Embed Size (px)
Citation preview
Carbon Metabolism and Regulation in C3 Plants - "Isolation
and Characterization of High CO2 Responsive Mutants of
Arabidopsis thaliùna"
BY
Judith A. Jebanathirajah
A thesis submitted in conforrnity with the requirements
for the degree of Doctor of Philosophy
Graduate Department of Botany
University of Toronto
O Copyright by Judith A. Jebanathirajah 200 1
National Library 1*1 ofCanada Bibliothèque nationale du Canada
Acquisitions and Acquisitions et Bibliographie Services services bibliographiques
395 Wellington Street 395, rue Wellington Ottawa ON K i A ON4 Onawa ON K l A ON4 Canada Canada
The author has granted a non- exclusive licence allowing the National Library of Canada to reproduce, loan, distribute or seil copies of this thesis in microform, paper or electronic formats.
The author retains ownership of the copyright in this thesis. Neither the thesis nor substantial extracts fiom it may be printed or otherwise reproduced without the author's permission.
L'auteur a accordé une licence non exclusive permettant à la Bibliothèque nationale du Canada de reproduire, prêter, distribuer ou vendre des copies de cette thèse sous la forme de microfiche/film de reproduction sur papier ou sur format électronique.
L'auteur conserve la propriété du droit d' auteur qui protège cette thèse. Ni la thèse ni des extraits substantiels de celle-ci ne doivent être imprimés ou autrement reproduits sans son autorisation.
For Marcel
Carbon metabolism and Regulation in C3 plants -"Isolation and
Characterization of High CO2 Responsive Mutants of
A rabidopsis thaliana"
Degree of Doctor of Philosophy, 200 1.
Judith Arunodhaya Jebanathirajah
Department of Botany
Abstract
Given that atmospheric COz levels are expected to double during the 21st century and
that crop and forest species account for two thirds of global photosynthesis, knowledge of
mechanisms governing the acclimation response to high COz in plants is essential. The
objective of this study was to better understand the mechanism of regulation affecting the
response of higher plants to the availability of inorganic carbon. As genetic screens have
proved useful in the undentanding of physiology and signal transduction in several
pathways, a genetic approach using the cnicifer Arabidopsis thalinna was taken. Initial
characterization of conditions that elicited a response from wildtype Ambidopsis plants
was performed prior to screening mutagenized populations. Wildtype Arabidopsis plants
exhibit a stress response when exposed to elevated CO2 (O. 1- 0.3%). Aspects of this stress
response include anthocyanin accumulation, curling of leaves, necrosis, hyper-
accumulation of foliar carbohydrates and down-regulation of photosynthetic gene
expression. Characterization of wildtype facilitated the isolation of mutants which
iii
showed a response differing from that of wildtype plants when exposed to elevated CO2.
Mutants that resulted from this screen were placed in two general categories; CO2 non-
responsive (cnr) and CO2 hyper-responsive (chr). initial characterization of
representative mutants from the different groups was carried out. The largest group of
mutants cnr was chosen for further study. These cnr mutants share varying degrees of a
single combination of phenotypes which include reduced anthocyanin production,
reduced or no curling of leaves, delayed senescence, and normal to vigorous growth
under elevated CO2. Two non-allelic T-DNA tagged mutants, cnr 1 - 1 and ozr 2- 1 were
selected for genetic, molecular, biochemical and physiological analyses. cnr 1-1 is a
dominant mutation and the gene affected by the T-DNA insert in this mutant is a leucine
rich repeat receptor kinase. The COz insensitive and glucose insensitive phenotype of cnr
1- 1 suggest a role for CNR 1 in carbon metabolism and the molecular identity of CNRl
suggests a role in signal transduction. c w 2-1 is a recessive mutation and the T-DNA
insert disrupts a P450 monoxygenase gene. Physiological and biochemical analyses
suggest that the P450 monooxyganse is involved in the abscisic acid pathway.
Acknowledgments
First and foremost 1 thank John Coleman, my advisor for his guidance and input over the
last five years. 1 thank Peter M'Court for his contributions towards this thesis and for
teaching me about "the cult of the crucifer". 1 thank Rowan Sage for his suggestions and
for his abilities as a teacher. 1 am also grateful to Tammy Sage for al1 her help with
microscopy. 1 am grateful to other members of the Department who contributed to my
overall education: Nancy Dengler, Thomas Berleth and Eduardo Blumwald
1 am thankful to Fernando Ferreira for his friendship and contributions to joint projects. 1
would like to acknowledge Dr. Zhou Yuanxiang for his help in solving problems and to
Thanh Nguyen who took al1 the photographs in this thesis. 1 would like to thank various
members of the department who have become friends: Tara Nanilani, Dr. Jim Mattsson
(for proof-reading the thesis), Gil Aharon. Maris Apse, Sara Sarkar, Majid Ghassemian,
Dario Bonetta, Eiji Nambara, Siobhan Brady and Brenda Chow. 1 am thankful to the
administrative staff especially Sandy Speller and Tamar Mamourian for being friends and
for generally "running a smooth show". 1 thank Bruce Hall and Andrew Petrie for al1
their help. 1 am grateful to NSERC and Trinity College for fellowships. 1 thank Dean
Allen and Abbott, al1 fellow dons and students at Trin. for their support and friendship. 1
would like to acknowledge Dean Elizabeth Abbot as a friend and mentor. I grateful to my
farnily for their love and prayers. 1 thank my father who taught us to be curious and my
mother for always being interested in what we did. To complete a circle, 1 thünk a very
special friend Peter Scott (from my Ballet Creole days).
TABLE OF CONTENTS
Chapter 1 . Introàuction to Carbon Metabolism and Regulation in C3 Plants
1.1 Photosynthesis and Global COz levels .......................................................... - 1
2 . Effects of Elevated CO2 on Photosynthesis ...................................................... 3
3 . Short Term Responses to Elevated COz Concentrations ........................................ 4
3.1 The Physiological and Biochernical Nature of the Short Term Response ................... 4
3.2 Stomatal Responses to High COz .............................................................. 7
4 . Long Terrn Photosynthetic Acclimation to Elevated COz .................................... -7
5 . Factors Affecting Acclimation to High CO2: Development, Export Capacity, Sink
Capacity, Nutrient Supply .......................................................................... 10
6 . The Carbon Nutrient Landscape ............................................................... 15
7 . Mechanisms of Acclimation of Long Term Exposure to Elevated COz .................. 16
7.1. High COz Conditions, Carbohydrate Accumulation and Transcriptional
.......................................................................................... Regulation -18
8 . Sugar Sensing in Yeast ......................................................................... -20
9 . Sugar Sensing in Plants ...................................................................... -26
10 . The Perception of Sugars in Plants ............................................................. 27
10.1. Hexokinase: A Signaling Enzyme? .......................................................... 28
10.2. Dual Function Transporters: Putative Signal Molecules ................................... 29
................................................................. 10.3 Signal Transduction Pathways 30
10.4. Effector Molecules ............................................................................. 32
10.5 . Cis Elements ................................................................................... -33
1 1 . Genetic Screens .................................................................................. -35
.................................................................. 12 . ConcIusions and Perspectives -36
................................................................................. 13 . Thesis Objectives 40
....................................................................................... 1 4 . Re ferences -42
Chapter 2 Isolation and Initial Characterizaiion of Mutants of Arabidopsk tlialiono
with Altered Sensitivity to Elevated Carbon Dioxide ....................................... 53
......................................................................................... Introduction -53
.............................................................................. Materials and methods 58
....................................................................................... Plant material -58
.................................................................................. Growth conditions .59
Genetic screen ...................................................................................... -59
Segregation and Allelism (Complementation) Analysis ...................................... -60
................................................................................. Chlorophyll Assay 61
................................................................................. Anthocyanin Assay 61
...................................................................... Extraction of Soluble Sugars 62
................................................................................... S tarch Extraction -62
....................................................................... Assay for Reducing Sugars -62
............................................................................. Results and Discussion 63
Isolation and Genetic Analysis of Mutants wiih Altered Responses to Enriched CO2
.............................................................. ...................... Conditions ,... -63
.................................................... Root Phenotypes Under Various Conditions 68
.................................................................................... Pigment Analysis 70
...................................................................... Foliar Carbohydrüte Anal ysis 70
Rationale For Choosing the cnr Mutants for Further Study ................................... 72
........................................................... Glucose Phenotypes and Other Traits -77
............................................................................................ Summary -80
........................................................................................... Re ferences -81
Chapter 3 . A Putative Receptor Kinase Affecting the Photosynthetic Response to
...................................................................................... Elevated COz -84
.............................................................................................. Abstract .84
.......................................................................................... introduction -84
............................................................................. Materials and Methods -87
....................................................................................... Plant Material -87
Growth Conditions ................................................................................... 87
....................................................................................... Genetic Screen 88
................................................................................... Genetic Analysis -88
........................................................... Kanarnycin Segregation Experiments -88
.............................................................. Pigment and carbohydrate analysis -89
Chlorophyll Assay .................................................................................. -89
Anthocyanin Assay .................................................................................. 89
..................................................................... Extraction of Soluble Sugars -90
.................................................................................... Starch Extraction 90
....................................................................... Assay for Reducing Sugars -91
....................................................................... Molecular Biology Methods 91
...................................................................................... DNA Isolation -91
................................................................................. Southem Analyses -92
RNA Isolation ...................................................................................... -93
viii
List of Tables
2.1 Possible types of mutation resulting from an elevated COz screen ....................... 55
2.2 Kanamycin sensitivity of M4 T-DNA mutant lines ........................................ 74
................................... 2.3 Segregation Analysis of progeny from cnr mutant lines 76
..................................................................... 2.4 Complementation analysis 76
2.5 Germination behaviour of selected cnr mutations .......................................... 79
.................................. 4.1 Quantification of ABA in fresh and rehydrated tissues 152
xiii
Chapter 1
Introduction
1.1 Photosynthesis and Global CO2 levels
Over millenia, changes in the CO2 composition of the atmosphere have taken place,
however it is only recently that human involvement has affected atmosphenc concentrations
of COz. For 500 years previous to the industrial revolution, CO2 levels remained fairly
stable at 270 ppm; however since the onset of the industrial revolution in 1750, the amount
of carbon dioxide in the atmosphere has increased 35 % to present levels of 365ppm. It is
expected that the preindustrial value of 270ppm will double within the 21" century if the
current emission rates are not curbed 1. There have been concerns as early as 1896 that an
increase in CO2 would cause "global warming" when Arrhenius wrote a paper with the title
"On the Influence of Carbonic Acid in the Air Upon the Temperature of the Ground. Since
Arrhenius. evidence has accumulated that greenhouse gases. including methane and CO2.
absorb radiation emitted by the eaiih's surface, which would otherwise be lost to space.
This added energy could potentially alter climate patterns 2. The current increases in
atmospheric CO2 levels have been well documented by a number of studies, particularly via
direct measurernents from the peak of Mauna -ha over the last forty years 3 (Figure 1.1).
Figure 1.1. Atmospheric CO2 levels measured from a Mauna Loa site over the past 40 years
and measurements taken from ice core sarnples. 3.4.
Although evidence for rising CO2 levels has been established, there is uncertainty conceming
details of how the global carbon cycle will respond to these increases in atmosphenc carbon. -7
For example, carbon tixation by photosynthesis is the ultimate source of energy for both
living organisms and rnost industrial processes that use fossil fuels. Since photosynthesis as
initiated by the Rubisco catalyzed carboxylation reaction is an integral part of the giobal
carbon cycle, the knowledge of mechanisms goveming the acclimation
and response of higher plants to changing CO2 levels is essentiai to detennining the impact
of high CO;? on the carbon cycle.
2, EFFEXTS OF ELEVATED CO2 ON PHOTOSYNTHESIS
By surveying various studies of the photosynthetic response of C3 plants to elevated CO2, it
is clear that species show differences in their response to elevated CO2. However
generalizations can be made and this review will describe the general response exhibited by
Arabidopsis and other plants. In some C3 species. such as Arabidopsis 5, two phases of
photosynthetic response to elevated CO2 are observed; 1) an initiai increase in
photosynthesis, the short term response and 2) a down-regulation of photosynthetic
capacity. the long term acclimation response 6. The short-term response occurs within
minutes to hours and is modulated by stomatal response mechanisms. biochemical feedback
pathways and enzyme activity. The long-term acclimation response takes place over a
longer period of time, houn to days and the nature of this acclimation is species dependant.
Acclimation usually involves the ability of plants to modulate the amounts and activities of
biochemical components in the leaf in order to optimize metabolic processes. The time
taken to effect the acclimation response to elevated COz is dependent on a number of factors
including export capacity, sink capacity. developmental stage, nutrient and water status of
7 the plant .
3. SHORT TERM RESPONSES TO ELEVATED COt CONCENTRATIONS
3.1 The Physiotogical and Biochemical Nature of the Short Term Response
Physiological studies have shown that CO2 enrichment results in an immediate stimulation
of photosynthesis by directly increasing the rate of carboxylation by reducing the rate of
photorespiration 7. A "burst" in photosynthetic rates is detected experimentally for the
majority of species such as soybean 8, potato and bean 9.
The increase in photosynthesis on exposure to a CO2 enriched environment is better
understood by studying the leaf level response to changes in COÎ concentrations. ACi
response curves plot the rate of photosynthetic assimilation vs. intracellular pCOz (Figure
1.2.). Gas exchange experiments show that photosynthetic rates are always dependent on the
most limiting factor at any point on the curve. At arnbient COz Ievels and saturating light
intensity, photosynthesis is limited by Rubisco, Le. the availability of CO;? at the site of
carboxylation and the activation state of Rubisco. If this limitation is relieved by increasing
the COz concentration, photosynthetic rates increase to a point at which constraint is caused
by availability of ATP and NADPH (thylakoid-lirnited). If CO2 concentrations are increased
further (Figure 1.2.), the photosynthetic rate becomes further restricted by the regeneration
of inorganic phosphate Pi. The regeneration of Pi is dependent on the triose phosphate
utilization (this part of the curve is said to be TPU-limited), i.e. the use of triose phosphates
in the synthesis of starch and sucrose thereby releasing inorganic phosphate (reactions are
carried out by the enzymes ADP-glucose pyrophosphorylase, ADPGase and sucrose
phosphate synthase, SPS). The free Pi is used to synthesize ATP and subsequently RuBP in
the stroma. When photosynthesis is limited by the finite capacity of the plant to use triose
phosphates. other non-lirniting factors are regulated biochemically 9 such that RuBP
production is coordinated with its consumption. The short term response described here is a
result of the coordination of a number of biochernicd processes that include the activation
state of Rubisco and biochemical feedback mechanisms acting on ADPGase, SPS, the triose
phosphate translocater and fructose bisphosphatase.
Saturatinq Cight 2 5 ' ~
- - ïhylakoid Copaci ty
#-A-- '
C PI rageneration -
- - campanratlm &nt
Intercellular CO2, pbar
Figure 1.2. Characteristic responses to intercellular COz of Rubisco lirnited. thylakoid
limited. or Pi regeneration limited photosynthesis
Biochemical feedback regulation of enzymes plays an important role in the short-term
response to elevated CO2. Enzymes of starch and sucrose synthesis are largely regulated by
intermediates in their respective metabolic pathways, such as triose phosphates, hexose
phosphates and Pi. The regulation of starch synthesis takes place at the second penultimate
to last reaction in the starch biosynthetic pathway; that is, ADP- glucose pyrophosphoxylase.
ADPGase activity is promoted by high PGA and inhibited by high Pi. Starch synthase is
less sensitive to regulation by its endproduct, starch, and the enzyme has no regulatory role
in starch synthesis. Sucrose synthesis. which takes place in the cytosol has two points of
control: the enzymes fructose - 1,6-bisphosphotase (FBPase) and sucrose phosphate synthase
(SPS). At low concentrations of Pi and fructose -6- phosphate and high concentrations of
triose phosphates FBPase is upregulated 7. SPS is controlled by reversible protein
phosphorylation by a protein kinase. Phosphorylation deactivates the SPS and
dephosphorylation activates it. Three sites of sexy1 phosphorylation are known for spinach
SPS, only one of these sites is thought to be regulatory. SPS is regulated by light/ dark
modulation, feedback regulation and osmotic stress activation.
Biochernical feedback or activation States of enzymes do not ultimately optimjze the use of
resources in the long tenn. Under ambient CO2 conditions and high light plants generally
invest large arnounts of nitrogen in photosynthetic protein; this investment pays off as
carbon is limiting and photosynthetic enzymes are found in a predominantly active state.
However, under high COz conditions molecular feedback results in reduction of enzyme
activity and this nitrogen investment in photosynthetic enzymes could ôe better used for
other purposes such as growth. Consistent with this hypothesis, long-term acclimation
responses involving the modulation of enzyme abundance by alteration of gene expression
has been observed 10.
3.2. Stornatal Responses to High COz
COz diffusion into the plant, is eontrolled by changing turgor pressure in the guard cells,
hence it is appropriate that guard cells respond to changes in COz concentrations 11.
Stomatal responses to elevated CO2 have been well documented and occur within seconds
or minutes of exposure l2- 13. A general observation that stomatal apertures decrease on
exposure to elevated CO2 and increase when CO2 concentrations are reduced has been
made. That the COz perception and response mechanism appears to be intrinsic to the
guard cells has been suggested by experiments using guard ce11 protoplasts (Conimelina
comrnunis) where the swelling of protoplasts was enhanced by aerating the incubation
media with CO2 14. The exact nature of the signal perception and transduction
mechanism has not been fully realized. However it is known that abscisic acid 15
cytosolic pH 16. malate level 17. cytosolic ca2* concentrations 18 and chloroplastic
zeaxanthin levels 19 appear to be involved in the signal perception/ transduction process.
4. LONG TERM PHOTOSYNTHETIC ACCLIMATION TO ELEVATED COz
A large number of studies using a variety of species have shown that the initial stimulation
of photosynthesis on exposure to CO2 enriched environments decreases or disappears over a
penod of days o r weeks ' 7 zO. The reduction in photosynthetic capacity has been correlated
with the accumulation of carbohydrates in leaves in several studies, suggesting that the
decrease in photosynthetic capacity is a direct response to the increase in carbohydrate.
Studies observed that the increase in nonstructural carbohydrate on exposure iû elevated
CO2 in Cotton, soybean, sunflower and sorghum occurred concomitantly with the decreases
in photosynthetic CO2 uptake 21. 22. Direct experimental evidence supporting the
correlation between carbohydrates and reduction in photosynthetic capacity o r gene
transcription include a study carried out on spinach showing a decrease in abundance of
photosynthetic enzymes when exogenous glucose is fed via the transpiration Stream 23.
There have k e n several other studies 249 25- 26 which indirectly showed this correlation.
These studies reduced sink capacity using cold girdling techniques that prevent the transport
of photosynthate to the sink organs, thus increasing concentrations of carbohydrate at the
source 27.
The indirect regulation of photosynthetic capacity in the long-terrn response of plants to
elevated COz is thought to be an acclimation response whereby plants realign limiting and
non-limiting processes. Carbohydrate production in enriched COz environments is non-
limiting so a reduction in both Rubisco content and other enzymes involved in
photosynthesis would curb carbohydrate synthesis and allow for an increase in nitrogen
investment in more limiting processes 28.
NO AC CLIMATION
RESPONSE
Photosynthetic Response to elevated CO, conditions IUGH CO,
1 Increased
photosynthetic rates
I SHORT TERN RESPO NS E:
LONG TERM ACCLIMATION RESPONSE:
Figure 1.3. Schematic showing the responses to elevated COz and conditions correlated
with the acclimation and non-acclimation response.
Unlike light acclimation, COz acclimation does not always follow a characteristic pattern. in
al1 species exarnined, the onset of the long-tenn acclimation response to increased CO2
availability is variable and a depression in photosynthetic capacity is not always observed at
the particular point in time when the measurements are made. The onset of the acclimation
response seems to be associated with the carbon: nitrogen ratio (C:N) of the plant *9.
which is affected by the developmental stage. sink capacity, export capacity, nutrient supply
and stresses.
5. Factors Affecting Acclimation to COz: Development, Export Capacity, Sink
Capacity, Nutrient Supply.
Plants at various stages of development have different capacities for carbohydrate
synthesis and growth. If the capacity for growth and storage are higher that the capacity to
synthesize carbohydrate, it is possible that this disparity in growth and production can
result in non-acclimation to elevated COz. This postdate is supported by the observation
that the initial stimulus of photosynthesis on exposure to elevated COÎ is more pronounced
in young seedlings. Rapidly growing seedlings are considered source lirnited and can
therefore utilize the additional carbohydrate produced for growth 3O. Indeterrninate plants
such as Cotton and soybean also show pronounced initial increases in photosynthetic rates
greater than determinate plants like sunflower and tobacco *O* 21, providing further
evidence for the influence of developrnent. In order to undentand the response of plants at
various stages in developrnent to elevated COz, it is important to understand whether the
sink or the source is limiting at a particular stage of development.
Based on their ability to produce or consume assimilates, plant tissue is divided into two
classes 3 1 . The first class is source tissue. which are defined as net exporters of fixed
carbon; this tissue is norrnally autotrophic. The other class is sink tissue, which are
defined as net importers of fixed carbon (always heterotrophic). Thus a whole plant can
be considered a mosaic of autotrophic and heterotrophic tissue. The ratio of heterotrophic
to autotrophic tissue can determine the behavior of the plant to elevated COZ. This ratio is
govemed by development. A newly germinated seedling, consisting of cotyledons is
initially heterotrophic relying solely on stored carbohydrate reserves until new leaf tissue
becomes photosynthetic. It is interesting to note that although the seedling is
heterotrophic, a source / sink gradient always exists between the shoot (cotyledons) and
the root tissue.
As a seedling grows. its first leaves make the transition from k i n g carbon sinks to carbon
exporters and ability of these leaves to export carbon affects the plants response to
elevated COz. Under high COz conditions the ability to export photosynthate has k e n
found to influence the acclimation response. If export capacity is curbed or hindered by
artificial (cold girdling) or natunl (developmental) rneans. carbohydrate build up occurs
inside the leaf and this often results in a reduction in photosynthetic capacity. This effect has
k e n shown in cucumber where photosynthetic capacity declined as a result of impeding
translocation in source leaves 32. The ability of a plant to export carbohydrate frorn source
leaves depends on the efficiency of the mechanism involved in shifting photosynthate out of
the source organ (leaf) into the phloem. There are two known mechanisms of phloem
loading. symplastic loading and apoplastic loading. The former is considered to be less
efficient than the latter 33. It has been shown that under arnbient COz conditions. symplastic
loaders accumulate 36% total nonstructural carbohydrate (TNC- expressed as a percentage
of dry weight of foliar tissue) compared with the 19% observed for apoplastic loaders.
However, under high COz both symplastic and apoplastic îoaders show a mean TNC level
of 41 8 33. Given this data. it could be further postulated that the apoplastic loaders would
not exhibit photosynthetic acclimation to high COz as rapidly as symplastic loaders.
However whether or not this correlation in fact exists, is yet to be shown.
Export capacity on its own does not determine whether or not a plant accumulates
carbohydrate in source leaves under elevated CO2 and whether this will lead to an
acclimation response. Another important factor is the sink capacity of a plant. Several
investigations have shown that photosynthesis is inhibited under high CO2 when the
dernand for photosynthate in a plant is reduced 8. 3*. in order to understand the effect of
sink capacity on high COz acclimation it is important to understand the nature of a sink and
the mechanisms of unloading sucrose from the phloern.
Sink capacity can be described as the ability to import photosynthates. This ability is
affected by sink size and sink activity 34 and the sink is either a growth or a storage sink.
Carbohydrate imported to a growth sink (usually a meristem, a new leaf or a growing mot)
is catabolized with the energy and carbon provided used to sustain growth and development.
Storage sinks include tubers, fruit tap mots and seeds where the carbohydrate is stored or
converted into lipids or proteins before storage.
Unloading of sucrose frorn the phloem can take place through the symplasrn or through
apoplastic routes 35, with the mechanisms of sieve element unloading affected by the
expression and activity of proteins involved in these processes that determine the ability to
the organ to import carbohydrates. Control of the symplastic route is exerted by modulating
the aperture and number of plasmodesmata 36. The structure of the plasmodesmata is
known to change during devetopment, affecting the size exclusion limit (SEL: the
maximum size of particle that c m freely diffuse through the plasmodesmata). The change in
the interconnectivity between cells results in syrnplastic field revision (syrnplastic
interconnections between cells are modified resulting in a new group of connected cells),
which subsequently results in restrictions in the movement of molecules such as sucrose
across a particular field 37. An exarnple of change in dornain structure during development
occurs in the embryo. In higher plants the ernbryo is one symplastic unit and as the embryo
develops, movement through certain plasmodesmata becomes restricted forming transient
and permanent symplastic dornains. Thus unloading is dependent on developmental
constraints 37.
Three distinct pathways exist for the uptake of sucrose in the apoplastic space. The
expression and activity of the proteins involved in these transport processes determine the
sink capacity of the sink organ. Sucrose is released into the apoplastic space from the
sievekompanion ce11 complex and can be taken up by parenchyma cells by sucrose/ proton
symporters, by endocytosis or alternatively by a third pathway where the sucrose in the
apoplastic space is hydrolyzed by ce11 wail invertases to hexoses which are then transported
into sink cells by hexose transporters. Using overexpression and antisense technology it is
also known that expression and activity of enzymes in pathways synthesizing storage
compounds such as starch affect sink capacity 38.
Sink capacity, export capacity and development are al1 dependent on protein synihesis
which require carbon, hydrogen, oxygen and most importantly nitrogen. The availability of
nitrogen and other nutrients such as phosphorus from the soi1 is known to affect the
response of plants to elevated CO2 29. Theoretically. given nutrient replete conditions under
elevated CO2 conditions, growth should not be limited and subsequently the sink capacity of
a plant should be not curbed. This has been shown in wheat where the acclimation response
is not observed when plants were grown hydroponically with nitrogen added in direct
proportion to the growth rate 39. Under non-replete conditions. plants reduce disparity
between supplies of carbon and nutrients by increasing capacity to acquire the most limiting
resource 7. When grown under elevated COz, carbon sources rneet and exceed the demand
required for plant growth, as the most lirniting resources under these circumstances are
usually nitrogen andor phosphorus. Carbon supply c m also exceed storage capacity such
that the extra carbohydrate is darnaging to the plant. Under ambient air conditions, COz and
Rubisco concentrations are lirniting and thus plants invest a large proportion of their
nitrogen in Rubisco (about 30% to 50% of total soluble protein). This investment ensures an
adequate supply of carbon. It is possible that when a plant perceives excess carbon, nitrogen
investment in the photosynthetic processes is no longer required and an ensuing reduction in
the concentration of Rubisco occurs. The reduced demand for Rubisco allows for nitrogen
reailocation for a more compelling need, such as increased sink capacity. The resulting
down regulation of the photosynthetic rate is interpreted as a response to change in plant
carboni nitrogen budgets.
The relative demand for carbon and nutrients in the production of tissue is reflected in the
nutrient content of that tissue, Le., the nutrient CO carbon ratio. This value is variable among
species. within species, arnong tissues, and developmentdly within the tissues, (Le. the
carbon nutrient ratio varies dunng the life cycle of a plant). This variability in the carbon/
nutnent ratio is reflected in the wide range of data reported for down regulation of gene
expression studies under nutrient limitation and at elevated COî conditions.
6. The Carbon: Nutrient Landscape
The acclimation response to COt has been described as variable or non-characteristic when
compared with light acclimation responses7; however al1 photosynthetic organisms
exarnined down-regulate photosynthetic capacity in the presence of excess exogenous sugar
or when girdling procedures are used 25. In these cases. there is an excess of sugar in the
tissue, such that the plant, despite being nutritionaily replete perceives the excess and down
regulates photosynthesis. This suggests a cornmon mechanism of perception where the plant
"perceives" excess carbon over a particular t hreshold value. if factors affecting acclimation
are taken into account, an n dimensional landscape such as Figurel.4. rnay be characterized
for a particular species over time. This n dimensional landscape could take into account
factors such as developmental stage, nutrient availability and carbohydrate status of a plant
over tirne. Hence thresholds can be estimated for points at which a plant might actually
"see" an excess of carbon under a variety of physiologicai conditions. This type of
relationship can be mapped out for a particular species by carrying out rnetabolic profiling
(mass chernicai profiling of an organism similar to large s a l e transcriptionai profiling using
rnicroarrays).
