ARCHIVAL REPORT

Calcineurin Downregulation in the Amygdala IsSufficient to Induce Anxiety-like and Depression-likeBehaviors in C57BL/6J Male Mice

Yann S. Mineur, Seth R. Taylor, and Marina R. Picciotto

Background: The calcium-dependent phosphatase calcineurin is highly expressed in the amygdala, a brain area important for behaviorsrelated to mood disorders and anxiety. Organ transplant patients are administered the calcineurin inhibitor cyclosporine A (CsA)chronically and demonstrate an increased incidence of anxiety and mood disorders. It is therefore important to determine whetherchronic blockade of calcineurin may contribute to symptoms of anxiety and depression in these patients.

Methods: Pharmacological (CSA) and viral-mediated gene transfer (adeno-associated viral expression of short hairpin RNA [shRNA])approaches were used to inhibit calcineurin activity systemically or selectively in the amygdala of the mouse brain to determine the roleof calcineurin in behaviors related to anxiety and depression.

Results: Systemic inhibition of calcineurin activity with CsA or local downregulation of calcineurin levels in the amygdala using adeno-associated viral-delivered shRNAs targeting calcineurin B increased measures of anxiety-like behavior in the elevated plus maze, thelight/dark box, and the open field test. A decrease in locomotor activity was also observed in mice treated systemically with CsA. In theforced swim model of depression-like behavior, both systemic CsA treatment and shRNA-mediated calcineurin blockade in the amygdalasignificantly increased immobility.

Conclusions: Taken together, these data demonstrate that decreasing calcineurin activity in the amygdala increases anxiety-likebehaviors and to some extent depression-like behaviors. These studies suggest that chronic administration of CsA to organ transplantpatients could have significant effects on anxiety and mood and this should be recognized as a potential clinical consequence oftreatment to prevent transplant rejection.

Key Words: AAV, anxiety, calcineurin, cyclosporine A, depression,elevated plus maze, forced swim, PP2B, shRNA, tail suspension

Organ transplant is a life-saving procedure that requireslife-long immunosuppression treatment to prevent rejec-tion of the allograft. Cyclosporine-A (CsA), an 11 amino

acid cyclic peptide inhibitor of calcineurin (Cn) activity, is one ofthe most commonly used molecules used to prevent tissuerejection. Since first introduced in the late 1970s for kidneytransplantation (1,2), CsA has been highly effective in improvingthe outcome of transplantation; however, treatment is oftenassociated with neuropsychological side effects including anxietyand depressive disorders (3,4). Because of the traumatic effects oftransplant surgery and postoperative care, it is not knownwhether treatment with CsA is a direct cause of mood disorders.It is therefore important to determine whether there is abiological connection between CsA treatment and anxiety ordepressive disorders, since recovery from surgery can be impairedby somatic illnesses related to major depression (5–8).

The amygdala is a critical brain area involved in the regulationof emotions and in normal and pathological reactivity to stressors(9). Amygdala activity is correlated with anxiety, aggressivebehavior, and fear, and several studies have reported that

From the Division of Molecular Psychiatry and Interdepartmental Neu-roscience Program, Abraham Ribicoff Research Facilities, ConnecticutMental Health Center, Yale University School of Medicine, New Haven,Connecticut.

Address correspondence to Marina R. Picciotto, Ph.D., Yale UniversitySchool of Medicine, Department of Psychiatry, 34 Park Street-3rd FloorResearch, New Haven, CT 06508; E-mail: marina.picciotto@yale.edu.

Received Aug 10, 2013; revised Mar 4, 2014; accepted Mar 5, 2014.

0006-3223/$36.00http://dx.doi.org/10.1016/j.biopsych.2014.03.009

hyperactivity of the amygdala is a risk factor in the developmentof mood disorders and heightened sensitivity to stress (10).Depressed patients can exhibit an increase in glucose metabolismin the amygdala, along with alterations in resting cerebral bloodflow in this structure (11–13). Further, functional magneticresonance imaging has shown that bilateral amygdala hyper-activity in response to environmental stressors is a significant riskfactor for both anxiety and depression (14).

Changes in amygdala activity can be achieved through multi-ple mechanisms, including perturbations of intracellular signalingand gene expression. In rats, viral-mediated overexpression of thecyclic adenosine monophosphate response element bindingprotein in the basolateral amygdala induces changes in measuresof depression-like and anxiety-like behavior (15). Interestingly,chronic treatment with several different classes of antidepressantdrugs can decrease the expression of c-fos, a marker of neuronalactivity in the amygdala (16,17). Stress also alters amygdalaactivation in human subjects, as measured by changes in bloodflow (18). Thus, molecules involved in signal transduction path-ways that alter the dynamics and activity of cellular function inthe amygdala may be involved in neuronal plasticity leading tobehaviors related to anxiety and depression.

