role innodule development to promote intracellular bacterial persis-tence is the LPS of the outer membrane (50). S. meliloti mu-tants with LPS alterations in either the lipid A or the carbo-hydrate core can have a weakened or severely diminishedcapacity to establish a chronic infection (16, 17, 28, 29, 46, 63,78). Modification of LPS by sulfation may also affect the sym-biotic proficiency of S. meliloti (22, 43). Although the precisefunction of LPS in promoting symbiotic development remainsunclear, defects in LPS sensitize bacteria to detergents andantimicrobial peptides, suggesting it could provide a barrieragainst environmental stress and host defense responses. Infact, there are indications that purified S. meliloti LPS may playa more active role by suppressing the oxidative burst of theplant innate immune response (76).

In the past, a number of genetic screens were performedwith the goal of identifying S. meliloti mutants defective forsymbiosis. For instance, Long et al. directly tested the symbi-otic proficiencies of transposon mutants with alfalfa (57), andthis intensive search yielded mutants involved in production ofNod factor. Others have taken the approach of isolating auxo-trophic mutants and screening them for symbiotic phenotypes(30, 45, 58). Previously, we isolated mutants unable to producesuccinoglycan (49), and this screen yielded mutants that haveprovided a wealth of information about succinoglycan produc-tion, as well as revealing the key role succinoglycan plays inestablishing the symbiosis. These considerations led us toscreen for mutants having increased or aberrant succinoglycanproduction with the goal of identifying unknown genes thatplay a role in symbiotic development.

Here, we describe our characterization of an important reg-ulator of S. meliloti succinoglycan that also has a profoundeffect on alfalfa symbiosis. We have isolated a transposon mu-tation disrupted in a putative two-component sensor that wedesignated CbrA and for which we found homologs in theclosely related plant pathogen Agrobacterium tumefaciens andanimal pathogens, Brucella spp. The cbrA::Tn5 mutation re-sults in overproduction of succinoglycan. By analyzing differ-ential expression of genes in the exo/exs cluster required forsuccinoglycan biosynthesis, we observed that the cbrA::Tn5mutation affects target gene expression predominantly duringstationary phase, suggesting that a common CbrA regulatorysignal exists under this particular ex planta growth conditionand in the host environment. In addition, we found that thecbrA::Tn5 allele conferred growth defects in the presence of avariety of toxic compounds, such as deoxycholate (DOC) andindole. Our observations are consistent with CbrA functioning

as a key regulator of S. meliloti physiology during free-livingand in planta growth.

Although S. meliloti is a plant symbiont, it shares a closephylogenic relationship with animal and human pathogensamong Brucella spp. (59). These bacteria have in common anintracellular chronic infection of their respective hosts within ahost-derived membrane-bound compartment (81). It is becom-ing clear that some of the bacterial requirements for rhizobialpersistence within the legume host are shared with the brucel-lae (27, 51, 52, 77). Thus, a broader implication of the identi-fication of genes required for S. meliloti symbiotic developmentderives from the potential to also distinguish genes that aid inBrucella sp. pathogenesis based on common physiological re-quirements.

MATERIALS AND METHODS

Bacterial strains, phage, plasmids, and growth conditions. Bacterial strains,generalized transducing phage, plasmids, and primer sequences are listed inTable 1. Bacteria were grown on either LB or LB/MC (LB supplemented with 2.5mM MgSO4 and 2.5 mM CaCl2). Unless otherwise noted, S. meliloti strains werecultured at 30°C in LB/MC to logarithmic phase (approximate optical density at600 nm [OD600] � 0.5) and stationary phase (approximate OD600 � 6.0) forphysiological and gene expression assays. For calcofluor analyses of succinogly-can production, LB agar was buffered with 10 mM MES (morpholineethanesul-fonic acid), pH 7.5, and calcofluor white MR2 (Cellufluor; Polysciences) wasadded at a final concentration of 0.02%. The following antibiotics were used:streptomycin (500 �g/ml), neomycin (200 �g/ml), gentamicin (12.5 �g/ml), spec-tinomycin (100 �g/ml), chloramphenicol (34 �g/ml), oxytetracycline (750 ng/ml),and tetracycline (10 �g/ml).

Genetic techniques. Transductions with �M12 were performed as describedpreviously (31). Random Tn5 mutagenesis and triparental matings were per-formed as described previously (49). Recombinant cosmids that complementedthe cbrA::Tn5 mutation were isolated from a pLAFR1-derived S. melilotigenomic library generously provided by S. Long (34). The pLAFR1 cosmidlibrary was mated into KEG2016, and cbrA::Tn5 complementing clones wereselected for on LB containing antibiotics (streptomycin, neomycin, and tetracy-cline) and 10 mM deoxycholate.

DNA manipulations. Genomic DNA was isolated as described previously (2).The cbrA::Tn5 transposon insertion in SmGC24 was cloned from an EcoRI/BamHI digest of genomic DNA into pUC19, and the resulting kanamycin-resistant plasmids were sequenced. pLAFR1 cosmid DNA was isolated as de-scribed previously (2). The presence of cbrA and fbpB in pLAFR1complementing cosmids was determined by PCR using Thermalase polymerase(Invitrogen) and primer sets cbrA5�/cbrA3� and fbpB5�/fbpB3�, respectively. ThecbrA and fbpB open reading frames (ORFs) were disrupted within cosmidpLAFR2070 using the �Red method as described previously (23). We performedPCR using the pKD3 template with primer sets cbrA-CATprime1/cbrA-CATprime2 and fbpB-CATprime1/fbpB-CATprime2. The cbrA::cat andfbpB::cat deletions in pLAFR2070 were verified by sequencing PCR productsobtained using primer c1 or c2 (23) in combination with either cbrA or fbpBgene-specific primers.

RNA isolation and RT-PCR analysis. S. meliloti cultures were diluted in 15 mlof LB/MC to an OD600 of 0.1 and were immediately treated with 30 ml ofRNAProtect Bacterial Reagent (QIAGEN) for 5 min at room temperature. Thecells were centrifuged at 4°C for 10 min at 10,000 relative centrifugal force(RCF), and the supernatant was decanted. The cell pellet was immediatelyfrozen in an ethanol/dry ice bath and either stored at �70°C or immediatelyprocessed using the MasterPure Complete RNA purification kit (Epicenter)following the manufacturer’s instructions. One microgram of total RNA wasanalyzed by gel electrophoresis (0.37 M formaldehyde, 1.2% agarose) withMOPS (morpholinepropanesulfonic acid) running buffer (40 mM MOPS, pH7.0, 10 mM NaAc, 1 mM Na2EDTA, pH 8.0, and 0.2 M formaldehyde) to judgesample integrity. To test for DNA contamination, we performed 25-�l PCRs with0.5 �g of RNA and 0.1 �M of the primers cbrAup and cbrA353; purifiedgenomic DNA was used as a positive control. For each RNA sample, a stock of50 pg/�l of DNA-free total RNA was made in the SuperScript One Step RT-PCR (QIAGEN) reaction buffer, and aliquots of 20 �l were combined with a setof gene-specific primers at 0.1 �M. Reverse transcription (RT)-PCRs with prim-ers specific for 23S RNA were used as a control to ensure equal amounts of RNA

VOL. 188, 2006 CBRA REGULATES CELL SURFACE PHYSIOLOGY AND SYMBIOSIS 4509

on Novem


.org/D

ownloaded from

http://jb.asm.org/

TABLE 1. Bacterial strains, phage, plasmids, and PCR primers used in this study

Strain/reagent Relevant characteristics Source or reference

Straina

MT616 E. coli MM294; pRK600 Cmr T. FinanDH5 E. coli endA1 hsdR17 supE44 thi-1 recA1 gyrArelA1 (lacZYA-argG) U169 deoR BRL Corp.Rm1021 SU47 Smr F. AusubelSmGC24 Original cbrA::Tn5 isolate This studyKEG2016 Transduced cbrA::Tn5 This studyKEG2018 exoY210::Tn5-233 �M12 transduction from Rm7210KEG2019 exoH::lacZ�-accC1 (Gmr) �M12 transduction from RmI-H1KEG2020 KEG1016 exoH::lacZ�-accC1 (Gmr) This studyKEG2081 KEG2016 exoY210::Tn5-233 This studyKEG2098 recA::Tn5-233 �M12 transduction from Rm6062KEG2099 KEG2016 recA::Tn5-233 This studyKEG2101 exoK445::Tn5-233 �M12 transduction from Rm8826KEG2102 exsH13::Tn5-132 �M12 transduction from Rm8823KEG2103 KEG2102 exoK445::Tn5-233 This studyKEG2104 KEG2016 exoK445::Tn5-233 This studyKEG2105 KEG2016 exsH13::Tn5-132 This studyKEG2106 KEG2098 pLAFR2070 This studyKEG2107 KEG2098 pLAFR2070fbpB This studyKEG2108 KEG2098 pLAFR2070cbrA This studyKEG2115 KEG2099 pLAFR2070 This studyKEG2116 KEG2099 pLAFR2070fbpB This studyKEG2117 KEG2099 pLAFR2070cbrA This studyKEG2118 KEG2105 exoK445::Tn5-233 This studyKEG2124 exsA::lacZ�-accC1 (Gmr) �M12 transduction from RmH22aKEG2125 KEG2124 cbrA::Tn5 This studyKEG2126 KEG2124 exsE317::Tn5-233 This studyKEG2127 KEG2126 cbrA::Tn5 This studyKEG2128 KEG2102 exoK445::Tn5-233 This studyKEG2129 KEG2124 cbrA::Tn5 This studyKEG2130 exsE317::Tn5-233 �M12 transduction from Rm8317KEG2131 KEG2016 exsE317::Tn5-233 This studySmJL12 pVO155 cbrA�-uidA� cbrA� This study

Phage�M12 Generalized transducing phage T. Finan

PlasmidspLAFR1 library Genomic library in pLAFR1 cosmid 34pLAFR2070 cbrA::Tn5 complementation cosmid This studypLAFR2070fbpB pLAFR2070 except fbpB replaced with cat This studypLAFR2070cbrA pLAFR2070 except cbrA replaced with cat This studypJL1049 pVO155 derivative with a cbrA�-uidA� fusion This study

PCR primerscbrA5� 5�CGCAAACGATCCGTC This studycbrA3� 5�CAATTGGCCAAGAC This studyfbpB5� 5�GTTAACTTGCACTTC This studyfbpB3� 5�GTTAACCTATGAC This studycbrAup 5�GTCGGGTCGAAAGAGAG This studycbrA353 5�GAACAGAATTGCCTCTTC This studycbrA-CATprime1 5�GTTGCTGGACCGGGCTGGGTATTAATAGAGCGTTAACGCGCAAAC

GATCCGTCGTGTAGGCTGGAGCTGCTTCThis study

cbrA-CATprime2 5�TCAATTGGCCAAGACGCGTTGTGAGGGAAAGGATATTTCCACCAGCGTGCCCTCATATGAATATCCTCCTTAG

This study

fbpB-CATprime1 5�CCTGCGGGAGCCAGTTTGTCGGTTCTTGAGGGTTGAGGAAACTGCGGGCTGTGTAGGCTGGAGCTGCTTCG

This study

fbpB-CATprime2 5�CTATGACCGGCGTTCGAGCGACCGGGACACCAGGATGACGGGGACCATCCCCATATGAATATCCTCCTTAG

This study

c1 5�TTATACGCAAGGCGACAAGG 23c2 5�GATCTTCCGTCACAGGTAGG 23cbrAgus5� 5�TCTTCGGTCGCGGTCTTCATCTTG This studycbrAgus3� 5�GGGGTACTGTCTTTCGGGCATAGG This study

a All S. meliloti strains used in this study were derived from the wild-type Rm1021.