OLD
Figure 1.4. Theoretical Carbon /Nutrient Developmental Landscape
7. MECHANISMS OF ACCLIMATION TO LONG TERM EXPOSURE TO
ELEVATED CO2 CONDITIONS
A number of mechanisms could explain the long-term reduction in photosynthetic capacity
under elevated COz conditions. These mechanisms include a decrease in the concentration
of photosynthetic enzymes by increasing protein turnover, translational down regulation. a
decrease in mRNA stability or a down regulation of transcription of genes encoding these
proteins. Several studies that examine this phenornenon of down regulation in
photosynthetic capacity have been carried out either by directly feeding sugars to
photosynthetic tissue 239 40 or by correlating the accumulation of soluble carbohydrate in
photosynthetic tissue on exposure to high COz 27. 41. 5. These studies suggest that the
most important process affecting the decrease in photosynthetic capacity is the down
regulation of transcription.
Although the acclimation to high COz is correlated with an increase in leaf carbohydrate, an
alternative proposal is that the reduction in photosynthetic capacity in high CO2 is a result of
faster senescence experienced under high CO2 38. This suggestion was made from
observations that wild type potato grown in an enriched COz environment shows a
reduction in CO2 assimilation rates (at 5 weeks) earlier than an accumulation in
carbohydrates is observed (after 7 weeks of exposure) 42. Although this may be a species
specific response, it does not provide a universal explanation for high COz acclimation. For
exarnple, it has been shown in pea 41 that the acclimation effect to high CO2 is reversible.
This high COî " apparent acclimation" effect should not be reversible if it was attributed to
senescence. When plants, acclimated to a high COz environment were shifted to arnbient
CO2 conditions, an increase in transcript abundance of carbonic anhydrase and Rubisco was
observed. 1 perforrned a similar study (Figure 1 S.) on Arabidopsis ecotype Columbia plants
with similar results. This suggests that the acclimation is not simply the result of
senescence.
rDNA RbcS CA1 ADPGasc
. . . . , .
3
. . .- .-
4
. .' -,ELEVATED CO,
Figurc 1.5. Slot blots of 5 pg total RNA aftcr DNAsc trcatmcnt fiom 3 wcck old Arabidopsis plants grown in soi1 undcr 200 p o l photons m-2s-l : 1) and 2) continuously undcr ambicnt and clcvatcd CO2 (3ûûûppm) rcspcctively, 3) tmnsfcrrcd fiom cicvatcd CO2 to ambicnt CO2 and 4) transfcrred fiom ambient CO2 to clcvatcd CO2. Transfcmed plants wcrc ailowcd to acclimate for 4 days aficr bans fer. rDNA- Ribosomal DNA probe, RbcS -Rubisco srnail subunit, CA1 - carbonic anhydrasc 1 and ADPGasc- ADP glucosc pyrophosphorylasc.
7.1 High CO2 Conditions, Carbohydrate Accumulation and Transcriptional
The earliest study that makes the connection between transcriptional repression caused by
high foliar sugar levels and elevated COz conditions was carried out using tornato 27. The
study investigated: i) the response of plants exposed to high or low COr, where samples
were taken from whole plants; ii) the responses of detached leaves to examine the effect of
removing the major sink iii) the response of detached leaves to feeding with sucrose; and iv)
the response of leaf discs to various non rnetabolized carbohydrates that act as osmotic
agents in order to show that the response to the sucrose feeding was not a result of osmotic
stress. Photosynthetic gene expression was quantified by observing mnscnpt abundance of
various nuclear and chloroplast genes. These investigations showed that nuclear gene
expression was more repressed by CO2 enrichment than chloroplast gene expression and
that a removal of the sink by detaching leaves exacerbated the down regulation of the
photosynthetic genes. When detached leaves were supplied with exogenous sugars, the
rnRNA abundance of the CAB-3c (ch1orophyll a/b binding proteins) and other
photosynthetic genes was lowered. The down regu tation of photosynthetic genes was not a
result of osmotic effects according to the experiments perforrned. The authors propose that
these experiments correlate the carbohydrate repression with the COz effect 27. Additional
molecular studies have since been carried out on plants grown under high CO2. Studies in
Arubidopsis, wheat, tornato and pea show a down regulation in Rubisco and other
photosynthetic genes such as carbonic anhydrase, phosphoglycerate kinase, chlorophyll a/b
binding proteins, Rubisco activase and PSB A (PSII core complex) transcript levels under
elevated COz conditions 5 9 43, 4 1 , 44.
The decreased expression of photosynthetic genes described above could be postulated to
allow reallocation of carbon and nitrogen to other processes, which are more advantageous
under the prevailing carbohydrate climate. This implies that some genes will be up-
regulated under high COz conditions and this has in fact been observed 45. Specific sets of
genes are known to be positively regulated by sugars. One class of these genes is involved
in carbon storage, utilization and import. and include SPS, ADPGase and certain invertases.
Other important classes include defense genes 46, genes involved in secondary metabolite
pathways, nitrogen metabolism genes and storage protein genes. However whether these
genes are affected by CO2 concentrations remains to be determined.
Gene expression and the control thereof by carbon catabolites is an essential regulatory
mechanism for al1 living organisms. In microrganisms. especially yeast and E. coli this topic
has been the subject of extensive studies. However certain elements of the perception.
signal transduction and modes of action have remained elusive 47. 48. Studies have also
shown that sugars are a universal regulatory signal in eukaryotes, and the understanding of
sugar signaling in bacterid and yeast system can aid in understanding sugar responses of
more complex organisms. Of al1 systems studied thus far, yeast shares important parallels
with plants in sugar sensing and consequently it is useful at this point to review catabolite
repression in yeast.
8. Sugar Sensing in Yeast
Yeast can be used as an important paradigm for the study of catabolite repression in
plants or other photosynthetic organisms. Yeast has two States of growth, fermentative and
gluconeogenic. During fermentative growth, fermentable carbon sources such as glucose are
metabolized in the glycolytic cycle. producing pyruvate. The pynivate is then
decarboxylated and reduced to ethanol. in the gluconeogenic state when no fermentable
carbon sources cxist, the ce11 metabohes ethanol or other substrates in the Krebs cycle and
ATP is obtained from respiration. Because the ce11 requires hexose phosphates for
biosynthetic reactions, yeast cells produce them via gluconeogenesis (Figure 1.6.). Most
gluconeogenic steps are catalyzed using reversible glycolytic enzymes and key
gluconeogenic enzymes, such as fmctose bisphosphatase (FBPase) and phosphoenol
pyruvate carboxykinase (Pckl) 49. In the presence of glucose, the preferred yeast substrate.
transcription of genes required to use other carbon sources and for gluconeogenesis are
repressed. In contrast, transcription of genes required for fermentation are up-regulated.
Metabolic control of gene expression is in response to a signal initiated by the carbon status
of the organisrn as modulated by the presence of sugars in the media.
OEREPRESSEDCELL GLUCONEOGENIC GROWTH
GALACTOSE - GLU-1-P G.11.7.10
+ oLuCosE - G L U 6 9 L RNA ONA
Hxk1.2 PROTEINS
PENTOSE PHOSPWA TE
FUUCTOSE Hxk,,2 - F R U ~ PA TH wa Y
Pfk 1 t Fbpl
A CITRATE OXALACETATE
KREBS CYCLE v
GLUCOSE REPRESSEO CELL FERMENTATIVE GROWH
+ -- PENTOSE
PHOSPUA rE P A T W A Y
ETHANOL PEP *-\
I
- J CITAAlE OXAUCETATE
KREBS CYCLE 1
Figure 1.6. Diauxic Shift 50
The transition from glucose fermentation to gluconeogenic growth is called the diauxic shift
and entails major changes in carbon metabolism. Amongst the enzymes involved in this
diauxic shift. some proteins are pst-transcnptionaily regulated. transcnptionally regulated
or both. There are t h e groups of glucose repressed genes: i) genes encoding enzymes
involved in gluconeogenesis; i.e. FBPase and PEP carboxykinase, which are strictly
repressed by glucose. ii) Genes encoding rnitochondrial enzymes which metabolize non
fermentable carbon sources and are dispensable during fementative growth. iii) Genes
encoding enzymes required for metabolism of galactose, sucrose and maltose; also known
as GAL, SUC and MAL, genes that convert the respective disaccharides to hexose
phosphates capable entenng the glycolytic cycle. Al1 three groups of genes are regulated by
separate mechanisms. It is not clear how glucose repression is triggered but hexokinase
activity is implicated as a point of control in yeast sugar sensing l.
Presuming that glucose repression in yeast would have sirnilar signaling pathways to
catabolite repression in bacteria, initial work concentrated on CAMP. In E. coli, CAMP is the
signaiing molecule, and if glucose is not available as a carbon source, the CAMP
concentration increases 52. When this happens CAMP binds to a regulator called CAP
(catabolite activator protein) which then becomes active. The CAP molecule only becomes
active in the presence of camp, at which time the CAMP-CAP complex acts as a classic
small molecule inducer. The CAP protein is a dimer of two 22.5 D a monomers and is
activated by one CAMP molecule, which attaches to a CAMP-binding domain. The protein
also has a DNA binding domain, which binds to a site of approximately 22 base pairs. As
none of the CAP dependent promoters have effective -35 consensus sequences and some of
them lack functional -10 consensus sequences, effective RNA polymerase binding requires
CAP for transcription at these sites 53.
Yeast, however, implements a different mechanism than bacteria (described above); that is.
a direct transcriptional control of target promoters is employed. Various yeast mutants
irnpaired in glucose repression have k e n isolated from numerous screens and have
provided insight into the biochemistry and signaling pathways of metabolite repression.
These include mutants of hexokinase. various sugar transporters and kinases with homology
to the yeast SNFl (Sucrose Non Fermenting) kinase gene product. The hexokinase gene,
which appears to have a role in signaling. is hexokinase isoform 2 (YHXK2). The
importance of this gene and its role in sugar sensing was reaiized when a mutant with a
lesion in this gene was isolated in several catabolite non-repression screens. These screens
isolated mutants that were unable to repress genes used to metabolize carbon sources other
than glucose. Several alleles of krk 2 mutants were isolated 54. The loss-of-function h k 2
mutants do not shut off the suite of genes involved in metabolism of non-glucose sugars,
such as invenase 5 l . The h k 2 mutant shows a clear effect in preventing glucose
repression; however an understanding of the actual mechanism of sensing and the
transduction of the signal by this enzyme has proved elusive. The flux of glucose through
this enzyme may activate a regulatory mechanism 55. As an alternative to HXK2 as a
sensor, it has also been argued that the kinase action of this enzyme depletes the cytoplasrn
of ATP. and it is this depletion that triggers the regulatory mechanism 56. In support of this
suggestion, there are other studies in yeast showing the importance of ATP: ADP ratios and
CAMP in catabolite regulation 48.
Apan from HXK2. several components in the carbon catabolite pathways were isolated
using screens. A protein kinase called SNFi was found to play a fundamentai role in the
glucose repression 57. The relationship between SNFl and HXK2 is not clear, but it is
apparent that SNFl acts downstream of HXK2. Cells lacking the SNFl gene are unable to
metabolize sugars other than glucose. Consequently SNFl is involved in activating genes
in the pathways required for utilizing other sources of carbon and in the gluconeogenic
pathways.
Foilowing on from the identification of additional components in the yeast glucose-
signaling pathway, a possible mechanism of action of SNFl can be proposed 58. Further
downstrearn of HXK2. a protein complex of MIGl (a zinc finger transcription factor) and
SSN6mUPl (a general repressor complex of RNA polymerase il transcription-SSN6 is a
TPR (tetrahicopeptide repeat) protein and TUPI is a p-transducin) 59 are known to interact
with cis elements of genes that are usually repressed under glucose replete conditions. The
SSN6mUP 1 cornplex functions as a general repressor of transcription through modulation
of chromatin structure. MIG 1. a DNA binding protein recruits the SSN6/TUPI to specific
sites. thus repressing genes containing MIG 1 binding sites 48. SNFl is thought to
inactivate MIGl in the absence of glucose. In the presence of glucose. the GLC71 REGl
(GLC7 is a protein phosphatase and REGl is thought to be the regulatory subunit)
phosphatase complex antagonizes the SNFl protein kinase such that MIG 1 is kept active.
In summary. the promoters of genes involved in the gluconeogenic pathway and in the
pathways utilizing alternative carbon sources have MIG 1 binding elements. in the presence
of glucose, genes having these MIG 1 binding elements are repressed by M G 1 and the
SSN6mUPl complex. It is important to note that no connecting elements between REG1
and the SSN6flUPl interaction with DNA are known 56.
Organisms very often have degrees of redundancy built into regulatory systems and may
have more than one sensing pathway. a fact becoming quite evident in plant studies. In
yeast, "sensor molecules" other than HXK2 are known to exist and two of these sensor
molecules are SNF3 and RGT2. SNF3 and RGT2 encode glucose transporter/receptor
homologues. Both these proteins have long C-terminal extensions. which act as signaling
domains 60. SNF3. a high affinity glucose receptor senses low concentrations of glucose.
and RGT2, a low affinity receptor senses high glucose concentrations. The mutants with
lesions in the genes encoding these transporters indicate that glucose metabolism is not a
singular requirement for signaling 61.
Similatities between yeast and plant sugar sensing pathways have k e n conternplated and
tested. Parallels can be drawn between modes of carbon metabolism known in yeast
(fermentation and gluconeogenesis). and the autotrophic and heterotrophic growth States of
plants. Based on their functions in yeast carbon metabolism, some homologues of yeast
genes have been investigated in plants. Plant homologues of yeast sugar signaling proteins
such as HXK have complemented yeast mutants and show sirnilar functions in plants 6*.
The genorne sequencing projects have revealed other putative functional parallels between
the yeast proteins such as SNFl h a s e and sugar transporters such as RGT2 and SNF3, and
plant homologues.
9. Sugar Sensing in Plants
Signal transduction involves the perception and reIay of a signal resulting in an "effect". In
trying to elucidate the signal transduction of sugar sensing in plants, the "effect" studied is
the transcnptionaf regdation of certain genes (Figure 1.7.).
Elevated CO2 or Sugar Mediated Effects
LONG TERM RESPONSE: TRANSC RIPTI ONAL RE G ULAT I ON POSSIBLE SIGNAL- SUCROSW
SHORT TERM RESPONSE :SIGNAL W K N O WN
GLYCOLYSIS INDEPENDENT
HEXOSE/ SUCROSE TRANSPORTERS
I STOMATAL RESPONSE
HEXO KINASE
(GLYCOLYSIS DEPENDENT)
~ R A ~ L W L A R -TASE PATHOGENEIS-
SUCROSE SYNTHASE RELATED Gï3ES CHLOROPHYLL uô BDIDiNG PROTEIN
R-ALANlNE M O N I A LYASE RüûIS C O S U A U SUBUtnT
PATAIIN B33 OXlGDr EVOLVIHG COBâPLm O B 3
GLUTAMINE WTHASE PLASTOC'fAHiH
CHALCONE SYNTHASE CARBOHIC ANHWR4SE
MALATE SSYHfHASE NITRATE
ISOCïïRATE LYASE D U C T A S E
Figure 1.7. CO2 or Sugar Effects on Transcription
Transcriptional regulation by sugars has been observed for photosynthetic genes, such as
CAB (chlorophyll ah binding proteins), RbcS (Rubisco small subunit), 0E33 (oxygen
evolving complex) and PC (plastocyanin), which are generally down regulated in the
presence of excess sugar. Other genes including nitrate reductase, P -amylase and storage
proteins such as patatin are upregulated in the presence of sugars 63.
The regulation of these genes has been studied in other contexts where transcriptional
regulation has k e n observed and it is known that many of the sugar-regulated genes also
respond to light, phosphate, nitrogen, hormones. wounding and anaerobiosis 64. For
example, the repression of the CAB and SUS1 (sucrose synthase) genes are often used to
gauge the drought response. Although it has been shown that SUS1 is responsive to sugars
and not to the direct application of abscisic acid, an increase in sugar concentrations cause a
decrease in osmotic potential of the cytosol and thus elicit a drought-like response in the
plant 65. As such one cannot assume that the transcriptional response observed on exposure
to sugars is solely attributed to a sugar-sensory pathway.
10. The Perception of Sugars
The use of 2-deoxyglucose (a metabolized hexose), manoheptulose (a hexokinase inhibitor)
and 6-deoxyglucose (a non-metabolized hexose) in experiments studying the transcnpt
abundance of sugar regulated genes indicate there are at least two or more sugar perception
pathways. These pathways affect different groups of genes, one pathway is responsive to
non -metabolized sugars such as 6-deoxyglucose and the other is responsive only when the
sugar is metabolized.
When Chenopodium rubrum ce11 cultures are fed 6-deoxyglucose, transcription of genes
such as apoplastic invertase, chalcone synthase and phenylalanine ammonia lyase were
induced 66. The patatin promoter fused to a reporter gene in Arabidopsis is also found to
be responsive to 6-deoxyglucose 67. 6-deoxyglucose is transported into the cell. but is not
phosphorylated by HXK nor is it metabolized further in the cell. This information is
interpreted as evidence for a sensing mechanism mediated by a hexose transporter similar to
SNF3 and RGT2 described in yeast; however this could also be interpreted as evidence for
an apoplastic sugar sensor without invoking a transporter. It is interesting to note that al1
the genes involved in this pathway are induced by 6-deoxyglucose. Genes repressed by 6-
deoxyglucose have not k e n identified.
Genes whose transcription is only affected by metabolized sugars such as glucose and 2-
deoxyglucose include the photosynthetic genes, pathogenesis-related genes and genes
involved in nitrogen metabolism. The photosynthetic genes are repressed at elevated levels
of sugars, whereas the pathogen related and nitrogen metabolism genes are up-regulated.
As yet, the specific mechanisms of sugar perception leading to repression or induction of
genes mcntioned are not clear, however the last five years of research have revealed much
about the perception of sugars in plants. Some of the more interesting studies have k e n
carried out in Arabidopsis where transgenic overexpression and antisense hexokinase
(HXK) suggests regulation of expression plays an important role in plant sugar sensing 62.
10.1. Hexokinase
In yeast, one of the two hexokinases (HXK2). was found to be a key enzymatic reaction in
sugar sensing and because of this importance in yeast, investigations using plant
homologues were carried out. These initial experiments in plants suggested that HXK
played a role in regulating glyoxalate and photosynthetic genes 68- 69. Shonly thereafter,
transgenic Arabidopsis antisense and overexpression plants were constructed. The HXK
antisense plants display hyposensitivi ty to sugars whereas the overexpressors s howed
relative hypersensitivity to sugars. The sensitivities of these plants were manifested in a
wide range of sugar responses such as gene expression and seedling growth responses. As
with the yeast studies, it is not known how hexokinase acts as a sensor, but it would appear
that the flux of sugars through the enzyme is important to the signal transduction process.
HXK is an induced fit enzyme and its conformation is dtered when the substrate hexose is
in the active site. As such, it has k e n suggested that this conformation alters interactions
with other proteins and subsequently triggers a signal transduction pathway 63. An altemate
mechanism suggested is that the phosphorylation of hexoses by HXK depletes the ATP in
the cell. Thus the ATP: ADP ratio decreases if the flux through the enzyme is high.
Although a nurnber of researchers 70 do not assign a signaling function to HXK, they do
acknowledge the importance of the enzyme in the glucose metabolic pathway. irrespect ive
of which mechanism of action is invoked, HXK is important in glucose metabolism.
10.2. Dual Function Transporters
The other presumed signaling pathway, which appears to be metabolism independent has
been suggested for two reasons: 1) because of the response of a suite of genes to 6-
deoxyglucose (see section on perception of sugars) and 2) sugar transporter proteins were
found to be sensors of both high and low external concentrations of sugars in yeast. These
yeast transporters SNF3 and RGT2 have C-terminal extensions that are required for glucose
signal transduction. and a transmembrane region which is required to pcrceive the glucose
61. So far no homologues of SNF3 or RGT2 have been found in Arabidopsis. however two
sugar transporters (AtSUGTRPR, accession #250752 and F23E 12.140 accession #
AL022604) have extended cytosolic central loops. which might be involved in signaling.
Further study is required to substantiate the signaling abilities of these proteins.
10.3. Signal Transduction Pathways
The action of various protein kinase and phosphatase inhibitors on modulation of rnRNA
abundance of carbohydrate regulated genes suggests that the carbohydrate signal is
mediated through the phosphorylation /dephosphorylation of the proteins involved in the
signal transduction pathways in plants. However the evidence accumulated so far indicates
that there is more than one pathway for the various sugar inducible genes and sugar
repressed genes. It has k e n shown that the accumulation of sugar inducible sporamin and
P -amylase transcripts were strongly inhibited by protein phosphatase PPl. and PP2
inhibitors such as okadaic acid and calyculin 71. On the contrary PPI and PP2A inhibitors
(endothal. okadaic acid, calyculin) were shown to induce transcription of sugar inducible
genes e.g. CIN and PAL (cell wall invertase and phenylalanine arnmonia lyase respectively)
and rnimic glucose repression of photosynthetic genes in Ciienopodium rubrum 72 and
maize ce11 cultures 73.
Several SNFl related kinases have k e n cloned from plants 74. The SNFl related kinases
f o m a highly conserved family of proteins that have been found in animais (AMP-activated
protein kinases), fungi and plants. In non-plant systems, they have been shown to be
involved in regulating metabolism and gene expression in response to environmental and
nutritional stresses. The marnmalian SNFl homologue is activated by an increase in AMP
concentrations. Normally cells maintain a low AMP concentration in the cell. When the
energy status of a ce11 is comprornised, the AMP concentration rises and this increase
activates the SNFl kinase which in tum inactivates pathways using the ATP reserves of the
ce11 e.g. acetyl CoA carboxylase (fatty acid synthesis) and HMGCoA reductase (steroid
biosynthesis) 75. If the plant SNFl homologues are found to be activateci/ deactivated by
changes in AMP: ATP ratios as with the marnmalian gene, it is possible that these proteins
serve as a link between metabolism and carbon fixation and ATP availability as influenced
by the light reactions in photosynthesis. This would serve to coordinate carbon fixation with
ATP production. The SNFl homologues could also be seen as a link between HXK activity
and carbon fixation as increased HXK activity has the potential to increase AMP: ATP
ratios.
Some proposed and/or known metabolic targets for plant SNFl related protein kinases
include HMG-CoA reductase, sucrose phosphate synthase and nitrate reductase. These
rnetabolic enzymes al1 exhibit a theoretical consensus phosphorylation site, however a direct
link between carbon metabolism, AMP concentrations and the action of SNFl homolgues
in plants remain to be shown 74. As SNFl in yeast also affects transcriptional activity it
might be expected that a similar function would be atuibuted to SNF 1 homologues in
plants. Therefore it is interesting that AKiN 1 O (Arabidopsis b a s e s ) and AKIN 1 1 (both of
which are members of the SNFl related kinases from Arabidopsis) interact with the N-
terminal domain of PRLl (a transcription factor that is presumed to act as a repressor of
photosynthetic gene expression T6.
10.4. Effector molecules
As yet only three plant transcription factors (PRLI, ATB2 and SPF1) 77* 78* 79 that play a
role in carbon metabolism have k e n described. PRLl is a WD protein not unlike TUPI in
yeast and COP 1 (Constitutive ~hotomorphogenesis) in Arabidopsis. TUP 1 is a regula to j
protein which is proposed to act as a nuclear repressor of glucose regulated genes in
conjunction with other proteins in a complex. COPl is thought to be involved in light
regulation. The prll mutant is hypersensitive to sucrose but does not show repression of
photosynthetic genes under high sugar. The prll mutant also displays other pleiotropic
phenotypes in response to the exogenous addition of hormones such as cytokinin, ethylene,
abscisic acid and auxin 77. The various phenotypes observed in the mutant indicate that
PRLl is likely a significant component in a transcription protein complex, which is
downstream of a number of signal transduction pathways.
ATB2 is a small protein with a transcription activation domain. a basic domain and an
unusuülly long leucine zipper region 78. ATB2 displays light and sucrose regulation and is
upregulated in the presence of sugars and down regulated in the absence of sugars. The
presence of ATB2 transcripts in sink tissue. and the light regulation of the gene when
photoassimilates are available, suggests a possible role in balancing carbon availability and
storage 78.
SPFl is a novel DNA binding protein which is enriched in both acidic and basic residues.
The DNA binding domain is locdized to the C-terminal half of this protein and binds to
specific sequences in the promoter regions of genes encoding sporarnin and B-amylase and
functions as a repressor of sporarnin and B- amylase expression. The SPFl mRNA is down-
regulated under high sugar concentrations 79.
10.5. Cis elements
Transcription and post-transcriptional stability are also affected by cis elements and as such
these sequences may be important in controlling the transcnpt abundance of sugar-regulated
genes. A study of six maize photosynthetic genes promoter-reporter fusions showed that the
promoter region was sufficient for the sugar regulation of the reporter gene; however no
consensus sequence could be attributed to this response 40. In yeast it has been suggested
the sugar regulation might be rnediated through chrornatin structural changes 63. However
in the particular case of the maize photosynthetic genes. the sugar repression of the reporter
gene that is observed is probably not a result of chromatin stmcturai changes, as the
experiments were carried out using pUC 19 promoter-fusion constructs electroporated into
maize protoplasts. Furthemore 5' and 3' UTR &muanslated sequences), and regions within
the open reading frarnes, are known to affect transcription and transcnpt stability; however
in the case of the six photosynthetic gene maize promoters. the promoter was adequate in
effecting sugar regulation 40.
Some promoter regions of sugar responsive genes such as maiate synthase (glyoxalate
cycle) have revealed cis elements which affect sugar regulation. However a consensus
sequence has not been found among like regulated genes 80. SPFl protein is known to bind
specific regions on three different sugar induced genes. This conserved sucrose lesponsive
element is known as SURE 79. A cis elernent resembling SURE and mammalian ChoRE -
(carbohydrate response element) was found on a RbcS2 gene from P~zaseolus vulgaris and
the role of this element was investigated using a transient expression of a promoter- reporter
construct in Phaseolus vulgaris protoplasts. These two elements had a mandatory
requirernent for a G box (light response elernent) for very high expression 81.
Very few studies acknowledge or have investigated the global effect of transcript stability
on expression of sugar-regulated proteins. The importance of the stability on mRNA
abundance however has been shown for a- amylase. A 3' UTR element and two
subdomains have been identified and observed to function as regions affecting stability in
response to the sugar status. Nuclear run on experiments showed that these regions only
affected the stability and not the transcription rate of the gene 82.
It is known that many other cis elements such as ABRE elements (ABA Esponse glements)
and G boxes (light response elements) are found on genes that are sugar responsive and that
the transcriptional activity of these genes is the sum of the various signal transduction
pathways which impinge on the activity of the gene under study.
11. Genetic screens
Several genetic screens have k e n performed using Arabidopsis in an effort to identi@
signaling and effector components of sugar regulation of gene expression. Some of the
screens perforrned used sugar responsive promoter-reporter constructs to screen for
mutants. Sugar-responsive promoters appear to have elements that cause the repression of
the gene under their control under high sugar conditions. When the promoter is upstrem of
a reporter such as GFP (green jellyfîsh fluorescent protein) under high sugar conditions in a
wild type Arabidopsis plant background, the GFP expression will be down regulated. The
constnict can be used to screen for mutants that show aberrant expression of the reporter
gene when compared to wild type plants. Sugar-responsive promoters used for such screen
include the plastocyanin prornoter for the sucose mcoupled - sun screen, the patatin
promoter for the oduced Wgar response - rsr screen and the P amylase promoter for the !ow
and Ngh j$ amylase - iba and hba screens 83.
