L E T ' S T A L KC A N C E R 2 0 2 0 C A N C E R I N T H E 2 1 S T C E N T U R Y

MAY 28-29 2020

L E T ' S T A L K C A N C E R 2 0 2 0

In Partnership with 

National Sponsor

Front cover credits: Unpublished pancreatic cancer organoid image courtesy of Ileana Co

L E T ' S T A L K C A N C E R 2 0 2 0

WELCOME NOTEDear students, teachers and members of the cancer research community: Let’s Talk Science and Canadian Cancer Society’s Research Information Outreach Team are pleasedto present Let’s Talk Cancer: Cancer in the 21st Century. We are excited to host our 5th annualevent in a virtual format, accessible to students across Canada. Cancer is a disease that has affected many families and individuals around the world. In the pastcentury, there have been several developments in cancer research that have greatly improved bothour understanding of different cancers, as well as the therapeutic landscape of cancer treatments.However, there is still much we do not know about cancer and it is important that we continue toask questions, build on current research and push the boundaries of scientific innovation. There isstill a lot of work to do in combating this complex and dynamic disease! Let’s Talk Cancer was developed to inspire the next generation of cancer  researchers byintroducing you to the science behind cancer research. Today, you will hear from a wide range ofcancer researchers in various fields about how the cancer field has progressed. You will learnabout the basics of cancer, the challenges clinicians and researches face, as well as new andexciting technologies - some of which are being developed in pharmaceutical industries today! Youwill also get a chance to test your knowledge through a fun quiz and activity using online dataanalysis tools that cancer researchers regularly use. We encourage you, the next generation ofscientists, engineers, cancer researchers and clinicians, to listen, utilize the resources at hand,participate in the activities and ask a lot of questions through this symposium! Finally, we must acknowledge the support from our partners, sponsors, planning team andvolunteers. This event could not have been possible without the partnership between Let's TalkScience, the Canadian Cancer Society's Research Information Outreach Team, and our nationalsponsor Bayer. We thank our planning team for putting together the programming, talks, quizzes,activities, workbook and online conference logistics despite the uncertain situation we are facing.Their contributions are the reason for the growing success of this symposium and the fuel forinspiring young minds! We hope that you enjoy the symposium and that it may inspire you to continue your education inscience, engineering and technology so that you too can experience our spirit of discovery! Thankyou for your curiosity, and enthusiasm to learn! The Let's Talk Cancer Team

1

ACKNOWLEDGEMENTS

Content TeamZeynep Kahramanoglu

Luke Chung

Kinjal Desai

Ilias Ettayebi

Cornelia Redel

Q&A Team - ContentGarrett Bullivant

Charles Carr

Kira Lai

Support Staff

Q&A Team - LogisticsShanzeh Ahmed

Filza Arshad

Nader Allam

L E T ' S T A L K C A N C E R 2 0 2 0

Lead CoordinatorsJulia Jaramillo

Patty Sachamitr

Megan DeWeerd

Emily Murrell

Katelyn Kozma

Isabela Gonzaga

Roshane Francis

Logistics and Let's Talk ScienceLiaison

Ileana Co

Let's Talk Science Nicole Winter

Emmanuelle Carty

Ana Radmilovic

Isabel Deslauriers

Canadian Cancer Society 

Betty Zou

Let's Talk Cancer organizing committee

2

2

L E T ' S T A L K C A N C E R 2 0 2 0

1 0 : 0 0

A M

W E L C O M E

Julia Jaramillo, MSc

1 0 : 0 5

A M

S E S S I O N 1 : C A N C E R G E N E T I C S A N D

E P I G E N E T I C S

Introduction to Cancer

Kinjal Desai, PhD

Genetics and Epigenetics of Cancer

Kinjal Desai, PhD

Climate Change and Cancer

Cornelia Redel, MSc

Rapid Research Talks

Roshane Francis, PhD candidate

MAY 28, 2020

10AM - 12:30 PM EST

1 1 : 5 5

A M

Q U I Z R E C A P !