4510 GIBSON ET AL. J. BACTERIOL.

on Novem


.org/D

ownloaded from

http://jb.asm.org/

template between reactions, and the number of PCR cycles was varied in incre-ments from 20 to 40 to determine the linear range for each target transcript. ThePCR products were analyzed by 1% agarose Tris-acetate-EDTA electrophoresisin the presence of ethidium bromide and visualized with UV. Total RNA fromeach growth phase was independently isolated at least three times, and theRT-PCR data presented represent a typical result within the linear range foreach transcript.

EPS isolation. Stationary-phase cultures were centrifuged at 4°C for 30 min at3,000 RCF, and the cleared supernatant was isolated. EPS present in the super-natant was isolated as described previously (25): EPS was precipitated away fromthe sugars present in LB medium using 0.3 volume of 1% centrimide, the pelletwas resuspended in 10% NaCl, and the EPS was reprecipitated with 2 volumesof cold acetone. The concentration of total carbohydrate was determined usingthe anthrone-H2SO4 method (54); sterile LB/MC treated similarly gives noanthrone-positive signal. The amount of carbohydrate present in each superna-tant was normalized to the protein concentration of its corresponding cell pellet,which was determined using the Bradford assay (Bio-Rad). The average andstandard deviation for each strain was derived from the results of three inde-pendent cultures.

Protein isolation and Western blot analysis. Bacterial cultures were centri-fuged at 4°C for 10 min at 10,000 RCF, and the cleared supernatant was isolated.Proteins within the supernatant were precipitated by the addition of 0.2 volumeof 100% trichloroacetic acid. The pellet was resuspended in 10 mM Tris, pH 8.0,and the protein concentration of each sample was determined using the Bradfordassay (Bio-Rad). Ten micrograms of protein was subjected to 12% sodiumdodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) and transferred

to an Immobilon-P polyvinylidene difluoride membrane (Millipore) for subse-quent Western blot analysis. The polyvinylidene difluoride membrane wasprobed with both an anti-ExoK primary antibody (1:5,000 dilution) and ananti-ExsH primary antibody (1:10,000 dilution) (87) and subsequently probedwith a horseradish peroxidase-conjugated anti-rabbit (Pierce) secondary goatantibody (1:10,000 dilution). The Western blot was developed using the Super-Signal West Dura kit (Pierce) and exposed to film.

Physiological-stress assays. For the efficiency-of-plating (EOP) assays, cul-tures were grown to exponential phase (OD600, �0.5) in LB/MC medium andthen diluted to an OD600 of 0.1 in LB. Each sample was serially diluted from 100

to 10�6 in LB, and 50 �l was spread onto LB agar containing either deoxycholate(Sigma) or indole (Sigma). After 4 to 5 days of growth at 30°C, the number ofCFU was determined, with the exception of the cbrA::Tn5 mutant, which re-quired an additional 48 h of growth at 30°C for colonies to appear on LBsupplemented with 1 mM indole. The average and standard deviation for eachstrain were derived from three independent cultures, with each dilution spreadonto two plates. The EOP assay to determine pLAFR2070 complementation wasperformed similarly with the exception that tetracycline was added to all of thegrowth media.

Nodulation assays. Medicago sativa AS13R seeds were sterilized by treatmentwith 70% ethanol for 30 min, followed by treatment with 20% bleach for another30 min. The seeds were washed in distilled water (dH2O) for 5 h and stored indH2O at 4°C in the dark for approximately 2 days prior to germination. The seedswere germinated on 1% agar/dH2O upside down in the dark at room tempera-ture overnight. Seedlings were transferred to buffered nodulation medium(BNM) agar plates (pH 6.0) (26) and allowed to grow for 4 to 5 days before

FIG. 1. A calcofluor-bright transposon screen yields a succinoglycan overproducer disrupted for a putative histidine kinase sensor. Succino-glycan production was visualized on LB calcofluor medium. (A) 1, Rm1021 (wild type); 2, KEG2018 (exoY); 3, KEG2016 (cbrA); 4, KEG2081 (cbrAexoY). (B) 1, KEG2106 (recA pLAFR2070); 2, KEG2107 (recA pLAFR2070fbpB); 3, KEG2108 (recA pLAFR2070cbrA); 4, KEG2115 (cbrA recApLAFR2070); 5, KEG2116 (cbrA recA pLAFR2070fbpB); 6, KEG2117 (cbrA recA pLAFR2070cbrA). (C) 1, Rm1021 (wild type); 2, KEG2016(cbrA); 3, KEG2124 (exsA); 4, KEG2125 (cbrA exsA); 5, KEG2130 (exsE); 6, KEG2131 (cbrA exsE). (D) The calcofluor-bright Tn5 mutation islocated within ORF Smc00776 (accession number CAC45293). The combined results of conserved domain database searches with NCBI rpsblast(http://www.ncbi.nlm.nih.gov/Structure/cdd/wrpsb.cgi) and SMART database (http://smart.embl-heidelberg.de/) predict a two-component histidinekinase domain (E value � 1.2e�17), an associated histidine kinase ATPase domain (E value � 5.3e�24), and at least one sensory PAS domain: PASdomain 1 (E value � 2.2e�00) and PAS domain 2 (E value � 1.5e�10). Several CbrA orthologs were found in related alphaproteobacteria:Agrobacterium tumefaciens C58 (AAK86425), Brucella melitensis 16 M (AAL51598), B. suis 1330 (AAN30511), B. abortus biovar 1 strain 9-941(YP_222279), Mesorhizobium loti (BAB52812), and Bradyrhizobium japonicum USDA 110 (BAC52661). The percent identity and percent similarityfor each predicted domain (indicated by arrows below the ORF) were determined by aligning the CbrA orthologs using T-COFFEE (64); aminoacid similarity was assigned based on ClustalW1.60.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

bacterial inoculation to promote synchronous nodule development. The rootswere directly inoculated with 100 �l of bacteria that had been cultured tologarithmic phase (OD600, �0.5) in LB/MC medium, spun down, washed in 0.5 BNM medium, and then diluted to an OD600 of 0.1 in 0.5 BNM medium. Plantphotographs were taken and microscopic analysis of nodules (see Fig. 2) wasperformed at 28 days postinoculation. Nodule development (number of nodules/plant and percent pink nodules/total number of nodules per plant) and plantheight were monitored for a period of 5 weeks (see Table 3). Plant height wasassessed by measuring the length of the epicotyl stem. Nodules were surfacesterilized with 70% ethanol for 30 s, followed by three water washes, and treat-ment with 10% bleach for 30 s, followed by three water washes. The nodules werethen crushed with a sterile pestle in 100 �l of LB/MC medium containing 0.3 Mglucose. The nodule suspension was serially diluted (100 to 10�6) and plated ontoLB/MC medium containing 0.3 M glucose. When appropriate, the medium wassupplemented with 0.02% calcofluor and 10 mM MES, pH 7.5, with or withoutneomycin.

Expression analysis of cbrA in nodules. A fragment containing the 5� ends ofboth cbrA and the oppositely transcribed Smc00777 ORF was PCR amplifiedwith primers cbrAgus5�/cbrAgus3�. The fragment was cloned into the uidA�

promoterless suicide plasmid pVO155 (3), resulting in plasmid pJL1049.pJL1049 was mated into Rm1021, and transconjugants were screened for thecorrect insertion. The resulting strain, SmJL12, contains a cbrA�-uidA� transcrip-tion fusion, followed by the intact cbrA gene with its native promoter. Plantsinoculated with SmJL12 showed a wild-type phenotype for nodulation. Four-week-old nodules were excised, sectioned, and stained with 1 mM 5-bromo-4-chloro-3-indoyl-�-D-glucuronide in 50 mM Na-phosphate buffer, pH 7, with0.02% SDS. Stained sections were washed three times with Na-phosphate buffer,pH 7, and analyzed by microscopy.

RESULTS

Identification of the cbrA gene encoding a putative two-component histidine kinase affecting succinoglycan produc-tion, stress resistance, and symbiosis. To identify genes in-volved in succinoglycan production, we performed a randomTn5 mutagenesis of the wild type, Rm1021. The screen wasperformed on LB containing calcofluor, a dye that fluorescesunder UV light specifically when bound to certain �-linkedpolysaccharides, including succinoglycan (49). We chose tocharacterize mutants with a calcofluor-bright phenotype, whichindicated succinoglycan overproduction or alteration in pro-duction. We then performed a secondary screen to identifycalcofluor-bright mutants that were also defective for sym-biosis with alfalfa, resulting in either a Nod� (no nodules),Fix� (white nodules), or Ndv� (defective nodule develop-ment) phenotype. Here, we describe our characterization ofone Tn5 mutant with a calcofluor-bright phenotype (Fig. 1A)and a profound symbiotic deficiency (Nod� with a mixture ofFix� and Ndv� nodules) (Fig. 2A to D). In contrast to othercalcofluor-bright mutants (25, 61), this strain is not mucoid(Fig. 1A).