Exposure to increased concentrations of exogenous sugars during germination results in
developmental arrest and this phenotype was used in multiple screens with various sugars to
isolate sugar response mutants. Screens performed on glucose resulted in gitz (glucose
insensitive), glo (ducose ver sensitive) mutants and carbohydrate insensitive (mi) mutants. -
A sucrose screen gave rise to sis mutants (sucrose insçnsitives) and a mannose screen to mig
mutants (mannose insensitive germination mutants) 63.
Al1 these mutants were screened on high concentrations of soluble sugars and thus osmotic
and other effects are unavoidable. Another disadvantage to the germination screen is that a
number of other pathways impinge on the process of germination including ABA. GA
(giberellic acid) and ethylene signaling systems. 1 favoured an alternative screen using
elevated CO2 conditions as the selective condition where carbohydriite loading is produced
by elevated rates of photosynthesis.
Whatever their limitations the different germination screens have revealed "cross-talk"
between pathways such as the glucose sensing and the ethylene pathways (gin1 letrl
epistasis interactions) g4, ABA signaling (mig mutants appear to have interactions with
ABA) and light responses (the sun mutants affect phytochrome signaling) 85.
12. Conclusion and Perspectives
The various screens and transgenic work performed by numerous research groups has and
will reveal much information about sugar signaling in plants. It is obvious, however, that as
the number of identified individual components of the signal transduction system increases,
and as more interactions with other pathways are revealed, our initial and somewhat
simplistic notions of sugar regulation of gene expression will need to be rnodified. The most
encompassing view of sugar signaling and perception is a biochemical mode1 (Figure 1.8.)
that accounts for much of the knowledge of sugar sensing accumulated thus far. This mode1
describes the production of carbohydrates and the balance of carbon in the leaf as a steady-
state process, which responds to the changes in carbon budget of the leaf. It is pointed out
that sucrose synthesis and hydrolysis are constantly cycling processes dependent on
vacuolar and apoplastic invertases 86. The mode1 emphasizes the three fates for sucrose
produced by cytosolic sucrose phosphate synthase 1) sucrose can remain within the cytosol;
2) sucrose may be transported into the vacuole; and 3) sucrose can be exported out of the
cell. The sucrose in the vacuole and the apoplasm can be hydrolyzed by acid invertases to
glucose and fructose which c m then move back into the cytoplasm and subsequently be
rephosphorylated by HXK and as such reenter metabolism. In the presence of excess
carbohydrate. cycling flux is increased such that HXK is saturated (or ATP is depkted) and
a signal via a transduction cascade is initiated such that an effector molecule (transcription
factor) represses/ ac tivates transcription.
The sucrose cycling mode1 arose as a means to explain certain observations: Although total
leaf soluble carbohydrates were found to increase under high COz for al1 species studied.
cytosolic hexose levels in many plants did not show significant changes under high CO2
conditions. even in species where the Rubisco content decreased by 30%. These studies
suggest that the cytosolic hexose levels are f;omeostatically controlled and that changes in
absolute cytosolic hexose concentrations cannot be correlated with carbohydrate dependent
gene regulation. Interestingly, when invertase activity was measured in species that showed
a reduction in Rubisco as a COz acclimation response high activity was observed. In
contrat. in plants which showed no reduction in Rubisco low invertase activity was
detected 86. This variation in invertase activity could explain why growth at elevated CO2
could result in negative feedback responses on photosynthetic gene transcription in some
species and not in others. Sucrose cycling would be increased under high COz in plants
displaying high levels of invertase activity. This would increase the flux through hexokinase
(and deplete ATP) which could result in a signal causing a down regulatlon of
photosynthetic gene transcription.
There has been some contention over the importance of cytosolic HXK in the sugar sensing
process in planta. This is partly due to the interpretation of results frorn three types of
transgenic tobacco plants expressing yeast invertase in the 1) apoplasm, 2) cytosol and 3)
vacuole. Plants overexpressing invertase in the apoplasm and the vacuole showed striking
phenotypes including stunted growth, lesions. curled leaves, a decrease in CAB transcript
abundance and an increase in PR (pathogenesis related) gene transcripts. Plants expressing
the yeast invertase in the cytosol did not show these phenotypes. The authors argue that if
cytosolic HXK was important in signaling, the transgenics expressing invertase in the
cytosol should be most affected g7* g8. The authors propose that the sensory rnechanism
must be in an endomembrane system and therefore not influenced by cytosolic hexose
levels. An alternative explanation could be given if the sucrose cycling mode1 is invoked.
The amounts of soluble sugar in the cytosol is maintained at low concentrations, usually
below ~ ~ m o l ~ - ' F W for fructose. glucose and sucrose. whereas 98% of the sugar found in a
ce11 is stored as sucrose in the vacuole 88. Thus expressing a yeast invertase (YINV) in the
vacuote will produce much more hexose than a transgenic expressing YINV in the cytosol.
This large amount of hexose in the vacuole wiil re-enter the cycle and be phosphorylated by
HXK. The cytosolic localized YINV can only cleave sucrose available in the cytosol hence
the flux of hexose through HXK is lower than that generated by vacuolar-localized
invertase.
SUCROSE
VACUOLE SUCROSE
GLUCOSE / FRUCTOSE
GLUCOSE1 FRUCTOSE
Figure 1.8. Sucrose Cycling, modified by adding transcription and signaling 89
It is important to remember that the predominant sucrose synthesis enzyme in the cytosol is
sucrose phosphase synthase, which catalyzes a non-equilibrum reaction 90. Hence the
reaction will favour sucrose synthesis if phosphoryiated hexoses are available. Therefore, the
concentration of hexoses in the cytosol will be determined by this enzyme, to a large extent,
and hexose levels should be considerably Iower if SPS is in the activated state. However if
ATP levels are low, then non-phosphorylated sugars will accumulate in the cytosol and SPS
wili not be able to synthesize sucrose. Invertases, being thermodynamica1Iy governed
equilibrium enzymes, can also synthesize sucrose; however the synthesis reaction is only
favoured when the concentration of hexose is high.
Although elernents of the molecular pathways affecting photosynthetic acclimation to high
CO2 and/or sugar sensing are known, the connections between these known elements are
still obscure. Given the amount of research activity in this area, a comprehensive picture of
acclimation will probably evolve as has k e n seen with the yeast studies. However a number
of key features might remain elusive.
Thesis Objectives
As several screens have previously been carried out using sugar to isolate mutants, a
different and novel approach was taken in this study. It was decided that an elevated CO2
screen would be a useful addition for the isolation of components in sugar signaling. Our
rationale for this is as follows. There is sirnilarity between the transcriptional repression
events observed during growth on high sugar media and the transcriptional repression seen
under high CO2 conditions and consequently, it should be possible to isolate mutants in the
sugar-signaling pathway using elevated COa as a selection condition. in addition to the
sugar-signaling pathway, it was postuIated that many other mutants rnight be isolated with
lesions upstream of the sugar-signaling pathway, and in other parallel signaling and carbon
metabolism pathways. Screening with above ambient COz was also a preferred option as
unlike sugar media screens (sugar concentrations are in excess of 300mM), osrnotic effects
were unlikely to complicate the screening process.
The development of the screen using elevated COz is described in Chapter 2 of this thesis
and a preliminary characterization of mutants, which were isolated from the screcn is also
presented in this chapter. The preliminary characterization of the mutants allowed us to
select mutants for further characterization and the COz non-responsive mutants (cnr) were
chosen for further study. Chapter 3 and 4 describe the genetic, molecular and biochemical
charactenzation of T-DNA tagged mutants cnr 1 - 1 and cnr 2- 1 respectively. A general
discussion about the screen and resultant mutants follows in chapter 5.
References:
1. Stauffer, B. Climate Change-cornucopia of ice core results. Nature 399, 4 12-4 13
( 1999).
2. Kerr, R. A. Draft report affirms human influence. Science 288,589-90 (2000).
3. Keeling, C. D., R.B. Bacastow, and T.P. Whorf. Measurements of the concentration
of carbon dioxide at Mauna Loa Observatory (ed. Clark, W . C.) (Oxford University Press,
New York, 1982.).
4. Jouzel, J., Barkov, N.I., Barnola, J.M., Bender, M., Chapellaz, J., Genthon, C.,
Kotlyakov, V.M., Lipenkov,V., Lorius, C., Petit, J.R., Raynaud, D., Raisbeck, G., Ritz, C.,
Stievenard, M., Yiou, F., and Yiou, P., Extending the Vostock ice-core record of
paleoclimate to the penultimate glacial period. Nature 364,407-4 12 ( 1993).
5. Cheng, S. H., Moore, B. & Seemann, J. R. Effects of short- and long-term eIevated
CO2 on the expression of Ribulose- 1, 5-bisphosphate carboxylase/oxygenase genes and
carbohydrate accumulation in leaves of Arabidopsis thaliana (L.) Heynh. Plant Physiol116,
7 15-23 (1998).
6. Sage, R. F. Acclimation of photosynthesis to increasing atmospheric C02: the gas
exchange perspective. Pizotosynth. Res. 39,35 1-368 (1994).
7. Stitt, M. Rising CO2 levels and their potential significance for carbon flow in
photosynthetic celIs. Plant Ce11 and the Environment 14, 74 1-762 ( 199 1 ).
8. Clough, J. M., Peet, M.M., Kramer, P.J. Effect of high atmospheric CO2 and sink
size on rates of photosynthesis of a soybean cultivar. Plant Physiol. 67, 1007- 10 10 ( 198 1).
9. Sharkey, T. D. Photosynthesis in intact leaves of C3 plants: physics physiology and
rate limitations. Bot. Rev. 51, 53- 105 (1 985).
10. Petersson. R.. McDonald. A.J.S.. Stadenberg, 1. Response of small birch plants to
elevated CO;! and nitrogen supply. Plant Cell and Environment 16. 1 1 15- 1 12 1 ( 1993).
1 1. Assmann. S. The cellular bais of guard ce11 sensing of rising C02. Plant Ce11 and
Environment 22,629-637 ( 1999).
12. Mott, K. A. Sensing of atmospheric CO2 by Plants. Plant Cell and Env. 13,73 1-737
( 1990).
13. Morison, J. 1. L. Stomatal response to increased CO2 concentrations. J.
Experirnental Biology 49,443-452 ( 1 998).
14. Fitzsimmons,P.J.,Weyers,J.D.B.VolumechangesofCornmelinacommunisguard
ce11 protoplasts in response to K+, light and COZ Physiologia Plantarum 66, 463-468
( 1986).
15. MacRobbie, E. A. Signal transduction and ion channels in guard cells. Philos Tram
R Soc Lorrd B Biol Sci 353, 1475-88 ( 1998).
16. Mansfield, T. A., Travis, A.J., Jarvis, R.G. Responses ro light atrd carborr dioxide.
(ed. Jarvis, P. G.)(Cambridge University Press, Cambridge, 198 1 ).
17. Hedrich, R., Marten, 1. Malate induced feedback regulation of plasma membrane
anion channels could provide a CO2 sensor to guard cells. EMBO 12,897-90 1 (1993).
18. Scwhartz, A., Uan, N., Grantz, D.A. Calcium effects on stomatal movenment in
Comrnelina comrnunis: the use of EGTA to modulate stomatal response to light, KCl and
CO2. Plant physiol. 87.583-587 ( 1988).
19. Zeiger. E.. Zhu, J. Role o f zeaxanthin in blue light photoreception and the
modulation of light -CO2 interactions in the guard cells. Journal of Experimental Batany
49,433-442 ( 1998).
20. Krarner, P. J. Carbon dioxide concentration. photosynthesis, and dry matter
production. Bioscience 31,29-33 ( 198 1).
21. Mauney, J. R., Guinn G., Fry K.E. and Hesketh J.D. Correlation of Photosynthetic
carbon dioxide uptake and carbohydrate accumulation in Cotton. soybean, sunflower and
sorghum. Photosynthetica 13,260-266 ( 1979).
22. Huber. S. C., Rogers M. and Israel D.W. Effects of CO2 enrichment on on
photosynthetic rate and photosynthetic parti tioning in soybean (Glycine mar) leaves.
Physiologia Plantarum 62,95- 10 1 ( 1984).
23. Krapp. A., Quick W.P., Stitt. Rubisco, other Calvin cycle enzymes, and chlorophyll
decrease when glucose is supplied to mature spinach leaves via the transpiration Stream.
Planta 186,58-69 ( 199 1 ).
24. Krapp. A., Hofmann, B.. Schafer. C., Stitt. M. Regulation of the expression of
RBCs and other photosynthetic genes by carbohydrates- A mechanism for the sink
regulation of photosynthesis. Plant Journal 3-8 17-828 ( 1993).
25. Krapp, A.. Stitt, M. An evaluation of direct and indirect mechanisms or the sink-
regulation of photosynthesis in spinach-changes in gas-exchange, carbohydrates,
metabolites, enzyme-activities and steady-state transcript levels after cold-girdling source
leaves. Planta 195.3 13-323 (1995).
26. Garnlei, Y. V., Pakhomova, M.V. The tirne course of carbohydrate transport and
storage in the leaves of the plant species with symptastic and apoplastic phloem loaded
under the normal and experirnentally modified conditions. Russian Journal of Plant
Physiology 47. 109- 1 28 (2000).
27. Van Oosten. J. J., Wilkins D. and Besford, T. Regulation of the expression of
photosynthetic nuclear genes by high CO2 is mimicked by carbohydrates: a rnechanisrn for
the acclimation of photosynthesis to high C O 2 Plant, CeIl and environment 17. 9 13-23
( 1994).
28. Sage, R. F., Reid C.T. in "Plartt Resportse Mechartisrns to the Environment". (ed.
Dekker, M.) 4 13-499 (Wilkinson, R.E., 1994).
29. Stitt, M.. Krapp, A. The interaction between elevated carbon dioxide and nitrogen
nutrition: the physiological and molecular backgound. Plant, Cell and Envirorzrnent 22,
583-62 1 ( 1999).
30. Baysdorfer, C., BasshamJ-A.,. Photosynthate supply and utilization in alfalfa. A
developmental shift from a source to sink limitation of Photosynthesis. Plant Physiol. 77,
3 13-3 17 (1985).
31. Oparka, K. J., Turgeon, R. Sieve elements and cornpanion cells- traffic control
centers of the phloem. Plant Cell11,739-750 ( 1999).
32. Mayord, M. L., Plaut, Z., Reinhold,L.,. Effect of translocation hinderîng processes
on source leaf photosynthesis in cucumber. Plant Physiology 77,7 12-717 (1985).
33. Korner, C. H., Peleaz, S., Van bel, A.J.E. CO2 responsiveness of plants: a possible
Iink to phioem loading. Plant, Cell and Enviromzent 18, 595-600 ( 1995).
34. Ho, L. C. Metabolism and compartmentation of imported sugars in sink organs in
relation to sink strength. Ann. Rev. Plant Physiol. Plartt Mol. Biol. 39,355-378 (1988).
35. Herbers, K., Soonewald, U. Molecular Determinants of sink strength. Current
Opinion in Plant Biology 1,207-206 ( 1998).
36. Lucas, W. J. & Wolf, S. Connections between virus movement, macromolecular
signaling and assirnilate allocation. Curr Opin Plant Bi01 2, 192-7 ( 1999).
37. Crawford, K., Zambryski, P.C. Plasmodesmatal signaling: many roles, sophisticated
statutes. Currer~t Opinion iri Plant Biol. 2,382-387 ( 1999).
38. Heineke, D., Kauder, F.. Frornrner, W., Kuhn, C., Gillissen, B., Ludwig, F. and
Sonnewald,U. Application of transgenic plants in understanding responses to atrnospheric
change. Plant Ce11 and En vironment 22,623-628 ( 1 999).
39. Farage, P. K., McKee, 1. F. & Long, S. P. Does a low nitrogen supply necessarily
lead to acclimation of photosynthesis to elevated COz? Plant P itysiol118.573-80 ( 1998).
40. Sheen, 1. Metabolic repression of transcription in higher plants. Plan! Ce11 2. 1027-
38 (1990).
4 1. Majeau, N., Coleman J.R. Effects of CO2 concentration on carbonic anhydrase and
nbulose 1.5- bisphosphate carboxylase/ oxygenase expression in pea. Plant P liysiology 112,
569-574 ( 1996).
42. Kauder, F., Ludewig,F., Heineke, D. Ontogenetic changes of poiato plants during
acclimation to elevated C 0 2 . J. Experilnental Botany 51,429-437 (2000).
43. Van Ooosten, J. J., Besford R.T. Sugar feeding rnirnicks effect of acclimation to
high CO2 -rapid down regulation of Rubisco small subunit transcripts but not of the large
subunit transcripts. Journal of Plant Physiology 143,306-3 12 (1994).
44. Nie, G. Y., Hendnx, D.L., Webber, A.N., Kimball, B.A. and Long, S.P. Increased
accumulation of carbohydrates and decreased photosynthetic gene transcript levels in wheat
grown at an elevated CO:, concentration in the field. Plant Physiology 108,975-983 ( 1995).
45. Koch, K. E. Carbohydrate-modulated gene expression in plants. Ann. Rev. Plant
Physiol. Plant Mol. Biol. 47,509-40 (1996).
46. Herbers, K., Meuwly, P., Metraux, J. P. & Sonnewald, U. Salicylic acid-
independent induction of pathogenesis-related protein transcripts by sugars is dependent on
leaf developmental stage. FEBS Lett 397,239-44 ( 1996).
47. Saier, M. H., Jr. Multiple mechanisms controlling carbon metabolism in bacteria.
Biotecliriol Bioeng 58, 170-4 ( 1998).
48. Goncalves, P. & Planta. R. J. Starting up yeast glycolysis. Trends Microbiol6, 3 14-
9 ( 1998).
49. Gancedo, J. M. Yeast carbon catabolite repression. Microbiol Mol Biol Rev 62, 334-
61 (1998).
50. Ronne, H. Glucose repression in fungi. Trends Genet 11, 12-7 (1995).
51. Randez-Gil, F., Sanz, P., Entian, K. D. & Pneto, J. A. Carbon source-dependent
phosphorylation of hexokinase PD and its role in the glucose-signaling response in yeast.
Mol Ce11 Bi01 18, 2940-8 ( 1998).
52. Loomis, W. F., Jr. & Magasanik, B. Genetic control of catabolite repression of the
lac operon in Escherichia coli. Biochem Biophys Res Commun 20,230-4 (1965).
53. Loomis, W. F., Jr. & Magasanik, B. The catabolite repression gene of the lac operon
in Escherichia coli. J Mol Bi01 23,487-94 ( 1967).
54. Wills. C. Regulation of sugar and ethanol metabolism in Saccharomyces cerevisiae.
Biochemistry and Molecular Biology 25.245-280 ( 1990).
55. De Winde. J. H.. Crauwels. M.. Hohmann. S.. Thevelein. J. M. & Winderickx. J.
Differential requirement of the yeast sugar kinases for sugar sensing in establishing the
catabolite-repressed state. Eur J Biuchem 241,633-43 ( 1996).
56. Johnston. M. Feasting, fasting and fementing. Glucose sensing in yeast and other
cells. Trends Genet 15.29-33 (1999).
57. Jiang. R.. Carlson. M. Glucose regulates protein interactions within the yeast SNFl
protein kinase cornplex. Genes and Development 10,3 105-3 1 15 ( 1996).
58. Ozcan. S. & Johnston. M. Three different regulatory mechanisms enable yeast
hexose transporter (HXT) genes to be induced by different levels of glucose. Mol Cell Biol
15, 1564-72 ( 1995).
59. Proteome Database. (Proteome Inc., 2000).
60. Liang, H. & Gaber, R. F. A novel signal transduction pathway in Saccharomyces
cerevisiae defined by Snf3-regulated expression of HXT6. Mol Biol Cell7. 1953-66 (1996).
61. Ozcan. S., Dover. J.. and Johnston. M. Glucose sensing and signaling by two
glucose receptors in the yeast Saccharomyces cerevisiae. EMBO J. 17,2566-2573 ( 1998).
62. Jang, J. C., Leon. P., Zhou, L. & Sheen, J. Hexokinase as a sugar sensor in higher
plants. Plant Cell9.5- 19 ( 1997).
63. Sheen. J.. Zhou. L. & Jang. J. C. Sugars as signaling molecules. Curr Opin Plant
Biol 2.4 10-8 ( 1 999).
64. Roitsch. T. Source-sink regulation by sugar and stress. Curr Opin Plant Bi01 2. 198-
206 ( 1999).
65. Dejardin. A., Sokolar, L.N., Klecczkowski. L.A. Sugarl osmoticum levels modulate
differential abscisic acid independent genes in Arabidopsis. Biochem. J. 344, 503-509
( 1999).
66. Roitsch, T., Bittner, M. & Godt, D. E. Induction of apoplastic invertase of
Chenopodium rubrum by D-glucose and a glucose analog and tissue-specific expression
suggest a role in sink-source regulation. Plant Physiol 108.285-94 (1995).
67. Martin, T., Hellmann, H., Schmidt. R., Willrnitzer, L. & Frommer, W. B.
Identification of mutants in metabolically regulated gene expression. Plnnr J 11. 53-62
( 1997).
68. Jang, J. C. & Sheen, J. Sugar sensing in higher plants. Plant Ce11 6, 1665-79 (1994).
69. Graham, 1. A., Denby, K.J. and haver, C.J. Carbon catabolite repression regulates
glyoxalate cycle gene expression in cucumber. Plant Ceil 6,76 1-773 ( 1994).
70. Halford, N., Purcell, P., Hardie, G. 1s hexokinase really a sugar sensor in plants?
Trertds irl Plants Science 4, 1 17- 1 19 ( 1999).
7 1. Takeda, S., Mano, S., Ohto, M., and Nakamura, K. lnhibitors of Protein
Phosphatasesl and 2A block the sugar inducible gene expression in plants. Plant Physiol.
106,567-574 ( 1994).
72. Ehness, R. & Roitsch, T. Co-ordinated induction of rnRNAs fgr extracellular
invertase and a glucose transporter in Chenopodium ntbntm by cytokinins. Plant J 11, 539-
48 ( 1997).
73. Sheen, J. C4 Gene Expression. Ann. Rev. Plant Physiol. Plant Mol. Biol. 50. 187-
217 (1999).
74. Halford, N. G., Hardie, D.G. Snfl-related protein kinases: global regulators of
carbon metabolism in plants. Phnt Molecular Biology 37,735-748 ( 1998).
75. Carling, D., Aguan,K., Woods, A., Verhoeven, A.J.M., Beri. R.K., Brennan, C.H.,
Sidebottom, C., Davison, M.D., and Scott, J. Mamrndian AMP-activated protein kinase is
homologous to yeast and plant protein kinases involved in the regulation of carbon
metabolism. J. Biol. Chem. 269, 1 1442- 1 1448 ( 1994).
76. Bhalerao. R. P. et al. Regulatory interaction of PRLl WD protein with Arabidopsis
SNF1-like protein kinases. Proc Nat1 Acad Sci U S A 96,5322-7 (1999).
77. Nemeth, K. et al. Pleiotropic control of glucose and hormone responses by PRLI, a
nuclear WD protein, in Arabidopsis. Genes Dev 12,3059-73 ( 1998).
78. Rook, F. et al. Sucrose-specific signaling represses translation of the Arabidopsis
ATBS bZIP transcription factor gene. Plant J 15,253-63 (1998).
79. Ishiguro, S., Nakamura, K. Characterization of a novel DNA binding protein SPFl
that recognizes SP8 sequences in the 5' upstrearn regions of genes coding for sporamin and
beta amylase frorn sweet potato. Mol. Gen. Genetics 28,563-57 1 (1994).
80. Sarah, C. J., Graham, I.A., Reynolds, S.J., Leaver, C.J., Smith, S.M. Distinct cis
acting elements direct the germination and sugar responses of the cucumber malate synthase
gene. Mol. Gen. Genetics 250, 153- 16 1 ( 1996).
81. Urwin, N. A. & Jenkins, G. 1. A sucrose repression element in the Phaseohs
vulgariî rbcS2 gene promoter resembles elements responsible for sugar stimulation of plant
and mmmalian genes. Plant Mol Biol35-929-42 ( 1997).
82. Chan, M., and Yu, S. The 3' untranslated region of a rice alpha -amylase gene
functions as a sugar dependent mRNA stability determinant. Proc. Natl. Acad. Sci. 95,
6543-6547 ( 1998).
83. Smeekens, S. Sugar regulation of gene expression in plants. Curr Opin Plant Biol 1,
230-4 ( 1998).
84. Zhou. L., Jang, J. C., Jones, T. L. & Sheen, J. Glucose and ethylene signal
transduction crosstalk revealed by an Arabidopsis glucose-insensitive mutant. Proc Natl
Acad Sci U S A 95, 10294-9 ( 1998).
85. Dijkwel, P. P., Huijser, C., Weisbeek, P. J.. Chua. N. H. & Smeekens, S. C. Sucrose
control of phytochrome A signaling in Arabidopsis. Plant Cell9.583-95 ( 1997).
86. Moore. B. D., Cheng S.H., Rice, J., Seemann, J.R. Sucrose cycling, Rubisco
expression and the prediction of photosynthetic acclimation to elevated C02. Plant, Cell
and Environrnent 21,905-9 1 5 ( 1998).
87. Heineke, D., Wildenberger, K., Sonnewald, U.. Willrnitzer, L., Heldt, H.W.
Accumulation of hexoses in leaf vacuoles: Studies with transgenic tobacco plants
expressing yeast denved invertase in the cytosol. vacuole or apoplasm. Planta 194, 29-33
( 1994).
88. Herbers, K., Meuwly P., Frornrner W.B., Metraux and Sonnewald U. Systemic
aquired resistance mediated by the ectopic expression of invertase: Possible hexose sensing
in the secretory pathway. Plant Cell8.793-803 ( 1996).
89. Moore, B. D.. Cheng, S.H., Sims, D.. and Seemann J.R. The biochernical and
molecular basis for photosynthetic acclimation to elevated atmospheric C02. Plant Cell and
W. Martin, T., Fromrner. W. B., Salanoubat, M. & Willmitzer, L. Expression of an
Arabidopsis sucrose synthase gene indicates a role in metabolization of sucrose both dunng
phloem loading and in sink organs. Plartt J 4,367-77 ( 1993).
Chapter 2
Isolation and Initial Characterization of Mutants of Arabidopsis fitaliana with
Altered Sensitivity to Elevated Carbon Dioxide
Introduction
The physiology of higher piants in response to elevated CO2 has been well studied. These
studies, however, will not identify unknown molecular components involved in the plant
response to elevated COz. As a result of this lim~tation, a genetic approach was taken and
a screen was devised and carried out using the crucifer Arabidopsis thaliann. Previous
examples have shown mutant analysis to be useful in understanding and in discovering
novel components involved in physiological and biochernical processes. Examples of
physiological and biochemical pathways that have been studied using screens include
photorespiration 1, glycerolipid synthesis 2 , arnino acid synthesis and abscisic acid
synthesis 4. In addition, several sensory pathways such as the ethylene signaling pathway
and the brassinosteroid signaling pathway have been studied using such mutants 5 .
Several screens have been performed to isolate mutants in carbon metabolism pathways,
some of which were mentioned in Chapter 1. Most of these screens were performed using
exogenous sugars such as glucose, mannose and sucrose 679 8. Two screens are known to
have used CO2 for screening purposes. The first screen was carried out by Somerville and
Ogren 1 and used 1% COz as a permissive condition and arnbient COz as a non-
permissive condition to isolate mutants with lesions in the photorespiratory pathway.
Plants were grown under 1% CO2 conditions and then transferred to ambient conditions
for 4 days. At a COz concentration of l%, the Rubisco oxygenation activity is suppressed
and carbon enters the photorespiration pathway at a greatly rcduced rate. A plant,
therefore, which has a lesion in a gene required for the photorespiration pathway will
survive when grown under high CO2. If the plant is grown under ambient CO2 conditions,
the carbon flux entering the photorespiration pathwüy increases and cannot be processed
to end products of the photorespiration, which are COz, NH3 and glycerate. A build up of
intermediate compounds occurs and chlorosis is seen under ambient CO2 conditions.