Cellular calcium dynamics are critical for neuronal activity, andthe calcium-regulated serine- and threonine-specific proteinphosphatase Cn is a calcium-dependent enzyme that can altercellular function. Calcineurin is composed of a catalytic subunit(CnA) containing a calmodulin binding domain, a regulatorysubunit binding domain and an autoinhibitory domain, and aregulatory subunit (CnB), which binds calcium directly (19,20).Both subunits are required for enzymatic activity and havemultiple isoforms. All CnA isoforms (α, β, and γ) are found inthe brain, but only the CnB1 regulatory isoform is expressedin brain (21–23). Calcineurin is expressed throughout the brain

BIOL PSYCHIATRY 2014;]:]]]–]]]& 2014 Society of Biological Psychiatry

2 BIOL PSYCHIATRY 2014;]:]]]–]]] Y.S. Mineur et al.

[with the highest levels observed in the hippocampus, striatum,substantia nigra, and amygdala (24,25)] and can regulate basicneuronal functions, including excitability (26), G protein-mediatedinhibition of calcium channels (27), and glutamatergic neuro-transmission in cortical neurons (28). A large number of calcineurintargets have been identified that are likely to be involved inthe ability of the enzyme to regulate neuronal excitability, includ-ing synapsin I, calcium channels, glutamate receptors, andthe transcription factors cyclic adenosine monophosphateresponse element binding protein and nuclear factor of activatedT cells (29).

We hypothesize that CsA-mediated Cn inhibition could induceanxiety-like and depression-like phenotypes in an animal model.In addition, decreasing Cn activity specifically in the amygdalamay be sufficient to induce these behaviors. To test thesehypotheses, we investigated the role of Cn inhibition ondepression-like and anxiety-like behaviors in mice followingchronic systemic treatment with CsA, demonstrating that periph-eral administration of the drug results in a significant increase inbehaviors related to anxiety and depression. We then used anadeno-associated virus (AAV) carrying short hairpin RNAs (shRNAs)targeting CnB (shCnBs) to knockdown calcineurin selectively inthe amygdala and showed that this was sufficient to recapitulatethe behavioral effects of systemic CsA administration.

Table 1. Time Table of Behavioral Experiments

CsA/Vehicle GroupsAAV-shCnB/AAV-Scr

Groups

DayInjection of CsA or Vehicle(15 Days Pretreatment)

Postsurgery Recovery(�2 Weeks) Days

1 Elevated Plus Maze 12 Light/Dark Test 24 Square Open Field 45 Tail Suspension 56 Forced Swim Test 69 Novelty-Suppressed Feeding 910 Locomotion 10

Determination of Placement for Viral Vector Infusions

AAV, adeno-associated virus; CsA, cyclosporine A; Scr, scrambled;shCnB, short hairpin RNA targeting calcineurin A.

Methods and Materials

AnimalsMale C57BL/6J mice (10–12 weeks old upon arrival) were

purchased from Jackson Laboratories (Bar Harbor, Maine) andwere maintained in a temperature-controlled vivarium (211C �21C) under a 12-hour light–dark cycle with lights on at 7:00 AM andhoused five per cage. Food and water were available ad libitum.

Drug Dosing and AdministrationFor systemic administration studies, mice received daily intra-

peritoneal injections of 15 mg/kg CsA (Sandimmune oral injec-tion; Novartis, East Hanover, New Jersey) or olive oil vehicle(Sigma, St. Louis, Missouri) for 15 days before behavioral testing.Drug administration continued during behavioral testing. Alldrugs were injected in a volume of 10 ml/kg body weight.

Construction of shRNAs and Viral Production and PurificationAs multiple isoforms of CnA are expressed in brain, but only

one CnB isoform, we designed an shRNA targeting Ppp3r1, thegene encoding CnB (shCnB) (NM_024459.2, targeting bp 451-474of CDS): GAGGAATTCTGTGCTGTCGTAGGT. A scrambled shRNA(Scr) sequence that did not target any murine messenger RNAs(mRNAs) was used as a control: TTATATGGCGCTTTCGAATGAGC.The shRNA oligos were ligated into pAAV-enhanced greenfluorescent protein-shRNA as described previously (30,31). Colonypolymerase chain reaction (PCR) and sequencing were used toverify positive clones.

Short hairpin RNA-containing plasmids were packaged into AAVtype 2 by triple transfection with 135 mg each of pAAV-shRNA,pHelper, and pAAV-RC plasmids (Stratagene, La Jolla, California)using calcium phosphate into human embryonic kidney 293 cells.Five days later, cells were harvested and suspended in freezingbuffer (.15 mol/L sodium chloride, 50 mmol/L Tris, pH 8.0; Sigma, St.Louis, Missouri), then lysed by three freeze-thaw cycles (in ethanol-dryice and 421C water bath). Benzonase (Sigma) was added (50 U/mL)and the solution was incubated for 30 minutes at 371C. Cellular

www.sobp.org/journal

debris was removed by centrifugation, and the clarified lysate wasadded to a 15%, 25%, 40%, 60% iodixanol step gradient. This wasspun at 50,000g for 3.5 hours at 10ºC; the 40% fraction wasremoved and diluted in phosphate buffered saline, 1 mmol/Lmagnesium chloride, and 2.5 mmol/L potassium chloride andthen concentrated, washed, and purified with Amicon 100K filtercolumns (Millipore, Billerica, Massachusettes) and phosphate buf-fered saline, 1 mmol/L magnesium chloride, and 2.5 mmol/Lpotassium chloride. Purified, concentrated virus (100–200 mL) wasstored at 41C.