We identified the genomic location of the Tn5 mutation bycloning the transposon with flanking S. meliloti genomic DNAinto pUC19 and sequencing the genomic DNA adjacent to thetransposon. The Tn5 insertion was found to disrupt a largeORF of 3.4 kb located on the S. meliloti chromosome anno-tated as Smc00776. Based on a conserved domain databasesearch, this ORF is predicted to encode a soluble cytoplasmic

FIG. 2. Plant growth and nodule morphology resulting from sym-biosis of alfalfa. (A) Average plants inoculated with either wild-type orcbrA bacteria were photographed after 28 days of growth. (B) The typeIII nodule, elongated and pink in coloration (Fix�), represents 99% ofnodules elicited by the wild type and 0 to 5% of nodules elicited by thecbrA mutant. (C) The type I nodule is small and white (Fix�) andrepresents on average 60% of the nodules elicited by the cbrA mutant.(D) The type II nodule is stunted in size with a slight pink coloration

at the base of the nodule (Ndv�) and represents approximately 40% ofthe nodules elicited by the cbrA mutant. (E) A nodule from a plantinoculated with a strain containing a cbrA�-uidA� fusion in a cbrA�

background was stained for �-glucuronidase activity.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

two-component histidine kinase associated with at least onesensory PAS domain (66, 86) and a large N�-terminal sequenceof unknown function that represents nearly two-thirds of theprotein (Fig. 1D). We have designated this gene cbrA, forcalcofluor-bright regulator A.

Putative CbrA orthologs were identified in several closelyrelated alphaproteobacteria, including the plant pathogenAgrobacterium tumefaciens and the animal pathogens Brucellamelitensis, Brucella abortus, and Brucella suis. The amino acidsequences of these proteins were aligned, revealing a 12.5%conservation of identity and a 53% conservation of similarity inamino acid sequence over the length of the protein (see Fig. S1in the supplemental material). The most significant regions ofsimilarity between CbrA orthologs are limited to the C�-ter-minal PAS and histidine kinase domains (Fig. 1D), providinglittle insight into the importance or function of the variableN�-terminal portion of CbrA. The putative kinase encoded bycbrA was not located beside or near a member of the responseregulator family, leaving the identity of the presumed CbrAcognate response regulator unknown. Instead, cbrA is located3� of a divergently transcribed ORF encoding a conservedhypothetical protein annotated as Smc00777 and 5� of the fbpBgene encoding a putative ABC iron transporter (Fig. 1D).

In contrast to the wild type, the cbrA::Tn5 mutant is unableto form single colonies on LB containing 10 mM DOC. Uti-lizing this DOC-sensitive phenotype, we isolated pLAFR1 cos-mids from an S. meliloti genomic library that restored wild-typegrowth to the cbrA::Tn5 mutant. Fifteen independent pLAFR1cosmids were isolated, and they each also restored a wild-typecalcofluor phenotype to the cbrA::Tn5 mutant. The cosmidscontained both cbrA and the downstream fbpB ORFs, as de-termined by PCR analysis (data not shown), so we used the�Red system in Escherichia coli to perform a directed deletionof either cbrA or fbpB in the complementing clonepLAFR2070 (23). The parent cosmid and each deletion deriv-ative were introduced into the wild-type and the cbrA::Tn5backgrounds, and effects on calcofluor fluorescence and DOCsensitivity were determined.

In a cbrA� strain, pLAFR2070 (cbrA� fbpB�) and the de-letion derivatives pLAFR2070fbpB and pLAFR2070cbrAeach present a wild-type calcofluor phenotype (Fig. 1B). Cor-respondingly, pLAFR2070 and its deletion derivatives supportthe same efficiency of plating (58 to 99% EOP) for the wildtype on LB containing 10 mM DOC (Table 2). In thecbrA::Tn5 mutant, only the pLAFR2070cbrA cosmid resultedin a calcofluor-bright phenotype and a severely decreased EOP(0.0076%) on LB containing 10 mM DOC, indicating a loss of

complementation relative to pLAFR2070. These complemen-tation results suggest that the cbrA::Tn5 mutation is a recessiveallele of cbrA, which is solely responsible for both the calco-fluor-bright and DOC-sensitive phenotypes of the mutant.Therefore, we will refer to the cbrA::Tn5-containing strain asthe cbrA mutant.

The cbrA mutant is ineffective at establishing alfalfa symbi-osis. To characterize the symbiotic deficiency associated withthe cbrA mutant, alfalfa seedlings were either mock inoculatedwith 0.5 BMN medium or inoculated with several strainsderived from the wild type, Rm1021. Alfalfa plants inoculatedwith the wild type grow to a height of 15 (�0.95) cm after 5weeks of growth, and the leaves of the plants are a healthygreen color (Fig. 2A). In contrast, plants inoculated with thecbrA mutant are significantly shorter, with an average height of5.2 cm (�0.58), and the leaves are slightly yellowed comparedto plants inoculated with the wild type (Fig. 2A). Plants thatare mock inoculated grow only 2.4 cm (�0.87) and displaysickly yellow leaves due to nitrogen starvation on the BMNmedium used to test nodulation. The symbiotic deficiency ofthe cbrA mutant is fully complemented by the pLAFR2070cosmid as long as the cbrA ORF is present, but not by thepLAFR2070cbrA cosmid (Table 3).

We determined the efficiency of nodule formation through-out a 5-week period and observed that the numbers of nodulesper plant elicited by the wild type (13 � 5) and cbrA mutant(10 � 4) were similar and that they appeared without an appre-ciable difference in timing (data not shown). As expected,nodules elicited by the wild type were elongated and pink incoloration (Fig. 2B). In contrast, nodules induced by the cbrAmutant were variable in both size and coloration. On plantsinoculated with the cbrA mutant, nearly 60% of nodules were

TABLE 2. EOP assay for pLAFR2070 complementation of deoxycholate sensitivity

Strain (genotype)LB � Tet (CFU)a

EOP (%)0 mM DOC 10 mM DOC

KEG2106 (recA pLAFR2070) 6.42 107 (�1.5 107) 3.70 107 (�6.2 106) 58KEG2107 (recA pLAFR2070fbpB) 7.44 107 (�2.1 107) 7.33 107 (�7.3 106) 99KEG2108 (recA pLAFR2070cbrA) 7.77 107 (�1.8 107) 6.16 107 (�1.2 107) 79KEG2115 (recA cbrA pLAFR2070) 8.86 107 (�5.6 106) 3.03 107 (�7.6 106) 34KEG2116 (recA cbrA pLAFR2070fbpB) 5.23 107 (�1.0 107) 2.52 107 (�9.3 106) 48KEG2117 (recA cbrA pLAFR2070cbrA) 3.90 107 (�7.4 106) 2.96 103 (�7.2 102) 7.6 10�3

a Numbers in parentheses are standard deviations derived from triplicate samples.

TABLE 3. pLAFR2070 complementation of theS. meliloti-alfalfa symbiosis

Strain (genotype) Plant htaNo. of

nodules/planta

% Pinknodulesb

KEG2098 (recA) 10 � 1.7 8.6 � 3 70 � 10KEG2099 (recA cbrA) 4.5 � 0.88 12 � 4 19 � 11KEG2106 (recA pLAFR2070) 11 � 1.5 8.1 � 5 81 � 8KEG2107 (recA pLAFR2070fbpB) 12 � 0.85 15 � 3 70 � 11KEG2108 (recA pLAFR2070cbrA) 11 � 1.5 9.2 � 3 76 � 12KEG2115 (recA cbrA pLAFR2070) 8.6 � 3.1 11 � 7 67 � 8KEG2116 (recA cbrA pLAFR2070fbpB) 9 � 3 11 � 7 77 � 12KEG2117 (recA cbrA pLAFR2070cbrA) 4 � 1.1 14 � 6 9.5 � 8

a Standard deviations are derived from a minimum of 10 plants.b Includes type II and type III nodules.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

small and white (Fig. 2C, type I nodule), approximately 40%were small with a pale pink coloration at the base (Fig. 2D,type II nodule), and only a few (0 to 5%) nodules were indis-tinguishable in size and coloration from those elicited by thewild type (type III nodule). We assessed the level of cbrAexpression in cbrA� bacteria using a cbrA�-uidA� fusion inte-grated at the gene locus and observed expression of cbrAthroughout the nodule (Fig. 2E), consistent with the possibilitythat CbrA is present throughout symbiotic development andcould potentially play a role in regulating bacterial physiologyduring multiple stages of nodulation.

We isolated bacteria from wild-type- and cbrA-induced nod-ules to assess whether the cbrA mutant was able to establish achronic infection. The number of colonies recovered from nod-ules induced by the wild type was 6.4 105 (�8 104) pernodule. In contrast, we were unable to recover any bacteriafrom the predominant type I nodules elicited by the cbrA mutant.Recovery of bacteria from both of the cbrA-induced type II andtype III nodules was highly variable (8.8 104 � 3 104 pernodule), an indication that the mutant is compromised forcolonization of its host.

We compared the calcofluor and DOC resistance pheno-types of colonies derived from cbrA-induced nodules to thoseof the wild type and cbrA mutant. Bacteria recovered fromcbrA-induced type II and type III nodules were uniformly calco-fluor bright and DOC sensitive in a manner indistinguish-able from the original cbrA::Tn5 mutant (data not shown).However, it remained possible that the small number of typeIII nodules induced by the cbrA mutant represented extragenicsuppressors and that neither the calcofluor-bright nor theDOC-sensitive phenotype was directly related to the symbioticdeficiency of the mutant. To test this, we reinoculated alfalfawith cbrA bacteria recovered from type III nodules. Plantsinoculated with the nodule-recovered cbrA bacteria were in-distinguishable from those inoculated with the original cbrAmutant, with an average plant height of 4.9 (�0.89) cm. There-fore, the cbrA mutant does not accumulate suppressors withinthe nodule but rather has a somewhat variable symbiosis phe-notype on alfalfa.

Coinoculation experiments in which two strains are forced tocompete for colonization of a single niche can often revealdefects not observed during single-strain inoculations. To de-termine the competitiveness of the cbrA mutant, we performeda coinoculation experiment with a 1:1 ratio of wild-type to cbrAbacteria. After 4 weeks of plant growth, we observed that themajority of nodules (87% on 20 plants) were indistinguishablefrom those elicited by the wild type alone. We isolated bacteriafrom coinoculated nodules and plated them onto LB calcofluormedium with or without neomycin. We observed a recoveryrate of 3.9 105 (�2 104) per nodule for wild-type bacteria;however, we were unable to recover any calcofluor-bright orneomycin-resistant colonies indicative of the cbrA mutant.Thus, the cbrA mutant is unable to compete effectively with thewild type for colonization of the nodule, reflecting a crippledcapacity for nodulation.