Mutants with lesions in enzymes such as phosphoglycolate phosphatase and glycine
decarboxylase were isolated from this screen. A second screen was perforrned, using 2%
CO2 conditions, by Artus and Sornerville to isolate mutants sensitive to high COz 9. This
set of mutants included two whose photosynthetic tissue becornes chlorotic on exposure
to enriched CO2 conditions. in one of the mutants, chlorosis is light dependent and begins
at the veins and spreads to the interveinal regions. The yellowing of the other mutant is
independent of light and begins at the basal regions of the leaves. These mutants were not
characterized at the molecular level.
A screen for mutants using the response to elevated carbon dioxide as the selective agent
should theoretically yield a large variety of mutants because, as reviewed in the
introduction, CO2 is a primary resource aIong with water, light and mineral nutrients. It
should be possible to obtain mutations affecting the carbon assimilation pathway in
higher plants from the entrance of a CO2 molecule through a stomate, through fixation
and beyond. As such, the screen should theoretically target mutants with defects in
assimilation, sink/ source relations and the regulation of carbon metabolism. To simplify.
the major categories of mutants that may be obtained (see Table 2-1) are those with
defects in assimilation, defects in regulation. defects in export capacity and defects in sink
capacity.
Table 2- 1.
Possible Types of Mutants Resulting From an Elevated COz Screen Types of Lesions hy per-responsive non-responsivc Defects in assimilation increased assimilation decreased assimilation Defects in export capacity decreased export increased export Defects in sink capacity decreased sink increased sink Defects in down - regulation of photosynthesis no down-regulation increased down-regulation
Mutants That May Not be Isolated Lesion i s lcthal More than one copy of gene coding for a particular protein Timing of screen is such that symptoms do not appear Redundancy- another protein can substitute for mutant protein Mutagenesis is biased such that frequency of mutations in a particular loci is low
Assimilation mutants that might result from the screen include those with defccts in
stomatal response to elevated CO2. Failure to reduce stomatal aperture in response to
elevated CO2 could result in a hyper-responsive phenotype as a result of increased
assimilation. The reverse is also tme, where reduced stornatal conductance could result in
a non-responsive phenotype. Guard cells of Arabidopsis mutants, such as ahi 1 and abi 2
(-scisic acid insensitive), fail to respond to COz, and thus it is feasible to expect a
phenotype in response to high COz caused by lesions in stomatal control pathways Io.
Apart from stomatal response defects. a large number of assimilation mutants might be
have lesions in the Calvin cycle. Although a loss of function mutation would be lethal, a
reduced-function mutation in a Calvin cycle enzyme could result in a hyper-responsive
mutant. where the accumulation of a particular substrate would result in a stressed
phenotype.
The export capacity of a leaf changes during development and in response to other
stimuli. Changes in the magnitude and timing of export capacity caused by a mutation
could be detected by this screen provided the timing of the screen is such that the
symptoms can be identified. Lesions which result in a reduction in export capacity, e.g. a
nul1 mutation in a sucrose transporter, should result in an accumulation of sucrose and
other carbohydrates at the site of synthesis, which may be manifested as a COz hyper-
responsive phenotype.
As many of the proteins that determine sink strength are the isozymes o f enzymes which
detemine export capacity (invertases and sugar transporters), sink strength modifications
as a result of mutation might cause phenotypes similar to those of export modification l l .
Mutants with an enhanced export and or sink capacity should show a CO2 non-responsive
phenotype. However, with mutations that decrease the sink capacity, the deleterious effect
may manifest itself initially at sink organs i.e. roots and meristems, whereas with lesions
which decrease expon capacity, the first impact will observed at the source leaf. A
reduction in unloading capacity could result in slow growing shoot and root meristems,
and/or necrosis of transport tissue caused by sugar accumulation. Such a screen might be
useful in differentiating isozyme function where expression is tissue specific. As the
Arabidopsis genome will be sequenced by the year 2001, the annotation of open-reading
frames with homology to known enzymes such as invertases may be relatively
straightforward, and elucidating the pattern of expression of these genes will become an
achievable goal. Nevertheless plants carrying lesions in these enzymes and proteins will
be necessary to confirm physiological function and the specificity of function.
Very few transgenics have been phenotypically characterized in high CO2 environments;
however, certain studies are useful as examples of what phenotypes might or might not be
observed in a high COz environment and what lesions might cause them 12. For example.
it has been shown that modification of the ability of a plant to store starch affects
acclimation to COz. This has been observed in triose phosphate transporter (TPT) and
AGPase antisense plants, where the capacity of sucrose and starch synthesis limits the
CO2 assimilation rates 13. 14. The phenotype of transgenic plants expressing yeast
invertase in the vacuole and apoplasm suggest that necrotic lesions and curling of leaves
are phenotypes one might anticipate under elevated CO2. On a cautionary note, the
plasticity and ability of plants to overcome biochemical defects have also been illustrated
by transgenics. Many transgenics designed to affect the carbon pathway do not show a
profound phenotype unless exposed to specific environmental conditions such as
continuous illumination that enhances assimilation 15.
As growth under high CO? conditions is known to result in an increase in carbohydrate
levels (Le. sugars and starches) in foliar tissue, mutations causing defects in sugar sensing
should also be found. These mutations may be differentiated from assimilation mutants
by observing growth on exogenous sugars such as 0.3M glucose, fructose or sucrose.
Under these high-sugar conditions the mutants defective in sugar sensing should display
the same phenotype as that displayed under high CO2, whereas the mutants defective in
CO2 assimilation should display a wild type phenotype on sugar.
Here 1 describe the development of a screen using elevated COz conditions. The wild type
Arabidopsis response to elevated COz was characterized and any mutant showing a
response different to that of wild type was isolated. This rnethod of screening provided an
unbiased approac h allow ing for the isolation of mutants that are potentiall y di fferent from
previously isolated high CO2 mutants. Previous high CO2 screens involved the isolation
of mutants that were chlorotic under non-permissive conditions, thus biasing the types of
mutants isolated 9* 1.
Materials and methods
Plant Material
T-DNA mutagenized Arabidopsis thaliana seed were obtained from the Arabidopsis
Biological resource center (ABRC, Ohio State University: stock numbers CS2606-2654).
The T-DNA seed collection screened was comprised of 49 pools of 1200 fourth
generation offspring derived from 100 mutagenized parents. Al1 of these T-DNA
transformed lines were in Wassilewskija background and were generated with the
3850: 1003Ti plasmid. EMS and fast neutron irndiated seed was purchased from Lehle
Seeds (Tucson. Arizona). Wild type seed Wassilewskija (WS-O) of the same ecotype as
the T-DNA mutagenized lines was used for phenotype comparisons and Columbia (Col-
0) was used for cornparison with the EMS and fast neutron mutagenized lines.
Growth conditions
Seed were surface sterilized with bleach (10%) and rinsed thoroughly. Seed was then
imbibed for 3-5 days at 4' C and grown on Pro-mix (sphagnum: perlite: vermiculite.
1 : 1 : 1) or on 0.8% agar supplemented with Murashige and Skoog Basal salts (Sigma)
buffered at a pH of 5.6 with 5 rnM MES (Sigma) under sterile conditions. Al1 plants were
grown at 2 1' c and 200 pmol rn-'s" illumination. The Promix grown plants were watered
with half strength 20:20:20 nutrient solution (7g/4L) once a week. The COz enriched
growth chamber was equipped with an Infra-Red Gas Analyzerlregulator (Horiba). This
analyzerlregulator continuously monitored the COz status of the chamber and controlled
the amount of CO2 entering the chamber. Plants grown for carbohydratc and pigment
analysis were 14 DPI ( m y s m s t -hbibition) and were grown on MS media under
ambient and enriched CO2 conditions. The data labeled "air" are measurements taken
from plants grown continuously under full light and ambient CO2 conditions. Data
labelled "COY are measurements taken from plants grown under ambient conditions and
then switched to 3000 ppm CO2 for four days. A11 rnolecular and physiological
experiments were conducted at COz concentrations of 365ppm and 3000ppm and above
200 pmol m"s-' illumination conditions.
Genetic Screen
Mutant seed was surface sterilized and imbibed at 4 ' ~ for 4 days on MS plates. These
plates were then transferred to ambient conditions for 10 days. After 10 days of growth
under ambient conditions, unhealthy plants (e.g. plants with chlorosis, stunted growth and
abnormal developmental patterns) were removed and the plates were then transferred to
elevated CO2 conditions for 4 days. The mutant plants were then screened for phenotypes
aberrant to wild type. A total of 80 000 seed denved frorn the 6 500 independent T-DNA
tagged lines generated by Feldmann, University of Arizona and 150 000 M2 EMS
mutagenized seed derived from 15 000 individually mutagenized plants were screened in
this manner. Five fast neutron irradiated pools derived from 9687 individually
mutagenized M 1 parents were also screened. Secondary screening procedures selected for
mutant Iines, which displayed a relatively conditional phenotype under CO2; that is
mutants which were indistinguishable from wild type under arnbient COz conditions but
showed a altered response at elevated CO2 concentrations.
Segregation and Allelism (Complementation) Analysis
Al1 mutant lines that passed the second screening round successfully were allowed to self
and set seed. These seed were plated on MS agar plates and were subjected to high COz
conditions as per the screen. A plant with the most extreme phenotype under these
conditions was chosen and transferred to soil. This procedure was repeated until the M4
generation. in order to allow unlinked background mutations to segregate out of the
mutant line. At this point al1 T-DNA mutagenized seed was plated on 50 pglml
kanamycin MS plates to determine if the lines contained T-DNA insertions. Mutant lines
found not to contain any insertions were put aside. others were found to be segregating
away from the kanamycin resistance marker and some mutant Iines showed 100 %
resistance. To remove background mutations and examine the segregation pattern of
mutant phenotypes, lines were crossed to wild type Arabidopsis thaliana ecotype WS.
Segregation of the mutant phenotype was analyzed by examining the F1 and /or F2
progeny for a high CO2 response phenotype. Mutants showing similar phenotypes such as
insensitivity to elevated CO2 conditions or more specifically CO2 insensitivef glucose
insensitive plants were crossed to each other and the high COL phenotype of the F1 and
for F2 generations was examined.
Chlorophyll Assay
Portions (0.1 g, FW- fresh weight) of previously weighed foliar tissue was frozen and
ground to a fine powder in liquid nitrogen. Thereafter, 80% (vfv) buffered acetone
(containing 2.5 rnM sodium phosphate pH 7.8) was added to the pulverized tissue
(lm1/100mg of fresh weight) and the mixture was vortexed twice and centrifuged for 10
minutes at 10 000 X g at 4 ' ~ . The supernatant was assayed for chlorophyll by measuring
absorbance at 645 and 663 nm. Chlorophyll content was calculated using the standard
formula. Chi (a+b) pg/mi = &&0.2) + A663 (8.02) 16.
Anthocyanin Assay
Portions (0.5 g) of previously weighed and frozen tissue was ground to a fine powder in
liquid nitrogen and the tissue extracted with 1 .O ml of acidic methanol (95% methanol
containing 0.1M HC1) by incubating the tissue in the acidic methanol for 16 hours at
room temperature. The following day the mixture was centrifuged for 15 minutes at 10
000 X g and the anthocyanin content of the supernatant measured spectrophotometrically
by determining absorbance at 530 nm and 657nrn. The amount of anthocyanin in relative
units is calculated by subtracting absorbance at 657nrn from absorbance at 530nrn. 17.
Extraction of Soluble Sugars
Previously frozen and dned plant material was ground to a powder. 15 mg of this plant
material was extracted with 2ml of a solvent mixture of methanol. chloroforrn and water
in a ratio of 12:5:3. The mixture was vortexed and incubated for 20 minutes then later
centrifuged to pellet the insoluble material. The supematant was then removed and placed
in a 13ml snap-cap tube on ice. This extraction procedure of the pellet was then repeated
twice. After the final extraction, 2ml of distilled water was added to the 6ml of collected
supematant, vortexed and placed at 4OC overnight. The following day. 200p.l of the
aqueous upper phase containing the soluble sugars was assayed for soluble sugar content.
Starch Extraction
The remaining pellet after the extraction of soluble sugars was dried ovemight in a fume
hood and later digested for 1 hour with 35% perchloric acid (v/v), in order to convert
polysaccharides into monosaccharides. The mixture was then filtered (standard laboratory
glass-fibre filter GFA. Machery- Nagel) and the supernatant was assayed for soluble sugar
content.
Assay for Reducing Sugars
200 y1 of the starch or soluble sugar solutions extracted by methods described above were
placed in 13 ml tubes, 800 pl of water and 1 ml of phenol (5% aqueous wlw) was added to
the sample. The mixture was agitated and a Stream of 5 ml of concentrated sulphuric acid
was delivered by pipette into the mixture. The solution was incubated at 37OC for 5
minutes for color development and the absorbance was measured at 490 nm in a
spectrophotomer. This absorbance was compared with a standard curve using glucose
solutions of known concentrations 18 .
RESULTS AND DISCUSSION
Isolation and Genetic Analysis of Mutants with Altered Responses Co Enriched COz
Conditions
in order to maxirnize photosynthetic output and prevent the light reactions k i n g the
-2 - 1 Iimiting factor for photosynthesis, light levels were always kept above 200 pmol m s .
initial characterization of the response of wildtype Arabidopsis plants to varying CO2
concentrations as well as length and timing of exposure to elevated COz was carried out.
The objective was to identify conditions with maximal phenotypic differences between
air grown and elevated COz grown wildtype plants, and subsequently use these conditions
to screen for mutants with defective responses to elevated CO2 concentrations.
Different nitrogen concentrations in the MS were also examined in order to determine
nutrient conditions which maximized differences between plants grown under normal and
elevated CO2 conditions. Based on this criteria, optimal conditions for the screen were
found to be growth on petri plates containing half the concentration of the standard MS
salt agar medium under ambient CO2 conditions (365ppm) for 10 days. after which the
plates were transferred to 3000ppm for 4 days. At this point wild type plants manifest
stunted growth. curled leaves and anthocyanin accumulation, a phenotype indicative of
stress. This reproducible wild type phenotype enabled the isolation of putative mutants.
which when compared with wild type showed an aberrant response to elevated CO2
conditions. When screening mutagenized populations, unhealthy plants (characterized by
poor growth. chlorosis, aberrant development etc.) were removed frorn the screening
protoçol prior to transferring the plates to high CO2 conditions. This procedure was
particularly important as it minimized the possibility of screening for previously isolated
photorespiratory or Rubisco activation mutants.
Mutigmasls d - EMS. T-DNA inwr(lon and
tast - m ~ o n
O *ba MUTANT SCREEN
- -- O
14 DAYS UNDER AIR
- - - REMOVE UNHEALTHY PLANTS AND TRANSFER TO CO2 FOR 4 DAYS
MUTANTS IDENTIFIED -- e- -- -* - - . - -- _ _ _
Figure 2. l . A diagram of the high CO2 screening process.
The primary screen yielded approximately 600 putative mutants. Mutant lines isolated fell
into two main categories; those that did not show a typical wild type stressed phenotype,
i.e. mr non-cesponsive (cnr) and those, which showed an exacerbated CO2 stress
phenotype i.e. CO2 hyper-gesponsive (chr). A large number of these mutants in both
classes were elirninated for various reasons. Insensitives or cnr mutants that produced
pale-colored seed and did not produce any anthocyanin in the petioles or leaves
Figure 2.2. Typical phenotypes of (A) wild type Artrbitlopsis t l i c ~ l i m c r (WS), (B) CO2 non respoiisive mutant line crw (89#5) and (C),(D),(E) (F) CO, hypcr-responsive mutants lines chr (1 3# 1,17# l ,6#3 and 47#37). Plants on the lefi of each panel were grown under ambient CO2 for 14 days. Plants on the right of each panel were grown under high CO, were growii for 7 days under ambicnt conditions and later transî'erred to elevated CO, (3000ppm) for 7 days. All other growth conditions were the saine i.c. 200 prnolm-?s-l continuous light on MS agar plates.
were eliminated based on the assumption that they might be mutants in the anthocyanin
biosynthetic pathway, including PAL (phenyl arnmonia lyase). Al1 mutants that showed
any chlorosis during growth under arnbient CO2 conditions were also discarded on the
grounds that they might be photorespiratory/ Rubisco activation mutants. in additional,
many mutants that were selected did not survive to produce seed. No attempts were made
to recover these mutants.
Secondary screening yielded 24 chr mutants, which showed aberrant leaf and growth
phenotypes under high CO2. These mutants were selected even though some were not
completely conditional as they exhibited a phenotype somewhat different to wild type
under ambient CO2 conditions. They were nevertheless included because the elevated
CO2 conditions greatly exacerbated the phenotype. Some of the traits observed under
ambient concentrations included slower growth and changes in developmental timing.
Thirty-three cnr mutants also resulted from the screen, and these mutants showed varying
degrees of insensitivity to elevated COz. These cnr characteristics included normal
(ambient CO2-like) to vigorous growth, reduced induction of anthocyanin accumulation.
and curling of leaves with al1 of these phenotypes observed under high CO2 conditions.
Preliminary characterization of this group suggested that phenotypes were conditional.
The cnr mutant lines were later separated into two groups: 1) those whose development is
arrested similarily to wild type when grown on 5-6% glucose agas supplemented with MS
salts, and 2) mutants which were tolerant to these conditions. This high glucose
phenotyping allowed for the potential separation of mutants into two classes, those
responding primaril y to CO2, and those responding to carbohydrate loading. Mut an ts with
lesions in COz uptake and assimilation should show a wild type response for growth on
high concentrations of sugars whereas mutants in sugar sensing should be insensitive to
both high COz and high sugar concentrations.
Some of the chr and clzr phenotypes are shown in Figure 2.2. The c n r mutant lines
showed various degrees of the same phenotype, reduced curling of leaves, reduced
anthocyanin production and reduced necrosis on prolonged exposure to elevated COz.
One of these mutant lines, 89#5 was chosen for further characterization. The chr mutant
lines showed a wide range of mutant phenotypes. Of these various phenotypes four were
chosen for further study: 1) a mutant line that became chlorotic, yel -13# l(yel1ow); 2) a
mutant line showing early senescence of cotyledons. e x - 17# 1 (brown); 3) a mutant line
showing chlorosis of the veins, var-6#3(varigated) and 4) a mutant line showing increased
curling and anthocyanin production, pur-47#37(purple). These mutant lines sometimes
showed a reduced level of the specific phenotype under ambient CO2 conditions;
however, the phenotypes were exacerbated under exposure to elevated COz.
Root Phenotypes under Various Conditions
As the plants were grown on agar plates, it was obsewed that some of the mutants
showed pronounced root phenotypes especially under high CO2 and on MS plates
supplernented with 0.3M glucose plates (Figure 2.3.). The most pronounced root
MEAN TOTAL ANTHOCYANINS
O AIR -
WSWT YELLOW BROWN PURPLE
I , WSWT
-..
--
YELLOW
MEAN TOTAL CHLOROPHYLL
BROWN
INSENSITIVE VARIGATED
PURPLE INSENSITIVE VARIGATED
Figure 2.4. Foliar anthocyanin and chlorophyll content of 14 day old plants (wild- type, mutant lines yellow- 13# 1, purple -47#37, insensitive- 89#5 and eighteen day old brown- 17# 1, varigated 6#3.4-6 plants were used for each measurement and two trials were performed. Pigment quantity is expressed per gram of fiesh weight (FW) Error bars show standard error.
phenotypes were seen for mutant lines cnr -89#5. chr- var 13#1 and chr-pur 47#37. The
89#5 showed greater root growth o n 0.3M glucose and under high CO2, whereas the var
6#3 and pur 47#37 displayed severe stunting on 0.3M glucose media, and to a lesser
extent by elevated CO2 when compared with wild type plants.
Pigment Analysis
Wild type plants display a significant increase in anthocyanin production under elevated
CO2 (shown in Figure 2.4.). As mentioned previously, anthocyanins are produced under
stress conditions usually when carbon is not limiting 19. and thus they can be used to
signal the level of stress a plant is experiencing. When compared with wildtype plants,
two c h mutant lines (13#1 and 17#1) d o not show an increase in anthocyanins. Two
other chr mutants (47#37 and 6#3) show similar responses to wildtype: that is, a large
increase in anthocyanin on exposure to elevated CO2 conditions. Chlorophyll content was
not remarkably different under both CO2 regimes for most of the mutant lines compared
to wild type plants. The exceptions were mutant line 17#1, which showed reduced
chlorophyll levels for both conditions, and mutant Iine 6#3, which showed an increase in
chlorophyll levels at high CO2 concentrations. The cnr mutant lines displayed little or no
change in anthocyanin production between ambient and elevated CO2 conditions. whereas
chlorophyll levels were similar to wild type plants under both ambient and CO2 enriched
conditions. in accordance with the vigorous growth of the cnr mutant under high CO2. the
decreased anthocyanin levels and relatively normal chlorophyll levels are indicative of a
low stress situation for the plant.
2 50.
3 zoo. V
g 2 150. m cn 1 V)
0, 100. z! - 50.
3
O -
800.
700.
G 600. E 'E 500. a 2 400. U, Z 300. VI
g' 200. 100.
O.
900. 800.
5 700. 600.
a - 500. 2 0, 400. 3 300. 5 200. y 100.
0.
wswr
1 WSVJT
3 WSWT
4 YELLOW
T
YELLOW
i YELLOW
TOTAL FOLlAR SOLUBLE SUGAR
BROWN PWPLE INSENSITIVE VARlGATEO
TOTAL FOLlAR STARCH -.-
II. BROWN PVRPLE INSENSITIVE VARJGATED
TOTAL FOLlAR CARBOHYDRATES
PURPtE INSENSITIVE VARIGATED
Figure 2.5. Foliar carbohydrate analysis of 14 day old plants (wild- type, mutant lines yellow- 1 3# 1. purple -47#3 7, insensitive- 89#5 and eighteen day old brown- 1 7# 1, varigated 6#3.4-6 plants were used for each measurement and two triais were performed. Amounts of carbohydrate are expressed as micrograms of carbohydrate per mg dry weight (DW) of tissue. Error bars show +/- standard ermr.
Foliar Carbohydrate Analysis
Wild type plants showed increases in both soluble sugars and starch after four days of
growth under high CO2, whereas the mutants show varying responses when cornpared to
wild type plants. The insensitive line 89#5 contains a lower amount of soluble sugar and
starch than wild type under both CO2 conditions. The chr mutant lines show varied
responses with the line 13#1 and 6#3 showing larger increases in carbohydrate content
under enriched COz conditions than wild type plants. Overall, it is difficult to define a
specific pattern of carbohydrate accumulation across the various lines with the exception
of a reduced response to COz exhibited by cnr plants when cornpared with wild type and
hypersensitive mutants.
Rationaie For Choosing the cnr Mutants for Further Study
The high CO2 screen perforrned in this study resulted in a large number of mutants, and
therefore a strategy had to be devised in order to select mutants for further
characterization. As the screen was carried out in an effort to isolate mutants in the
regulation of carbon assimilation and metabolism, a rationale had to be devised to
separate these particular mutants from others that might not be involved in regulation.
The rationale used was based on information from previous carbon metabolism studies in
plant and yeast. Initially, when this screen was devised, it was thought that the chr class
of mutants would likely involve regulation of photosynthetic gene expression, that is
assurning a simple repression rnechanism and the ability to identify loss of function
mutations. Plants unable to down regulate their photosynthetic output would over produce
carbohydrates and therefore would be stressed when exposed to elevated CO2 conditions.
The regulation mechanism in plants, however, appears to be more complex than a simple
repression system 7. Mutant and transgenic analysis in plants by Sheen 20 and in yeast 21
(chapterl) suggests that lesions involved in hexokinase signaling pathways will be
insensitive to high levels of sugars. When wild type Arabidopsis is grown on MS media
containing 0.3M sucrose, glucose or fructose, it displays a phenotype similar, but
exacerbated. cornpaced to wild type grown under high COt. This phenotype includes
increased an thocyanin production, increased trichome number, and stunted growth. Some
of the cnr mutants isolated from this screen show insensitivity to sugars, corroborating
the suggestion that these mutants might be related to the pathway involving hexokinase.
Given this possibility one of the mutants selected for further study was a cnr mutant,
which was also insensitive to glucose.
The insensitive mutants selected for further study were from T-DNA mutagenized lines,
since the disrupted gene might be cloned with relative ease. Segregation analysis of
several transformants determined t hat the average number of independent T-DNA inserts
is 1.5 per diploid genorne 22. Therefore, to determine if the plants contained T-DNA
inserts that were likeiy to be linked to the mutations, M4 plants, which were selected
under CO2 for 4 generations, were tested for kanamycin resistance (Table 2.2). The
selection under COî entailed selecting the most CO2 insensitive plants at each generation
and allowing such plants to self fertilize and set seed. Kanamycin resistant mutants were
selected for further characterization with the exception of 2 1#27 which showed a
kanamycin sensitive phenotype that was unlinked to the cnr phenotype. 21#27 was
nevertheless characterized further as it displayed a particularly strong cnr phenotype.
Table 2.2. Kanamycin Sensitivity of M4 T-DNA Mutant Lines. M4 T-DNA
mutagenized lines showing CO2 non-responsive phenotypes were tested for kanamycin
resistance on MS a g a plates containing 50 pg of kanamycin per ml of agar media.
O al l O
al 1 O 3 1 al 1 O O ail 5 O O 3 6 I l 7 O
Mutant line
possible Noi possible
possible Not possible
possible Not possible Not possible
possible possible
Not possible Not possible
possible possible possible
Not possible possible
resistant sensitive linkage to cnr phenotype
The genetics of the 89#5 mutant line were found to be interesting as both the COz and
kanamycin resistant phenotypes were segregating wild type plants. The 89#5 mutant line
was segregating 3: 1 for kanamycin resistance : kanamycin sensitivity for al1 generations
tested. The high COt phenotype of the mutant was also segregating 3: 1 for the CO2 non-
responsive phenotype: CO2 wild type phenotype. This suggested that the mutant selected
to set seed was dominant for the CO2 insensitive phenotype, and it appeared that the CO2
non-responsive phenotype was segregating with the insertion element. The 89#5 mutant
line was thus selected for further study because of its cnr phenotype and its putatively
dominant nature.
In order to establish the segregation pattern of the mutant lines, plants were emasculated
and pollinated with wild type pollen. Table 2.3 shows the segregation of F1 and F2
progeny from these crosses with wild type. Al1 plants taken to the F1 generation for al1
Iines selected showed a wild type phenotype under high CO2 with the exception of 89#5.
As expected, 89#5 was segregating insensitive plants at this generation. insensitive plants
were allowed to self and set seed. F2 populations where al1 individuals displayed the CO2
insensitive phenotype were regarded as homozygous for the mutation and used for further
studies.
The five CO2 non-responsive mutant iines were also emasculated and crossed with one
another in order to detennine if any one of these lines had lesions in the same gene (see
Table 2.4.) Since al1 FI plants showed the wild type response under elevated CO2. the
data seem to indicate that none of the mutant lines have lesions in the same gene. If any
of the mutant lines were allelic then al1 F1 progeny would be CO2 insensitive.
Table 2.3. Segregation analysis of progeny from CO2 non-responsive (cnr) mutant lines,
which had been emasculated and pollinated with wild type pollen. The table shows the
high COz phenotypes of F 1 and F2 progeny; plants are recorded as showing either cnr or
wild type CO2 phenotypes.
F I F2 cnr/ (cnr + W T ) F2 Phenotypc Phenotype F2 X Z
Mutant Line 1 l#4 17#12 2 I#Z7 89#5 * 89#7
cnr wt cnr wt Observed Expected Segrega tion pattern
O 4 23 71 0.24 0.25 0.053 recessive O 12 31 79 0.28 0.25 0.48 recessive O IO 15 50 0.23 0.25 0.2 1 recessive 14 9 79 26 0.73 0.75 0.2 1 dominant O 24 29 84 0.26 0.25 0.053 recessive
*89#5 - dominant heterozygote
Table 2.4 Complementation Analysis. Data showing the high CO2 phenotypes of F1
progeny f rom cnr mutant lines crossed with each other.