Stereotaxic Injection of Viral VectorsUsing a stereotaxic apparatus (Kopf Instruments, Tujunga,

California), AAV-shCnB or AAV-Scr was infused into the basolateralnucleus of the amygdala (BLA) under isofluorane anesthesia. Usinga 29G, beveled-tipped Hamilton syringe (Hamilton, Reno, Nevada),.5 mL of AAV-shCnB or AAV-Scr was infused bilaterally into the BLAover 5 minutes. The ventral part of the BLA was targeted based onthe observation that interference with calcium-dependent intra-cellular processes in this brain area can alter behaviors related toanxiety and depression (32); however, since viral diffusion couldoccur, the central amygdala was also likely infected. After infusion,the syringe was held in place for an additional 5 minutes beforebeing removed. Coordinates for the stereotaxic injections (relativeto bregma) were determined in a stereotaxic atlas (33) and werethen adjusted based on the infusion of blue dye in pilot studies.The final coordinates used were �2.2 anteroposterior, �3.1 lateral,�4.8 mm dorsoventral. Following infusion, mice recovered for10 days before undergoing behavioral testing. After all behavioraltesting was performed, the placement of the injections wasdetermined by cryostat sectioning through the infusion site andthe detection of green fluorescent protein (GFP)-positive cells.

Experimental GroupsMice received either pharmacological challenge with systemic

CsA for 15 days that continued through behavioral treatment(n ¼ 7–10/group) or amygdala infusion of AAV-Scr or AAV-shCnB(n ¼ 12/group). Behavioral tests were then performed insequence as follows: elevated plus maze, light/dark box, openfield, tail suspension, forced swim test, novelty-suppressed feed-ing, and locomotion (Table 1). To avoid any potential interactionsbetween the behavioral paradigms used, the order of the testswas determined as recommended in Crawley (34). Each test wasseparated by 24 to 48 hours. A separate group of mice wasinfused with AAV-Scr or AAV-shCnB (n ¼ 6/group) for in vivomeasurement of calcineurin knockdown.

Y.S. Mineur et al. BIOL PSYCHIATRY 2014;]:]]]–]]] 3

All studies were approved by the Yale University Animal Careand Use Committee and followed the National Institutes of HealthGuide for the Care and Use of Laboratory Animals.

Elevated Plus MazeThe elevated plus maze was made of black Plexiglas, had four

30 � 5-cm arms, and was elevated 50 cm above the floor as hasbeen described previously (35). Two arms were enclosed by 15-cmwalls, while the other two arms were open with a 3-mm edge toprevent slipping. The maze was illuminated homogeneously withthe regular room light. A 5 � 5-cm center area at the crossing ofthe arms was considered to be a neutral area. The animals wereplaced in the test room 30 to 60 minutes before testing to limitacute stress. A nontest mouse was first placed on the maze todeposit fresh odors. At the beginning of the test, mice were placedin the center of the maze facing an open arm. The subject was thenallowed to explore the maze freely for 5 minutes. The percentageof time spent in the open arms compared with the total time minustime in the center was used as the primary measure of anxiety-likebehavior; number of entries into the open and closed arms wererecorded, and the total number of entries was also reported.

Light/Dark TestThe light/dark test was performed similarly to what has been

previously described (36–38). The apparatus consisted of twoopaque Plexiglas compartments of the same size connected by acentral opening (18 � 10 � 13 cm, light compartment illuminatedby a 60 W desk lamp). Mice were placed into the dark compartmentfacing away from the opening and tracked for 5 minutes after thefirst cross was made. Number of entries into the dark side and timespent in the dark compartment were measured.

Anxiety Test in a Square Open FieldMice were placed in a square open field (40 cm � 40 cm)

composed of a clear floor without bedding, and their behaviorwas observed for 20 minutes. Two main endophenotypes relatingto anxiety-like behavior were then recorded (39): time spent inthe thigmotaxis area (within 5 cm of the walls, with four paws inthe area) and overall time spent freezing in the open field.

Tail Suspension TestAs has been described previously, mice were gently sus-

pended by the tail and scored for time spent immobile overthe 6-minute test (38). After completion of the test, mice werereturned to a holding cage until all cage mates were tested.

Forced Swim TestMice were gently placed in clear glass beakers filled with

15 cm water (room temperature, �221C) for 15 minutes. Care wastaken not to put the nose of the mouse below water level. Micewere observed and the overall time spent immobile was scored(immobility was defined as a minimal amount of movement madeby the mouse excluding respiratory and whisker movements ortetanic movements of the limbs). After testing, each mouse wasplaced in a heated holding cage (301C–351C) with bedding coveredby a paper towel. Animals were returned to the holding room oncedry and placed back in their home cages (17,38).