D A Y 1 A G E N D A

1 0 : 5 5

A M

B R E A K

1 1 : 0 5

A M

S E S S I O N 2 : C A N C E R H E T E R O G E N E I T Y

Genetic Heterogeneity

Luke Chung, MSc candidate

Functional Heterogeneity

Katelyn Kozma, PhD candidate

Rapid Research Talks

Rochelle McAdam, PhD candidate

1 2 : 2 5

P M

D A Y 1 C L O S I N G R E M A R K S

Julia Jaramillo, MSc

3

L E T ' S T A L K C A N C E R 2 0 2 0

1 0 A M W E L C O M E

Julia Jaramillo, MSc

1 0 : 0 5

A M

S E S S I O N 3 : N E W T O O L S F O R D E T E C T I O N A N D

T R E A T M E N T

Bioinformatics 

Megan DeWeerd, MSc candidate

CRISPR

Megan DeWeerd, MSc candidate

Immunotherapy

Patty Sachamitr, PhD

Radiopharmaceuticals

Emily Murrell, PhD

Liquid Biopsies

Ilias Ettayebi, MSc

Rapid Research Talk

Gabe Gyulay, PhD (Medical Scientific Advisor- Oncology,

Bayer)

MAY 29, 2020

10AM - 12:30 PM EST

1 2 : 0 0

P M

R E L A Y F O R L I F E T A L K

Matt O'Brien

D A Y 2 A G E N D A

1 1 : 1 5

A M

B R E A K

1 1 : 2 5

A M

P U T T I N G I T A L L T O G E T H E R

Activity

1 2 : 0 5

P M

D A Y 2 C L O S I N G R E M A R K S

Julia Jaramillo, MSc

4

Normal cells respond to appropriate signalsNormal cells that become abnormal and acquire the Hallmarks of Cancer can becomecancerous

Mutations in genes can produce abnormal proteins that contribute to the Hallmarks of CancerEpigenetics is a layer of regulation to make sure genes are expressed in only certain cell typesMutations can occur in regulatory regions outside of genes, resulting in incorrect expression ofgenes

INTRODUCTION TO CANCER

GENETICS AND EPIGENETICS OF CANCER

L E T ' S T A L K C A N C E R 2 0 2 0

SESSION 1: CANCER GENETICS ANDEPIGENETICS

Figure 1: Hallmarks of Cancer (Hanahan & Weinberg, 2000) Figure 2: Epigenetics ensures genes are appropriatelyexpressed in different cell types

(Adapted from Australian Academy of Science)

Climate change is an accumulation of long term alteration of temperature and typical weatherpatternsRising temperatures have many consequences in the air, water and soilIn turn, this contributes to our health, through our water, our food and the very air we breatheFactors contributing to climate change also have potential to cause DNA damage, which affectsour risk for developing cancer

CLIMATE CHANGE AND CANCER

5

CLIMATE CHANGE AND CANCER Test your knowledge:What are some ways to reduce outdoor air pollution?

a. Policies and investments supporting cleanertransportb. Energy-efficient housingc. Better municipal waste managementd. All of the above

What can be considered as genotoxicity?

a. A balance between endogenous andexogenous sourcesb. A balance between DNA damage and DNArepairc. An imbalance between endogenous andexogenous sourcesd. An imbalance between DNA damage andDNA repair

The process of the concentration of a poison orchemical increasing as you move up the foodchain is known as:

a. Bioaccumulationb. Biomagnificationc. Increased metabolic ratesd. None of the above

L E T ' S T A L K C A N C E R 2 0 2 0

SESSION 1: CANCER GENETICS ANDEPIGENETICS

6

Figure 3: Environmental factors can damage our DNA andincrease our risk for cancer (created in BioRender)

Molecular features, tumour histology and clinical information are not always the same betweentumours, between patients, or even within a tumourIntertumoural heterogeneity refers to the differences between patients’ tumoursIntratumoural heterogeneity refers to the different cells within a single patients’ tumourGenetic heterogeneity refers to differences resulting from different mutationsFunctional heterogeneity refers to differences independent of mutations (rate of growth candiffer between cells within a tumour). It is represented by the cancer stem cell modelIt's important to understand and detect heterogeneity because it helps with treatments andreveals important details about the tumour, such as drug resistance and metastasis

HETEROGENEITY IN CANCER

L E T ' S T A L K C A N C E R 2 0 2 0

SESSION 2: CANCER HETEROGENEITY

Figure 4: Heterogeneity within the tumour is influenced by many factors.

