Elements of BiotechnologyUnit 4

DNA Fingerprinting

Forensic & Parental

1

DNA Fingerprinting & Forensics

• History

• Uses of DNA Profiling

• Hypervariable DNA sequences examined (RFLPs, VNTRs, STRs, SNPs, mitochondrial DNA, Y chromosomal DNA)

• Methods (Southerns & PCR)

• Statistical considerations

• Technical considerations

• Databases and Privacy

2

DNA Fingerprinting

• You're 99.9% identical

• But of course, you are unique--in a genome of three billion letters, even a 0.1 % difference translates into three million differences.

• These differences (or polymorphisms) reside in several places in the genome, often in microsatellites

• Examples of such polymorphisms include VNTRs, STRs, RFLPs and SNPs

3

DNA Fingerprinting

• Focuses on the 0.1-1.0% of human DNA that is unique

• First described in 1985 by Dr. Alec Jeffreys in England

• DNA evidence is admissible in courts

• Labs such as Cellmark Diagnostics and Lifecodes Corporation are examples of companies which provide such DNA evidence to courts, but states and many U.S. cities have labs for DNA fingerprinting

• Have any of you worked in a crime lab?

4

Uses of DNA fingerprinting• Paternity testing

• Identification of criminals (e.g. murderers, rapists, letter bombers)

• Immigration disputes (family relationships)

• Identification of deceased individuals with mutilated or decomposed bodies (e.g., the military, 9/11 victims)

• Identifying the sperm donor who “decorated” Monica Lewinsky’s blue dress

5

How is DNA fingerprinting done?

• DNA obtained from hair, semen, blood, sweat, saliva, bone or any other tissue (often found at a crime scene)

• Can be done by southern blotting with an appropriate probe or by a PCR method using appropriate primers

• Can use single locus probes/primers or multilocus probes/primers

• DNA can be resolved on a gel or by a capillary electrophoresis system

6

Sequences examined in DNA fingerprinting

• VNTRs-variable number tandem repeats; composed of 8-80 bp repeat units (e.g., [GCGCAATG]n) which are tandemly repeated so that the overall length is 1-30 kb

• STRs-short tandem repeats; composed of 2-7 bp repeat units (e.g., [AC]n) which are tandemly repeated so that the overall length is less than 1 kb

• RFLPs-restriction fragment length polymorphisms

• SNPs-single nucleotide polymorphisms

• Mitochondrial DNA-maternal inheritance, tends to be more stable than nuclear DNA

• Y chromosome DNA- passed from father to son

7

DNA fingerprinting: an example

• D1S80, a VNTR located on human chromosome 1, contains a 16 bp repeat unit

• The number of repeats varies from one individual to the next, and is known to range from 14-41

8

Some examples of DNA fingerprinting

• Paternity cases

• Crime scenes

9

Determining the probability of a match

• Relies on statistics

• Analysis depends upon your ethic background (i.e. African American, Caucasian, Hispanic Asian, etc.)

10

11

Technical Considerations

• Preserve the integrity of DNA sample

• Avoid DNA contamination & degradation

• Avoid incomplete digestions if REs are used

• Use standard hybridization conditions

• Use standard PCR primers and procedures

• Gel analysis is less reproducible than capillary electrophoresis of PCR products

• Difficulties in interpreting bands on a gel or X-ray film

12

DNA databases

• Already in place in the FBI for convicted felons (i.e., CODIS-COmbined DNA Index System, involves 13 STR loci) and the Dept. of Defense for armed service personnel and the Virginia saliva and blood bank of convicted felons

• A national DNA database has been suggested. What do you think?

• Could current or potential employers or insurance companies base decisions they make on this kind of data?