Novelty Suppressed Feeding TestMice were food-deprived for 24 hours before testing. The day of

the test, mice were placed in the behavioral room at least 30minutes before testing. The testing arena was dimly lit. Animalswere placed in an open field (54 cm � 28 cm � 12 cm) with a

piece of chow on a circular piece of blotting paper. Animals wereplaced in a corner, facing the center and were then observed amaximum of 6 minutes. Time to first feeding episode was recordedand the test was then halted. Animals were then returned to theirhome cage and provided with food ad libitum. Food consumptionin the home cage was recorded to control for changes in appetite.

Locomotor Activity in an Open FieldMice were placed into the center of a brightly lit, novel cage

(48 cm � 22 cm � 18 cm) with no bedding for 20 minutes. Threeconsecutive beam breaks were used as an index of locomotor activity.

Quantitative Real-Time PCR and mRNA Quantitation of CnBFor in vitro testing of shCnB efficacy, N2a cells, mouse neuro-

blastoma cells that endogenously express calcineurin, were trans-fected with either pAAV-shCnB or pAAV-Scr using Lipofectamine2000 (Invitrogen, Grand Island, New York) according to the manu-facturer’s protocol. Twenty four hours later, cells were lysed and RNAwas isolated using the Qiagen RNeasy Mini kit, according to themanufacturer’s protocol. RNA was stored at �801C until furtherprocessing. RNA (500 ng) from each sample was reverse transcribedinto complementary DNA using the QuantiTect Reverse TranscriptionKit (Qiagen, Frederick, Maryland). Complementary DNA was thenquantified using real-time PCR with SYBR Green in a StepOnePlusThermal Cycler (Applied Biosystems, Grand Island, New York). Primersets for CnB and a reference gene (β-glucuronidase, GusB1) weredesigned using Primer3 (University of Massachusettes Medical School,Worcester, Massachusettes) to span introns to prevent genomic DNAamplification. CnB primers: Forward, TTTGAGCGTGGAAGAGTTCAT;Reverse, CGCCTTTGACACTGAACTGA. GusB1 primers: Forward,AACCTCTGGTGGCCTTACCT; Reverse, TCCCGATAGGAAGGGTGTAG.

For verification of knockdown in vivo, animals infused with AAV-Scr and AAV-shCnB in the amygdala (n = 6/group) were sacrificed byrapid decapitation 20 days after surgery. Brains were removed andfrozen in isopentane cooled in a dry-ice ethanol bath. Brains weresectioned on a cryostat to the rostral portion of the amygdala. Greenfluorescent protein was detected using the NIGHTSEA BlueStarFlashlight and barrier filter glasses (Electron Microscopy Sciences,Hatfield, Pennsylvania). Sections (200 mm thick) containing GFPfluorescence in the amygdala were placed on a glass coverslip,and punches of GFP-enriched amygdala from the frozen tissuesections were taken under light-emitting diode visualization of GFP.Punches were stored on dry-ice or at�801C. RNA was extracted fromthe tissue punches using a Qiagen MicroRNeasy Plus Kit. Reversetranscription (with 28 ng of RNA as starting material) and quantitativePCR were performed as above. For in vivo quantitation, GAPDH wasused as a reference gene. GADPH Forward primer: GGTGAA-GGTCGGTGTGAACG; Reverse primer: CTCGCTCCTGGAAGATGGTG.

Statistical AnalysisFor comparison of the mean values between groups, statistical

evaluation was performed using analysis of variance with Cyclo-sporine A versus vehicle or AAV-Scr versus AAV-shCnB as between-subject factors. Knockdown efficacy was quantified using REST 2009software (Qiagen). p values � .05 were considered statistically signi-ficant. All data are presented as means� standard error of the mean.

Results

Systemic CsA Administration Induces a SignificantAnxiety-like Phenotype

To evaluate the effect of chronic, systemic inhibition of calcineurinactivity on behaviors related to anxiety and depression, we treated

www.sobp.org/journal

Figure 1. Anxiety-like behavior in elevated plus maze and light/dark box in mice treated chronically with cyclosporine A. (A) Percent time spent in and (B)number of entries into open arms in the elevated plus maze. (C) Time spent in the dark side and (D) number of entries into the dark side in the light/darkbox. Data are expressed as mean � SEM, n ¼ 7 to 12 per group. *p � .05; ***p � .001.

4 BIOL PSYCHIATRY 2014;]:]]]–]]] Y.S. Mineur et al.

mice peripherally with CsA and then tested the animals in theelevated plus maze, light/dark test, the open field (anxiety-likebehaviors), forced swim test, and tail suspension test (depression-like behaviors). Locomotion was then assessed.

In the elevated plus maze, systemic injection of CsA significantlydecreased the time spent in the open arms (F1,18 = 18.12, p � .01;Figure 1A) but the total number of entries was unchanged (F � 1;Figure 1B). In the light/dark test, CsA-treated mice spent more timein the dark compartment compared with vehicle-treated mice (F1,17¼ 26.47, p � .001; Figure 1C). The number of entries into the lightcompartment was decreased in CsA-treated mice compared withvehicle injection (F1,17 ¼ 5.69, p � .05; Figure 1D), and the animalswere also faster to enter the dark compartment (F1,17 ¼ 6.41, p �.05; data not shown). In a square open field, the mice treated withCsA exhibited a greater time engaging in thigmotaxis (time spentnext to the walls of the open field: F1,22 ¼ 11.59, p ¼ .01; Figure 2A),and the overall freezing time was also increased following treat-ment (F1,22 ¼ 10.57, p� .05; Figure 2B). Finally, the time to initiate afeeding episode was also significantly increased in the noveltysuppressed feeding test (F1,22 ¼ 37.91, p � .0001; Figure 2C) withno change in body weight following food restriction and nodifference in food intake in home cages (F � 1; Figure 2D,E).