7

SESSION 2: CANCER HETEROGENEITY

Test your knowledge:Which of the following is an external factor associated with heterogeneity? 

a. Protein biomarker concentrationb. Chromosomal rearrangementsc. Decrease in oxygend. Gene mutation

Which situation fits the Functional Heterogeneity concept better?

a. Genetic instability in cancer cellsb. New tumour generated by cancer stem cellsc. Diverse distribution of blood vessels within the tumourd. Migration of system immune cells to the tumour

Which of the following features in cancer heterogeneity is the easiest to observe? (i.e. largestin size)

a. Genetic codeb. Chromosomesc. Cellular morphologyd. CN Tower

Treatment of tumours results in selection for the following:

a. Resistant clonesb. Metastatic clones c. Highly proliferating clones d. All of the above

Cetuximab is an example of a targeted therapy which targets a cell receptor known as EGFR.This therapy:

a. Kills cells with a growth advantageb. Kills cancer stem cells c. Does not result in relapse d. Prevents clonal sweep

L E T ' S T A L K C A N C E R 2 0 2 0

8

Bioinformatics is a type of computer science used to answer biological questionsDuring Whole Genome Sequencing (WGS), DNA is sheared into small fragments, which areindividually sequenced and then assembled by the computer into one long sequenceSequencing results can be compared to a reference in order to identify genetic aberrations,including mutations

BIOINFORMATICS

Test your knowledge:Given the DNA sequences below, what is the mutation?Normal DNA sequence AGTAGGCTAAGTCAGATCGTumour DNA sequence  AGTAGGCTAGGTCAGATCG a.T>G  c.G>Ab.T>C d.A>G

The two main components include:the guide RNA, which is responsible for targetinga specific region of DNAthe Cas9 protein, which is responsible forcutting the DNA

By providing a normal DNA sequence to serve as atemplate when the cleaved DNA is repaired, genemutations can be correctedWe can also use CRISPR to introduce mutationsthat we want to test experimentally

CRISPR

L E T ' S T A L K C A N C E R 2 0 2 0

SESSION 3: NEW TOOLS FOR DETECTIONAND TREATMENT

9

Figure 5: CRISPR/Cas System (created in BioRender)

sgRNA

Cas9

Test your knowledge:What might be some limitations of using CRISPR in the clinic?

a. Possible off target cuts of the DNA could be dangerousb. Ethical complications of editing DNA that could be passed on to offspringc. Cancer is the result of many mutations and it would be difficult to correct all of themd. All of the above

L E T ' S T A L K C A N C E R 2 0 2 0

SESSION 3: NEW TOOLS FOR DETECTIONAND TREATMENT

The Immune system is our defense against invading pathogens like viruses and bacteria. It alsoprotects us against cancer. Without the immune system, the incidence of cancer would be wayhigherDespite the ability of the immune system to identify and kill cancer cells, cancer still occurs. Thisis because cancer cells have found ways to evade and trick the immune system.Cancer immunotherapy harnesses components of the immune system to treat cancer. Somecancer immunotherapies consist of antibodies that bind to, and inhibit the function of, proteinsexpressed by cancer cells. Other cancer immunotherapies include vaccines and T cell infusions

Lymphocyte c. Natural Killer cells Phagocyte d. T cells

IMMUNOTHERAPY

Test your knowledge:Which class of immune cell is capable of recognizing and ingesting invaders ?

a.b.