The cbrA mutant has a calcofluor-bright and extended-halophenotype that reflects succinoglycan overproduction. The S.meliloti exopolysaccharide succinoglycan is a symbiotically im-portant macromolecule whose chemical modifications and po-lymerization state influence its symbiotic proficiency (19, 49).

To distinguish whether the cbrA mutant calcofluor-bright phe-notype reflected altered succinoglycan production or synthesisof a novel calcofluor-binding exopolysaccharide, we combinedthe cbrA allele with the well-characterized exoY (encoding agalactose-1-P-transferase) null mutation that completelyblocks the first step of succinoglycan biosynthesis (15, 60). Likethe exoY null mutant, the cbrA exoY double mutant is dark onLB calcofluor medium, demonstrating that the exoY mutationis epistatic to the cbrA mutation (Fig. 1A). Identical epistasisresults were obtained with null mutations of exoB (encoding aUDP-glucose-4-epimerase) and the glycosyltransferase genesexoA and exoL, as well as exoF, exoP, exoQ, and exoT nullmutations, i.e., the cbrA mutant is calcofluor dark when com-bined with any one of these exo mutations (data not shown).Thus, the calcofluor-bright phenotype of the cbrA mutant re-flects altered succinoglycan production. In addition, the cbrAmutant rapidly develops a fluorescent halo on calcofluor me-dium after just 2 days of growth while the wild type requiresapproximately 5 days to produce a fluorescent halo (Fig. 3).The florescent halo makes visible the diffusion of LMW suc-cinoglycan into the medium surrounding a colony (48, 88). Notsurprisingly, halo formation by both the wild type and cbrAmutant is also dependent on exoY (Fig. 3).

To distinguish whether the cbrA extended-halo phenotype isdependent on the functions of known exo genes or is producedthrough a novel mechanism, we performed a series of geneticepistasis analyses with genes known to be involved in LMWsuccinoglycan production. For instance, halo formation is de-layed in an exoK null mutant disrupted in one of the extracel-lular glycanases that degrade nascent HMW succinoglycan intoLMW products (7) (Fig. 3). The cbrA exoK double mutantproduces a halo that is also delayed relative to that of the cbrAsingle mutant. Interestingly, the exoK mutation is not com-pletely epistatic to the cbrA allele, since the cbrA exoK doublemutant produces a halo similar in timing and extent to that

FIG. 3. The cbrA mutant has an extended-halo phenotype. Thesuccinoglycan fluorescent-halo phenotype was assessed on LB calco-fluor medium atr 2, 5, and 10 days postinoculation (dpi). The exoalleles transduced into the cbrA� (wild-type [WT]) and cbrA�

(cbrA::Tn5) backgrounds are indicated on the left.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

produced by the wild type rather than the exoK mutant. Nullmutants disrupted for a second extracellular glycanase en-coded by exsH were found to produce a halo indistinguishablefrom that of the wild type (88). Nevertheless, the exsH exoKdouble mutant completely lacks a halo, revealing that the de-layed halo of the exoK mutant is exsH dependent (88). Whilethe cbrA exsH double mutant produces an extended halo in-distinguishable from that of the cbrA mutant, the moderatehalo of the cbrA exoK double mutant is further delayed uponintroduction of the exsH mutation. These results indicate thatthe activities of both extracellular glycanases contribute toproduction of the cbrA halo in a manner similar to that ob-served previously with the wild type.

The succinyltransferase ExoH is also required for produc-tion of LMW succinoglycan (48), since nonsuccinylated formsof this EPS are not substrates for either ExoK or ExsH deg-radation (89). Thus, an exoH null mutant was observed tocompletely lack a fluorescent halo (7, 47, 89) (Fig. 3). The cbrAexoH double mutant is defective for halo formation in a man-ner indistinguishable from the exoH single mutant, indicatingthat the cbrA mutant absolutely requires the succinylation ofEPS monomers for halo production. Thus, the cbrA mutantextended-halo phenotype is dependent on the depolymeriza-tion of nascent secreted HMW succinoglycan based on therequirement for both ExoH-dependent succinylation and theextracellular glycanases ExoK and ExsH.

The extended-halo phenotype of the cbrA mutant suggeststhat succinoglycan production could be altered with a shifttoward LMW exopolysaccharides at the expense of HMWforms. Alternatively, significant halo formation by the cbrAexoK mutant compared to the exoK mutant indicates that thecbrA allele could affect the absolute amount of succinoglycanproduced and thereby lead to increased accumulation of LMWforms. Therefore, we quantified the production of total extra-cellular polysaccharides by analyzing the anthrone-positive car-bohydrate content of conditioned LB/MC medium superna-tant. When grown to stationary phase, the cbrA mutant producesapproximately 23-fold more EPS than the wild type (Table 4).Under these growth conditions, the exoY mutant produces four-fold less EPS than the wild type. Importantly, the cbrA exoYdouble mutant produces the same low level of EPS observed withthe exoY single mutant, demonstrating that the major extracellu-lar polysaccharide being assayed under these growth conditions issuccinoglycan. While the exoH and exoK single mutants producewild-type levels of EPS, the levels of succinoglycan production in

the exoH cbrA and exoK cbrA double mutants resemble that of thecbrA parent strain. Thus, exoH and exoK null mutations do notalter the amount of succinoglycan made but do alter the molec-ular-weight distribution of the molecule as reflected by fluores-cent-halo formation. These results support the possibility that thecbrA mutant produces an extended-halo phenotype as a result ofsuccinoglycan overproduction.

CbrA regulates the expression of genes within the succino-glycan biosynthetic cluster in a growth phase-dependentmanner. To understand the underlying mechanism for alteredsuccinoglycan production in the cbrA mutant, we undertook anexpression analysis of genes within the large exo/exs clusterrequired for production, modification, and secretion of succi-noglycan (40) (Fig. 4A). We began by assaying secreted ExoKand ExsH protein levels, since these two extracellular gly-canases contribute to the cbrA extended-halo phenotype (Fig.3). The amounts of secreted ExoK and ExsH in LB/MC culturesupernatants were determined by Western blot analysis of tri-chloroacetic acid-precipitated protein (Fig. 4B). Although wefound no difference in secreted ExoK levels detected underexponential-growth conditions, we did observe an increasefrom the cbrA mutant relative to the wild type during station-ary-phase growth. In contrast, the amount of secreted ExsHwas unaltered by the presence of the cbrA allele during eitherexponential- or stationary-phase growth.

We wanted to further determine whether CbrA affects theexpression of genes involved in succinoglycan production atthe transcriptional level. ExoH and ExoT both contribute tothe production of LMW succinoglycan (39, 47), while ExoYcatalyzes the first step in monomer biosynthesis and is regu-lated by several transcription factors that modulate the level ofsuccinoglycan production (11, 21, 67, 72, 85). We compared theexpression levels of an exoH�-lacZ�, an exoT�-lacZ�, and anexoY�-lacZ� fusion within cbrA� and cbrA::Tn5 allelic back-grounds on LB medium containing X-Gal (5-bromo-4-chloro-3-indolyl-�-D-galactopyranoside). The activity of �-galactosi-dase expressed from an exoY-�lacZ� fusion is unchanged uponintroduction of the cbrA mutation (data not shown). In con-trast, the cbrA mutation results in increased �-galactosidaseactivity from the exoH�-lacZ� and exoT�-lacZ� fusions com-pared to the wild type (data not shown), suggesting that CbrAis able to alter gene expression at the level of either transcrip-tion or mRNA stability.

We therefore expanded our study of exo/exs gene expressionby performing RT-PCR analyses to determine the extent towhich CbrA regulates genes within the succinoglycan biosyn-thetic cluster. We primarily chose to analyze genes required forsuccinoglycan biosynthesis or modification, and particularlythose that appear to represent the first gene within an operon(Fig. 4A). The wild type and cbrA mutant were grown inLB/MC medium under logarithmic- and stationary-phasegrowth conditions, and total RNA was isolated. The cbrA mu-tant displayed increased transcript levels of exsA, exsE, andexoB, as well as confirming the increased expression of exoHand exoT indicated by transcription fusions (Fig. 4C). Interest-ingly, the CbrA-dependent increase in expression of exsA, exsE,and exoB is strictly limited to stationary-phase growth condi-tions, as was observed with ExoK (Fig. 4B). Although we didobserve a subtle, but consistent, cbrA-dependent increase inexoH and exoT transcripts during exponential growth, the more

TABLE 4. Quantitation of anthrone-positive EPSs fromstationary-phase cultures

Strain (genotype) nM EPS/mg proteina Ratio(strain/wild type)a

Rm1021 (wild type) 15.3 � 5.8 1KEG2018 (exoY) 3.46 � 0.9 0.23KEG2016 (cbrA) 351 � 11 23KEG2081 (cbrA exoY) 5.34 � 3.1 0.35KEG2019 (exoH) 15.9 � 2.2 1.03KEG2020 (cbrA exoH) 395 � 9.5 26KEG2101 (exoK) 14.7 � 4.8 0.96KEG2104 (cbrA exoK) 381 � 10 25

a Standard deviations are derived from triplicate samples.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

dramatic change in transcript levels is observed during station-ary-phase growth. In contrast, the majority of gene transcriptsassayed by RT-PCR (exsG, exsH, exoA, exoF, exoL, exoP, exoQ,exoV, exoW, exoY, exoZ, exoR, exoS, and chvI) are unaffected bythe presence of the cbrA::Tn5 allele during stationary-phasegrowth (data not shown). In total, the results of our analysesindicate that CbrA regulates the expression of a very smallsubset of exo/exs genes, and primarily under stationary-phasegrowth conditions. Combined with our previous observationsregarding halo formation, these data indicate that the cbrAallele may affect succinoglycan production in two distinct andgenetically separable manners: increased biosynthesis of suc-cinoglycan (through exoB regulation), as well as an alteredmolecular-weight distribution of the extracellular polysaccha-ride (through exoH, exoT, and ExoK regulation).