In the tail suspension test, only subtle effects were detected andthe difference in time spent immobile did not reach significance(Figure 3A). Cyclosporine-A injected mice showed a significant

Figure 2. Anxiety-like behavior in the open field and novelty-suppressed feedthigmotaxis zone (within 5 cm of walls) and (B) amount of time spent freezingnovelty-suppressed feeding test. (D) Body weight after 24-hour fasting. (E) Fofeeding testing. Data are expressed as mean � SEM, n ¼ 7 to 12 per group.

www.sobp.org/journal

increase in immobility time in the forced swim test (F1,19 ¼ 7.6; p�.05; Figure 3B), however, and a significant difference was onlyobserved after at least 5 minutes of testing (0 to 5 min: F � 1; 5 to10 min: F1,22 ¼ 5.03, p � .05; 10 to 15 min: F1,22 ¼ 13.51, p � .01).

A significant decrease in locomotor activity was measured inmice treated chronically with CsA (F1,22 ¼ 50.8, p � .0001;Figure 3C).

Knockdown of Calcineurin BTo measure knockdown of CnB in vitro, we used a mouse

neuroblastoma cell line, Neuro 2a (ATTC CCL-131), whichendogenously expresses calcineurin. Transfection with pAAV-shCnB or pAAV-Scr resulted in 30% to 50% of cells expressingGFP. Quantitation of mRNA levels was done using quantitativereal-time PCR. With 6000 iterations of randomized comparisons,CnB mRNA from shCnB-transfected N2a cells was 67 � 12% ofshScr-transfected levels (p � .01). To test for knockdown in vivo,mice were infused with AAV-Scr or AAV-shCnB into the amyg-dala. A representative example of the spread of the virus, asdetermined by GFP expression, is shown in Figure 4. Quantita-tive PCR from the amygdala showed that CnB mRNA in shCnB-infused animals was 69 � 10% of Scr-infused animals (p � .001).Calcineurin B mRNA in an adjacent cortical area was unchangedin shCnB-infused animals (100 � 11% of Scr-infused animals;Figure 4D).

ing in mice treated chronically with cyclosporine A. (A) Time spent in thein a square open field. (C) Time to initiate the first feeding episode in theod consumed in the home cage for 5 minutes after novelty-suppressed**p � .01.

Figure 3. Depression-like behavior in mice treated chroni-cally with cyclosporine A. Immobility time in the (A) tailsuspension and (B) forced swim tests. (C) Locomotoractivity in an open field. Data are expressed as mean �SEM, n ¼ 7 to 12 per group. *p � .05, ***p � .001.

Y.S. Mineur et al. BIOL PSYCHIATRY 2014;]:]]]–]]] 5

AAV-shCnB-Mediated Knockdown of Calcineurin B in theAmygdala Increases Anxiety-like and Depression-likeBehaviors in Mice

To determine whether the changes in anxiety-like anddepression-like behavior following chronic, systemic CsA treat-ment could be caused by a decrease in calcineurin activity in aspecific brain area, we used AAV to express shRNAs targetingcalcineurin in the amygdala, a brain region involved in the controlof anxiety and depression and with a high level of calcineurinactivity. Mice that received AAV-Scr or AAV-shCnB infusions intothe amygdala were tested in the same battery of behavioral testsused to assess anxiety-like and depression-like behavior in CsA-treated mice. A significant decrease in the time spent in the openarms was observed in the mice that received AAV-shCnB infusion

Figure 4. Viral vector-mediated calcineurin B (CnB)knockdown. (A) Low-magnification image of the amyg-dala after infusion with adeno-associated virus-short hair-pin RNA targeting calcineurin A. Scale bar ¼ 500 mm.(B) Higher magnification image of field shown in (A).Virally infused cells are found throughout the amygdalacomplex. Scale bar ¼ 100 mm. (C) Diagram demonstratingthe spread of viral infusion. (D) Quantitative polymerasechain reaction revealed a significant decrease in CnBmessenger RNA levels in the amygdala, but not adjacentcortex, of adeno-associated virus-short hairpin RNA target-ing calcineurin A-infused animals compared with adeno-associated virus-Scr-infused animals. ***p � .001. BLA,basolateral amygdala; LA, lateral amygdala. (Reprintedfrom Paxinos and Watson [33] with permission fromElsevier ©2008.)

into the amygdala compared with mice with AAV-Scr infusioninto the amygdala (F1,22 ¼ 19.42, p � .001; Figure 5A), while thetotal number of entries was not significantly changed (F � 1;Figure 5B).