What kind of immunotherapy involves taking an Immune cell out of a patient’s body, giving itthe ability to recognize a tumour cell and putting it back in the patient’s body?

a. Checkpoint Inhibitor c. CAR-T cell b. Adoptive T cell Transfer d. Oncolytic Viruses

1 0

Radiotracers are radioactive drugs that are designed to target biomarkers on cancer cellsurfaces. Using these drugs, we can take a picture of where the radioactivity is located in thebody to see where specific types of cancer cells areRadiotherapeutics are drugs that use radioisotopes with more harmful types of radioactivity tolocate radioactivity onto cancer cell surfaces for cancer treatmentBy matching diagnostic radiotracers and radiotherapeutics we know that the therapy will targetthe same cancer cells we see during imaging diagnosis. This is an example of “theranostics” andpersonalized medicine

RADIOPHARMACEUTICALS

SESSION 3: NEW TOOLS FOR DETECTIONAND TREATMENT

Test your knowledge:What advantages are there to molecular imaging over other diagnostic techniques (i.e. bloodtests and biopsies)?

a. Non-invasive b. Can tell if cancer has spreadc. Characteristic of the heterogeneous tumour environmentd. All of the above

 Why is radioactivity used to treat cancer?

a. It damages the DNA so the cells dieb. It explodes the cancer cellsc. It turns off cancer genes so the cells are healthy againd. It recruits the immune system to help fight the cancer

L E T ' S T A L K C A N C E R 2 0 2 0

1 1

Figure 6: Overview of radiopharmaceuticals

A biopsy is the main way to diagnose most typesof cancerDuring a traditional tumour biopsy, a smallamount of tissue is removed for examinationunder a microscopeLiquid Biopsy is a test done on a sample ofblood to look for cancer cells from a tumor thatare circulating in the blood or for pieces of DNAfrom tumor cells that are in the bloodThe main advantage of liquid biopsies is thatthey are non-invasive and can be regularlytaken. This can lead to earlier detection of atumour, better monitoring of the tumour, andhopefully faster and better treatment

LIQUID BIOPSIES  

SESSION 3: NEW TOOLS FOR DETECTIONAND TREATMENT

L E T ' S T A L K C A N C E R 2 0 2 0

1 2

Test your knowledge:  Which one of these is an epigenetic mark that can be used to differentiate between normaland tumour cell free DNA?

a. Mutation c. Proteinb. Methylation d. RNA

What is the needle in the haystack problem for liquid biopsies? 

a. Can’t find normal cell free DNA because there is too much tumour cell free DNAb. Can’t find tumour cell free DNA because there is too much normal cell free DNAc. Liquid biopsies are invasive, so we can’t find the tumour cell free DNAd. None of the above

Advantages of Liquid Biopsies is/are:

a. Non-invasive procedureb. Representative of different tumour cellsc. Real-time monitoring of the diseased. All of the above

True or False: Normal cell free DNA has the same methylation as tumour cell free DNA.

a. True b. False

Figure 7: Overview of liquid biopsy

Go to https://blast.ncbi.nlm.nih.gov/Blast.cgiClick Nucleotide BLASTCheck “Align two or more sequences”Copy and paste the normal DNA sequence (found inpage 17) into the first box (include the header)

1.2.3.4.

What is the mutation?

a. A>C  b. G>Tc. T>G  d. C>T

SYNOPSISYou are a cancer researcher. Your task is to identify and therapeutically target mutations that cause brain cancer.

L E T ' S T A L K C A N C E R 2 0 2 0

1 3

Step 1: Identify the mutationCompare DNA from patient’s tumour to normal DNA using BLAST

Step 2: Identify the geneCompare the DNA sequence to the human gene database

Repeat 1 & 2 aboveUncheck "Align two or more sequences"Copy and paste the normal DNA sequence into the box(include the header)

1.2.3.

What is the gene?

a. CDKN2A  b. TP53 c. EGFR d. CDK1

5. Copy and paste the tumour DNA sequence (found inpage 17) into the second box (include the header)6. Optimize for “highly similar sequences (megablast)”7. Click BLAST8. Click Alignments & scroll down

4. Type "Homo sapiens (taxid:9606)" in the organism box5. Optimize for "somewhat similar sequences (blastn)"6. Click BLAST

ACTIVITY: PUTTING IT ALL TOGETHER

Go to http://mutationtaster.org/ Enter the following information:

Gene: EGFR Transcript: Select ENST00000275493   Position/snippet refers to: coding sequence (ORF) Alteration: tccga[g/t]acgaagc Click continue!