The CbrA-regulated exsA and exsE genes are predicted tofunction as inner membrane ABC transporters; however, theirindividual substrates have yet to be determined (9, 53). Nullmutations in either exsA or exsE were shown to have no effecton calcofluor fluorescence (9, 55). We also found that thesenull mutations have little to no effect on the cbrA calcofluor-bright phenotype (Fig. 1C). Thus, in contrast to other cbrA-

regulated genes, these transporters are not involved in thesuccinoglycan overproduction phenotype of the cbrA mutant.

The cbrA mutant is sensitive to deoxycholate, which is sug-gestive of a compromised cell envelope. In addition to succi-noglycan, another aspect of the cell surface that plays a role insymbiosis is the LPS of the outer membrane. Mutants withdistinct LPS alterations, but a common sensitivity to detergentsin the medium, are unable to establish a chronic intracellularhost infection and rapidly degenerate (16, 29, 37). Given thecbrA mutant symbiosis deficiency, we were interested to deter-mine whether the cbrA mutant had phenotypes characteristicof envelope defects. In contrast to the wild type, we observedthat the cbrA mutant is unable to form single colonies whengrown on LB plates supplemented with either the cationicdetergent DOC (10 mM) or the hydrophobic dye crystal violet(1 �g/ml), suggestive of an alteration in the cell envelope of thecbrA mutant (data not shown). However, the cbrA mutant isnot universally sensitive to the presence of membrane-disrupt-ing agents in the medium. For instance, there was little to nosensitivity observed during growth in the presence of the cat-ionic detergent sodium dodecyl sulfate or the cationic peptidemelittin (data not shown). Therefore, the cbrA mutant appears

FIG. 4. CbrA regulates the expression of a subset of exo/exs genes in a growth phase-dependent manner. (A) The exo/exs gene cluster on pSymBis required for succinoglycan biosynthesis. The stippled arrows represent genes that were assayed for CbrA-dependent regulation: those in blackare derepressed in the cbrA mutant, while those in white are unaffected by cbrA. Genes represented by solid gray arrows were not assayed.(B) ExoK and ExsH levels were assayed by Western blot analysis of cbrA� (wild type) and cbrA� (cbrA::Tn5) culture supernatants derived fromeither exponential- or stationary-phase-grown cells. (C) Total RNA isolated from cbrA� (wild type) and cbrA� (cbrA::Tn5) strains grown to eitherexponential or stationary phase in LB/MC medium were subjected to RT-PCR analysis. The gene amplified in each RT-PCR is indicated abovethe gel; although the final products were analyzed in a single gel, a few intervening lanes were cropped out of the final image for clarity.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

to be sensitive to a certain spectrum of stress agents. We alsoobserved that the cbrA exoY double mutant, which is unable toproduce succinoglycan (Fig. 1A), is as sensitive to DOC as isthe cbrA parent, while an exoY single mutant possesses a wild-type level of resistance to this agent (data not shown). Thus,the detergent sensitivity of the cbrA mutant appears to beindependent of succinoglycan production.

We quantified the DOC sensitivity of the wild type and thecbrA mutant by performing an EOP assay on LB mediumcontaining various amounts of DOC (Fig. 5). With an initialinoculum at an OD600 of 0.1 (ca. 107 cells/ml), we observed thecbrA mutant to be approximately an order of magnitude moresensitive than the wild type to growth in the presence of as littleas 1 mM DOC. A more pronounced cbrA mutant sensitivitywas observed during growth in the presence of increasingamounts of DOC. We chose a concentration of 10 mM DOCfor future studies in order to detect either an exacerbation orsuppression of the sensitivity associated with the cbrA::Tn5allele when combined with additional mutations.

Expression of the two ABC family transporters encoded byexsA and exsE is increased in the cbrA mutant. ExsA is relatedto the E. coli MsbA protein (64% similarity, 30% identity),which is required for transport of lipid A and phospholipidswithin the inner membrane (24, 92). It was reported that ExsEis a member of the BacA/hALD family of transporters involvedin peroxisomal transport of very long-chain fatty acids (27, 53),

and very long-chain fatty acids are a unique component of thelipid As in alphaproteobacteria (12, 14). Since the S. melilotibacA gene is required for symbiosis (37), we looked for CbrA-dependent regulation of a bacA�-�phoA fusion but observed nodifference in bacA expression when comparing the wild type tothe cbrA mutant (data not shown). In addition, we found thatthe cbrA bacA double mutant was an order of magnitude moresensitive to DOC treatment than was either single mutant(data not shown), further suggesting that these two genes func-tion independently to alter the cell envelope.

Since homology predicts that ExsA and ExsE could playroles in lipid trafficking and the exsA and exsE mutations hadlittle effect on the cbrA succinoglycan phenotype, we assessedwhether these genes play roles in the detergent sensitivity ofthe cbrA mutant. In comparison to the wild type, neither theexsE nor the exsA null mutant demonstrated altered growth orviability in the presence of 10 mM DOC (Table 5). The exsEexsA double mutant also has a wild-type level of DOC resis-tance, indicating that these proteins do not perform a primaryfunction in DOC import or export. In contrast, the cbrA mu-tant is several orders of magnitude more sensitive to 10 mMDOC than the wild type or exsA and exsE mutants. Wheneither an exsA or exsE null allele is combined with the cbrAmutation, we found that each double mutant remained highlysensitive to DOC. In fact, the double mutants appear to haveslightly increased DOC sensitivity relative to the cbrA mutant,indicating that neither exsA nor exsE is required to promote theDOC-sensitive physiology of the cbrA mutant. Thus, increasedexpression of exsA and exsE does not result in DOC sensitivity,indicating that there is an additional CbrA-regulated gene(s)to be discovered which plays a role in cell envelope integrity.

Growth of the cbrA mutant is reduced under oxidative-stressconditions. During early nodule development, bacterial pro-gression through the infection thread is concurrent with anoxidative burst derived from the plant (75), and mutants sen-sitive to oxidative stress were found to be symbiotically defi-cient (42, 74, 79). Since CbrA contains a PAS domain that mayprovide a redox sensory function (80), and the cbrA mutant iscompromised for the symbiosis (Fig. 2A to D), we were inter-ested in determining the role CbrA plays in bacterial resistanceto oxidative stress. In contrast to the wild type, we observedthat the cbrA mutant is unable to form single colonies whengrown on LB containing the oxidative-stress agent hydrogenperoxide (1 mM), indole (1 mM), or cumene hydroperoxide(0.2 mM), as well as the redox-cycling agent plumbagin (100�M) (data not shown).

FIG. 5. The cbrA::Tn5 mutant is sensitive to deoxycholate treat-ment. Triplicate cultures of cbrA� (wild-type) and cbrA� (cbrA::Tn5)strains were assayed for growth inhibition in the presence of variousconcentrations of deoxycholate. The number of CFU was determinedafter 4 to 5 days of growth at 30°C (further incubation of the plates didnot result in the appearance of additional colonies).

TABLE 5. EOP assay for sensitivity to DOC

Strain (genotype)LBa

EOP (DOC/LB) (%)0 mM DOC 10 mM DOC

Rm1021 (wild type) 1.02 108 (�2.2 106)* 6.57 107 (�7.7 106) 64KEG2016 (cbrA) 5.48 107 (�1.2 106) 2,847 (�711) 5.2 10�3

KEG2130 (exsE) 1.03 108 (�6.8 106) 5.90 107 (�5.0 106) 57KEG2131 (cbrA exsE) 3.51 107 (�2.7 106) 223 (�39) 6.4 10�4

KEG2124 (exsA) 9.29 107 (�1.7 107) 5.43 107 (�1.7 106) 58KEG2125 (cbrA exsA) 5.55 107 (�5.8 106) 233 (�113) 4.2 10�4

KEG2126 (exsA exsE) 9.17 107 (�5.7 106) 6.53 107 (�4.7 106) 71

a Numbers in parentheses are standard deviations derived from triplicate samples.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

To more quantitatively determine the role CbrA plays inprotecting the cell from oxidative stress, we performed an EOPassay with the wild type and the cbrA mutant on LB mediumcontaining 1 mM indole. Indole intercalates within the innermembrane and is thought to disrupt the respiratory apparatus,leading to the production of oxygen free radicals (35) and waschosen because of its relative chemical stability. With an initialinoculum at an OD600 of 0.1 (ca. 107 cells/ml), the wild type hasan EOP of 102% and the cbrA mutant has a similar EOP of83%. Unlike the wild type, however, the appearance of cbrAcolonies on LB with 1 mM indole requires an additional 48 hof growth compared to LB alone. The delayed appearance ofthe cbrA mutant indicates that oxidative stress significantlyimpairs its growth. Thus, the cbrA mutant is compromised in itsability to combat oxidative stress, although not to the extentthat viability is adversely affected.

Given our observation that CbrA regulates the expression ofseveral exo genes that alter succinoglycan production, we con-sidered the possibility that CbrA plays a role in oxidative-stressresistance through regulation of one or more of the cellularproteins that combat this stress. To test this possibility, weassayed catalase and superoxide dismutase activities fromwhole-cell lysates that had been subjected to native PAGE (41,74). We observed similar levels of SodB, KatA, and KatCactivities in the cbrA mutant and the wild type during station-ary-phase growth and during exponential growth in the pres-ence of indole (Fig. 6). Thus, CbrA does not appear to play acritical role in regulating the activities of these proteins.

DISCUSSION

Through a calcofluor-bright screen, we have isolated a pre-viously unidentified regulator, CbrA, which is critically re-quired for an effective symbiosis. CbrA is a putative two-com-ponent sensor kinase containing a PAS domain, and it controlsaspects of ex planta cell physiology relevant to symbiotic de-

velopment. The cbrA mutant is compromised for the symbiosis,eliciting nodules that are mostly Fix� or Ndv�, and it appearsunable to effectively establish a chronic infection based on thedecreased and highly variable numbers of bacteria recoveredfrom cbrA-induced nodules. This defect is further exacerbatedwhen the cbrA mutant is forced to compete with the wild typefor nodule occupancy, resulting in the complete absence ofcbrA bacteria within the nodules of coinoculated plants. Thisabsence of cbrA bacteria within coinoculated nodules also in-dicates that wild-type bacteria are unable to rescue the symbi-otic defect of the cbrA mutant, which implies that the cbrAdefect cannot be explained simply as a lack of symbioticallyactive succinoglycan. Our identification of cbrA is particularlyinteresting, since there are sparingly few regulators, for in-stance, NodD (83) and Fix/Nif proteins (32), that have beendescribed as being required for symbiosis, despite the fact thatthe developmental program dictating nodulation requires con-tinual communication between the symbiotic partners. Char-acterization of NodD and Fix/Nif regulators over the pastseveral decades has provided a wealth of information about thecomplex requirements for symbiosis, and we anticipate thatadditional insights into CbrA function will also prove impor-tant to understanding the rhizobium-legume symbiosis.