In the light/dark test, AAV-shCnB-infused mice spent a greatertime in the dark chamber (F1,22 ¼ 8.39, p � .01; Figure 5C) andmade fewer entries into the light chamber (F1,22 ¼ 9.35, p � .01;Figure 5D) compared with AAV-Scr-infused mice and were fasterto enter the dark compartment (F1,22 ¼ 5.98, p � .05; data notshown).

In the open field, time spent engaging in thigmotaxis wasincreased (F1,22 ¼ 11.31, p � .01; Figure 6A), as was freezing time(F1,22 ¼ 15.38, p � .001; Figure 6B). Conversely, in the novelty-suppressed feeding test, animals that received AAV-shCnB

www.sobp.org/journal

Figure 5. Anxiety-like behavior following local knockdown (KD) of calcineurin in the amygdala. (A) Percent time spent in and (B) number of entries intoopen arms in the elevated plus maze. (C) Time spent in the dark side and (D) number of entries into the dark side in the light/dark box for groups of micewith local KD of calcineurin in the amygdala. Data are expressed as mean � SEM, n ¼ 12 per group. *p � .05; **p � .01.

6 BIOL PSYCHIATRY 2014;]:]]]–]]] Y.S. Mineur et al.

infusion into the amygdala were slightly slower to initiate feeding,but this difference did not reach significance (F1,22 ¼ 3.8, p ¼ .06;Figure 6C). No differences were observed in the amount of weightlost after fasting or the amount of food consumed in the homecage (Figure 6D,E).

In the tail suspension test, knockdown of calcineurin B in theamygdala somewhat increased immobility compared with AAV-Scr infused mice, but this difference did not reach significance(F1,22 ¼ 4.07, p ¼ .06; Figure 7A). In the forced swim test,stereotaxic injection of AAV-shCnB significantly increased theduration of immobility (F1,24 ¼ 62.350, p � .001; Figure 7B).

No significant change in locomotor activity was observedfollowing knockdown of CnB in the amygdala (F1,14 ¼ 2.53; p � .1;Figure 7C).

Discussion

The current set of experiments demonstrates that chronicadministration of CsA results in a generalized increase of anxiety-like behavior across several paradigms. Results in tests ofdepression-like behavior were not as striking, although thechange in immobility in the forced swim test suggested thatthere was a depression-like effect of chronic CsA treatment.Interestingly, very similar phenotypes were seen following localknockdown of calcineurin activity in the amygdala by viral-mediated delivery of shRNAs targeting the calcineurin B subunit.Taken together, these results suggest that inhibition of

Figure 6. Anxiety-like behavior in square open field and hyponeophagia in micin the thigmotaxis zone (within 5 cm of walls) and (B) amount of time spent frethe novelty-suppressed feeding test. (D) Body weight after 24-hour fasting. (E)feeding testing. Data are expressed as mean � SEM, n ¼ 12 per group. **p �

www.sobp.org/journal

calcineurin in amygdala alters local activity, is sufficient torecapitulate the effect of systemic cyclosporine administration,and can increase anxiety-like and depression-like behaviors. It isworth noting that calcineurin activity in other brain areas mayalso contribute to anxiety-like or depression-like behaviors, butthis possibility was not investigated in the current study.

One likely possibility is that antagonism of calcineurin canpotentiate neuronal activity in the amygdala, thereby increasingstress-related behaviors. Studies in rats have shown that blockadeof calcineurin activity in the amygdala prevents reversal ofsynaptic potentiation and extinction of fear memory (32). Incontrast, the expression of fear memory is correlated with anincrease in the activity of calcineurin (32). Thus, CsA mayselectively disrupt depotentiation in the amygdala and this mayprolong anxiety and fear states, leading to the affective pheno-types measured here.

The current study knocked down CnB in all neuronal subtypesof the amygdala. It is not known whether calcineurin is critical forfunction of specific classes of amygdala neurons or whetheralterations in calcineurin activity change the balance of excitatoryand inhibitory signaling in this structure. Future studies targetingspecific neuronal subtypes will be necessary to dissect the role ofcalcineurin activity in gamma-aminobutyric acid and glutamateneurons of the BLA.

Previous studies have reported that patients treated with CsAto prevent rejection after organ transplantation display increasedsymptoms of depression and anxiety (3,4,40–42). While invasive

e following knockdown (KD) of calcineurin in the amygdala. (A) Time spentezing in a square open field. (C) Time to initiate the first feeding episode inFood consumed in the home cage for 5 minutes after novelty-suppressed.01, ***p � .001.

Figure 7. Depression-like behavior in mice followinglocal knockdown (KD) of calcineurin in the amygdala.Immobility time in the (A) tail suspension and (B) forcedswim tests. (C) Locomotor activity in an open field. Dataare expressed as mean � SEM, n ¼ 12 per group.***p � .001.

Y.S. Mineur et al. BIOL PSYCHIATRY 2014;]:]]]–]]] 7

surgery, as well as the stress of serious illness, is likely to play apivotal role in changes in mood, these reports suggest thattreatment with the calcineurin inhibitor CsA may also contrib-ute to affective changes in these subjects. The results of thecurrent study show that both antagonism of calcineurin byperipheral administration of CsA and genetic downregulation ofcalcineurin mRNA expression in the amygdala promote anxiety-like and depression-like behaviors, strongly suggesting that CsAtreatment in transplant patients could contribute to theincrease in mood disorders seen in these patients. Previousstudies have suggested that increased calcineurin activityresults in greater sensitivity to classical antidepressants (43).In addition, polymorphisms in the gene encoding the catalyticsubunit of calcineurin have been associated with a greater riskof bipolar disorder (44). Taken together, these studies suggestthat calcineurin activity in the amygdala is essential for normalmood regulation.