Go to https://www.cbioportal.org/  Select "CNS/Brain" Select "Glioblastoma Multiforme (TCGA, PanCancer Atlas) " Click "Query by Gene " Type in "EGFR" into the "Enter Genes" box Click "Submit Query"

Step 3: Predict the effect of the mutationDoes the mutation cause a change in the amino acid sequence of the protein?Normal 3 letter code: GACTumour 3 letter code: TAC a. YESb. NO Hint: use the amino acid codon table in the resources section (page 17). Is the mutation predicted to be damaging?1.2.

i.ii.iii.iv.v.

a. YESb. NO How frequently is this gene altered in glioblastoma (a primary brain cancer)?1.2.3.4.5.6.

a. 17% c. 53%b. 25% d. 78%

L E T ' S T A L K C A N C E R 2 0 2 0

1 4

ACTIVITY: PUTTING IT ALL TOGETHER

Step 4: Determine if the mutation causes cancerWhat can we use to test this?

a. DNA sequencing c. Immunotherapyb. Liquid biopsy d. CRISPR

You  introduce the EGFR mutation by editing the gene with CRISPR. You find that the cellscontaining the mutation divide faster than normal cells (no mutation). You also observe that,unlike the normal cells, the cells harbouring the EGFR mutation form tumours in models. Step 5: Therapeutically target the mutationHow can we target EGFR to stop the tumour cells from growing?a. Use an agonist that activates EGFR c. Both a&bb. Use an inhibitor of EGFR d. Neither a nor b You treat the cells with the EGFR inhibitor and find that it preferentially slows the cellscontaining the EGFR mutation. You move on to preclinical models to test the inhibitor ontumour cells derived from patients. You observe an initial reduction in the tumour size, butover time, the tumour returns. Why might the tumour have returned?Think about it! Step 6: Investigate heterogeneity as a possible cause of recurrenceYou find that a small population of cells within the original tumour does not contain the EGFRmutation. Looking at the epigenetic marks, you find that there are fewer "OFF" DNAmodifications in this subpopulation. What could be the result of loss of gene repression?a. Genes are not expressed when they should beb. Genes are expressed when they shouldn't bec. Proteins are not expressed when they should bed. Proteins are expressed when they shouldn't bee. Both a&cf. Both b&d

L E T ' S T A L K C A N C E R 2 0 2 0

1 5

ACTIVITY: PUTTING IT ALL TOGETHER

Step 7: Identify differentially expressed proteins between the two subpopulationsYou find that the subpopulation of cells without the EGFR mutation express high levels of thecell surface protein CD133. According to published research, this protein is not highlyexpressed in normal cells. Step 8: Targeting cancer-specific cell surface proteinsHow can we specifically target cells that have this protein on their surface?

a. CRISPR c. Radioligand therapy e. Both b & cb. Immunotherapy d. Both a & b

You conjugate a radioisotope to an antibody that binds to CD133. When you administer it inmodels, you find that the only tumour cells left are those with the EGFR mutation. What should we do next?

a. Surgically remove the tumour cells containing the EFGR mutationb. Use the EGFR inhibitor alone next time because the tumour only recurred laterc. Use the EGFR inhibitor in combination with the radiopharmaceutical to eliminate bothsubpopulations within the tumourd. None of the above

The combination therapy results in tumour eradication, but you still fear recurrence due to asmall subpopulation of cells that are left behind. How can we effectively monitor the patient?

a. Surgical biopsy d. Both a & bb. Radiopharmaceuticals e. Both a & cc. Liquid biopsy f. Both b & c