Mutant Line 1 11#4 17#12 21#27 89#5 89#7
*Mutant crosses between 17#2 and 89#5 lines did not al1 germinate. Three crosses were attempted with
89#5 as the femait: p;:=r,: and no crosses were attempted with 17#12 as the female parent.
11#4 17#12 21#27
89#S(het) 89#7
wt wt 7 wt: 5 cnr wt wt wt t wt wt wt 12 wt :7 cnr wt
7 wt: 5 cnr 12 wt :7 cnr 4 wt:6 cnr wt wt wt 4 wt:6 cnr
Glucose Phenotypes and Other Traits
As the photosynthetic gene regulation observed under elevated CO2 has been correlatcd
with the increase in foliar carbohydrates, the phenotype of the CO2 insensitive mutants
grown on elevated sugars was examined. The phenotypes of the c w lines grown on 2-
deoxyglucose was also inspected because 2-deoxyglucose is phosphorylated by
hexokinase but not metabolized further. In this way, as described in previous references
23 24, any further metabolism of the hexoses can be decoupled from the signaling event
attributed to hexokinase. The selected cnr mutants were plated on 0.3 M glucose and
their glucose phenotypes were observed (Figure 2.6.). The germination behavior on
fructose and 0.8 rnM deoxyglucose was also examined (Table 2.5). Al1 the tested cnr
lines showed insensitivity to 0.3 M glucose. with the exception of 89#7. This mutant line
appeared to be supersensitive to glucose but showed no sensitivity to 0.3M sorbitol
(expriment not shown). The growth on sorbitol supplemented media suggests that the
glucose hypersensitivity is not simply an osmotic effect. In addition to having somewhat
smaller seed when compared to wild type seed, 89#7 also appeared to have reduced
germination capability. Unless seed was chilled for at least 3 days, 89#7 germination
levels were below those observed for wild type. This mutant was selected for funher
study and was designated cnr 2- 1. Another mutant line 17# 1 2. both glucose and high CO2
insensitive was designated cnr 3-1. This mutant has been shown to have a significantly
larger seed size (measurements performed using SEM Dr T. Sage and Students). SEM
analysis of seed development in the silique suggests that the mutant also aborts
approximately a third of its embryos. It is possible that this abortive process increases
carbon allocation to a smaller number of embryos and that this results in the larger seed
size. The mutant line 89# 5 dso displayed glucose insensitive phenotype and was
designated cnr 1- 1 and was selected for further study.
Table 2.5. Germination* Behavior of Selected cnr Mutations on 0.3 M
Glucose, 0.3M Fructose and 0.8 mM Deoxyglucose.
*Germination was scored as the appearance of green cotyledons after 7 days of growth.
Mutation 1 l#4 17#12 21 #27 89#5 89#7
wt
Mutation 1 l#4 17#12 21#27 89#5 89#7
wt
Mutation 11#4 17#12 21#27 89#5 89#7
wt
0.3 M Glucose tungerm. total %gerrn.
20 69 71 .O 12 65 81 -5 12 65 81 -5 23 1 03 77.7 44 54 18.5 29 47 38.3
0.3 M Fructose #ungerrn total %germ
25 45 44.4 22 43 48.8 66 1 06 37.7 16 35 54.3 33 36 8.3 3 1 41 24.4
0.8 mM Deoxyglucose #ungerm total %germ
4 15 73.3 4 12 66.7 2 11 81.8 1 13 92.3 14 18 22.2 8 14 42.9
Summary
A novel screen was designed to isolate two classes of mutants cnr and chr. Several EMS.
T-DNA and fast neutron generated mutants were isolated, thus demonstrating the utility
of such a screen. There have been no prior screens performed using an enriched CO2
environment in this manner to isolate carbon metabolism mutants. Previous screens using
high COz were designed to select photorespiration mutants 25 or to select COZ hyper-
sensitive mutants 9. The rationale behind this study is that a CO2 screen would isolate
mutations upstream of screens performed on a high sugar medium. as well as mutations
isolated by sugar requiring screens.
References
1. Somerville, S. C., Ogren, W.L. A phosphoglycolate phosphatase- deficient mutant
in Arabidopsis. Nature 280, 833-836 ( 1979).
2. Shanklin, J., Cahoon, E.B. Desaturation and Related Modification of Fatty Acids.
Ann. Rev. Plant Physiol. Plant Mol. Biol. 49, 6 1 1-64 1 ( 1998).
3. Champigny, M. a. F., C. Nitrate activation of cytosolic protein kinase diverts
photosynthetic carbon from sucrose to amino acid biosynthesis. Plant Physiol. 100, 7- 12
( 1992).
4. Tan, B. C., Schwartz, S. H., Zeevaart, J. A. & McCarty, D. R. Genetic control of
abscisic acid biosynthesis in maize. Proc Natl Acad Sci U S A 94, 12235-40 ( 1997).
5. Li. J. & Chory, J. A putative leucine-rich repeat receptor kinase involved in
brassinosteroid signal transduction. Ce11 90, 929-38 ( 1997).
6. Zhou, L., Jang, J. C., Jones, T. L. & Sheen, J. Glucose and ethylene signal
transduction crosstalk revealed by an Arnbidopsis glucose-insensitive mutant. Proc Natl
Acad Sci U S A 95, 10294-9 ( 1998).
7. Smeekens, S. Sugar regulation of gene expression in plants. Curr Opin Plant Bi01
1, 230-4 ( 1998).
8. Dijkwel, P. P., Huijser, C., Weisbeek, P. J., Chua, N. H. & Smeekens, S. C .
Sucrose control of phytochrome A signaling in Arabidopsis. Plant Ce11 9, 583-95 ( 1997).
9. Artus, N., 1990, 13:575-58. Two mutants of Arabidopsis thaliana that become
chlorotic in atmospheres enriched with CO2. Plant Ce11 and Environment 13,575-580
(1990).
10. Webb, A. A. & Hetherington, A. M. Convergence of the abscisic acid, CO2, and
extracellular calcium signal transduction pathways in stornatal guard cells. Plant Physiol
114, 1557-60 (1997).
11. Martin, T., Hellmann, H., Schmidt, R., Willmitzer, L. & Frommer, W. B.
Identification of mutants in metabolically regulated gene expression. Plant J 11, 53-62
( 1997).
12. Heineke, D., Kauder, F., Frommer, W., Kuhn, C., Gillissen, B., Ludwig, F. and
Sonnewald, U. Application of transgenic plants in understanding responses to
atmospheric change. Plant Ce11 and Environment 22,623-628 ( 1999).
13. Hausler, R. E., Schlieben, N. H., Schulz, B. & Flugge, U. 1. Compensation of
decreased triose phosphatelphosphate translocator activity by accelerated starch turnover
and glucose transport in transgenic tobacco. Planta 204,366-76 ( 1998).
14. Sun, J., Okita, T. W. & Edwards, G. E. Modification of carbon partitioning,
photosynthetic capacity, and Oz sensitivity in Arabidopsis plants with low ADP-glucose
pyrophosphorylase activity. Plant Physiol 119,267-76 ( 1999).
15. Fridlyand, L. E. & Scheibe. R. Regulation of the Calvin cycle for COz fixation as
an example for general control mechanisms in metabolic cycles. Biosystems 51, 79-93
( 1999).
16. Edelmann, M., Hallick, R.B., and Chua, N.-H. (ed.) Methods in Chloroplast
Molecular Biology (Elsevier Biomedical Press, New York, 1982).
17. Weyrauch, D. A. Bioteclznology and Bioengineering 22,337-352 ( 1980).
18. Tissue, D. T., Wright, S.J. Effect of seasonal water availability on phenology and
the annual shoot carbohydrate cycle of tropical forest shmbs. Fuctional Ecology 9, 5 18-
527 ( 1995).
19. Vitrac. X. et al. Sugar sensing and ca2'-calrnodulin requirement in Mis virr$era
cells producing anthocyanins. Phytochemisrry 53, 659-65 (2000).
20. Jang, J. C., Leon, P., Zhou, L. & Sheen, J. Xexokinase as a sugar sensor in higher
plants. Plant Cell9.5- 19 ( 1997).
21. De Winde, J. H., Crauwels, M., Hohmann, S., Thevelein, J. M. & Winderickx, J .
Differential requirement of the yeast sugar kinases for sugar sensing in establishing the
catabolite-repressed state. Eur J Biochem 241,633-43 ( 1996).
22. Azpiroz-Leehan, R. & Feldmann, K. A. T-DNA insertion mutagenesis in
Arabidopsis: going back and forth. Trends Genet 13. 152-6 (1997).
23. Jang, J. C. & Sheen, J. Sugar sensing in higher plants. Plntir Cell6, 1665-79
(1994).
24. Roitsch, T., Bittner. M. & Godt. D. E. induction of apoplastic invertase of
Cizenopodi~rnt rubnrm by D-glucose and a glucose analog and tissue-specific expression
suggest a roIe in sink-source regulation. Plant Physiol 108, 285-94 (1995).
25. Somerville, C. R. & Ogren, W. L. Mutants of the cruciferous plant Arabidopsis
thaliana lacking glycine decarboxylase activity. Biochem J 202, 373-80 ( 1982).
Chapter 3
A Putative Receptor Kinase AfTecting the Photosynthetic Response to Elevated CO2
A bstrac t
Arabidopsis thuliana, grown in the presence of elevated CO2 (above 1000pprn) under
saturating light conditions, exhibit increased anthocyanin pigmentation, curling of leaves,
and a generally stunted phenotype. A genetic screen was devised to isolate mutants which
show an aberrant phenotype in response to elevated CO2 when compared with the wild
type. W e describe here the isolation of a T-DNA tagged mutant crir 1-1 (CO? non-
responsive) exhibiting insensitivity to elevated COz. This insensitivity to elevated CO2 is -
manifested as a combination of phenotypes including reduced anthocyanin production
and normal to vigorous growth. The genetic. bioçhemical and molecular characterization
of the lesion conferring this phenotype and the molecular rescue of this phenotype are
described here. The CNRl gene encodes a putative cytoplasmic receptor kinase
suggesting a role in signal transduction.
Introduction
As current levels of atmospheric COa are predicted to double in the next century, it is
necessary to be able to understand the response of higher plants to elevated COz l . Many
physiological studies have contributed to our present knowledge in this respect *;
however, in contrast to the physiological studies, there have been very few studies
attempting to dissect the rnolecular basis of the response of higher plants to elevated CO2
conditions. In an effort to better understand this response of plants to these conditions we
performed a screen using Arobidopsis thaliana in an attempt to isolate mutants showing
an aberrant response to high COz.
Exposure to elevated CO2 has a number of effects on plants. These effects include an
initial burst in photosynthesis, which in many plants is attenuated on prolonged exposure
to an enriched COz environment 3. This attenuation of photosynthetic rates observed in
these plants is caused by reduced amounts of photosynthetic proteins such as Rubisco and
chlorophyll a/b binding protein 4. Thus the decrease in photosynthesis resulting from the
long-tcrm exposure to CO2 has been attributed to decreased nitrogen investment in the
photosynthetic apparatus 5. It has been suggested that this decreased investment is
accomplished through transcriptional regulation 6. Several studies have shown t hat the
transcript abundance of certain genes including photosynthetic genes is affected by
prolonged exposure to elevated CO2. Transcription of photosynthetic genes such as
chlorophyll a h binding protein and Rubisco are down regulated, whereas genes such as
nitrate reductase are up-regulated on prolonged exposure to elevated CO2 conditions
8. Sirnilar transcriptional control of the sarne genes has been observed in plants grown in
the presence of sugars such as glucose and sucrose, and parallels have been drawn
between sugar regulation and CO? transcriptional regulation. In addition. the change in
transcript abundance under elevated COz shows sorne correlation with the accumulation
of carbohydrates 6. It has k e n postulated that the transcriptional regulation of CAB and
Rubisco is mediated by carbohydrate levels 9, which can accumulate in plants on
prolonged exposure to enriched CO2 environments. The complete signal transduction
pathway that exerts this transcriptional control is not known as yet; however. there are
molecular components that appear to exert an influence on the control of photosynthetic
gene transcription. For example. there is some evidence to suggest that hexokinase 10
may play a role as a sensor in this pathway. but it is unlikely to be the sole signaling agent
in the pathway, as it appears that sugar transporters also play an important role in this
respect 1 1. In order to isolate other molecular cornponents in the sugar-sensing pathway.
screens carried out thus far have used high concentrations of exogenous sugar in growth
media as a means of selection. The various screens have given rise to many mutants such
as the sun - Wcrose mcoupled mutants 12, the rsr- oduced gugar Fsponse mutants 13,
and the giu-glucose hsensitive mutants 14. Although the specific lesions resulting in
these phenotypes have not yet been identified, the characterization of these mutants will
reveal much information about carbohydrate sensing and carbon regulation in plants.
In this study, a different approach was favored for screening purposes in that enriched
CO2 atmospheres were used to isolate mutants defective in the regulation of carbon
metabolism. This approach enables the isolation of mutants upstream of the sugar
signaling pathway as well as in the pathway. The screen identified 33 CO2 non-responsive
mutants from EMS, T-DNA and fast neutron mutagenized lines. CO2 non-responsive
mutants were categorized as plants which displayed few. if any. of the stress responses
exhibited by wild type plants when exposed to high levels of COz. The specific CO2 non-
responsive mutant described here was isolated from the T-DNA mutagenized Feldmann
collection l5 and the characterization of the lesion was facilitated because the CO2 non-
responsive phenotype was found to segregate with the kanarnycin resistance marker of the
T-DNA insertion element.
Materials and Methods
Plant Material
T-DNA mutagenized Arabidopsis thaliana seed were obtained from the Arabidapsis
Biological resource center (ABRC. Ohio State University: stock numbers CS2606-2654).
Wild type seed used was of the Wassilewskija (WS) ecotype. The T-DNA seed collection
screened was comprised of 49 pools of 1200 fourth generation offspring derived from 100
mutagenized parents.
Growth conditions
Seeds were surface sterilized with bleach (10%) and rinsed thoroughly, after which the
seed was imbibed for 3-5 days at 4' C and grown on Pro-Mix - sphagnum: perlite:
vermiculite (1 : 1: 1) or plated directly on 0.8% agar supplemented with Murashige and
Skoog Basal salis (Sigma) buffered at to pH of 5.6 with 50mM MES (Sigma) under
sterile conditions. Al1 plants were grown at 21' C under 200 pmol m-2s-' PAR continuous
illumination. The Promix grown plants were watered at three day intervals and fertilized
with a half strength 20:20:20 nutrient solution once a week. The elevated CO2 chamber
was equipped with an Infra-Red Gas Analyser (Horiba) regulator, which continuously
monitored the CO2 status of the chamber. Al1 rnolecular and physiological experiments
were conducted at either a CO2 concentration of 365 ppm (ambient) or at 3000ppm
(elevated) and at a light intensity of 200 pmol photons m-2s-'.
Genetic Screen
Mutant seed was surface sterilized. plated and imbibed at 4 ' ~ for 4 days. plates were then
transferred to ambient COz conditions for 10 days. After 10 days of growth unhealthy
plants were discarded and the plates were then transferred to elevated COz conditions for
4 days. The mutant plants were then screened for phenotypes that differed from wild type
(see Chapter 2)
Genetic Analysis
To examine segregation of mutant phenotypes and to eliminate background mutations,
mutants which showed insensitivity to enriched CO2 environments were backcrossed to
wild type WS plants. Segregation was analyzed by examining the FL and F2 progeny of
backcrossed mutants for sensitivity to elevated COz (3000ppm).
Kanamycin Segregation Experirnents
To determine if the mutants isolated from the T-DNA collection contained insertions
within their genomes, F2 seed from backcrossed lines, were tested for segregation of
kanamycin resistance as described elsewhere (Feldman 1992). F2 seeds were plated on
MS agar plates containing kanamycin (25pg/ml). Kanamycin sensitivity was detemined
after two weeks of growth, at which point sensitive plants displayed arrested development
and bleached cotyledons and leaves.
To determine if a T-DNA insertion was linked to the CO2 insensitive phenotype in cnr 1,
a cosegregation experiment using seed (F3 generation) from 80 CO2 insensitive F2 plants
and 20 CO2 sensitive F2 plants was performed. The cosegregation experiment involved
plating the F3 seed on 25pg/ml kanamycin MS plates. The genotypes of plants were
inferred from the F2 CO2 phenotypes and the F3 kanamycin sensitivities.
Pigment and Carbohydrate Analysis
Chlorophyll Assay
Portions (0.1 g, FW- fresh weight) of previously weighed foliar tissue was frozen and
ground to a fine powder in liquid nitrogen. Thereafter. 80% (vlv) buffered acetone
(containing 2.5 mM sodium phosphate pH 7.8) was added to the pulverized tissue
(lm11100mg of fresh weight) and the mixture was vortexed twice and centrifuged for 10
minutes at 10 000 X g at 4 ' ~ . The supernatant was assayed for chlorophyll by measuring
absorbance at 645 and 663 nrn. Chlorophyll content was calculated using the standard
formula. Chi (a+b) + A6&0.2) + Abb3 (8.02) 16.
Anthocyanin Assay
Portions (0.5 g) of previously weighed and frozen tissue was ground to a fine powder in
liquid nitrogen and the tissue extracted with 1.0 ml of acidic methanol (95% methanol
containing 0.1M HCI) by incubating the tissue in the acidic methanol for 16 hours at
room temperature. The following day the mixture was centrifuged for 15 minutes at 10
000 X g and the anthocyanin content of the supernatant measured spectrophotometrica~i y
by determining absorbance at 530 nm and 657nm. The arnount of anthocyanin in relative
units is calculated by subtracting absorbance at 657nm frorn absorbance at 530nm. 17.
Extraction of Soluble Sugars
Previously frozen and dried plant material was ground to a powder. 15 mg of this plant
material was extracted with 2ml of a solvent mixture of rnethanol, chloroforrn and water
in a ratio of 12:5:3. The mixture was vortexed and incubated for 20 minutes then later
centrifuged to pellet the insoluble material. The supernatant was then rernoved and placed
in a 13ml snap-cap tube on ice. This extraction procedure of the pellet was then repeated
twice. After the final extraction, 2ml of distilled water was added to the 6ml of collected
supernatant. vonexed and placed at 4OC ovemight. The following day, 2 0 0 ~ 1 of the
aqueous upper phase containing the soluble sugars was assayed for soluble sugar content.
Starch Extraction
The remaining pellet after the extraction of soluble sugars was dried overnight in a fume
hood and later digested for 1 hour with 35% perchloric acid (v/v), in order to convert
polysaccharides into monosaccharides. The mixture was then fil tered (standard laboratory
glass-fibre filter GFA, Machery- Nagel) and the supernatant was assayed for soluble sugar
content.
Assay for Reducing Sugars
200 pl of the starch or soluble sugar solutions extracted by the above methods were
placed in 13 ml tubes, 800 pl of water and lm1 of phenol(5% aqueous w/w) was added to
the sample. The mixture was agitated and a Stream of 5 ml of concentrated sulphuric acid
was delivered by pipette into the mixture. The solution was incubated at 37°C for 5
minutes for color development and the absorbance was measured at 490 nm in a
spectrophotomer. This absorbance was compared to a standard curve using glucose
solutions of known concentrations 18 .
Molecular Biology Methods
DNA Isolation DNA was isolated from leaf tissue using CTAB 19. Tissue was ground to a powder with
liquid nitrogen in a mortar and pestle. The powder was transferred to a centrifuge tube
and lm1 preheated ( 6 5 ' ~ ) 2X CTAB buffer (2% CTAB wlv. 1OOrn.M Tris-HCl pH 8,
20rnM EDTA pH 8, 1.6M NaCI, 1% PVP MW 40000) was added per gram of fresh
weight. ISmV g FW chloroforrn: isoarnyl alcohol (24: 1) was added and mixed
thoroughly to form an ernulsion. The emulsion was then centrifuged at 10 000 X g for
10min. The upper phase was transferred to a new tube and 1/10 the volume of a 10%
CTAB buffer (10% CTAB wlv. 0.7M NaCI) preheated to 6 5 ' ~ was added and mixed
well, the chloroforrn extraction step was then repeated and after centrifugation the
supernatant was transferred to a new tube and 1 volume of CTAB precipitation buffer
(1% CTAB, 50mM Tris-HCI pH 8, lOmM EDTA pH 8) was added. This mixture was
allowed to stand overnight at 4OC. The following day the tube was centrifuged and the
pellet was collected and resuspended in water and an appropriate amount of RNAse and
salt were added to a final concentration of 100pg/mI. This mixture was incubated at 37'~
for 1-2 hours. Another chloroform extraction step was perfomed and the supernatant was
collected and transferred to a new eppendorf tube. After centrifugation (10 OOOxg for 10
minutes), 2 volumes of cold 100% ethanol (stored at -20°C) was added. The DNA was
then allowed to precipitate for 15 minutes at -20°C. collected by centrifugation and air-
dried for 20-30 minutes. The pellet was rehydrated using 40 pl of O. 1 X TE ( 1 .OmM Tris-
HCI pH 8, 0.lmM EDTA pH 8) to a final concentration of 1 pg/ml.
Southern Analyses
Southem analysis was performed essentially as described elsewhere 20. Genomic or
plasmid DNA was cut using restriction enzymes in their appropriate buffers and the DNA
separated by electrophoresis in a 0.7-0.8% agarose gel in 0.5 X TBE buffer. Gels were
then shaken gently for 30 minutes in 0.25N HCI to fragment DNA and thus facilitate
transfer of large fragments. The gels were then rinsed in distilled water, transferred to
0.4N NaOH solution for 30 minutes with gentle shaking, and then neutralized using a
sodium acetate solution (3M NaOAc pH 5.5) for an additional 30 minutes. The DNA
fragments were then transferred to nylon membranes (Schleicher and Schuell Inc.) in 10X
SSC buffer solution. Blots were hybridized with probes labelled with a "P dCTP using a
random priming method. 21. Prehybridization and hybridization in Denhardt's was
perforrned as previously described 20.
RNA Isolation
Al1 RNA was isolated from 10 day-old seedlings. Seedlings to be exposed to ambient and
elevated CO2 conditions were plated on 0.5X MS agar plates and glucose-grown samples
were plated on 0.5X MS agar plates containing 220mM glucose. Plants were grown at
ambient levels of CO2 for 6 days under continuous light of 200pmol photons nY2s-'.
Following the 6 day growth period, plants were then transferred to the dark for 3 days
followed by exposure to 200 pmol photons rn'*s" light under either elevated or ambient
COz conditions for 10 hours. Al1 glucose plates were exposed to ambient CO2 conditions.
Dark-grown sarnples were extracted by plunging aiuminium foi1 covered plates in liquid
nitrogen and removing the plant tissue after this flashfreezing process. RNA was
extracted frorn leaf rnaterial grown under al1 conditions using a hot phenol method 22.
Northern Analyses
Formaldehyde gels were used to separate total mRNAs using standard protocols 20. 10-
15pg of total RNA was separated in 2.2M formaldehyde, 1.2% agarose gels in 0.02M
MOPS buffer (pH 7). RNA was transferred to nytran membranes (Schleicher and Schuell)
in 20X SSC using capillary action after sozking the gel in DEPC treated water for 30
minutes. Blots were probed with radiolabelled DNA hybridized in a 10% dextran
sulphate solution (10% dextran sulphate, 1% SDS. 100pg/ml denatured sheared calf
thymus DNA, 1M NaCl). Washes were done under stringent conditions as per standard
protocols.
Cloning of Plant DNA Flanking the T-DNA Insertion Element
DNA extraction and southem anal ysis was performed as described earlier. H ybridizations
and washings were carried out under high stringency conditions at 65 OC and 60 OC
respectively. Hybridization was performed using RB (right border) sequences of the T-
DNA insert (pJJ1104, vector pSP64, ampicillin selection: 50pg/ml. fragment size: 1. lkb
ClaYPvuU. ABRC) was analyzed by southern anaiysis probing with the right border RB
sequences.
To clone insertion junctions between the T-DNA and genomic DNA from c n r 1-1, a
library of cnr 1 - 1 was made in bacteriophage lambda (Stratagene). 2 mg of cnr 1- 1
genomic DNA was digested to completion using Eco RI and the extent of digestion was
monitored by electrophoresis. The DNA was then size fractionated using a Prep Ce11
(Pharmacia), over a 13 cm 1 % agarose gel in OSX TBE at 150 volts. Two dye markers
were used to follow fractionation, xylene cyanol and bromophenol blue. Following the
elution of the xylene cyanol, 500 pl fractions were collected in a microcentrifuge tube at 5
minute intervals over a 6 hour period. Every fraction was precipitated with ethanol as
previously described and every fifth fraction was resuspended in 20 pl of H20. 5 pl of
each of these fractions were then separated on a 1% agarose gel, transferred to Nytran
membranes and subjected to southern analysis using the right border sequence.
Enrichment of the desired fragment was observed in fractions 40-45.
Fraction 45 contained approximately 200 ng/p1 of DNA and 2p1 of this fraction was
ligated to Eco RI adaptors 1 pg of Eco RI digested, calf alkaline phosphatased lambda
arm DNA (Stratagene) in a total volume of 5 pl. 1 pl of this reaction was then run on a
gel to confirm ligation. 2 pl of this reaction was then packaged using Gigapack gold
extracts as per the manufacturers instructions (Stratagene). The titre of the library was
determined as per the manufacturers instructions and found to be approximately 150 000
pfdml. 100 000 phage were infected into XL Blue MRF' and plated ont0 12 LB 150 mm
agar plates. Phage li fts were performed using nitrocellulose filters (45pm Millipore h c . )
23. These filters were probed using RB sequence and 5 positive plaqu- PS were identified.
These plaques were then cored. titred and plated and retested through secondary and
tertiary screening.
The pBluescript plasmid was excised in-vivo from phages by infection of XL-Blue
MRF' and SOLR strains (Stratagene) and the resulting plasmids were characterized
further by restriction analysis and southern hybidization using the right border sequence
as the probe.
Complementation with Wild type Gene and Promoter
A full-length genomic sequence was obtained by screening the CD44 1 cosmid library
from the Arabidopsis Stock Centre (The library contains 10 equivalents of wild type
DNA from the Ws ecotype). 8 L individual chapten of a genomic library. each containing
500 cosmid clones of approximately 25 kb each were screened. The vector pOCA 18 used
in this library contains a hygromycin resistance cassette; thus. mutants from the
kanamycin resistant T-DNA mutagenized lines can be complemented and selected on
hygromycin using these contructs. DNA was extracted from the 8 1 individual chapters
using an alkaline lysis method 20 and these individual chapters were screened using PCR
methods. The îirst round of screening entailed amplifying the 5' UTR. exon 1 and part of
exon 2 of the RLK from the DNA preparations using 2LRR 79416
(TTCGATTTACTGTACTT'ATCTTCTCC) and 2LRR 78489
(CTAACTTCCCTCCTATCTTTATATATCC). If the chapter arnplified this region of the
gene, the E.coli stocks of the chapter were plated on LB agar and screened using a
radiolabelled probe from 3-la. Al1 positive clones were subjected to a PCR reaction to
amplify the full-length gene of 9.097kb using the LRR 79416
(TTCGATTTACTGTACTTATCTTCTCC) and LRR 703 19
(AAGTTATCCTAAAACAGAGGAAAACC) primers. The reaction was carried out
using elongase (Pharmacia) at a ~ g ~ ' concentration of 1.8 rnM at 60°C annealing
temperature. an extension temperature 68OC and tirne of 7 minutes. Two cosmid clones
were isolated where the predicted 9 kb PCR product was amplified. These clones were
transformed into Agrobacteriurn tuniifaciens competent cells and transformed into the
mutant cnr 1- 124. The seed from these transformants were selected on MS hygromycin
plates. and these resistant plants were allowed to set seed 25.