13

Fig. 9.18 Random Amplified Polymorphic DNA (RAPD)

• Use of arbitrary oligonucleotide primers, usually 9-10 nucleotides long, in a PCR of total DNA to distinguish plant cultivars, animal varieties, and microbe isolates

• A PCR product will be produced whenever two of the oligonucleotide primers face one another and are 100-3,000 bp apart

Chromosomal DNA Region of amplified DNA

14

Fig. 9.20 Real Time PCR

• A way to quantitate DNA in a PCR

• Involves the use of SYBR green dye

• SYBR green only binds to and fluoresces with dsDNA

15

Fig. 9.16 Bacterial biosensors

• One example involves using Pseudomonas fluorescens (genetically engineered for bioluminescence) to monitor pollutants

• If pollutants are present in a sample, then cell death occurs and “the light goes out”

lux genes in thechromosomal DNA

16

Fig. 9.5 Bacterial biosensors (another example)

• Green fluorescent protein (GFP) can be used a reporter gene under the control of some inducible promoter (e.g., one that responds to some environmental signal such as a toxin)

• If the signal is present GFP will be produced

17

Molecular Diagnosis of Genetic Disease

• Cystic fibrosis

• Sickle-cell anemia

18

1

What Is GMFOOD?

• = genetically modified

• = changing the gene

19

GENES = information

in the cells that

tell the cells

what to do

20

Genetically Modified Organism-GMO

• A genetically modified organism (GMO) is any organism whose genetic material has been altered using genetic engineering techniques.

• GMOs are the source of genetically modifiedfoods and are also widely used in scientific research and to produce goods other than food.

21

• Genetic modification involves the mutation, insertion, or deletion of genes. Inserted genes usually come from a different species in a form of horizontal gene-transfer. In nature this can occur when exogenous DNA penetrates the cell membrane for any reason. To do this artificially may require:

• attaching the genes to a virus• physically inserting the extra DNA into the nucleus of the intended

host with a very small syringe• with the use of electroporation (that is, introducing DNA from one

organism into the cell of another by use of an electric pulse)• with very small particles fired from a gene gun.• Other methods exploit natural forms of gene transfer, such as the

ability of Agrobacterium to transfer genetic material to plants, or the ability of lentiviruses to transfer genes to animal cells.

22

Uses of GMO

• GMOs are used in biological and medical research, production ofpharmaceutical drugs, experimental medicine (e.g. gene therapy),and agriculture (e.g. golden rice, resistance to herbicides).

• The term "genetically modified organism" does not always imply,but can include, targeted insertions of genes from one species intoanother. For example, a gene from a jellyfish, encoding afluorescent protein called GFP, can be physically linked and thus co-expressed with mammalian genes to identify the location of theprotein encoded by the GFP-tagged gene in the mammalian cell.

• Such methods are useful tools for biologists in many areas ofresearch, including those who study the mechanisms of human andother diseases or fundamental biological processes in eukaryotic orprokaryotic cells.

23

Genetically Modified Foods

Bt brinjal

Bt cotton

24

Background

Bt Brinjal, India’s (and the world’s) first genetically modified food crop has been temporarily stopped in India, thanks to a massive grassroots campaign.

Bt Cotton, however, is being cultivated in many parts of India. Benefits are doubtful, though Doubts exist about its productivity, and has been implicated with negative effects, like resistant test, high water consumption, farmer suicides, etc.

25

Definition

What does Bt stand for?

Bt stands for Bacillus thuringiensis, which is a natural soil bacteria, which secretes a toxin that is deadly to two pests - fruit and shoot borer (FSB, Leucinodes orbonalis) and fruit borer (Helicoverpa armigera).

Eggplant borer :Helicoverpa

armigera

Cotton bollworm:Leucinodesorbonalis

26

Definition

What is a genetic modification?

Insertion of Bt gene in the

Brinjalgenetic code

Produce the Bt Toxin to kill the pest

But is only the gene introduced? No, a PROMOTER and an antibiotic resistance MARKER

GENE are also introduced! 27

DefinitionProtein production occurs at specific times and places

GENE EXPRESSION: A gene creates proteins only

at specific times and locations in an organism, and in very tightly regulated amounts.

Example: Pancreatic cells have genes for producing the insulin protein, and so do cells in the eye.

Specific location

Specific amount

Specific time

Expression is tightly regulated 28

DefinitionRegulation

How does regulation occur?