Consistent with the calcofluor-bright phenotype of the cbrAmutant, our quantitative measurements of secreted extracellu-lar carbohydrate revealed a 23-fold overproduction of succi-noglycan compared to the wild type. The enzymes responsiblefor succinoglycan production and modification have been iden-tified and characterized in great detail (10, 40). The exoB geneis among the small subset of CbrA-regulated exo genes, andexoB encodes an epimerase required for formation of theUDP-galactose that serves as a substrate for the first step inmonomer biosynthesis catalyzed by ExoY (15, 18, 72). In con-trast, the galactose-1-P-transferase encoded by exoY and theglucosyl transferases encoded by exoA, -L, and -W, which func-tion as core enzymes in the assembly of succinoglycan mono-mers (72), were not targets of CbrA regulation. Thus, thesuccinoglycan overproduction phenotype of the cbrA mutantappears to depend heavily on differential exoB expression.

The cbrA succinoglycan overproduction phenotype is accom-panied by a calcofluor extended-halo phenotype. Each of thesephenotypes requires exoY function, and in addition, the ex-tended-halo phenotype requires ExoH, ExoK, and to a lesserextent ExsH. For reasons still not understood, exoT mutantsare unable to secrete succinoglycan into the medium (72), sowe were unable to test the genetic requirement for exoT in thecbrA mutant calcofluor-bright and extended-halo phenotypes.

While our genetic analyses show that the extended-halo phe-notype of the cbrA mutant reflects an overproduction of LMWsuccinoglycan, it will be of great interest to biochemically de-termine the ratio of LMW to HMW succinoglycan and therelative degree of succinylation. However, we predict that thecbrA mutant specifically overproduces LMW forms of succino-glycan at the expense of HMW forms because of the limitednumber of exo genes whose expression is altered in the cbrAmutant. ExoH, ExoK, and ExoT each play a role in promotingLMW succinoglycan production (39, 47, 88), and the expres-sion of these factors is increased in the cbrA mutant. We failedto observe CbrA-dependent regulation of the exoV and exoZgenes, which encode enzymes that add pyruvyl or acetyl sub-

FIG. 6. The oxidative-stress sensitivity of the cbrA mutant is notdue to altered KatA/C or SodB expression. The cbrA� (wild-type) andcbrA� (cbrA::Tn5) strains were grown to stationary phase in LB/MCmedium or into logarithmic phase in LB/MC medium and subjected to5 �l of 70% ethanol (no indole control) or 5 �l of 1 M indole (1 mMindole) as indicated above the gels. Whole-cell lysates were obtainedusing a French press and subjected to 10% acrylamide SDS-PAGE.Catalase activity was assayed as described previously (79) with 15 �g oflysate, and superoxide dismutase activity was assayed as describedpreviously (73) with 12 �g of lysate.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

stituents to the succinoglycan monomer (71, 72). Accordingly,it appears that CbrA plays a role in modulating two specificand related aspects of succinoglycan composition: monomersuccinylation and polysaccharide molecular-weight distribu-tion.

Much of our understanding of the role succinoglycan playsin promoting the symbiosis suggests that the symbiotically com-petent form of this exopolysaccharide must be succinylated(38, 47). In addition, it has been shown that LMW forms ofsuccinoglycan are more effective than HMW forms at promot-ing infection thread growth and nodulation (6, 82, 84). Inter-estingly, the cbrA mutant overproduces LMW succinoglycan,and it seems likely that this exopolysaccharide is succinylatedbased on both the genetic requirement for exoH in extended-halo formation and the increased expression of exoH in themutant. Thus, the cbrA mutant appears poised for efficientinvasion of its host; however, cbrA bacteria were found to bedefective for proper nodule development on alfalfa. Althoughthis apparent contradiction is currently unresolved, it is possi-ble that the cbrA regulatory mutant fails to produce the correctform of succinoglycan under the specific conditions presentduring nodule formation. Alternatively, an overproduction ofLMW succinoglycan may itself provoke a nonproductive re-sponse from the plant. However, exoZ null mutants overpro-duce LMW succinoglycan and still elicit Fix� nodules onalfalfa (71), despite a decreased efficiency of infection threadformation (19), making this possibility less likely. Perhaps thecbrA mutant makes symbiotically competent succinoglycan andthe symbiotic defect of the mutant derives from an inability tomodulate succinoglycan composition during later developmen-tal stages.

Alternatively, the inability of the cbrA mutant to establish aneffective symbiosis with alfalfa could be related to the physio-logical defects that express themselves through sensitivity toDOC and indole. In particular, the cbrA mutant may be lesscompetent to withstand harsh aspects of the host environment,such as the oxidative burst, and these stress sensitivities couldaccount for the inability of cbrA mutants to compete with thewild type for colonization of alfalfa nodules. It is tempting tospeculate that the stress sensitivities of the cbrA mutant arerelated to changes in the composition of LPSs of the outermembrane. The exoB null mutant has an altered LPS profilesuggestive of O-antigen modifications (47), so it is possibleexoB overexpression in the cbrA mutant could affect the LPScarbohydrate content. However, it remains to be directly de-termined whether the cbrA mutant has alterations in its LPScomposition or whether the DOC and indole sensitivities ofthe cbrA mutant derive from an alternative cell envelope com-ponent.

Prior to our identification of CbrA, a number of regulatorswere known to affect succinoglycan production in S. meliloti.However, to our knowledge, CbrA is the only regulator knownto affect the expression of exoB rather than exoY. For instance,a null mutation in the LysR family transcription factor mucRresults in succinoglycan overproduction with a shift towardLMW forms through regulation of exoF, exoH, exoK, exoX, andexoY expression (11, 44, 67). The two-component sensor ExoSalso regulates succinoglycan levels (25), presumably via thecognate response regulator ChvI (20), but modulates expres-sion of exoF, exoP, and exoY (21, 25, 85). Succinoglycan pro-

duction is also regulated by ExoR and SyrA through unknownand indirect mechanisms (4, 21, 25, 67, 68). In addition to theseregulatory factors, succinoglycan levels are responsive to thepresence of noncarbon nutrients (25, 49), while the ratio ofLWM and HMW succinoglycans reacts to osmotic conditions(91). Thus, regulation of succinoglycan production and com-position is quite complex and is responsive to a number ofenvironmental and intracellular sensory inputs.

Interestingly, the exo/exs genes subject to CbrA regulationappear to be primarily affected under stationary-phase growthconditions. The exact nature of the stationary-phase signalremains an outstanding question, but given that CbrA pos-sesses a sensory PAS domain, it is possible that CbrA senseschanges in intracellular redox as a result of altered metabolism.Given that CbrA plays a key role in establishing the symbiosis,this regulator is poised to provide bacteria important informa-tion about their location or development within the nodule.Ultimately, insights gained from characterizing how CbrA ac-tivity is modulated will be highly relevant to understandingbacterial perception of the host environment.

ACKNOWLEDGMENTS

We are indebted to Anke Becker for providing the exo�-lacZ� fu-sions used in this study (8, 9) and to A. Becker and Karsten Neihaus forhelping to determine the Tn5 insertion site in the cbrA mutant. Wethank Mary Lou Pardue for generously allowing us to use her micro-scope. We thank Veronica Godoy, Bryan Davies, Sanjay D’Souza, andLyle Simmons for critical reading of the manuscript. Special thanks goto Hajime Kobayashi for careful reading and discussion of the manu-script on many occasions.

This work was supported by National Institutes of Health grantGM31010 (to G.C.W.), a National Science Foundation postdoctoralfellowship (to K.E.G.), and a Fullbright/Spanish Ministry of Educationand Science postdoctoral fellowship (to J.L.). G.C.W. is an AmericanCancer Society Research Professor and a Howard Hughes MedicalInstitute Professor.

REFERENCES

1. Aman, P., M. McNeil, L. E. Franzen, A. G. Darvill, and P. Albersheim. 1981.Structural elucidation, using HPLC-MS and GLC-MS, of the acidic exopoly-saccharide secreted by Rhizobium meliloti strain Rm1021. Carbohydr. Res.95:263–282.

2. Ausubel, F. M., R. Brent, R. E. Kingston, D. D. Moore, J. G. Seidman, J. A.Smith, and K. Struhl (ed.). 1991. Current protocols in molecular biology, vol.1. John Wiley and Sons Inc., New York, N.Y.

3. Barnett, M. J., V. Oke, and S. R. Long. 2000. New genetic tools for use in theRhizobiaceae and other bacteria. BioTechniques 29:240–242, 244–245.

4. Barnett, M. J., J. A. Swanson, and S. R. Long. 1998. Multiple geneticcontrols on Rhizobium meliloti syrA, a regulator of exopolysaccharide abun-dance. Genetics 148:19–32.

5. Barnett, M. J., C. J. Toman, R. F. Fisher, and S. R. Long. 2004. A dual-genome symbiosis chip for coordinate study of signal exchange and devel-opment in a prokaryote-host interaction. Proc. Natl. Acad. Sci. USA 101:16636–16641.

6. Battisti, L., J. C. Lara, and J. A. Leigh. 1992. Specific oligosaccharide formof the Rhizobium meliloti exopolysaccharide promotes nodule invasion inalfalfa. Proc. Natl. Acad. Sci. USA 89:5625–5629.

7. Becker, A., A. Kleickmann, W. Arnold, and A. Puhler. 1993. Analysis of theRhizobium meliloti exoH/exoK/exoL fragment: ExoK shows homology to ex-creted endo-beta-1,3-1,4-glucanases and ExoH resembles membrane pro-teins. Mol. Gen. Genet. 238:145–154.

8. Becker, A., A. Kleickmann, M. Keller, W. Arnold, and A. Puhler. 1993.Identification and analysis of the Rhizobium meliloti exoAMONP genes in-volved in exopolysaccharide biosynthesis and mapping of promoters locatedon the exoHKLAMONP fragment. Mol. Gen. Genet. 241:367–379.