Results
Figure 3.1. shows 14 day-old wild type Arabidopsis and homozygous cnr 1-1 on M S
media grown continuously under arnbient COz conditions (plate on the left) and plants
grown under ambient conditions for 10 days and then transferred to a 3000 ppm COz
enriched environment for 4 days (plate on the right). The wild type Arabidopsis plants
grown under enriched COz conditions show a pronounced anthocyanin accumulation in
cornparison to the cnr 1-1 plants. The elevated COz grown wild type Arabidopsis plants
are also generally smaller and also have shorter petioles than the cnr 1-1 plants. As CO2
responsive mutants could potentially be sugar responsive mutants, the response of cnr 1- 1
and wild type plants to MS media containing high concentrations of sugar was tested.
Figure 3.2. shows the growth of wild type Arabidopsis and cnr 1- 1 plants grown on MS
media with and without 5% glucose. cnr 1-1 displays slightly more root growth than wild
type on MS media without glucose; however on 5% glucose, the root growth of cnr 1-1 is
alrnost 1.5 to 2 times the wild type plant root length. The leaf phcnotypes of the mutant
and the wild type are also different. When grown on 5% glucose, the mutant is less
stunted and also displays much less anthocyanin than the wild type plant.
To detemine if a T-DNA insertion was linked to the CO2 insensitive phenotype of crtr 1-
1, a cosegregation experiment using seed (F3 seed) from 80 CO2 insensitive F2 plants and
20 COî sensitive F2 plants was performed. The 80 F2 plants, which showed a COz non-
responsive phenotype and the 20 plants which exhibited a COz sensitive phenotype were
potted and allowed to set seed. These F3 seed were tested for kanamycin resistance. Al1
80 plants selected as CO2 non-responsive plants segregated kanamycin resistant plants
whereas al1 20 COz sensitive plants were kanamycin sensitive. This suggests that the
lesion causing the COz insensitivity is within 1 map unit of the T-DNA insertion element.
AMBIENT CO,
CONDITIONS
3000 ppm CO2
CONDITIONS
WT cnr 1-1 WT cnr 1-1
Figure 3.1. Pheiiotypes of 14 day old wild type Arubidoysis aiid mutant crtr 1 - 1 grown on MS
growth media on plates. The plate on the lefi was grown under ambient CO, conditions for 1 1 days
the plate on the right was grown under ambient CO, conditions for 10 days and then transferred to
elrvated CO, conditions for 4 days. Continuous light conditions above 200 pmol m-*sa' were used for
both plates. Wild type Arnbidopsis is s h o w on the lefl of each plate and cnr 1-1 is s h o w on the
right of each plate.
Figure 3.2. Root growth phcnotypes of cnr 1 - I and wild type Arabidopsis. 14 day old cnr 1 - 1 (left) and wild type (right) grown on A-Murishige Skoog (MS) solid media and B.Plants grown on MS supplernented with 5% glucose.
As the CO2 non-responsive phenotype was segregating with the kanamycin marker and
the Southem analysis of the mutant DNA using the right border fragment as a probe
showed a single band for both the Eco RI and Hindm digested cnr 1-1 DNA (Figure
3.3.), the plant DNA flanking the T-DNA insert was cloned. Cloning and sequencing of
plant DNA flanking the right border indicated that the insert was positioned on
chromosome IV and was 200 bp upstream of the start codon of a Leucine Rich Repeat
(LRR) containing Receptor-Like Kinase (RLK). Sequence analysis of this ORF revealed a
protein structure sirnilar to RPPS (resistance to Peronospora pnrasitica), RPP 1
(resistance to Peronospora parasitica), the N gene product (resistance to tobacco mosaic
virus) and the L6 flax resistance gene (resistance to Melamspora fini) (Figure 3.4.-
sequence al ignment). Al1 of these receptor like kinases contain a -11-bterleukin receptor
region (TIR), a nucleotide binding site and a leucine rich repeat region. In order to verify
the position and identity of insert and the gene downstream of the insert a southern using
wild type Arubidopsis ecotype Columbia, ecotype Wassilewskija (WS) and cnr 1 - 1 DNA
was performed (Figure 3.5). A PCR derived fragment spanning the promoter of the RLK
dl4480 was used a probe (Forward primer- CGTACCTGCTTGAGTGCAGG, Reverse
primer- GCCATGGTAGCAGTGATGCA). The Pst 1 digests of the Columbia.
Wassilewskija and cnr 1-1 DNA clearly shows the insertion element is in the promoter
region of the gene designated as d14480c (accession # CAB 10466, g2245047).
Figure 3.4. Sequence alignment of CNR 1 (A. thaliana), RPP5 (A. thaliana), RPP 1 (A. thaliana),
N (N. tabacum) and L6 (Flax). Al1 these genes contain a regions similar to i) the 1011-lnterleukin
Receptor (TIR), ii) a Nucleotide Binding Site (NBS) iii) a kinase-2 motif (LVVLDD) and iv) a - Leucine Rich &peat Begion(LRR). -
The TIR region is underlined in teal. The NBS (GPSGIGKS) is underlined in red, the region
around the NBS, which is similar to ATPase regions is underl ined in yellow . The kinase-2 motif is underlined in black. The LRR region is underlined in blue.
521 y0 540 550 560 570 580 590 600 610 520 630 640 650 I + + * +--l ~ - - - - C V r n V O I C S U R I T P 0 6 0 a r m L m G I E I I R R K U a i I P - o C I E O R ~ O - T L - R K 7 V L ( i I R F C - T ~ P l D E K Ç F ~ m s Y T - W 9 v n P P m W - - - U m # E K I R I T W r m D H U E # c a a O l W Y S K I i W P - B ( R o R ~ o I R E V L m ( T t - m U ~ ~ ~ O I L ~ + 1 1 ) Ç D G t n w s W F P R I W K R M m O i ~ H Y U l l f f U % E G E ~ O r m L ~ G R E T ~ W i a m I ~ a D I L - # Ç I O E I E L I ( I ~ ~ H E R L Q O U C H S P E ~ H I ~ O W ç L V F I ~ ~ Q K D P - - - t E R S R U L i I Q M V I n W W C C ~ - S S r S S n f f HlllllFRPW m c ~ ~ q v c m n ~ R a U R E I V R R E r m L P - u c R s I w s R E - - - - - Q U 6 Y K I E n [ . ~ ~ K .dc,,~-,.gl,-U~s~!,..,-.a.,~.diiGrsivr,,,v.,.,.k~lu.sa@.,wl,n,t~~s~~~~sf~~.,..,.,,..I.C,-,-C.n-..lr.l-...-,-.1,...,,1,-..-
651 660 670 680 690 700 710 720 730 740 750 760 770 780 I + + c-l ~ l r i i . P r p l m ~ a I W C a S # ~ - u ~ w x t ç u o R I w n H B ç I m ~ s m g l s a E E U L s o c R s L # K R L ~ V n ~ E . i Q r O m Q R G S U Q # O L m 5 1 1 # K E I H l l ~ ~ ~ Q W l C U i G L U O L ~ E ô I I C W L E . 1 L S V Q S U S Ç W C K ~ C L P S m Q E F L v n ~ O J Q U 0 6 m Q - R I 1 # m L S r S S n # L P T S I R T # E E U L - Y u P ç S m Q T - N ~ Ç F P S r r a K K V I 1 a A W P R U ~ # L P S L R R I D L Ç I ( # L I 1 T R ~ ~ ~ - I & U ~ ~ K I I V f l M S H I 7 ~ - R L ~ Ç L ~ Ç D U B P K S I E V L S N T f l 1 E -- , l r , ~ ~ ~ ~ . ~ ~ ~ ~ . ~ ~ ~ X ~ ~ k ~ L ! ~ l ~ S , ~ ~ l ~ ~ ~ l U ~ ~ ~ h S ~ ~ S ~ ~ ~ d S ~ ~ s , o l ~ ~ ~ p ~ ~ . ~ ~ ~ n L a ~ ~ d ~ , ~ ~ l v ~ ~ ~ ~ ~ i ~ ~ ~ ~ ~ ~ ~ ~ . ~ ~ ~ ~ ~ ~ ~ . ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~ ~
7 8 l 7 9 0 800 B10 820 83û 840 850 860 870 880 890 900 910 I 7 +-I
Y n S S S I ~ T l P U F P T H ~ G T ~ I W F P R K U ( S V U I T ~ ~ C P U ~ R L ~ V E L I I E I Ç E L O ~ ~ C O G T O Ç L ~ S U Q I ( I ( L R ~ S L ~ G C V ~ W L P S S I W T K L ~ ~ O I ~ E C E ~ ~ ~ S F P T W N U ( Ç L E ~ Z D D ~ Q I I l 1 L q G C ç ç L V a P S - F C I l R T K L E I L ~ R 9 E # P P S l ~ m s
~ G C C S K V I 6 C Y L M R X ç u B F p - C V M I E ~ E Y L G - -VDX iiEUCIQWnVLKFCPIMÇ66TFG)(U(BRaCLEFm6TllREV ------~--------~~---~----~.i-~-------------~--~--.i-----------------~--~------------d------l-Ll---f-t--K--~~----~-L*-~~*--N---~--~-
911 320 930 WO 950 960 970 380 390 Zoo0 IO10 1020 1030 1040
1171 l l û û 1190 1200 1210 1220 1230 1240 1250 1260 1270 1280 12W 1300 I - -+--- *--------*-- Y I
An expected 4.OKb fragment was observed in the cnr 1-1 Pst digest and an expected
963bp fragment was observed for both wild type Columbia and WS genome.
As the insertion element was 200bp upstream of the CNRl start codon, it was not clear
how the gene expression was modified by the insertion. Northern analysis comparing
wild type and crzr 1-1 RNA extracted from tissue grown under various conditions was
performed (Figure 3.6.). and expression of the RLK in cnr 1- 1 appears to be modified by
the insertion when compared with the wild type in that expression of the CNRl does not
appear to be regulated by CO2 or glucose. The data show that the steady-state level of
CNRl transcripts is down-regulated by COz and glucose in the wild type background. in
the crzr 1-1 mutant background the levels of CNRl transcripts are not notably
downregulated.
The impact of the crzr 1-1 lesion on the foliar carbohydrate levels was determined.
Carbohydrate content was measured in 10 day-old seedlings grown on MS agar under
ambient conditions and in 10 day-old seedlings grown under ambient CO2 conditions for
6 days and then transferred to elevated CO2 (3000ppm) for 4 days (the data from these
plants are labeled CO2 in Figure 3.7.). A cornparison of foliar soluble sugars levels in the
mutant and wild type plants did not show significant differences under arnbient and
elevated CO2 conditions. In contrat, foliar starch levels in the mutant were significantly
lower than in wild type in high CO2 conditions. Given the large starch component, total
non-structural carbohydrates for cnr 1-1 were lower than wild type for tissue exposed to
elevated CO2 conditions. Mean total chlorophyll and mean total anthocyanin (see Figure
cnr 1-1 4- 4.0K.B
PROBE
Arabidopsis wild type
Figure 3.5. A. Southem blot of Arabidopsis ecotype Coli umbia (lanes 1 and 4), WS (lanes 2 and 5) and cnr 1 - 1 (lanes 3 and 6)
+- 562 BP probed with a fragment of CNRl spanning the region shown in B. In A lanes 1-3 were cut with Barn HI, lanes 4-6 were cut with Pst 1, B shows the expected restriction enzyme site map of this region for both wild type Columbia and cnr 1 - 1 .
28s rDNA
a O 0, CNRl Exon 112
WILD TYPE
1 2 3 4 5
cnr 1-1
1 2 3 4 5
1) 112 MS dark
2) 112 MS glucose dark
4) 112 MS CO, light
5) 112 MS glucose light
3) 1/2 MS air light
Figure 3.6. Northem analyses of wild type Arabidopsis and cnr 1-1 RNA hybridized with a 28s rDNA probe and a CNRl probe
consisting of the 5' UTR exon 1 and part of exon 2 (a relatively non-conserved region between this family of leucine rich repeat RLKs).
When the northem blot was hybridized with the CNRl exonll2 probe a major band was seen between 3.0 and 3.2 Kb. Other signals were
seen, however none of them were as strong as the signal seen at approximately 3.0 Kb. Al1 RNA was from 10 day old seedlings grown
under continuous light for 6 days and then placed in the dark for 4 days. The seedlings were then placed in the light for 4 hours under
ambient or enriched CO, (3000pprn) conditions. Afier this 4 hour period tissue was harvested and RNA was extracted.
3.8.) were measured for tissue subjected to the sarne conditions as the carbohydrate
samples. Chlorophyll levels for the mutant and wild type plants were similar under both
ambient and elevated CO2 conditions. Mean total anthocyanin levels were somewhat
higher for the cnr 1-1 than in wild type plants in ambient CO2 conditions, but cnr 1- 1
anthocyanin levels are significantly lower than wild type in elevated COz.
Nuclear genes coding for proteins involved in photosynthesis such as chlorophll a/b
binding protein (CAB), Rubisco and carbonic anhydrase (CA 1 - chloroplastic isoform) are
normally down regulated in wild type Arabidopsis under elevated CO2 conditions and on
high glucose media (220rnM glucose). This phenornenon is observed for wild type plants
but not for m r 1-1 plants (Figure 3.9.). Unlike wild type plants the photosynthetic genes
CAB, RbcS or CA1 are not down-regulated in cnr 1-1. The pattern of ADP-glucose
pyrophosphorylase expression is somewhat different when wild type and cnr 1-1 are
compared.
CARBOHYDRATE ANALYSIS
TOTAL FOL- SOLUBLE SUCAR CONTENT
Genotype
FOUIR TOTAL NONSTRUCTURAL CAROOHYDRATE
WS WT cnrl-1 GENOTYPE
TOTAL FOLlAR STARCH LL
WS WT cnrl-i GENOTYPE
Figure 3.7. Total foliar sugar, starch and non-structural carbohydrate measured in 10 day old foliar tissue grown on MS media. Tissue samples were taken fiom plants grown continuously in ambient CO, conditions (data is marked as air) and fiom seedlings grown under ambient conditions for 6 days and then transferred to 3000 ppm CO, for 4 days (data is marked as CO,). At least three replicates were performed for each data set, and the amount of carbohydrate is expressed as pg of hexose per mg of dry weight (DW) . Error bars +/- SE.
PIGMENT ANALYSIS of WILD TYPE and cnr 1-1
Total Chlorophyll
T
--- !e AIR C02'
cnr 1-1
Mean Total Anthocyanins
cnr 1-1
.I AIR CO2
Figure 3.8. Pigment analysis of 10 day old plants grown on MS media. Pigments were measured in 10 day old foliar tissue grown on MS media. Tissue samples were taken from plants grown continuously in ambient CO, conditions (data is marked as air) and fiom plants grown under arnbient conditions for 6 days and then transferred to 3000 ppm CO2 for 4 days (data is marked as CO,). At least four replicates were performed for each data set. Error bars are +/- SE. FW(Fresh Weight).
Discussion
The inability of cnr 1 - 1 to modulate photosynthetic gene expression and the absence of
other characteristics of stress, when grown at high levels of CO2 or exogenous sugar,
certainly indicates a role for CNRl in carbon metabolism. The molecular identity of the
CNRl is in line with a role in signal transduction, as it most likely encodes a receptor-
like kinase (RLK). A number of different RLKs have been isolated from various screens,
from fields as diverse as development and plant pathology. The isolation of RLKs, such
as BR1 1 (dEassinosteroid insensitive 1) 26, CLVI ( w a t a 1-clv 1, a developmental
mutant with enlarged meristems, CLV 1- gene that regulates the size of shoot meristems)
27. WAKl (ce11 wall associated receptor kinase- involved in salicylic acid induced
defense responses) 28 suggest an important role for RLKs in many different pathways.
RLKs appear to utilize a method of signaling that has been conserved across species. That
is, molecular messages are relayed by reversibie protein phosphorylation. In animals, it
has been shown that these signal transduction phosphorylation cascades are initiated by
receptor protein kinases. So far the plant homologues of these animal receptor kinases
have not been definitively shown to be receptors and unlike many of the animal receptors,
ligands for these plant RLKs are not well known.
CNRl. isolated in this study is from the family of TIR RLKs ( m L L -bterleukin
Receptor like kinases). These TIR RLKs have been found in various organisms including -
Drosophila (Toll receptor) and mammals (Interleukin receptor) 29. in both Drosophila
and mamrnals. the components of these pathways play a role in both disease resistance
and development. Animals have general stress induced immune responses which activate
a non-specific inflammatory response. A sirnilar stress induced general response pathway
might be found in plants. It is very interesting that many of the interleukin type receptors
found in animals bind specific types of oligosaccharides 30. Recent evidence t h n the
interleukin -2 receptor and its carbohydrate binding capabiiities are involved in a forrn of
diabetes suggests a role for these receptors in sugar homeostasis in mammals 31. if these
types of receptors actually respond to carbohydrates and bind monosaccharides o r
oligosaccharides ligands. one couid propose that the large number of TIR type receptors
in animals and plants evolved from a primitive sugar-sensing receptor. It could be
postulated that divergence from this initial carbohydrate binding receptor gave rise to
specific interactions with more complex oligosaccharides: for example, highly antigenic
surface glycoproteins made by pathogens 32.
In plants, there are a number of these TIR RLKs including CNR 1. CNR 1 shows the sarne
general structure of the disease resistance genes such as the N-gene, L6, RPPS and RPP1.
Given the phenotypes of the c n r 1-1 plants under elevated COz, this newly isolated RLK
mriy function as COz or carbohydrate sensor; however, it is also possible that the gene is a
general stress response sensor which responds to changes in carbohydrate metabolism
within a cell. The fact that al1 the TIR RLKs, which are closely related to CNRl at the
amino acid level, are resistance-related-genes suggests that the protein might be involved
in initiating or signaling a general stress response. Some of the isolated resistance genes
appear to be non-specific with respect to pathogens 33, suggesting that this class of TIR
RLKs. such as the RPP8. respond to a perturbation in general metabolism. Carbohydrate
metabolism is a potential signal as most pathogens impact a host metabolism particularly
through rnobilization of available energy sources such as carbohydrates. Hence plants
having a general stress response mechanism which reacts to changes in carbohydrate
rnetabolism is a logical hypothesis.
A simple model in agreement with the data collected and explaining the possible action of
CNRl is shown in Figure 3.10. The ligand for the receptor is unknown; however, given
the phenotype of the mutant cnr 1-1 when exposed to high concentrations of CO2 and
sugar, the simplest explanation for the phenotype wouId be to invoke COz or sugars as
potential ligands. The ligand in the model would bind to the receptor only if the
concentration of that ligand was above a threshold concentration. When the concentration
of CO? or carbohydrates is high, CNRl may mediate a signal to export carbohydrates
from tissue. A feüsible mode of action for CNRl rnay be to enhance the sink capacity of
the plant in the presence of high carbohydrate levels, consequently providing more
carbohydrate to growing meristems or storage in tissue other than the leaves. In addition
to enhancing sink capacity, CNRl could affect photosynthetic gene regulation by
negatively down-regulüting photosynthetic gene expression; however, a more likely
scenario is that the presence of high concentrations of sugars down-regulates
photosynthetic genes through some other means. When grown in ambient levels of CO2
or on media without exogenous glucose, C N R l would not initiate export of carbohydrate
because intracellular carbon pools are beiow threshold levels. Consequently
photosynthetic gene and CNRl gene expression are also not be down regulated under
these conditions.
WSSlBLE MODEL TO DESCRlBE ROLE OF CNRi ACTION IN THE iWOTOSYNTHFiIC CELL
WILD TYPE FUNCTION
HICH CO,
Figure 3.10. A model invoked to explain the action of CNR given the data presented in
this chapter. The arrow without the negative sign represents ligand Ireceptor binding and
the line with the negative sign represents a regulatory effect.
From preliminary northern analysis (Figure 3.6.) of wild type plants under glucose and
elevated COz conditions, CNR 1 is not expressed. Whereas in the mutant cnr 1 - 1, the gene
is expressed under these conditions, so the expression of the gene is affected by the
insertion of the T-DNA. Using these data we can apply the model described above for
wild type to the mutant. If CNRl provides the signal for unloading carbohydrates at high
concentrations of COz or sugars, the mutant will exhibit a higher expon capacity under
these conditions. This may explain the low foliar starch content in cnr 1- 1 compared with
wild type plants under high COz conditions. Growth of the cnr 1-1 mutant on 5% glucose
concentrations also supports this hypothesis; in Figure 3.2. the mutant has longer roots
compared to wild type. Photosynthetic and CNRl gene expression are both down
regulated under high sugar and COz conditions. It seems logical that this down regulation
would occur concomitantly because the down-regulation of photosynthetic gene
expression would eventually result in reduced carbon fixation. and, if the plant is
expressing CNRI, this would result in export of foliar carbohydrate despite reduced
carbon fixation rates. The model accounts for the data presented and can be tested by
comparing the carbohydrate content of phloem exudates from wild type plants and cnr 1-
1. If the hypothesis is true, the carbohydrate content of the phloem exudate from the
mutant cnr 1-1 would be higher than that of wild type plants. Other experiments, which
could potentially provide important evidence supporting this model are discussed in
Chapter 5.
References
1. Drake, B. G., Gonzalez-Meler, M.A., Long, S. More Efficient Plants: A
consequence of rising atmospheric C02. Ann. Rev. Plant Physiol. Plant Mol. Biol. 48.
609-639 ( 1997).
2. Moore, B. D., Cheng, S.W., Sirns, D., and Seemann, J.R. The biochemical and
molecular basis for photosynthetic acclimation to elevated atmospheric COZ Plant Ce11
and Environment 22, 567-582 ( 1999).
3. Huber. S. C., Rogers M. and lsrael D.W. Effects of CO? enrichment on
photosynthetic rate and photosynthetic partitioning in soybean (Glycine m m ) leaves.
Physiologia Plan tarunr 6 2 - 9 5 1 O 1 ( 1984).
4. Sage, R. F.. Sharkey T.D.. Seemann. J.R. Acclimation of photosynthesis to
elevated CO2 in five C3 species. Plant Physiol. 89.590-596 (1989).
5. Stitt, M. Rising CO;! levels and their potential significance for carbon flow in
photosynthetic cells. Plnnr Cell and the Environnzerzt 14, 74 1-762 ( 199 1 ).
6. Van Oosten. J. J., Wilkins D. and Besford, T. Regulation of the expression of
photosynthetic nuclear genes by high CO2 is mimicked by carbohydrates: a mechanism
for the acclimation of photosynthesis to high C02. Plant, Ce11 and environrnent 17,9 13-
23 (1994).
7. Cheng, S. H., Moore, B. & Seernann, J. R. Effects of short- and long-term
elevated COz on the expression of Ribulose- 1 -5-bisphosphate carboxylase/oxygenase
genes and carbohydrate accumulation in leaves of Arabidopsis thaliana (L.) Heynh. Plant
Physiol l l 6 , 7 15-23 ( 1998).
8. Majeau, N., Coleman J.R. Effects of CO2 concentration on carbonic anhydrase
and ribulose 1.5- bisphosphate carboxylase/ oxygenase expression in pea. Plant
Physiology 112,569-574 ( 1996).
9. Sheen, J., Zhou. L. & Jang, J. C. Sugars as signaling molecules. Curr Opin Plant
Bi01 2,4 10-8 (1999).
IO. Jang, J. C., Leon, P.. Zhou, L. & Sheen, J. Hexokinase as a sugar sensor in higher
plants. Plant Ce11 9.5- 19 ( 1997).
1 1. Hellrnann. H., Funck, D., Rentsch, D. & Frommer, W. B. Hypersensitivity of an
Arabidopsis sugar signaling mutant toward exogenous proline application. Plant Physiol
122,357-68 (2000).
12. Dijkwel, P. P., Huijser, C., Weisbeek, P. J., Chua, N. H. & Srneekens. S. C.
Sucrose control of phytochrome A signaling in Arabidopsis. Plant Ce11 9,583-95 (1997).
13. Martin, T., Hellrnann, H., Schmidt, R., Willmitzer, L. & Frommer, W. B.
Identification of mutants in rnetabolically regulated gene expression. Plant J 11. 53-62
( 1997).
14. Zhou, L., Jang, J. C., Jones, T. L. & Sheen, J. Glucose and ethylene signal
transduction crosstalk revealed by an Arabidopsis glucose-insensitive mutant. Proc Nat1
Acad Sci U S A 95, 10294-9 ( 1998).
15. FeIdmann, K. A. T-DNA insertion mutagenesis in Arabidopsis: Mutational
Spectmm. Plant Journal 1,7 1-82 (199 1).
16. Edelmann, M., Hallick, R.B., and Chua, N.-H. (ed.) Methods in Chloroplast
Molecular Biology (Elsevier Biomedical Press, New York, 1982).
17. Weyrauch, D. A. Biotechnology and Bioengineering 22,337-352 (1980).
18. Tissue, D. T., Wright, S.J. Effect of seasonal water availability on phenology and
the annual shoot carbohydrate cycle of tropical forest shmbs. Fuctional Ecology 9. 5 1 8-
527 ( 1995).
19. Stewart, C. N., Jr. & Via, L. E. A rapid CTAB DNA isolation technique useful for
RAPD fingerprinting and other PCR applications. Biotechnigues 14,748-50 ( 1993).
20. Sambrook, J., Fritsch, E.F., and Maniatis, T. Molecular Cloning: A Laboratory
Manual (Cold Spring Harbour Laboratory Press. Cold Spring Harbour, 1989).
21. Feinberg, A. P. & Vogelstein, B. "A technique for radiolabeling DNA restriction
endonuclease fragments to high specific activity". Anal Biochem 137, 266-7 ( 1984).
22. Verwoerd, T. C., Dekker. B. M. & Hoekema, A. A small-scale procedure for the
rapid isolation of plant RNAs. Nucleic Acids Res 17, 2362 (1989).
23. Singh, H., LeBowitz, J.H., Baldwin, A.S. Jr., and Sharp, P.A. Molecular cloning
of an enhancer binding protein: Isolation by screening of an expression library with a
recognition site DNA. Ce11 52,4 15 ( 1988).
24. Simoens, C., Alliotte, T., Mendel, R., Muller, A., Schiemann, J., Van
Lijsebettens, M.. Schell, J., Van Montagu, M., inze. D. A binary vector for transferring
genomic libraries to plants. Nucleic Acids Research 14,8073-8090 (1986).
25. Schultz, B., Bennet, M.J., Dilkes, B.P., and Feldmann K.A. T-DNA tagging in
Arubidopsis thaliana: cloning b y gene disruption (, 1994).
26. Li, J. & Chory, J. A putative leucine-rich repeat receptor kinase involved in
brassinosteroid signal transduction. Ce11 90.929-38 ( 1997).
27. Clark, S. E., Jacobsen, S. E., Levin, J. 2. & Meyerowitz, E. M. The CLAVATA
and SHOOT MERISTEMLESS loci competitively regulate meristem activity in
Arabidopsis. Development 122, 1567-75 ( 1996).
28. He, Z. H., Cheeseman, I., He, D. & Kohorn, B. D. A cluster of five ce11 wdl-
associated receptor kinase genes, Wükl-5, are expressed in specific organs of
Arabidopsis. Plant Mol Bi01 39, 1 189-96 (1999).
29. Dinesh-Kumar, S. P. & Baker, B. J. Alternatively spliced N resistance gene
transcripts: their possible role in tobacco mosaic virus resistance. Proc Nat1 Acad Sci U S
A 97, 1908- 13 (2000).
30. Tandai-Hiruma, M., Endo, T. & Kobata, A. Detection of novel carbohydrate
binding activity of interleukin- 1. J Bioi Clzem 274,4459-66 ( 1999).
3 1. Podolin, P. L. et al. Differential glycosylation of interleukin 2. the molecular basis
for the NOD Idd3 type 1 diabetes gene? Cytokine 12,477-82 (2000).
32. Sherblom, A. P., Sathyamoorthy, N., Decker, J . M. & Muchmore, A. V. IL-2, a
lectin with specificity for high mannose glycopeptides. J Immunoi 143,939-44 (1989).