For a gene to be expressed, specific chemical factors need to bind to a PROMOTER region and other regulatory region in the genetic code upstream of the gene.

AAACCGGTATAATCCCCTGAGTTTGCCGTTAGTAG

Factor binds

promoter

Factor binds regulatory

region Promoter

GeneRegulatory region

29

DefinitionRegulatory region

Therefore a gene is expressed only when specific agents bind to promoter and regulatory regions at specific time and at specific cell types (eye cell vs pancreatic cell).

Though promoter sequence are known, information about regulatory regions and what factors binds to them is mostly unknown.

30

Definition BT Gene insertion

A BT modified brinjal has a BT gene inserted, along with a promoter element(Cauliflower Mosaic Virus (CaMV) promoter)

The promoter is so powerful that it keeps the BT gene expression turned on at full volume at all times in BT Brinjal!

This could lead to metabolic stress as the plant has to keep producing this toxin despite the external conditions.

31

Definition BT Gene insertion

A BT modified brinjal has a BT gene inserted, along with a promoter element(Cauliflower Mosaic Virus (CaMV) promoter)

ACTGTCTATGTA + TACGTATAATGGTAGATTTATATGGG

TAACTGTCTATGTACGTATAATGGTAGATTTATATGGG

Gene

Promoter

BT Gene

BT Gene Promoter

Insertion point

32

The insertion is carried out using an mobile microbial DNA which infects the host cell (for dicotyledons like lugumes, or by a gene gun (gold pellets carrying fragments of DNA), either which performs the random insertion in some of the target cells.

Target cell

Target cellTarget

cell

Microbial Vector

Gene gun

Definition Insertion process

Create primary transformant

33

Definition BT Gene insertion

Microbial Vector has the genetic sequence of toxin present in a part of an insertion sequence.

AACCGTGGTGGGTCCCAATTAGGGTTACCGGGG

Gold Pellet

AA

CG

TTC

CG

TT

The gene gun shoots gold pellets having the sequence of interest

34

Target cell

Target cellTarget

cell

Definition Result of insertion process

Only some of the target cells successfully incorporate the gene

To identify the successfully converted viable cells, an antibiotic resistance marker gene IS ALSO INSERTED

35

DefinitionResistance marker gene

AACCGGTTGGTTGGGTTTGGGGGGGCCGGTTAAA

Insertion sequence

Resistance marker gene

Bt genePromoterSequence

The target cells which successfully incorporate the insert sequence are selected on the basis of their resistance to an

antibiotic

36

Definition Result of insertion process

Target cell

Target cellTarget

cell

Antibiotic

Target cell

Only target cells survive based on

resistance to antibiotics

37

Definition Create final hybrid variety

Primary transformantbacterial plasmid

DNA (pMON10518)

Hybrid varietyMHB 4, 9, 10,

80, 99Backcross

Final varietyBt MHB

Final variety needs high amounts water and fertilisers .

38

Effects

Random insertion

Transformation-induced “unexpected” changes might lead to unexpected production of toxins, allergens, carcinogens (rotenone – Parkinson’s) or teratogens in the transformed cells.Domingo, J.L., Toxicity Studies of Genetically Modified Plants, Critical Rev Food Sc and Nutrition 47: 721-33 (2007)

Antibiotic marker

Can confer antibiotic resistance to gut bacteria and other organisms.

Jumping gene

(plants)

Transgene-vector recombinant DNA had the capacity of ‘jumping into' alien species, it could also ‘jump out' of a transgenic crop and ‘jump into' another species causing gene contamination.

Jumping gene

(animals)

Evidences are now available that show that DNA from GM plants can survive in the human gastrointestinal tract. Netherwood,T. et al Nature Biotechnology 22, 204 - 209 (2004)

39

Advantages?