L E T ' S T A L K C A N C E R 2 0 2 0

1 6

ACTIVITY: PUTTING IT ALL TOGETHER

>Normal DNAACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGAGACGAAGCCACGTGCAAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAACCCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTGGTGACAG >Tumour DNAACCAGTGTGCTGCAGGCTGCACAGGCCCCCGGGAGAGCGACTGCCTGGTCTGCCGCAAATTCCGATACGAAGCCACGTGCAAGGACACCTGCCCCCCACTCATGCTCTACAACCCCACCACGTACCAGATGGATGTGAACCCCGAGGGCAAATACAGCTTTGGTGCCACCTGCGTGAAGAAGTGTCCCCGTAATTATGTGGTGACAG

RESOURCES

L E T ' S T A L K C A N C E R 2 0 2 0

1 7

*U is used in RNA (the intermediate between DNA andprotein). For simplicity, think of U as T in DNA. Figure 8: Amino acid codon table.

Phe = PhenylalanineLeu = LeucineIle = IsoleucineMet = MethionineVal = ValineSer = SerinePro = ProlineThr = ThreonineAla = AlanineTyr = TyrosineHis = Histidine

Gln = GlutamineAsn = AsparagineLys = LysineAsp = Aspartic acidGlu = Glutamic acidCys = CysteineTrp = TryptophanArg = ArginineGly = GlycineStop = Signal that theprotein is done being made

Amino Acids Abbreviations

*U=T

L E T ' S T A L K C A N C E R 2 0 2 0

NOTES ______________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________________

1 8

MEET THE TEAM!

Kinjal Desai, PhD

L E T ' S T A L K C A N C E R 2 0 2 0

Cornelia Redel, MSc, PhD Candidate Cornelia received a BSc and a MSc degree from the University of Wuerzburg, Germany, where

she studied Biochemistry with a focus on molecular and structural biology, respectively. Duringher undergraduate degree, she became interested in MYC, a protein that has functions intumour development, progression and severity across many human cancer types. Both hertheses were focused around MYC, investigating different aspects of its role in cancer cells.Sheis continuing to work on MYC during her doctoral thesis in Dr. Linda Penn's lab at theUniversity of Toronto, where she is investigating the stability and turnover of the MYC proteinand factors that contribute to MYC breakdown. By identifying these factors, she hopes totarget MYC's stability as a new approach in drug development for MYC-dependent cancers.

1 9

Kinjal received her Bachelor of Science from St. Xavier’s College, India, and her Doctorate ofPhilosophy from Dartmouth College, USA. Her thesis work uncovered genetic changes thatmodified a key gene involved in breast cancer, which promotes progression of the disease.This fuelled her interest in understanding how signals within a cell dictate how genes can turnon or off in cancer. She is now a postdoctoral research fellow at the Hospital for Sick Childrenin Toronto, where she works on medulloblastoma, the most commonly occurring malignantbrain tumour in children. Her research goal is to learn more about the reliance of brain cancercells on these key signals in order to develop potential treatments to treat brain cancer. She isalso an instructor at the University of Toronto School of Continuing Studies and has guestlectured at the University of Toronto Molecular Genetics department. Outside of working inthe lab and teaching, Kinjal enjoys baking, tennis, and stand-up comedy.

Zeynep Kahramanoğlu, MSc Zeynep received her B.Sc. at the University of Guelph, specializing in Molecular Biology and

Genetics, and minoring in French. Later, she earned her master’s degree in Pathology andLaboratory Medicine with a collaborative degree in Developmental Biology from WesternUniversity. Her master’s thesis focused on the effects of chemotherapy on late-stage ovariancancer tumour cells and surrounding tumour blood vessels. She currently works as a researchtechnician in a tumour immunology lab. Outside of lab hours, Zeynep is a passionate writerand enjoys kickboxing, dancing, and windsurfing.

MEET THE TEAM!

Luke received an Honours Bachelor of Science in Biophysics from York University in 2013,and he is currently pursuing a MSc in the Sled lab at the Mouse Imaging Centre. Hisresearch focuses on the physiological changes after head trauma, specifically braintemperature. Using magnetic resonance imaging, he aims to develop a non-invasive braintemperature measurement technique to be used in a mouse model of traumatic braininjury. Luke also has a deep interest in cancer research which he hopes to pursue throughclinical training in oncology and radiology. Outside the lab, Luke enjoys practicing variousstreet dance styles as well as powerlifting.