9. Becker, A., H. Kuster, K. Niehaus, and A. Puhler. 1995. Extension of theRhizobium meliloti succinoglycan biosynthesis gene cluster: identification ofthe exsA gene encoding an ABC transporter protein, and the exsB gene whichprobably codes for a regulator of succinoglycan biosynthesis. Mol. Gen.Genet. 249:487–497.

10. Becker, A., S. Ruberg, B. Baumgarth, P. A. Bertram-Drogatz, L. Quester,


on Novem


.org/D

ownloaded from

http://jb.asm.org/

and A. Puhler. 2002. Regulation of succinoglycan and galactoglucan biosyn-thesis in Sinorhizobium meliloti. J. Mol. Microbiol. Biotechnol. 4:187–190.

11. Bertram-Drogatz, P. A., I. Quester, A. Becker, and A. Puhler. 1998. TheSinorhizobium meliloti MucR protein, which is essential for the production ofhigh-molecular-weight succinoglycan exopolysaccharide, binds to short DNAregions upstream of exoH and exoY. Mol. Gen. Genet. 257:433–441.

12. Bhat, U. R., H. Mayer, A. Yokota, R. I. Hollingsworth, and R. W. Carlson.1991. Occurrence of lipid A variants with 27-hydroxyoctacosanoic acid inlipopolysaccharides from members of the family Rhizobiaceae. J. Bacteriol.173:2155–2159.

13. Brewin, N. J. 1991. Development of the legume root nodule. Annu. Rev. CellBiol. 7:191–226.

14. Brozek, K. A., R. W. Carlson, and C. R. Raetz. 1996. A special acyl carrierprotein for transferring long hydroxylated fatty acids to lipid A in Rhizobium.J. Biol. Chem. 271:32126–32136.

15. Buendia, A. M., B. Enenkel, R. Koplin, K. Niehaus, W. Arnold, and A.Puhler. 1991. The Rhizobium meliloti exoZ-exoB fragment of megaplasmid 2:ExoB functions as a UDP-glucose 4-epimerase and ExoZ shows homology toNodX of Rhizobium leguminosarum biovar viciae strain TOM. Mol. Micro-biol. 5:1519–1530.

16. Campbell, G. R., B. L. Reuhs, and G. C. Walker. 2002. Chronic intracellularinfection of alfalfa nodules by Sinorhizobium meliloti requires correct lipo-polysaccharide core. Proc. Natl. Acad. Sci. USA 99:3938–3943.

17. Campbell, G. R., L. A. Sharypova, H. Scheidle, K. M. Jones, K. Niehaus, A.Becker, and G. C. Walker. 2003. Striking complexity of lipopolysaccharidedefects in a collection of Sinorhizobium meliloti mutants. J. Bacteriol. 185:3853–3862.

18. Canter Cremers, H. C., M. Batley, J. W. Redmond, L. Eydems, M. W.Breedveld, L. P. Zevehuizen, E. Pees, C. A. Wijffelman, and B. J. Lugtenberg.1990. Rhizobium leguminosarum exoB mutants are deficient in the synthesisof UDP-glucose 4�-epimerase. J. Biol. Chem. 265:21122–21127.

19. Cheng, H. P., and G. C. Walker. 1998. Succinoglycan is required for initiationand elongation of infection threads during nodulation of alfalfa by Rhizo-bium meliloti. J. Bacteriol. 180:5183–5191.

20. Cheng, H. P., and G. C. Walker. 1998. Succinoglycan production by Rhizo-bium meliloti is regulated through the ExoS-ChvI two-component regulatorysystem. J. Bacteriol. 180:20–26.

21. Cheng, H. P., and S. Y. Yao. 2004. The key Sinorhizobium meliloti succino-glycan biosynthesis gene exoY is expressed from two promoters. FEMS Mi-crobiol. Lett. 231:131–136.

22. Cronan, G. E., and D. H. Keating. 2004. Sinorhizobium meliloti sulfotrans-ferase that modifies lipopolysaccharide. J. Bacteriol. 186:4168–4176.

23. Datsenko, K. A., and B. L. Wanner. 2000. One-step inactivation of chromo-somal genes in Escherichia coli K-12 using PCR products. Proc. Natl. Acad.Sci. USA 97:6640–6645.

24. Doerrler, W. T., H. S. Gibbons, and C. R. Raetz. 2004. MsbA-dependenttranslocation of lipids across the inner membrane of Escherichia coli. J. Biol.Chem. 279:45102–45109.

25. Doherty, D., J. A. Leigh, J. Glazebrook, and G. C. Walker. 1988. Rhizobiummeliloti mutants that overproduce the R. meliloti acidic calcofluor-bindingexopolysaccharide. J. Bacteriol. 170:4249–4256.

26. Ehrhardt, D. W., E. M. Atkinson, and S. R. Long. 1992. Depolarization ofalfalfa root hair membrane potential by Rhizobium meliloti Nod factors.Science 256:998–1000.

27. Ferguson, G. P., A. Datta, J. Baumgartner, R. M. Roop II, R. W. Carlson,and G. C. Walker. 2004. Similarity to peroxisomal-membrane protein familyreveals that Sinorhizobium and Brucella BacA affect lipid-A fatty acids. Proc.Natl. Acad. Sci. USA 101:5012–5017.

28. Ferguson, G. P., A. Datta, R. W. Carlson, and G. C. Walker. 2005. Impor-tance of unusually modified lipid A in Sinorhizobium stress resistance andlegume symbiosis. Mol. Microbiol. 56:68–80.

29. Ferguson, G. P., R. M. Roop II, and G. C. Walker. 2002. Deficiency of aSinorhizobium meliloti BacA mutant in alfalfa symbiosis correlates with al-teration of the cell envelope. J. Bacteriol. 184:5625–5632.

30. Ferraioli, S., R. Tate, M. Cermola, R. Favre, M. Iaccarino, and E. J. Patriarca.2002. Auxotrophic mutant strains of Rhizobium etli reveal new nodule de-velopment phenotypes. Mol. Plant-Microbe Interact. 15:501–510.

31. Finan, T. M., E. Hartweig, K. LeMieux, K. Bergman, G. C. Walker, and E. R.Signer. 1984. General transduction in Rhizobium meliloti. J. Bacteriol. 159:120–124.

32. Fischer, H. M. 1994. Genetic regulation of nitrogen fixation in rhizobia.Microbiol. Rev. 58:352–386.

33. Fraysse, N., F. Couderc, and V. Poinsot. 2003. Surface polysaccharide in-volvement in establishing the rhizobium-legume symbiosis. Eur. J. Biochem.270:1365–1380.

34. Freidman, A. M., S. R. Long, S. E. Brown, W. J. Buikema, and F. M. Ausubel.1982. Use of cos derivatives for pRK290 in constructing a clone bank ofRhizobium meliloti DNA. Gene 18:289–296.

35. Garbe, T. R., M. Kobayashi, and H. Yukawa. 2000. Indole-inducible proteinsin bacteria suggest membrane and oxidant toxicity. Arch. Microbiol. 173:78–82.

36. Geurts, R., E. Fedorova, and T. Bisseling. 2005. Nod factor signaling genes

and their function in the early stages of Rhizobium infection. Curr. Opin.Plant Biol. 8:346–352.

37. Glazebrook, J., A. Ichige, and G. C. Walker. 1993. A Rhizobium melilotihomolog of the Escherichia coli peptide-antibiotic transport protein SbmA isessential for bacteroid development. Genes Dev. 7:1485–1497.

38. Glazebrook, J., J. W. Reed, T. L. Reuber, and G. C. Walker. 1990. Geneticanalyses of Rhizobium meliloti exopolysaccharides. Int. J. Biol. Macromol.12:67–70.

39. Gonzalez, J. E., C. E. Semino, L. X. Wang, L. E. Castellano-Torres, and G. C.Walker. 1998. Biosynthetic control of molecular weight in the polymerizationof the octasaccharide subunits of succinoglycan, a symbiotically importantexopolysaccharide of Rhizobium meliloti. Proc. Natl. Acad. Sci. USA 95:13477–13482.

40. Gonzalez, J. E., G. M. York, and G. C. Walker. 1996. Rhizobium melilotiexopolysaccharides: synthesis and symbiotic function. Gene 179:141–146.

41. Herouart, D., S. Sigaud, S. Moreau, P. Frendo, D. Touati, and A. Puppo.1996. Cloning and characterization of the katA gene of Rhizobium melilotiencoding a hydrogen peroxide-inducible catalase. J. Bacteriol. 178:6802–6809.

42. Jamet, A., S. Sigaud, G. Van de Sype, A. Puppo, and D. Herouart. 2003.Expression of the bacterial catalase genes during Sinorhizobium meliloti-Medicago sativa symbiosis and their crucial role during the infection process.Mol. Plant-Microbe Interact. 16:217–225.

43. Keating, D. H., M. G. Willits, and S. R. Long. 2002. A Sinorhizobium melilotilipopolysaccharide mutant altered in cell surface sulfation. J. Bacteriol. 184:6681–6689.

44. Keller, M., A. Roxlau, W. M. Weng, M. Schmidt, J. Quandt, K. Niehaus, D.Jording, W. Arnold, and A. Puhler. 1995. Molecular analysis of the Rhizo-bium meliloti mucR gene regulating the biosynthesis of the exopolysaccha-rides succinoglycan and galactoglucan. Mol. Plant-Microbe Interact. 8:267–277.

45. Kerppola, T. K., and M. L. Kahn. 1988. Symbiotic phenotypes of auxotrophicmutants of Rhizobium meliloti 104A14. J. Gen. Microbiol. 134:913–919.

46. Lagares, A., G. Caetano-Anolles, K. Niehaus, J. Lorenzen, H. D. Ljunggren,A. Puhler, and G. Favelukes. 1992. A Rhizobium meliloti lipopolysaccharidemutant altered in competitiveness for nodulation of alfalfa. J. Bacteriol.174:5941–5952.

47. Leigh, J. A., and C. C. Lee. 1988. Characterization of polysaccharides ofRhizobium meliloti exo mutants that form ineffective nodules. J. Bacteriol.170:3327–3332.

48. Leigh, J. A., J. W. Reed, J. F. Hanks, A. M. Hirsch, and G. C. Walker. 1987.Rhizobium meliloti mutants that fail to succinylate their calcofluor-bindingexopolysaccharide are defective in nodule invasion. Cell 51:579–587.

49. Leigh, J. A., E. R. Signer, and G. C. Walker. 1985. Exopolysaccharide-deficient mutants of Rhizobium meliloti that form ineffective nodules. Proc.Natl. Acad. Sci. USA 82:6231–6235.