In summary, blockade of calcineurin activity in the amygdalaappears to result in an increase in symptoms related to affectivedisorders. Therefore, the development of calcineurin antagoniststhat do not penetrate into the brain or immunosuppressants thatdo not target calcineurin activity would be a significant advancethat would minimize the risk of anxiety and mood symptoms inorgan transplant patients and could improve clinical outcomes inthese patients.

This work was supported by Grants DA14241, MH77681, andDA033945 from the National Institutes of Health and the State ofConnecticut, Department of Mental Health and Addiction Services.

The authors declare no biomedical financial interests or potentialconflicts of interest.

1. Calne RY, Rolles K, White DJ, Thiru S, Evans DB, McMaster P, et al.(1979): Cyclosporin A initially as the only immunosuppressant in 34recipients of cadaveric organs: 32 kidneys, 2 pancreases, and 2 livers.Lancet 2:1033–1036.

2. Calne RY, White DJ, Thiru S, Evans DB, McMaster P, Dunn DC, et al.(1978): Cyclosporin A in patients receiving renal allografts fromcadaver donors. Lancet 2:1323–1327.

3. Kahan BD, Flechner SM, Lorber MI, Golden D, Conley S, Van Buren CT(1987): Complications of cyclosporine-prednisone immunosuppressionin 402 renal allograft recipients exclusively followed at a single centerfor from one to five years. Transplantation 43:197–204.

4. de Groen PC, Aksamit AJ, Rakela J, Forbes GS, Krom RA (1987): Centralnervous system toxicity after liver transplantation. The role of cyclo-sporine and cholesterol. N Engl J Med 317:861–866.

5. Katon WJ (2003): Clinical and health services relationships betweenmajor depression, depressive symptoms, and general medical illness.Biol Psychiatry 54:216–226.

6. Ormel J, Rijsdijk FV, Sullivan M, van Sonderen E, Kempen GI (2002):Temporal and reciprocal relationship between IADL/ADL disability anddepressive symptoms in late life. J Gerontol B Psychol Sci Soc Sci 57:P338–P347.

7. Patten SB (2001): Long-term medical conditions and major depressionin a Canadian population study at waves 1 and 2. J Affect Disord 63:35–41.

8. van den Brink RH, van Melle JP, Honig A, Schene AH, Crijns HJ,Lambert FP, Ormel J (2002): Treatment of depression after myocardialinfarction and the effects on cardiac prognosis and quality of life:Rationale and outline of the Myocardial INfarction and Depression-Intervention Trial (MIND-IT). Am Heart J 144:219–225.

9. Davis M, Whalen PJ (2001): The amygdala: Vigilance and emotion.Mol Psychiatry 6:13–34.

10. Vyas A, Mitra R, Shankaranarayana Rao BS, Chattarji S (2002): Chronicstress induces contrasting patterns of dendritic remodeling in hippo-campal and amygdaloid neurons. J Neurosci 22:6810–6818.

11. Drevets WC, Videen TO, Price JL, Preskorn SH, Carmichael ST, RaichleME (1992): A functional anatomical study of unipolar depression.J Neurosci 12:3628–3641.

12. Sheline YI, Gado MH, Price JL (1998): Amygdala core nuclei volumesare decreased in recurrent major depression. Neuroreport 9:2023–2028.

13. Drevets WC (2001): Neuroimaging and neuropathological studies ofdepression: Implications for the cognitive-emotional features of mooddisorders. Curr Opin Neurobiol 11:240–249.

14. Wolfensberger SP, Veltman DJ, Hoogendijk WJ, Boomsma DI, de GeusEJ (2008): Amygdala responses to emotional faces in twins discordantor concordant for the risk for anxiety and depression. Neuroimage 41:544–552.

15. Wallace TL, Stellitano KE, Neve RL, Duman RS (2004): Effects of cyclicadenosine monophosphate response element binding protein over-expression in the basolateral amygdala on behavioral models ofdepression and anxiety. Biol Psychiatry 56:151–160.

16. Beck CH, Fibiger HC (1995): Chronic desipramine alters stress-inducedbehaviors and regional expression of the immediate early gene, c-fos.Pharmacol Biochem Behav 51:331–338.

17. Mineur YS, Picciotto MR, Sanacora G (2007): Antidepressant-like effectsof ceftriaxone in male C57BL/6J mice. Biol Psychiatry 61:250–252.

18. Clark CP, Brown GG, Archibald SL, Fennema-Notestine C, Braun DR,Thomas LS, et al. (2006): Does amygdalar perfusion correlate withantidepressant response to partial sleep deprivation in major depres-sion? Psychiatry Res 146:43–51.