33. Cooley, M. B., Pathirana, S., Wu, H. J., Kachroo, P. & Kiessig, D. F. Members of
the Arabidopsis HRTRPP8 family of resistance genes confer resistance to both viral and
oomycete pathogens. Plant CeLl12,663-76 (2000).
Chapter 4
A Cytochrome P450 CYP 78A6 Affecting the Photosynthetic Response to Elevated
CO*.
Abstract
A COz con-~sponsive Arnbidopsis mutant. crir 2-1 was isolated using a screen
performed under enriched CO2 conditions from T-DNA mutagenized populations. This
mutant showed an aberrant response to elevated CO2 conditions compared to Arabidopsis
wildtype plants grown under similar conditions. Some of the characteristic traits
observed in the wildtype sensitive response includes anthocyanin accumulation. stunted
growth, and curling leaves. None of these stress phenotypes are observed in the mutant.
The molecular, physiologicai and biochcmical characterization of the mutant has been
performed. The mutant allele is recessive and cosegregates with a kanamycin marker in
this T-DNA mutagenized line. Characterization of the T-DNA insertion site indicates
that the expression of a P450 dependent monooxygenase has k e n altered. Dehydration
studies show that stomates of this mutant are less open than wildtype stomates. The
reduced stornatal aperture is thought to result in the decreased assimilation of carbon.
This defect in modulating stomatal aperture has been correlated with increased
concentrations of abscisic acid found in foliar tissue. These increased levels of abscisic
acid suggest that CNR2, a P450 dependent monooxygenase is likely the abscisic acid 8'-
hydroxylase which catalyzes the first step in the oxidative degradation of (+) AB A. This
proposition is further supported by the germination behavior of cnr 2-1 mutant seed
grown on abscisic acid containing media. cnr 2-1 is hyperdormant in the absence of
chilling and supersensitive to exogenous abscisic acid concentrations of 0.3rnM.
Introduction
As atmospheric CO2 levels continue to increase as the result of fossil fuel utilization,
there is considerable interest in the impact that these increases will have on such
processes as plant productivity, plant species distribution, and even the prirnary CO2
consuming process. photosynthesis. Although plants have experienced significantly
higher CO2 concentrations over the past many millenia than the present levels, their
recent evolutionary history during the past 150.000 years has been chmcterized by
relatively low CO2 concentrations, ranging from approximately 270 ppm from 100 to
12,000 years to a low of 180 ppm during peük glaciation periods of 2 1,000 to 150,000
years ago I . As such, plants may be genetically adapted to much lower COZ
concentrations than that occurring now, but the pace of the atrnospheric COz increase to
anticipated IeveIs of 700 ppm by mid century is unprecedented.
Many studies have examined the impact of elevated CO7 concentrations on
phocosynthesis of C3 plants 2% 3. For a nurnber of species. the immediate increase in the
rate of CO2 assimilation engendered by increased external CO2 Ievels is followed by
decline in photosynthetic capacity after prolonged exposure to these same conditions.
This acclirnation response has been correlated with increases in foliar non-structural
carbohydrates, such as hexoses, sucrose, and starch, and is also accompanied by a decline
in Rubisco protein levels, transcript abundance for both rbcS and rbcL. as well as a
number of other transcripts of proteins required for photosynthesis including chlorophyll
a h binding proteins, carbonic anhydrase, and Rubisco activase 45- 6 . The role that
carbohydrates play in the acclimation response is still a matter of debate. Although it is
possible to mimic the high COz acclimation response by the addition of exogenous sugars
4, the specific mechanism(s) by which the plants perceives elevated carbohydrate levels,
o r perhaps even CO2, and then initiate a response through signaling pathways are
unknown. Certainly there is considerable evidence to show that increased hexose levels
can repress transcription of a nurnber of photosynthetic genes 7. 8, and there is evidence
to suggest that the enzyme hexokinase may play a role in sensing foljar hexose
concentrations 9. However. no single complete pathway has been identified, and there is
considerable evidence to suggest that multiple carbohydrate sensing pathways exist in
plants 10. 1 1. 12-
As a means of identifying elements responsible for sensing elevated CO2 levels and
initiating a response. a genetic screen was conducted using the srnall crucifer Arnbidupsis
tltaliana mutagenized by random insertion of T-DNA sequences. As described
previously (Chapter 2). 14 day old ambient CO2 grown plants were screened for their
ability to respond differently than wildtype plants when exposed to 3000 ppm CO? for
four days. Two broad categories of mutants were identified; plants that performed better
than wildtype plants at high levels of CO2 and were described as O z non-osponsive
(cnr); and mutants which were affected more than wildtype plants by exposure to high
levels of CO2. These mutants were categorized as w2 hyper-osponsive (clrr). In this
chapter. the isolation and characterization of the COz non-responsive mutant. cnr 2- 1, is
descri bed.
Materials and Methods
Plant Material
Wildtype (Wassilewskija -WS ecotype) and T-DNA mutagenized Arabidopsis thaliana
seed were obtained from the Arabidopsis Biological resource center (ABRC, Ohio State
University: stock numbers CS2606-2654). The T-DNA seed collection screened was
comprised of 49 pools of 1200 fourth generation offspring derived from 100 mutagenized
parents.
Growth conditions
Seeds were surface sterilized with bleach ( 10% v/v), rinsed thoroughly and imbibed for 3-
5 days at 4 ' ~ prior to sowing in pots containing Pro-Mix or on 0.8% agar supplemented
with MS Basal salts (Sigma) buffered at to pH of 5.6 with 50 rnM MES (Sigma) under
sterile conditions. Al1 plants were grown at 21' C under continuous illumination of
200pmol m - ' ~ ' PAR or with a 14 h day/lO h night photoperiod where required. The Pro-
Mix grown plants were fertilized with 20:20:20 nutrient solution once a week. Plants in
pots or on plates were grown in a chamber equipped with an infra-red gas analyser
(Horiba) regulator which continuously monitored and maintained the appropriate COz
concentration. Al1 molecular and physiological experiments were conducted with plants
grown at either ambient (370 ppm) or elevated COz concentrations (1000ppm) as
required.
Genetic Screen
Mutant seed was surface sterilized and imbibed at 4 ' ~ for 4 days, and plates were then
transferred to ambient conditions for 14 days. After 14 days of growth under ambient
conditions. unhealthy plants were removed from the plates, and the plates were then
transferred to elevated CO2 conditions for 4 days. The mutant plants were then screened
for phenotypes aberrant to wildtype.
Genetic Analysis
Mutants were backcrossed to wildtype to remove background mutations and to perform
segregation analysis. The high COt phenotype of the FI progeny was exarnined for al1
seed from 5 different crosses. Phenotype was analyzed again for the F2 progeny for lack
of high COz sensitivity, i.e. increased anthocyanin, curling of leaves and necrosis.
Kanamycin Segregation Experiments
To test for linkage of the high COÎ insensitive mutation in line 87#7 with a T-DNA
insertion, a cosegregation experiment using F3 progeny was undertaken. F2 seed from
mutants backcrossed to wildtype were plated and randomly selected and grown in soil.
The F3 seed were harvested from each F2 parent separately and dried for two weeks.
After drying, approximately 40 seed from each F3 parent was tested for kanamycin
resistance and high CO2 insensitivity. F2 genotypes were inferred from mutant
phenotypes based on the ratio of wildtype to mutant seed in each F3 pool tested. CO2
sensitivity was tested in the same manner as the initial screen and kanamycin sensitivity
was measured ten days post-imbibition.
Dormancy experiments
Dormancy was measured by monitoring germination changes as induced by chilling,
(germination was scored by the presence of a radicle). Seed was plated on MS plates and
individual plates were chilled for 1 day. 2 days and 3 days at 4'C. Radicle emergence was
scored at 24 hour intervals over a 5 day period.
Nucleic Acid Analysis
DNA was isolated from leaf tissue using a method described by Stewart 13. Tissue was
ground to a powder with Iiquid nitrogen in a mortar and pestle. The powder was
tranferred to a centrifuge tube and lm1 of 2X CTAB buffer (2% CTAB w/v, lOOmM Tris-
HCI pH 8. 20mM EDTA pH 8. 1.6M NaCl. 1% PVP MW 40000. pre-warmed to 6 5 ' ~ )
was added per gram of fresh weight. 1.5 ml1 g FW chloroform: isoamyl alcohol (24: 1)
was added and mixed thoroughly to form an emulsion. The emulsion was then
centrifuged at 10 OOOg for IOmin. The upper phase was transferred to a new tube and 1/10
the volume of a 10% CTAB buffer (lO%CTAB wlv, 0.7M NaCl p r e - w m e d to 6 5 ' ~ )
was added and mixed well, the chloroform extraction step was then repeated and after
centrifugation the supernatant was transferred to a new tube, to which 1 volume of CTAB
precipitation buffer ( 1 % CTAB, 50mM Tris-HCI pH 8, lOmM EDTA pH 8) was added.
This mixture was allowed to stand overnight at 4OC. The following day the DNA was
collected by centrifugation and the DNA pellet was resupended in high salt TE and an
appropriatc amount of RNAse was added to a final concentration of 100pg/ml. This was
incu bated for 1-2 hours at 3 7 ' ~ . Another chloroform extraction step was performed and
the supernatant was collected and transferred to a new eppendorf tube after
centrifugation. 2 volumes of cold 1 0 % ethanol (stored at -20°C) were added to the
supernatant and the DNA was allowed to precipitate for 15 minutes at -20°C, collected by
centrifugation and air-dried for 20-30 minutes. The pellet was rehydrated using O. 1 X TE
( 1 .OmM Tris-HCI pH 8 , O . 1 rnM EDTA pH 8) to a final concentration of 1 pdmi.
RNA Isolation
RNA was isolated using the "hot phenol " method 14. Modifications to this protocol
includes addition of a drop of chloroform to overnight precipitation mixture and
decanting top Iayer after centrifugation. DEPC water is added to interphase (containing
pellet) and chloroform lower phase. Phenol and chloroform are added to this mixture such
that the aqueous phase and organic phase are in a 1: 1 ratio. After centrifugation of this
mixture, the aqueous top phase is transferred to a new tube and quantified using a UV
spectrophotometer. The RNA is distributed into 50pg aliquots to which O. 1 volumes of 3
M sodium acetate pH 5.2 is added. the RNA is then precipitated with two volumes of
ethanol and stored as such.
Southern Analyses
Genomic DNA was cut using restriction enzymes of choice and separated using
electrophoresis through 0.8% agarose gels in 0.5 X TBE buffer. Gels were soaked in:
0.25M HCI to fragment the DNA; in 0.5M NaOH, 1.5M NaCI to denature DNA and in
1.5 M NaCl, 0.5 M Tris - HCI pH 7.8 neutralization solution. The DNA was then
transferred to Nytran (Scheicher and Schuell) by capillary transfer in 20X SSC 15. Blots
were then hybridized with probes synthesized by random priming using the Kienow
fragment. Hybridization and washing was carried out using high stringency conditions at
6 5 0 ~ 1 5 .
Northern Analyses
Forrnaldehyde gels were used to separate total RNAs using standard protocols 15. 10-
15pg of RNA was separated in 1.2 % formatdehyde agarose gels in LX MOPS buffer.
RNA was transferred to nytran membranes (Schleicher and Schuell) in 20X SSC using
capillary action afer soaking the gel in DEPC treated water for 30 minutes. Blots were
probed with radiolabelled DNA hybridized in 5% dextran sulphate solution. Washes were
done under stringent conditions as per standard protocols. Northerns for P450 transcript
level were probed with a 1.2 Kb Eco RI/ Not 1 fragment of the cDNA clone 3-3a.
Plasmid Rescue
Plasrnid rescue was perforrned as described by Dilkes 16. DNA was isolated from the cnr
2-1 mutant and digested with Eco RI and Sa1 1 for right border and left border rescues,
respectively. Five pg of DNA was incubated with 125 units of T4 ligase at 16OC
overnight in a total volume of 500 pl. The ligation mixture was phenol: chloroform
extracted and concentrated by precipitation. The concentrated mixture was electroporated
into competent DH5-a cells. Cells were then plated on 50 wg /ml ampicillin LB plates.
Identification of cDNA and Genomic Clones
A specific 173 bp Sa1 I/ BamHI genomic fragment from the plasmid rescue #71b3 was
used to screen an Arabidopsis cDNA library, PRL2 obtained from the ABRC (stock #
CD4-7). The PRL library is constructed in Lambda ZipLox, which allows for the
automatic excision of the cDNA inserts into plasmid forms. After the tertiary screen three
different sized clones were isolated from approximately 200 000 plaques. The biggest
cDNA isolated was 1.2Kb. On sequencing this clone was shown to contain the 2"& exon
and part of the 1" exon. The full-length cDNA was obtained by RT-PCR (Statagene)
using poly T RNA as a template and gene specific primers. The resultant product was
cloned into pGEM T- easy (Promega) and pPCR-Script (Stratagene) vectors.
Antisensing and Overexpression Manipulation of cDNA in Wildtype (Work done by
Fernando Ferreira)
Although F3 analysis strongly suggests that the T-DNA insertion is within approximatelÿ
1 map unit from cnr 2- 1, it does not prove that the cnr 2- 1 mutation is caused by a T-
DNA insertion disruption of the CYP 78 or CNR2. To demonstrate that the CNR2 causes
the COz non-responsive phenotype, a number of constructs were made using binary
vectors and the full length cDNA of CYP78 (CNRS). The full-length cDNA was
amplified by PCR using forward primer KpnVEcoRI P450F (5'-3':
GGGTACCGAATTCATGGCTACGAAACTCGAAAGC) and reverse primer
HindmlSacI P450R (GCATAAGCTTGAGCTCTTAACTGCGCCTACGGCGCA). The
amplification conditions were as follows: a single denaturing step at 94°C for two
minutes preceded the 30 cycles of 30 seconds at 94°C; 60 seconds at 60°C; and a final
elongation step at 72°C for 90 seconds. The resultant amplification product was cloned
into pGEM-T-EASY (Promega). The overexpression and antisense constructs were made
in the following manner. The HindWXbaI fragment containing the 3 5 s CaMV promoter
from pBI221 was cloned into the respective sites in pBS (pBS-35s). For the anti-sense
orientation. the CNR2 amplification product was digested with Sad and Eco RI and
ligated into the respective sites in pBS-35s to create pCNR2-AS. For the over-expression
orientation, the CNR2 amplification product was digested with Sac1 and KpnI and
inserted into the respective sites of pBS-35s to generate pCNR2-OV. T o facilitate the
insertion of the above constructs into a binary vector, pGPTV-ZERO was fitted with the
pZERO- 1 (Invitrogen) polylinker using HindiII and Xbal to generate pGPTV-ZERO.
CNRS-AS was cloned into pGPTV-Kan as a HiridIIVSacI fragment. CNR2-OV was
cloned into pGPTV-ZERO as a HindIWEcoRI. Fragment. T o examine the cellular
localization of CNR2, another construct was made in pEGAD (a gift from S. Cutler)
where the CNR2 amplification product was cloned in frame with the GFP downstream of
the alanine flexi-linker region into the Eco RV Hindiil cloning sites. Wildtype
Arabidopsis WS plants were transformed with the antisense construct, the overexpression
constnict and the pEGAD constructs by the rnethod of 17.
Carbohydrate and Pigment Analysis
Carbohydrate and pigment quantitation were performed as described in Chapter 2.
Sequence Analysis
AI1 sequencing was done by the University of York sequencing facility. Sequence
analyses were performed using BLASTX and DNASIS (Hitachi).
Lipid Analysis
Seed (50) were placed in a 50 ml screw capped tube. Three wildtype and three c n r 2-1
samples were extracted. lm1 of HCI(lSN):CH30H (dry) was placed in the tube with the
seed. This incubation with acidic methanol results in the formation of methanolic esters
of fatty acids present in the sample. The mixture was microwaved for 2 minutes and
allowed to cool down and vortexed, this was repeated twice more for 1 minute intervals.
If the sample lost volume while microwaving more HCI(l.5N):CH30H (dry) was added
to keep the volume approximately constant. A known amount of 15:O fatty acid was
added to the sample as a standard. 0.5 ml of water and lm1 of hexane was added to the
tube, vortexed vigorously for 2-3 minutes, and later centrifuged for 10 minutes at 2000
rpm. lm1 of the top fraction was extracted and dryed using nitrogen gas. The sample was
then resuspended in 200 pl of hexane and loaded ont0 a lipid column for GC for analysis
Determination of ABA Content
40 mg of leaf tissue for plants grown under continuous light conditions was frozen in
liquid nitrogen. The leaf tissue was then powdered and 400 pl of 80% acetone was added.
The tissue was then incubated in the acetone at 4°C for 24 hours in the dark. After this
extraction procedure, the mixture was centrifuged and the supernatant was rernoved and
diluted 150 in PBS and used for ELISAs (Phytodetek ABA, agdia Inc.). Microtitre wells
are coated with a monoclonal antibody to ABA and ELISA uses the competitive antibody
binding method to measure concentrations of ABA in the plant extract. 100 pl ABA
labeled with alkaline phophatase (tracer) is added to wells dong with 100 pl plant extract
or standard to each ELISA microtitre well. A competitive binding reaction is set up in the
sample between constant amount of tracer, a limited amount of antibody and the sample
containing an unknown amount of ABA. The hormone in the sarnple cornpetes with the
tracer for antibody binding sites. After 3 hours of incubation at 4 ' ~ . the tracer is washed
away three times using a wash buffer. A substrate for the alkaline phophatase conjugate
was added and incubated for lhour at 37°C. A stop solution (1M NaOH) was then added
after the incubation. Color absorbance at 405 nm was measured after 5 minutes using a
dynatech M R 7 0 plate reader. Each sample for the ABA measurements was taken from a
fully expanded leaf. Each trial consisted of 4 plants for each genotype. Duplicates for
samples and standards were included on every plate. One-way analysis of variance
(ANOVA) showed that trial 1 and 2 should be pooled.
Dehydration Assay
A crude assay to measure dehydration was carried out on wildtype and cru- 2-1 plants of
comparable size and weight. 3-week old plants were excised at the root and fresh weight
of the rosette leaves was measured at 20-minute intervals. The loss of water was
measured as a percentage of the plants initial weight. Five plants were used for each
genotype. One-way ANOVA analysis was performed between wildtype and mutant data
for each point in tirne.
Results
Identification of the T-DNA-Tagged Allele of cnr 2-1.
The mutant cnr 2-1 isolated from the Feldmann T-DNA tagged lines showed a strong
insensitive phenotype when grown under high COz (Figure 4.1. and 4.2.). Fourteen day
old wildtype seedlings grown in constant illumination and exposed to 3000 ppm CO2 for
the four days show significant levels of anthocyanin and the cupping of leaves typically
seen in stressed plants. in cornparison, the cnr 2- 1 plant shows little anthocyanin coloring
and no leaf blade deformation. Similar results are seen for plants grown under a 12 hour
photoperiod for two weeks and then transferred to high CO2 conditions for 4 days.
Elevated anthocyanin levels and leaf cupping are clearly present in the wildtype plants but
not in the mutant. in contrast with other high CO2 insensitive mutants, cnr 2-1 was
supersensitive to high levels of exogenous hexoses with little or no germination observed
on 5% glucose MS plates. (Figure 4.6. in Chapter 2) Because of the strong high CO2
phenotype aad the unusual supersensitivity to glucose. this mutant was chosen for funher
study.
FoIlowing isolation of this mutant from the population of tagged Iines, a single high CO1
insensitive plant was selected and allowed to self and the seed from this plant tested for
kanamycin resistance and for high CO2 insensitivity. This process was repeated for 4
generations. Each generation showed 100% resistance to kanamycin and 100% high CO2
insensitive phenotype. To determine if the lesion was dominant or recessive, an
individual plant from the founh generation of this line was crossed with wildtype and the
seed (Fl progeny) from five crosses plated and tested for high CO2 insensitivity. Progeny
from al1 five crosses showed sensitivity to elevated CO2, indicating that the mutation is a
recessive mutation that has caused the high CO2 insensitive phenotype. F2 progeny
segregated 1 :3 for kanamycin resistance (kansensitiVc kanmisimi ) and 3: 1 for high CO2
scnsiiivity, .high ~ ~ ~ i n s e n s i i i v ~ i y . Of these F2 progeny, 83 high CO2 insensitive and 2 1 high COz
sensitive plants were selected and placed on MS plates containing 30 p.g/mi kanamycin.
After 10 days of growth, a11 83 high CO2 insensitive plants displayed 100% kanamycin
resistance and al1 21 high CO2 sensitive plants were kanamycin sensitive. O n the basis of
the nurnber of F2 plant examined, it was concluded that the lesion causing the high CO2
phenotype was within 20 map units of the T-DNA insert. As this is a large distance, F3
progeny analysis was used to better define the distance between the T-DNA insert and the _ - mutation causing the high CO2 phenotype. F3 analysis allows the F2 parent genotype to
be inferred from the behavior of the F3 progeny on kanamycin containing plates and
under high CO2 conditions. The genotypes of 89 randomly selected F2 parents were
determined by F3 progeny analysis. The data show that 45 F2 parents were heterozygous
for the kanamycin resistance and for the high COz phenotype. 20 F2 plants were
homozygous for the wildtype high CO2 phenotype and a11 cf these generated kanamycin
sensitive F3 progeny. 24 F2 parents were found to be both kanamycin resistant and
displayed the mutant high CO2 non-responsive phenotype. No recombinant chromosomes
were seen. These data show that the lesion causing the high COz insensitive phenotype
designated as ctzr 2- 1 is approximately within 1 map unit of the T-DNA insertion.
ci' U
cnr 2-1 Figure 4.2. Phenotypic differences between wild-type and c
photoperiod and 200 prn~lrn-~ s" light intensity) for 2 week
transferred to 1000ppm CO, under the same light condition
AMBIENT CO, (365PPM) WS WT
wr. 2- 1
S. Plar s for 4
ELEVATED CO, (1000PPM) WS WT
cnr 2-1 plants grown under identical arnbient conditions, (360p
its on the right were grown under ambient CO, for 10 da days.
ipm CO,, 12 hr lys then
h~ind111 marker Eco RI Hind III Eco RI Hind III Eco RI Hind III Eco RI Hind III
'9 1 resistance with a dual plant promoter
NOS and Right border (RB)
NPT1:hnamyein resistance with a
Left Border
bacterial prornoter
Figure 4.3. Southem blot of Eco RI digested cnr 2-1 DNA using a right border fragment as a probe. Sequence data, digests of right and left border plasmid rescues, genetics and southem analysis indicate that the structure of the insertion site is as described in the diagram above. The diagram of the insert is not drawn to scale.
Cloning of Genomic Sequence Fianking T-DNA and cDNA
In order to examine the number and structure of inserts in the mutant cnr 2-1. southern
blot analysis using the T-DNA right border as a probe of mutant genomic DNA was
performed (Figure 4.3.). The mutant genomic DNA showed three right border insertions
when cut with Eco RI. Rather than independent insertion events throughout the genome.
these T-DNA border sequences appear to be tandem insertions as the F2 population
following crosses with wildtype plants segregates 1:3 for kanamycin resistance
. . (kan"n"t"c- kan"s'"'"n' ). If the insertions were in different chromosomes or different areas
of the genome it is likely that at least two of the insertions would segregate and the ratio
Of kanscnsitivc. kanrcsistant plants in the F2 generation would be 1 : 15 . To obtain flanking
plant genomic DNA, plasrnid rescue was conducted using Sa1 1 and Eco RI digested DNA
prepared from the homozygous mutant cnr 2-1. For rescue of plasmids containing left
border T-DNA and flanking plant sequences, genomic DNA was digested with Pst 1.
Five plasmids likely containing plant genomic DNA were identified. These plasmids
could be distinguished from sequences containing only T-DNA by the presence of an
additional band of plant origin. Al1 five left border plasmids displayed the same Pst 1
digest pattern. One was selected and designated as 71b3. To obtain right border plasmids.
mutant genornic DNA was digested with Eco RV SalI, and one plasmid likely containing
plant DNA was identified out of nine plasmids recovered. The other eight plasmids
appear to contain only T-DNA sequence. identified by the triplet signature of 3.8. 2.4 and
1.2 Kb bands seen on digestion with Eco RI /Sa1 1. This large proportion of rescued
plasmids containing solely T-DNA again suggests tandem right border duplications
(Figure 4.3). The right border plasmid suspected to contain plant DNA was designated
LGETRVIVT ~flKEILWSPVFflDRPVKESflYSLHFNRflIGFflPHGVY URTLRR1f)SHLFST KQI~TQRRVISSgnVEFIEKOS~Pt-FVRELLKTflSLNNmiCSVFGQEYELEKWELRE
~ V G K S R ~ H ~ S D L R U P Y ~ T A V V K E V L R ~ H P P GPLLSU~~RLC~ITDTIV~DGRCVP~~GTT~~HVN~U~V~DPHWIVOPLEFKPERFV~GEVEFSVLGSDLRL~~PFGSGRRICPGKWLGFTTV~UT~~~ AVV-WODWHTY LPRVVKEVLRLHPPGPLLSUflRLSIWDTTI-DGYHVPflGTTflHVNTUAICRDPHVUKOPLEF~PERFVT~M#FSILGSDPRLflPFGSGRRflCPGKTL~RTVWFUVflS AVVGHûf?SVKDSDIPKLPY I~VVKEALRHHPPGPLLSMflRLST€~~~G~VPflGTTflt lVNN~ITHD~IWSPKFRPERFVWEG~EVBVRGMDlRLflPFGAGRRVCPGKflLGL~TVMUVflK SVVDSSRWLDSDIQRLPY LQSIVKETLRHHPPGPLLSUflRLAIHDWV-DGHnIPflGTT~HVNNUAITHDECWUf#PIIKFHPDRFI----OEDVMILGSDLRLflPFGSGKRVCPGKTHIKf#lV~LUL~Q .VVq.sR.v. #sDi., SpYlqa! VKE .LR$HPPGPLLSUflRLai. Dv.v.DG.. ! Pflf~TTflilVHnUu ! bhDp. .M.. P*eF .NRF ! . . .gde #v. ! 1GsDlRLflPFGsGrRvCPGKt~~latV~ 1U. fl.
521 530 !i40 550 560 566 ( ~ l - - œ œ œ ~ + œ œ ~ ~ ~ ~ œ ~ ~ + w œ œ ~ œ ~ œ œ œ + œ œ œ œ œ - - œ - + - - ~ œ - ~
HLHEFEMiP~VDLSEKLRLSCEHCmPLPRLRRRRS Arabidopsis thaliana CNR 2- 1 LLHEFEUVPSMKGVDLTEVLKLSSEtlAWPLTVKVRPRRG Glycine max (AF022463) LLmFEULPHAEWV~SEVLKLçCEH~PL)(CVPVTRWFim:FSD P i n ~ s radia!a (AF049067) LLKSFKLLPS-RWGVDLSECLKlîSLEtlKUPLVCWWPRFE Phalaenopsis sp. (U34744) BLh.FeulPs. ,ngVDLsE,LkeÇ.EHanPL.cv.vpR.. . .. . . Figure 4.4. Protein sequence of CNRî and alignment with related P450-related monooxygenases. The N-terminus contains a hydrophobic, putative transmembrane anchor domain (underlined). The conserved hinge region x (underlined in red) and the heme binding domain (underlined in blue) are shown.
7rb4 and was sequenced using a pBR322 primer S'ATTATCACATTAACC3'. This
primer is 60 bp away from the EcoRI site on this vector therefore the sequence read using
this primer will be plant DNA. The sequence obtained from the right border rescue was
50bp of plant sequence and part of the NOS terminator. This was deemed insufficient to
determine the identity of the site of insertion. The left border rescued plasmid was
sequenced using the sarne pBR322 primer and 460 bp of sequence obtained. Cornparison
of this sequence with Arabidopsis genomic DNA sequence database showed the left
border of the T-DNA insert to be in the 2"d exon of a P450 monooxygenase located on
chromosome II. Using a 173 bp Sal U BamHI fragment from 71b3 to screen an
Arabidopsis cDNA library, a partial cDNA clone was isolated and sequenced. The full-
length cDNA was obtained by using gene specific primers and RT PCR. The forward
gene specific primer used was (P4SF 15 1 :5*
TTGATCCGCCATGGCTACGAAACTCG3*), the reverse primer used was
(P45R 1976:5*TTAACTGCGCCTACGGCGCAATTTAG3').