Luke Chung, MSc Candidate

Roshane Francis, PhD Candidate

Katelyn Kozma, PhD Candidate

Katelyn Kozma is a PhD candidate in the department of Molecular Genetics at the Universityof Toronto. Her research interests lie in the field of cancer & genetics. Katelyn's thesis projectinvolves using mouse models of breast cancer to uncover mutations which promote diseasespread and metastatic dissemination. Since metastatic lesions are often genetically dissimilarfrom their originating mammary tumor, identification of such mutations will potentiallyenable identification of novel therapeutic targets. Outside of the lab Katelyn enjoys baking,running and skiing.

L E T ' S T A L K C A N C E R 2 0 2 0

2 0

Roshane received her Bachelor of Science degree from the University of Toronto,specializing in cellular and molecular biology. She is currently pursuing a PhD in theDepartment of Molecular Genetics at the University of Toronto. Her research has focusedon understanding how developmental programs are abnormally reactivated in adults duringgastric cancer. In addition to being a scientist, she loves to sing, travels when she can andenjoys trying out new restaurants.

MEET THE TEAM!

Megan DeWeerd, MSc Candidate Megan received an Honours Bachelor of Medical Science in Biochemistry and Cancer Biology

from Western University in 2019. She is currently an MSc candidate in Dr. Robert Rottapel’slab at the Princess Margaret Cancer Centre in Toronto. Her research focuses on high-gradeserous ovarian cancer (HGSOC); almost every patient with this disease has a mutation in thesame gene, known as TP53. Using a combination of analyses at the gene, RNA, and proteinlevels, Megan hopes to uncover cellular pathways that are reprogrammed by thesemutations, which may lead to new therapeutic targets for ovarian cancer treatment. Sheplans to transfer into the PhD program next year and is passionate about cancer researchand science education. Outside the lab, Megan enjoys baking, reading, and hiking.

L E T ' S T A L K C A N C E R 2 0 2 0

2 1

Rochelle McAdams, PhD Candidate

Isabela Gonzaga, PhD Isabela received her Doctorate in Oncology from Brazilian National Cancer Institute in 2018.

Her thesis was aimed to characterize and investigate the therapeutic potential of cancer stemcells from esophageal squamous cell carcinoma, the 5th cause of death by cancer in Brazil. In2017, she lived 6 months in Toronto for a collaboration in Dr. Daniel de Carvalho’s Lab to testthe efficacy of an epigenetic drug on esophageal cancer stem cells inhibition. After defendingher thesis, she moved back to Toronto as a Post-Doctoral Research Fellow in Dr. Daniel deCarvalho’s Lab at Princess Margaret Cancer Centre, where she is currently working onmolecular mechanisms behind the combination of epigenetic and pro-apoptotic drugs inAcute Myeloid Leukemia.

Rochelle received her Bachelor of Science degree at Queen's University in Kingston. She iscurrently pursuing a PhD at the University of Toronto in the Department of MolecularGenetics. Working at the Research Institute of the Hospital for Sick Children, she uses variousmodels to study the mechanisms of functional heterogeneity in the pediatric tumourmedulloblastoma.

MEET THE TEAM!

Patty received her Doctorate in Stem Cell Biology and Immunology from University ofOxford in 2016, where she investigated the differentiation of immune cells from stemcells for Immunotherapy.  She then moved from the UK to Toronto to pursue a Post-Doctoral Research Fellow in Dr. Peter Dirks’ laboratory at the Hospital for Sick Childrenwhere she was engaged in the discovery and validation of drugs for the treatment of Glioblastoma, an aggressive brain cancer in adults. She currently works as a Scientist inthe Translational Immunology group at Bluerock Therapeutics, a Toronto-based celltherapy company. Outside the lab, Patty is passionate about yoga, scuba diving,travelling and cooking.