50. Lerouge, I., and J. Vanderleyden. 2002. O-antigen structural variation: mech-anisms and possible roles in animal/plant-microbe interactions. FEMS Mi-crobiol. Rev. 26:17–47.

51. Lestrate, P., A. Dricot, R. M. Delrue, C. Lambert, V. Martinelli, X. De Bolle,J. J. Letesson, and A. Tibor. 2003. Attenuated signature-tagged mutagenesismutants of Brucella melitensis identified during the acute phase of infectionin mice. Infect. Immun. 71:7053–7060.

52. LeVier, K., R. W. Phillips, V. K. Grippe, R. M. Roop II, and G. C. Walker.2000. Similar requirements of a plant symbiont and a mammalian pathogenfor prolonged intracellular survival. Science 287:2492–2493.

53. LeVier, K., and G. C. Walker. 2001. Genetic analysis of the Sinorhizobiummeliloti BacA protein: differential effects of mutations on phenotypes. J.Bacteriol. 183:6444–6453.

54. Loewus, F. A. 1952. Improvement in anthrone method for determination ofcarbohydrates. Anal. Chem. 24:219.

55. Long, S., J. W. Reed, J. Himawan, and G. C. Walker. 1988. Genetic analysisof a cluster of genes required for synthesis of the calcofluor-binding exopoly-saccharide of Rhizobium meliloti. J. Bacteriol. 170:4239–4248.

56. Long, S. R. 1996. Rhizobium symbiosis: Nod factors in perspective. PlantCell. 8:1885–1898.

57. Long, S. R., G. B. Ruvkun, H. M. Meade, W. J. Buikema, S. E. Brown, A. M.Friedman, and F. M. Ausubel. 1983. Genetic analysis of symbiotic nitrogenfixation. Dev. Ind, Microbiol. 24:21–29.

58. Meade, H. M., S. R. Long, G. B. Ruvkun, S. E. Brown, and F. M. Ausubel.1982. Physical and genetic characterization of symbiotic and auxotrophicmutants of Rhizobium meliloti induced by transposon Tn5 mutagenesis. J.Bacteriol. 149:114–122.

59. Moreno, E., E. Stackebrandt, M. Dorsch, J. Wolters, M. Busch, and H.Mayer. 1990. Brucella abortus 16S rRNA and lipid A reveal a phylogeneticrelationship with members of the alpha-2 subdivision of the class Proteobac-teria. J. Bacteriol. 172:3569–3576.

60. Muller, P., M. Keller, W. M. Weng, J. Quandt, W. Arnold, and A. Puhler.1993. Genetic analysis of the Rhizobium meliloti exoYFQ operon: ExoY ishomologous to sugar transferases and ExoQ represents a transmembraneprotein. Mol. Plant-Microbe Interact. 6:55–65.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

61. Mulligan, J. T., and S. R. Long. 1989. A family of activator genes regulatesexpression of Rhizobium meliloti nodulation genes. Genetics 122:7–18.

62. Niehaus, K., and A. Becker. 1998. The role of microbial surface polysaccha-rides in the Rhizobium-legume interaction. Subcell. Biochem. 29:73–116.

63. Niehaus, K., A. Lagares, and A. Puhler. 1998. A Sinorhizobium melilotilipopolysaccharide mutant induces effective nodules on the host plant Medi-cago sativa (alfalfa) but fails to establish a symbiosis with Medicago trunca-tula. Mol. Plant-Microbe Interact. 11:906–914.

64. Notredame, C., D. G. Higgins, and J. Heringa. 2000. T-Coffee: a novelmethod for fast and accurate multiple sequence alignment. J. Mol. Biol.302:205–217.

65. Oke, V., and S. R. Long. 1999. Bacteroid formation in the Rhizobium-legumesymbiosis. Curr. Opin. Microbiol. 2:641–646.

66. Ponting, C. P., and L. Aravind. 1997. PAS: a multifunctional domain familycomes to light. Curr. Biol. 7:R674–R677.

67. Quester, I., and A. Becker. 2004. Four promoters subject to regulation byExoR and PhoB direct transcription of the Sinorhizobium meliloti exoYFQoperon involved in the biosynthesis of succinoglycan. J. Mol. Microbiol.Biotechnol. 7:115–132.

68. Reed, J. W., J. Glazebrook, and G. C. Walker. 1991. The exoR gene ofRhizobium meliloti affects RNA levels of other exo genes but lacks homologyto known transcriptional regulators. J. Bacteriol. 173:3789–3794.

69. Reinhold, B. B., S. Y. Chan, T. L. Reuber, A. Marra, G. C. Walker, and V. N.Reinhold. 1994. Detailed structural characterization of succinoglycan, themajor exopolysaccharide of Rhizobium meliloti Rm1021. J. Bacteriol. 176:1997–2002.

70. Reuber, T. L., J. Reed, J. Glazebrook, M. A. Glucksmann, D. Ahmann, A.Marra, and G. C. Walker. 1991. Rhizobium meliloti exopolysaccharides:genetic analyses and symbiotic importance. Biochem. Soc. Trans. 19:636–641.

71. Reuber, T. L., and G. C. Walker. 1993. The acetyl substituent of succinogly-can is not necessary for alfalfa nodule invasion by Rhizobium melilotiRm1021. J. Bacteriol. 175:3653–3655.

72. Reuber, T. L., and G. C. Walker. 1993. Biosynthesis of succinoglycan, asymbiotically important exopolysaccharide of Rhizobium meliloti. Cell 74:269–280.

73. Santos, R., S. Bocquet, A. Puppo, and D. Touati. 1999. Characterization ofan atypical superoxide dismutase from Sinorhizobium meliloti. J. Bacteriol.181:4509–4516.

74. Santos, R., D. Herouart, A. Puppo, and D. Touati. 2000. Critical protectiverole of bacterial superoxide dismutase in rhizobium-legume symbiosis. Mol.Microbiol. 38:750–759.

75. Santos, R., D. Herouart, S. Sigaud, D. Touati, and A. Puppo. 2001. Oxidativeburst in alfalfa-Sinorhizobium meliloti symbiotic interaction. Mol. Plant-Mi-crobe Interact. 14:86–89.

76. Scheidle, H., A. Gross, and K. Niehaus. 2005. The lipid A substructure of theSinorhizobium meliloti lipopolysaccharides is sufficient to suppress the oxi-dative burst in host plants. New Phytol. 165:559–565.

77. Scupham, A. J., and E. W. Triplett. 1997. Isolation and characterization of

the UDP-glucose 4�-epimerase-encoding gene, galE, from Brucella abortus2308. Gene 202:53–59.

78. Sharypova, L. A., K. Niehaus, H. Scheidle, O. Holst, and A. Becker. 2003.Sinorhizobium meliloti acpXL mutant lacks the C28 hydroxylated fatty acidmoiety of lipid A and does not express a slow migrating form of lipopoly-saccharide. J. Biol. Chem. 278:12946–12954.

79. Sigaud, S., V. Becquet, P. Frendo, A. Puppo, and D. Herouart. 1999. Differ-ential regulation of two divergent Sinorhizobium meliloti genes for HPII-likecatalases during free-living growth and protective role of both catalasesduring symbiosis. J. Bacteriol. 181:2634–2639.

80. Taylor, B. L., and I. B. Zhulin. 1990. PAS domains: internal sensors ofoxygen, redox potential, and light. Microbiol. Mol. Biol. Rev. 63:479–506.

81. Ugalde, R. A. 1999. Intracellular lifestyle of Brucella spp. Common geneswith other animal pathogens, plant pathogens, and endosymbionts.MicrobesInfect. 1:1211–1219.

82. Urzainqui, A., and G. C. Walker. 1992. Exogenous suppression of the sym-biotic deficiencies of Rhizobium meliloti exo mutants. J. Bacteriol. 174:3403–3406.

83. van Rhijn, P., and J. Vanderleyden. 1995. The Rhizobium-plant symbiosis.Microbiol. Rev. 59:124–142.

84. Wang, L. X., Y. Wang, B. Pellock, and G. C. Walker. 1999. Structuralcharacterization of the symbiotically important low-molecular-weight succi-noglycan of Sinorhizobium meliloti. J. Bacteriol. 181:6788–6796.

85. Wells, D. H., and S. R. Long. 2002. The Sinorhizobium meliloti stringentresponse affects multiple aspects of symbiosis. Mol. Microbiol. 43:1115–1127.

86. Wolanin, P. M., P. A. Thomason, and J. B. Stock. 2002. Histidine proteinkinases: key signal transducers outside the animal kingdom. Genome Biol.3:3013.

87. York, G. M., and G. C. Walker. 1998. The Rhizobium meliloti ExoK and ExsHglycanases specifically depolymerize nascent succinoglycan chains. Proc.Natl. Acad. Sci. USA 95:4912–4917.

88. York, G. M., and G. C. Walker. 1997. The Rhizobium meliloti exoK gene andprsD/prsE/exsH genes are components of independent degradative pathwayswhich contribute to production of low-molecular-weight succinoglycan. Mol.Microbiol. 25:117–134.

89. York, G. M., and G. C. Walker. 1998. The succinyl and acetyl modificationsof succinoglycan influence susceptibility of succinoglycan to cleavage by theRhizobium meliloti glycanases ExoK and ExsH. J. Bacteriol. 180:4184–4191.

90. Zevehuizen, L. P. T. M., and A. R. W. van Neerven. 1983. (1–2)-�-D-Glucanand acidic oligosaccharides produced by Rhizobium meliloti. Carbohydr. Res.118:127–134.

91. Zevenhuizen, L. P., and P. Faleschini. 1991. Effect of the concentration ofsodium chloride in the medium on the relative proportions of poly- andoligo-saccharides excreted by Rhizobium meliloti strain YE-2SL. CarbohydrRes. 209:203–209.

92. Zhou, Z., K. A. White, A. Polissi, C. Georgopoulos, and C. R. Raetz. 1998.Function of Escherichia coli MsbA, an essential ABC family transporter, inlipid A and phospholipid biosynthesis. J. Biol. Chem. 273:12466–12475.


on Novem


.org/D

ownloaded from

http://jb.asm.org/

Documents

CbrA Is a Stationary-Phase Regulator of Cell Surface Physiology … · library was mated into KEG2016, and cbrA::Tn5 complementing clones were selected for on LB containing antibiotics