Sequence Analysis
Blastx analysis indicated that the DNA flanking the insert encodes a cytochrome P450-
dependent monoxygenase on chromosome II. It is interesting to note that immediately
upstream of this P450 open reading frame is a putative cytochrome b5. BlastP showed
most closely related P450s to be CYP78A3 from Glycine max accession # AF022463
(65% identity). a P450 from Pinus radiata accession# AF049067(54% identity). a PM0
from Phalaenopsis sp. accession# U34744 (55% identity). and a P450 CYP78 from Zea
mays accession # P48420(48%
h ~ i n d I I I markcr
Figure 4.5. Southem arialysis of DNA from wild type and olr 2-1, iising a fragment of DNA from the plasinid rescue 71b3 as a probe. Laiies 1,2 and 3 are wild type DNA rrsiricted with Eco RI, Eco RI/ Hindlll and Hiiidlll respectively. Lanes 4,s and 6 are cnr 2-1 DNA restricted with Eco RI, Eco RI/ HindlIl and Hindlll respectively. Tlic arrows indicate differences in size and extra bands.
identity)(Figure 4.4.). Many of these CYP78 group P450 monooxygenases had k e n
previously cloned by differential display or subtraction techniques used to obtain
inflorescence, tasse1 and ovule specific genes. The gene structure of the cloned CYP78 is
similar to most P450 in that it contains one intron and two exons and belongs to an E
class P450 with group 1 and LI signatures.
Southern and Northern analysis
T o verify that the putative P450 gene was actually disrupted in the cnr 2-1 mutant lines,
southern blot analysis of DNA from cnr 2- 1 and wildtype Arabidopsis ecotype WS was
performed (Figure 4.5.). The probe used was a 1.2 Kb EcoRVNotI cDNA fragment,
which spans the T-DNA insert region. The restriction enzymes used for the genomic
digest were Eco RI and Hindm as the wildtype genornic sequence does not contain these
restriction sites in the coding region. The T-DNA insertion element, however, does have
EcoRI and HindiiI restriction sites. The southern clearly show that the region containing
the P450 gene to be disrupted by the insertion as two bands are observed for the cnr 2- 1
DNA and only one band is observed for the wildtype DNA.
Northern blot analysis (Figure 4.6.) shows that the CNR2 mRNA is present in plants
grown under normal and elevated CO2 conditions in vegetative tissue. There is a slight
increase in transcript abundance under elevated CO2. No significant levels of
hybridization are obtained with RNA isolated from the mutant. Taken together these data
provide strong evidence that the cDNA clone identified is disrupted in the cnr 2-1 locus
and that the level of expression is extrernely low or absent.
To assess the level of COi directed down-regulation of photosynthetic expression in the
mutant, the transcript abundance of chlorophyll a/b binding protein (CAB), carbonic
anhydrase 1 (CA 1 ), and ADP-glucose pyrophosphorylase ( ADPGase) was investigated
using RNA from 10 day oid Arabidopsis wildtype seedlings and 10 day old cnr 2-1
seedlings (Figure 4.7.). Al1 plants were grown for six days in air under 200 pmol photons
m-'s-' light, plants were then placed in the dark for 4 days. On the fourth day. plants for
the air sample were placed in light for 4 hours under ambient CO2 conditions. Piants for
the CO2 sample were placed in light for 4 hours under 3000 ppm CO2 conditions. crir 2-1
showed no change in CAB and CA1 transcript abundance under air or CO2 conditions,
whereas wildtype Arabidopsis ecotype WS showed a significant decrease in transcript
abundance for both these genes under elevated CO2 conditions. Furthermore wildtype
plants showed a significant increase in ADPGase transcripts under high COz conditions
whereas transcript levels in cm- 2- 1 were only slightly increased under these conditions.
Physiological Consequences of a Mutation at the crir 2 Locus
The germination capacity of cnr 2-1 was also investigated. In the absence of chilling.
following plating on MS containing agar, the percentage of mutant seed failing to
germinate was high compared with wildtype seed. Dormancy levels in wildtype and crzr
2-1 were therefore measured by chilling seed for increasing amounts of time at 4OC in
darkness. Radicle emergence was measured at 24 hour intervals after imbibition. The
results of this experiment are presented in Figure 4.8. Chilling increases the percentage
and rates of cnr 2- 1 germination. The mutant cm- 2- 1 seed requires more chilling than the
Figure 4.7. Northern blot analysis of cm* 2-1 and wild type Arabidopsis ecotype Ws using RNA from 10 day old
seedlings grown on Murishige and Skoog medium in air (365ppm CO,) for 6 days. Plates were placed in the dark
for 4 days and on day 4 seedlings were placed in the presence of light under ambient or elevated CO2 (3000 ppm)
conditions for 4-5 hours. Lanes are as specified: A- cnr 2-1 elevated CO2 grown, B- cnr 2-1 ambient CO2 grown,
C- wild type elevated CO, grown, D-wild type ambient CO, grown. Probes used are indicated in the figure.
wildtype seed and can therefore can be considered to be hyperdormant. When cnr 2- 1
seed was plated on 5% glucose MS media. germination was further reduced irrespective
of chilling for 4 days. In order to rule out the osmotic effect of high glucose levels in the
media, mutant and wildtype seed was plated on 5% sorbitol containing MS media. Both
wildtype and mutant seed exhibited similar germination percentages on the sorbitol
containing plates after chilling (data not shown). The lipid profile and the seed storage
proteins of cnr 2 were investigated and found to be similar to wildtype (Figure 4.9. and
4.10.) suggesting that differences in seed reserves were not the likely cause of the reduced
germination capacity of the mutant.
Total carbohydrate concentration in cnr 2-1 foliar tissue were similar to wildtype, when
measured as pg of carbohydrate per mg of dry weight. Differences in carbohydrate
content might be observed if measured as a function of leaf area. Mean total chlorophyll
concentrations measured for crir 2- 1 were not significantly different to that of wildtype.
Relative amounts anthocyanin were higher in the mutant under ambient conditions but
similar under elevated CO2.
To investigate stomatal effects, crzr 2- 1 and wildtype plants showed that the rate of water
loss from wildtype plants was higher than that of the mutant, and that ct2r 2-1 plants
retained more water than the wildtype plants after 50 minutes of excision from the root
(Figure 4.13). Kruskal-Wallis one-way analysis of variance on ranks showed data to be
significantly different aftcr 50 minutes (P=0.00 1).
CARBOHYDRATE ANALYSE Total Foliar Solubk Sugar Content
WS WT cnr 2-1
TOTAL FOLIAR STARCH
cnr 2-1
TOTAL FOLUR NON-STRUCTURAL CARBOHYDRATE
MO- - I
l l 1
O AIR rn CO2
WS WT cnr 2-1
Figure 4.1 1. Total foliar sugar, starch and non-structural carbohydrate measured in 10 day old f o l k tissue grown on MS media. Tissue samples were taken fiom plants grown continuously in arnbient CO, conditions (blue is air) and fiom plants grown under ambient conditions for 6 days and then transferred to 3000 ppm CO, for 4 days (red is CO,). At least four replicates were performed for each data set. Data is presented as pg hexose per mg of tissue expressed as Dry Weight (DW). Error bars are +/- SE.
149
PIGMENT ANALYSIS OF WILD
Mean Total Chlorophyll
1800 I . .
TYPE AND cnr 2-1
cnr 2-1
Mean Total Anthocyanins
wçwt cnr 2-1
Figure 4.12. Pigment analysis of 10 day old plants grown on MS media. Pigments were measured in 10 day old foliar tissue grown on MS media. Tissue samples were taken from plants grown continuously in ambient CO, conditions (blue is air ) and from plants grown under ambient conditions for 6 days and then transferred to 3000 ppm CO2 for 4 days (red is CO2). At least four replicates were performed for each data set. Error bars are +/- SE. FW(Fresh Weight).
As the cnr 2-1 mutant displays greater seed dormancy than wildtype seed and reduced
rates of water loss following excision of the rosette it was hypothesized that cnr 2-1
might have increased amounts of ABA. Wildtype Arabidopsis, cnr 2-1 and the ghanced
response to ABA eral-1 seed were plated on ABA containing MS plates. chilled for -
three days and allowed to germinate (Figure 4.15.). The cnr 2-1 seed were found to be
hypersensitive (reduced germination frequencies) to 0.3 rnM ABA in cornparison to
wildtype seed, however cnr 2-1 seed was not as sensitive to exogenous ABA levels as era
1-1 seed. ABA concentrations were also measured in vegetative tissue obtained from
well-watered plants and from plants re-watered following 5 days of withholding water.
Table 4.1. Quantification of ABA in fresh and rehydrated tissues.
N= 8 for fresh tissue and N=4 for rehydrated tissue.
Genotype
wildtype
crtr 2-1
ABA content (picomoVg FW)
Fresh Tissue
Trial 1 +/-SD
227 45
332 2 1
Rehydrated Tissue
lhour +/-SD Shours +/-SD
330 76 252 39
379 57 358 82
Table 4.1. shows ABA content to be 40-50% higher in the well-watered cnr 2-1 tissue
than in wildtype vegetative tissue grown under continuous light and ambient levels of
CO2. One-way ANOVA of ABA content between the mutant and wildtype shows that the
data are statistically significant (P=0.00 1, F=35.34) Although re-hydrated tissue show
large variations in ABA content, the same trends are observed when m r 2-1 and wildtype
are compared. One hour following rehydration, both genotypes show increased amounts
of ABA, however after 5 hours the olr 2-1 ABA level remain high whereas the wildtype
plant shows a substantial decrease. The data suggest that cnr 2- 1 plants have similar rates
of ABA synthesis but maintain high levels of ABA following water stress treatment.
Time (minutes) Figure 4.1 3. Dehydration curve of wild type compared to mr 2-1. Roots were excised from 2 week old plants and rate of water loss was nieasured fioni the rosette leaves of the plant and expressed as a percentage of initial weight. Five plants of approximately equal size and weight were used for eacli point and genotype. One-way analysis of variance of each time point indicates that significant differences between WT and cnr 2-1 exist after the 50 minute drying period.
0.0 FM ABA 0.3 pM ABA 3 pM ABA
Figure 4.14. Wild type (top right sector in each plate), cnr 2- 1 (top lefi sector) and an ABA supersensitive mutant ern 1 - 1 (bottom sector) genninated and grown for 10 days on O PM ABA (lefi), 0.3 p M ABA (centre) and 3 PM ABA (right).
Discussion
Using a novel screen designed to isolate mutants with modified responses to elevated
CO2, a mutant with a lesion in a cytochrome P450 monooxygenase has been isolated.
Cytochrome P450s or heme monoxygenases are a superfamily of enzymes found in both
prokaryotes and eukaryotes and are involved in biosynthesis or degradation of both
exogenous and endogenous chernicals including steroids, fatty acids, and s econdq
metabolites. Common to al1 P450s is an iron-protoporphyrin IX complex, which is the
donor of the reactive oxygen atom during substrate oxidation and a cysteine residue,
which is an axial ligand of the iron in this prosthetic group 19. The core containing the
heme-binding site is highly conserved whereas the regions associated with substrate
recognition and redox partner binding are highly variable. This variability in sequence
confers the P450s with regio and /or stereo-product selectivity. The predicted number of
mono-oxygenase genes in Arabidopsis is 300-350 and currently there is EST evidence for
approximately 204 genes. Phylogenetic studies have shown that plant, fungi and animal
P450s arose from a single ancestor that had a variant of CYP51 20. Given this
information, it is interesting to note that yeast have 2 P450 genes, C. elegarzs has 80
P450s and mammals are predicted to have 50-80 P450s. The number of P450s found in
Arabidopsis shows an immense investment in biochemical comptexity which has been
engaged in many ways. Complex biochemical pathways using various rnonooxygenases
have been shown to produce toxic alkaloids and phytoalexins for defence against
herbivory and pathogens, and other products include pigments and aromatics made to
attract poltinators. The nurnber of P450s predicted for Arabidopsis appears to be
representative of most plants, indeed it seems as if Arabidopsis is missing some families
of P450s which are found in other plants 20. According to the UPGMA anweighted
Pair Q o u p Analysis) tree of plant P450s CYP78 falls into clan A between CYP79A1 and -
CYP99. Clusters of P450s are not from organisms that share a common ancestor but they
probably represent genes that diverged from a single ancestral sequence.
Most P45O catalyzed reactions are NADPH and O2 dependent hydroxylations, however
they are also lcnown to perform N-dealkylation, O-dealkylation, oxidative deamination,
oxidative dehalogenation and other reactions. The reaction requires two reducing
equivalents which are usually delivered to the P450 via a NADPH reductase when both
substrate and O2 are bound to the P450. Most P450 reactions proceed with the
stoichiometry characteristic of monooxygenases (Figure 4.1 5).
ALPHATIC HYDROXLYATION
Figure 4.15. Typical hydroxylation reactions carried out by P450 mono-oxygenases
Several plant P450 have been cloned from Arribidopsis and other plants recentiy.
However very few have been cloned using mutant screens. Mutants such as the one
described here expedite the determination of the function of a protein. The data presented
are consistent with cnr 2-1 containing a lesion involved in ABA metabolism. The mutant
exhibits lower rates of transpiration as detennined by reduced rates of water loss in
excised rosettes. This reduced transpiration could be caused by the presence of ABA in
concentrations higher than that found in wildtype. ABA is synthesized under water stress
conditions and causes changes in ion channel activities, which subsequentl y resul t in a
loss of turgor in guard cells. This loss of turgor results in a reduction in stomatal aperture
limiting water loss from the plant 21. The reduced stornatal apertures and concomitant
reduced rates of transpiration could explain the lack of high COz sensitivity, as
intracellular levels of COz would be significantly Iower than that achieved in the wildtype
plants when exposed to 3000 ppm. In addition to these observations. the mutant also
displays hypersensitivity CO exogenous ABA during germination assays and is
hyperdormant, attributes that could be explained by the presence of elevated endogenous
levels of ABA in the seed (Figure 4.14). The increased sensitivity of em 1 to exogenous
0.3 rnM ABA in cornparison to cnr 2-1. suggests that a lesion in a signal transduction
pathway l 8 affects germination more than a biochernical lesion. An alternative
explanation is that other ABA degradative pathways exist. However they are thought to
be minor degradative pathways cornpared with the 8' ABA hydroxylase pathway l 8
(Figure 4.16.).
The increases levels of ABA measured in leaf tissue of watered cnr 2-1 plants, and the
high levels and slower turnover of ABA in rehydrated leaf tissue of the mutant provide
support to the hypothesis that this P450 monooxygenase is involved in ABA metabolism.
Evidence has been provided showing the 8' ABA hydroxylase from maize is a
cytochrome P450 monooxygenase 22. This study shows that the catabolism of (+) ABA
shows the characteristic requirement for NADPH and molecular oxygen observed for a
P450 monoxygenase. The 8' ABA hydroxylase is also inhibited by CO and the inhibition
is reversible by light.
Figure 4.16. The Catabolism and Anabolism o f ABA. Modified 23
The arrow marked 8'hydroxylase is putative reaction camed out by C W .
3 1 !If?31-& O-~s-;i0101~tion (+)-7-H'/DRO%Y ABA
i ~ ~ - c i r - n r n j a n ~ . i t 7 'HYDROX'USE
ABA'1.4 D I O S
C'iCLASE
REDUCTASE (-)PtL4SEIC AClD -- (-) D ~ ~ - D B O P H ~ ~ ~ C ACID
References
1. Jouzel, J., Barkov, N.I., Barnola, J.M.. Bender, M., Chapellaz, J., Genthon, C.,
Kotlyakov. V.M., Lipenkov,V., Lorius. C., Petit, J.R., Raynaud, D., Raisbeck, G., Ritz.
C., Stievenard, M., Yiou, F., and Yiou. P.,. Extending the Vostock ice-core record of
paleoclimate to the penultimate glacial period. Nature 364,407-4 12 ( 1993).
2. Stitt, M. Rising CO2 levels and their potential significance for carbon flow in
photosynthetic cells. Plant Ce11 and the Environmrnt 14, 74 1-762 ( 199 1 ).
3. Sage, R. F., Reid C.T. in "Plan? Response Mechnrzisms to the Environment" 4 1 3-
499 (ed.Wilkinson, R.E., 1994).
4. Van Ooosten, J. J., Besford R.T. Sugar feeding mimics effect of acclimation to
high CO2 -rapid down regulation of Rubisco small subunit transcripts but not of the large
subunit transcripts. Journal of Plant Physiology 143.306-3 12 ( 1994).
5. Majeau, N., Coleman J.R. Effects of CO2 concentration on carbonic anhydnse
and ribulose 1.5- bisphosphate carboxylase1 oxygenase expression in pea. Plant
Physiology 112, 569-574 ( 1996).
6. Cheng, S. H., Moore, B. & Seemann. J. R. Effects of short- and long-term
elevated CO2 on the expression of ribulose- 1, 5bisphosphate carboxylase/oxygenase
genes and carbohydrate accumulation in leaves of Arubidopsis thalinna (L.) Heynh. Plant
Pliysiol116.7 15-23 ( 1998).
7. Sheen, J. Metabolic repression of transcription in higher plants. Plant Ce11 2,
1027-38 (1990).
8. Krapp. A., Hofmann, B., Schafer, C., Stitt, M. Regulation of the Expression of
a B C s and other Photosynthetic Genes by Carbohydrates- A mechanism for the sink
regulation of photosynthesis. Plant Journal 3.8 17-828 (1993).
9. Jang, J. C. & Sheen, J. Sugar sensing in higher plants. Plant Ce11 6, 1665-79
( 1994).
10. Smeekens, S. Sugar regulation of gene expression in plants. Curr Opin Plant Biol
1, 230-4 ( 1998).
11. Halford, N., Purcell, P., Hardie, G. 1s hexokinase really a sugar sensor in plants?
Trends in Plartts Science 4 , 1 17- 1 19 (1999).
12. Monde , S., Boles, E., Hellmann, H., Barker, L., Patrick, J.W., Frommer, W.B.
and Ward. J. The dual Function of Sugar Carriers: Transport and sugar Sensing. Plant
Ce11 11,707-726 ( 1999).
13. Stewart, C. N., Jr. & Via, L. E. A rapid CTAB DNA isolation technique useful for
RAPD fingerprinting and other PCR applications. Biotechiques 14,748-50 (1993).
14. Verwoerd, T. C., Dekker, B. M. & Hoekema, A. A small-scale procedure for the
rapid isolation of plant RNAs. Nucleic Acids Res 17.2362 ( 1989).
15. Sambrook, J., Fritsch, E.F., and Maniatis, T. Molecular Cloningr A Lclboratory
Mmzual (Cold Spring Harbour Laboratory Press, Cold Spring Harbour, 1 989).
16. Dilkes, B. P. & Feldmann, K. A. Cloning genes from T-DNA tagged mutants.
Metliods Mol Bi01 82, 339-5 1 ( 1998).
17. Schultz, B., Bennet, M.J., Dilkes, B.P., and Feldmann K.A. T-DNA tagging in
Arabidopsis thaliana: clonittg by gene disrupriorl ( 1994).
18. Cutler, S., Ghassemian, M., Bonetta. D., Cooney, S., McCourt, P. A protein
famesyl transferase involved in abscisic acid signal transduction in Arabidopsis. Science
273, 1239- 124 1 ( 1996).
19. Degttyarenko, K. N., Archakov, A.I. Molecular evolution of P450 superfamily and
P450-containing monooxygenase systems. FEBs 332, 1-8 ( 1993).
20. Nelson. D. R. Cytochrome P450 and the Individuality of species. Arcliives of
Biocliernistry and Biophysics 369, 1 - 10 ( 1999).
21. Leymarie, J.. Lasceve, G., and Vavasseur, A. Elevated COz enhances stomatal
responses to osmotic stress and absicisic acid in Arabidopsis tlialiana. Plant. Cell a d
Environment 22, 30 1-308 ( 1999).
22. Krochko. J. E., Abrams, G. D.. Loewen, M. K., Abrams, S. R. & Cutler. A. J. (+)-
Abscisic acid 8'-hydroxylase is a cytochrome P450 monooxygenase. Plant Physiol 118.
849-60 ( 1998).
23. Cutler, A. J. & Krochko, J. E. Formation and breakdown of ABA. Trends Plant
Sci 4,472-478 ( 1999).
Chapter 5
Final Discussion and Future Directions
The use of enriched COz atmospheres for the purpose of isolating mutants defective in
carbon rnetabolism has been extrernely fruitful in the p s t 2. This thesis describes the
isolation mutants defective in the regulation of carbon metabolism using elevated CO2
conditions. Although the screen was successful in achieving its goal, it was not a
saturating screen and thus the screen should be performed in the future using other mutant
collections. Several new transposon mutagenized collections have become avai!able and
the screening of these collections should increase the chance of identifying more of the
molecular cornponents influencing carbon metabolism. This study also did not overly
emphasize the genetics of the current mutant collection. As 33 cnr lines were isolated
using this screen, reciprocal crosses between mutant lines should be performed in order to
estirnate the number of genes involved in con ferring a CO2 non-responsive phenotype.
Only five of the current cnr mutant lincs were subjected to complementation analysis and
each one of these mutant lines was placed in a separate complementation group. Of these
five c n r mutants, only two mutants were characterized further. The remaining mutants
should certainly be studied further with respect to their genetics. biochemistry and
physiology. A particularly interesting mutant line to examine would be the 17#12, a
highly CO2 insensitive and vigorously growing line which produces large seed, a trait
which might be of future economic importance.
The genetic, ~nolecular and biochemical characterization of cnr 1- 1 and c n r 2- 1 show that
the screen is capable of isolating a spectrum of mutants with lesions in different aspects
of carbon fixation from stomatal control by COz to modulation of carbohydrate signaling
and the potential regulation of sink-source relationships.
Characterization of cnr 2- 1 strongly suggests that CNR 2 is involved in the degradation of
abscisic acid (ABA). Based on these findings. other known ABA mutants should be
tested for COz sensitivity. In addition, mutants from this CO2 screen which show lower
germination percentages should be crossed to known ABA mutants with sirnilar
germination phenotypes to determine if any of the COz mutants are allelic to identified
ABA mutants. For example, it would also be interesting to cross cnr 2-1 with an abi 1 or
2 mutant (ABA insensitive mutant with a lesion in a protein phosphatase, thought to be
involved in the ABA signal transduction pathway). T h e resulting double mutant should be
"wilty" and should not respond to high COz by reducing turgidity of guard cells. Another
interesting expr imen t which investigates the stomatal physiology of the cnr 2-1 mutant
would be to examine gas exchange of a crzr 2- 1 leaf at a low CO2 concentration in a car
2- 1 leaf, which was first exposed to a COz concentration of above 600ppm concentration.
Given the suggestions that this cnr 2-1 lesion renders the plant defective in ABA
degradation and that the response of stomates to COr converges on the ABA signaling
pathway 3, the stomates of the cnr 2-1 leaf first exposed to the elevated C O should be
slower in opening when transferred to a low COz concentration than the wild type plants
subjected to the same regime.
Characterization of the CNR2 protein would be an interesting endeavor. A protein
expression construct using PET or other protein expression vectors could be made for
activity assays. This experiment could supply supporting evidence for the function of this
P450. The recombinant CYP78 has to be expressed dong with its electron donor,
NADPH reductase in bacteria and this strain can be used examine the degradative activity
of this P450 on ABA. The specific electron donor could be found using the yeast two-
hybrid system. Site directed mutagenesis could also be used to examine substrate
specificity and protein -protein interactions between the CNR2 and the electron donor.
Mutant proteins with defective active sites or defective interactions with electron donors
should show low P450 activities for the specific substrate. A protein expression construct
could also be used to produce protein for crystallograpby as no plant P450 has been
crystallized to date. The construct, which can be used for this purpose should be truncated
at the N-terminus such that the short transmembrane region is removed.
i t would also be interesting to examine the site of expression of this particular P450. In
order to examine the localization of CNR2, a construct with the promoter of CNR2 fused
to a reporter gene such as GFP could be made and transformed into Arabidopsis. The
reporter construct will allow us to follow the site and time of expression of CNR2.
The T-DNA insertion in the promoter of the LRR RLK appears to segregate with both the
COz insensi tive and glucose insensitive phenotype and thus the mutation is probabl y
caused by the insertion element. However, this claim cannot be definitiveiy supported
unless the mutant lesion is cornplemented with the wild type gene and promoter or
phenocopied using transgenic plants overexpressing CNR 1. As expression of CNR 1 does
appear to be regulated under glucose and enriched CO2 conditions in the cnr 1-1
background. it is highly unlikely that the mutant phenotype will be rescued or partiaily
rescued by complementation using the wild type gene and prornoter. The other
possibility of providing functional data for this gene in carbon metabolism would be to
phenocopy the mutant by over-expressing the wild type gene. The mutant has already
been transformed with the wild type gene and the promoter (Chapter 3). The second
generation of transformants should be subjected to phenotyping under elevated CO2 and
high glucose growth conditions to verify the role of the mutant in carbon metabolism
regulation. It would also be interesting to observe the phenotype of an antisense C N R l
plant. Present data suggests that the plant should exhibit a COz hypersensitive response
chr.
As yet the transcript size of CNRl is not definitive. Northern analysis shows that the
mRNA is approximately 3-3.2 kb. Attempts to amplify a 3.2kb full-length cDNA
fragment (suggested by ORF predition programmes) using RT-PCR have been
unsuccessful. The largest clone amplified by RT-PCR thus far is 2.9kb (work done by Dr
Zhou). A better prediction of size using northern analysis is yet to be performed. An
interesting aspect of the TIR- RLKs is that more than one transcript has been isolated for
the N-gene and L6 gene 4. This group of genes often shows differential splicing of
transcripts and hence produces both full length and truncated proteins from the same ORF
4. The difficulty in obtaining a full-length RT-PCR product may reflect differential
splicing and as such it is important to investigate this phenornenon and the role of the
truncated and full-length proteins in the response to elevated CO2.
The Kyte-Dolittle hydropathy plot of the CNRl protein suggests that the protein does not
contain any membrane spanning domains and therefore may be localized in the
cytoplasrn. However, there is some sequence evidence to suggest that the protein has a
signal peptide at the N-terminus; thus it could be located in the chloroplast. Localization
could be further examined with a fusion protein containing this N-terminal region and a
reporter gene such as GFP. Another method would be to examine the localization and
expression of this protein using antibodies and in situ hybridization techniques.
This study has produced some interesting and potentially economically viable mutants
which will require much more than the survey study presented here to thoroughly explain
their roles in deciphering carbon metabolism. This being said, the study provides
evidence for the feasibility of isolating mutants in carbon metabolism and regulation
thereof using elevated COî conditions. The most interesting aspects of these mutants will
probably be revealed using rigorous physiological methods. The work presented here will
provide much material for future studies.
References
1. Sornerville, S. C., Ogren, W.L. A phosphoglycolate phosphatase- deficient mutant
in Arabidopsis. Nature 280, 833-836 ( 1979).
2. Somerville, C. R. & Ogren, W. L. Mutants of the cruciferous plant Arabidopsis
thaliarta lacking glycine decarboxylase activity. Biochem J 202, 373-80 ( 1982).
3. Webb, A. A. & Hetherington, A. M. Convergence of the abscisic acid, C02, and
extracellular calcium signai transduction pathways in stomatal guard cells. Plant Physiol
114, 1557-60 (1997).
4. Dinesh-Kumar, S. P. & Baker, B. J. Alternatively spliced N resistance gene
transcripts: their possible role in tobacco mosaic virus resistance. Proc Nat1 Acad Sci
USA 97, 1908- 13 (2000).
5. Ayliffe, M. A. et al. Analysis of alternative transcripts of the flax L6 mst
resistance gene. Plant J 17, 287-92 ( 1999).