L E T ' S T A L K C A N C E R 2 0 2 0

Ilias Ettayebi, MScIlias received his Bachelor of Science in Biomedical Science from University of Guelphand his Master of Science in Medical Biophysics from University of Toronto. He iscurrently conducting research in Dr. Daniel De Carvalho’s laboratory at the PrincessMargaret Cancer Centre. His  interests include colon cancer stem cell biology, and therole of antiviral immunity in targeting cancer stem cells. Outside the lab, Ilias enjoysplaying basketball and hiking.

2 2

Emily received her PhD in Organic Chemistry and Molecular Imaging from WesternUniversity in 2019. Her thesis research involved the design and chemical synthesis oflibraries of compounds which were screened against cancer-specific biomarkers toidentify new radiotracers for cancer imaging. Emily is currently a postdoctoral fellow atthe Brain Health Imaging Centre at CAMH in Toronto, where she synthesizes andevaluates new radiopharmaceuticals for imaging a wide variety of brain illnesses.Outside the lab, Emily enjoys travelling and all kinds of food.

Emily Murrell, PhD

Patty Sachamitr, PhD

MEET THE TEAM!

Gabe received his undergraduate degree in Biology and his PhD in genetics and molecularbiology at McMaster University in Hamilton. He then completed a post-doctoral fellowship inHamilton, where his research focused on cardiovascular disease and prostate cancer. Hejoined Bayer in 2016 as a Medical Science Liaison and is now a Medical Scientific Advisorspecializing in Oncology. He has always been driven by science and found the pharmaceuticalindustry provided the perfect balance for science and business.

L E T ' S T A L K C A N C E R 2 0 2 0

Julia Jaramillo, MSc

Gabe Gyulay, PhD

2 3

Ileana Co, PhD CandidateIleana received a Bachelor's of Applied Science (BASc) in Chemical Engineering, specializing inBioprocess Engineering with a minor in Commerce, at the University of British Columbia. Sheis currently a PhD candidate at the McGuigan Lab for Tissue Engineering at the Institute ofBiomedical Engineering at the University of Toronto. Her PhD work focuses on developingtissue engineered models of pancreatic cancer and immune cells in order to understandtheir role in tumour progression and identify potentially novel therapeutic targets. She is alsothe Finance and Large Events Coordinator for Let's Talk Science (UofT-St.George) and isinvolved in planning other symposia like StemCellTalks. In her spare time, Ileana enjoysreading, hiking and spending time with friends and family through food and travel!

Julia obtained her Bachelor of Medical Sciences degree from Western University, where shespecialized in Biochemistry. She then received her Master of Science degree from theDepartment of Molecular Genetics at the University of Toronto. She now works as a ResearchTechnologist at the Hospital for Sick Children, where she studies an adult brain cancer calledglioblastoma. Outside of the lab and volunteer work, Julia enjoys playing volleyball, traveling,trying new restaurants and spending time with her family - especially her puppy!

OUR SPECIAL GUEST

ABOUT US

The Research Information Outreach Team (R.I.O.T) R.I.O.T is a volunteer group of the Canadian Cancer Society. We are graduatestudents and post-doctoral fellows in cancer research labs who are specificallyfocused on research outreach. Working with the Canadian Cancer Society, wecommunicate the impact of cancer research, including Society-funded research, toyou through public events such as this one, our blog and other communitytalks.The Canadian Cancer Society currently supports RIOT teams across Canada –Halifax, Montreal, Calgary, London, Toronto, Windsor, Ottawa, Hamilton andKingston. Since 2011, our Toronto team has been dedicated to raising awarenessabout the progress and promise of cancer research to our city and the surroundingGTA.

Let's Talk Science Let’s Talk Science is a national charitable organization committed to building youthinterest and engagement in science, engineering and technology. It is run out ofover 40 university and college campuses across the country. At the U of T St.George site, we mobilize graduate student volunteers studying science, technology,engineering and math (STEM) to do hands-on/minds-on science activities withchildren and youth. For more Let's Talk Science activities, check out our website:https://lts.escalator.utoronto.ca/home/

L E T ' S T A L K C A N C E R 2 0 2 0

2 4