By drawing a picture describe the flow of genetic information from DNA to a protein.

What is the function of RNA?

Transfers or relays genetic information

What is the product of transcription?

mRNA

Where in the cell does transcription take place?

Nucleus

What is the product of translation?

A protein

Where in the cell does translation take place?

At the ribosome

True or false: During transcription, mRNA is being

synthesized from both sides (both backbones) of DNA.

False: mRNA is a complement to only one side of DNA

What determines which amino acid is brought to the ribosome during translation?

The mRNA codon – use your codon chart.

Remember 1 codon = 1 amino acid!

What bring the amino acids to the ribosome during translation?

tRNA

Given the DNA sequence find the mRNA sequence and the amino acid sequence:

TACGGACAC

DNA: TACGGACACmRNA: AUGCCUGUGA.A.: Met-Pro-Val

Removing a nucleotide from a DNA sequence is called ____________ mutation.

Frameshift (deletion)

What mutation is shown below:

ATTGGCTATCCGATTGGGTATCCG

Point mutation (also called substitution)

What is the major problem that could result from a mutation?

An abnormal protein

If a mutation does not cause a change in the amino acid sequence it is called a:

Silent mutation

Name 1 benefit of genetic engineering.

• helps to determine paternity• identify a carrier of a particular

gene • solve a crime

What process or technique is used to help researchers analyze a person’s DNA and compare the sequence to other organisms?

Gel electrophoresis

What is the term used to describe which genes are turned “off and on” in order to synthesis necessary proteins for the organism?

Gene expression

When cloning a mouse, how many mice does the process require?

3 – A donor somatic cell (the cell being cloned), a donor egg cell and a surrogate.

The nucleus is removed from the donor egg cell and the somatic cell nucleus is implanted in the surrogate.