19. Clipstone NA, Fiorentino DF, Crabtree GR (1994): Molecular analysis ofthe interaction of calcineurin with drug-immunophilin complexes.J Biol Chem 269:26431–26437.

20. Husi H, Luyten MA, Zurini MG (1994): Mapping of the immunophilin-immunosuppressant site of interaction on calcineurin. J Biol Chem 269:14199–14204.

21. Hashimoto Y, Perrino BA, Soderling TR (1990): Identification of anautoinhibitory domain in calcineurin. J Biol Chem 265:1924–1927.

22. Kissinger CR, Parge HE, Knighton DR, Lewis CT, Pelletier LA, TempczykA, et al. (1995): Crystal structures of human calcineurin and the humanFKBP12-FK506-calcineurin complex. Nature 378:641–644.

www.sobp.org/journal

8 BIOL PSYCHIATRY 2014;]:]]]–]]] Y.S. Mineur et al.

23. Rusnak F, Mertz P (2000): Calcineurin: Form and function. Physiol Rev80:1483–1521.

24. Buttini M, Limonta S, Luyten M, Boddeke H (1993): Differentialdistribution of calcineurin A alpha isoenzyme mRNA’s in rat brain.Naunyn Schmiedebergs Arch Pharmacol 348:679–683.

25. Polli JW, Billingsley ML, Kincaid RL (1991): Expression of thecalmodulin-dependent protein phosphatase, calcineurin, in rat brain:Developmental patterns and the role of nigrostriatal innervation. BrainRes Dev Brain Res 63:105–119.

26. Yakel JL (1997): Calcineurin regulation of synaptic function: From ionchannels to transmitter release and gene transcription. Trends Phar-macol Sci 18:124–134.

27. Zhu Y, Yakel JL (1997): Calcineurin modulates G protein-mediatedinhibition of N-type calcium channels in rat sympathetic neurons.J Neurophysiol 78:1161–1165.

28. Victor RG, Thomas GD, Marban E, O'Rourke B (1995): Presynapticmodulation of cortical synaptic activity by calcineurin. Proc Natl AcadSci U S A 92:6269–6273.

29. Mansuy IM (2003): Calcineurin in memory and bidirectional plasticity.Biochem Biophys Res Commun 311:1195–1208.

30. Mineur YS, Abizaid A, Rao Y, Salas R, DiLeone RJ, Gundisch D, et al.(2011): Nicotine decreases food intake through activation of POMCneurons. Science 332:1330–1332.

31. Hommel JD, Sears RM, Georgescu D, Simmons DL, DiLeone RJ (2003):Local gene knockdown in the brain using viral-mediated RNAinterference. Nat Med 9:1539–1544.

32. Lin CH, Lee CC, Gean PW (2003): Involvement of a calcineurin cascadein amygdala depotentiation and quenching of fear memory. MolPharmacol 63:44–52.

33. Paxinos G, Franklin KBJ (2008): The Mouse Brain in StereotaxicCoordinates. Waltham: Elsevier Academic Press.

www.sobp.org/journal

34. Crawley JN (2008): Behavioral phenotyping strategies for mutant mice.Neuron 57:809–818.

35. Caldarone BJ, King SL, Picciotto MR (2008): Sex differences in anxiety-like behavior and locomotor activity following chronic nicotineexposure in mice. Neurosci Lett 439:187–191.

36. Crawley JN (1985): Exploratory behavior models of anxiety in mice.Neurosci Biobehav Rev 9:37–44.

37. Crawley J, Goodwin FK (1980): Preliminary report of a simple animalbehavior model for the anxiolytic effects of benzodiazepines. Phar-macol Biochem Behav 13:167–170.

38. Mineur YS, Somenzi O, Picciotto MR (2007): Cytisine, a partial agonist ofhigh-affinity nicotinic acetylcholine receptors, has antidepressant-likeproperties in male C57BL/6J mice. Neuropharmacology 52:1256–1262.

39. Prut L, Belzung C (2003): The open field as a paradigm to measure theeffects of drugs on anxiety-like behaviors: A review. Eur J Pharmacol463:3–33.

40. Jindal RM, Joseph JT, Morris MC, Santella RN, Baines LS (2003):Noncompliance after kidney transplantation: A systematic review.Transplant Proc 35:2868–2872.

41. Sato Y, Onaka T, Kobayashi E, Seo N (2007): The differential effect ofcyclosporine on hypnotic response and pain reaction in mice. AnesthAnalg 105:1489–1493.

42. Telarovic S, Telarovic S, Mihanovic M (2007): [Cyclosporine-induceddepressive psychosis in a liver transplant patient: A case report]. LijecVjesn 129:74–76.

43. Crozatier C, Farley S, Mansuy IM, Dumas S, Giros B, Tzavara ET (2007):Calcineurin (protein phosphatase 2B) is involved in the mechanisms ofaction of antidepressants. Neuroscience 144:1470–1476.

44. Mathieu F, Miot S, Etain B, El Khoury MA, Chevalier F, Bellivier F, et al.(2008): Association between the PPP3CC gene, coding for the calcineuringamma catalytic subunit, and bipolar disorder. Behav Brain Funct 4:2.