Yield not shown to increase in Bt

Cotton or GM Soy

Increased use of water for Bt cotton

Increase use of pesticides

Mahyco admits unable to control pests in Gujarat with Bt Cotton

40

Disadvantages

Could lead to genetic

contamination

Will make us dependent on

Monsanto for food

Monoculture will wipe out diversity

Farmers suicides have doubled in Bt

cotton belt in Vidarbha

41

Evidence

Long terms lab tests on rats have

all shown ill-effects

Monsanto / Mahyco uses their

own datasets to show yield

increase

Long term human tests not done

Monsanto made tests only on few

rats (10) for only 3 months

42

EvidenceNon-target effects of GM food crops

•21 reported harmful environmental effects; •44 reported unexpected changes in plant physiology;•20 reported unpredicted changes in plant morphology; •6 reported a decrease in the food or feed quality•4 reported scrambling of both the transgene and host DNA

Effect on animals(a) Arpad Putszai paper in the Lancet, showed the unpredicted changes (b) in the gastro-intestinal mucosa of rats fed with GM potato; (c) A 90-day internal company study on rats fed with MON863 Bt-maize showed decreased body-weight and severe toxic effects in the liver and kidneys;(c) a 20-week feeding study by the Austrian Federal Ministry of Health revealedlower fertility and reduced birth weight in mice fed with Bt-maize;

(d) a study carried out in the Italian government’s National Institute of Research on Food and Nutrition showed that very young and old mice fed with Bt-maize (MON810) for 90 days were immunologically compromised

43

Future DirectionsDo we really need this?

We already have varieties

Benefit to corporations

Danger to consumers

Negative effects on farmers

44

Future Directions

Tissue specific expressions

(instead everywhere like root)

Chloroplast transformation (instead of nuclear

transformation)

Use safer promoters

(CaMV promoter aggressive, similarity

to HIV)

Site-directed, non-random insertion

(Gene stacking

Golden rice)

45

Future Directions

GM potato, tomato, rice,

everything in the waiting

BRAI act will make it illegal for ‘non-

scientists’ to question GM

Loss of diversity will make crops

susceptible

Control of food for the world

46

Dolly

The first successful cloned animal

47

What was Dolly?

• In 1997 Dolly the sheep became the first vertebrate cloned from the cell of an adult animal. Not only was this a remarkable scientific breakthrough but it immediately gained interest and concern from around the world on the future of cloning technology as it would effect humans.

48

• Dolly the sheep was successfully cloned in Britain in 1996 by the scientist “Ian Wilmut” and was put down in February 2003 after developing a lung infection and arthritis.

• Dolly was a genetic copy of the Finn Dorset ewe. • Her birth, more than 10 years ago showed that nuclei from specialized

adult cells can be reprogrammed into all the cells of an organism. • The technique that led to Dolly is called• somatic cell nuclear transfer and has• remained essentially unchanged over• the last decade.

Dolly: The Cloning of a Sheep

492

Topics of Discussion

• What is cloning?

• Methods of cloning

• Dolly in detail

• Dolly’s probability

• Today’s legality

• The future of cloning

• Ethical final questions

50

What is cloning?

• Reproductive cloning- The entire animal is produced from a single cell by asexual reproduction. This would allow for the creation of a human being who is genetically identical to another.

• Therapeutic cloning- Broader use of the term “cloning.” Does not create a new genetically identical individual. Research includes therapy for human mitochondria disease and others that could replace damaged or diseased tissues without the risk of rejecting another’s tissue. Could create new skin tissue for burn patients.

51

Other types of cloning

– Multiple copies of genes or gene fragments, repeating nucleotide sequences

– Single cell organisms, like bacteria and fungi. This includes fermentation processes for production of bread, beer, and wine.

– Entire plant asexual replication

– Natural cloning occurs in sexual reproduction, when the embryo splits in two to produce twins.

52

Methods of cloning

– Embryo splitting- Artificially splitting a single embryo at a very early stage of development. In the natural process this would create twins. However, because this is done at an early stage and there are usually less than eight cells you can only make a few clones. Both the nuclear genes and mitochondria genes would be identical.

53

Methods of cloning

– Nuclear replacement- Genetic material (nucleus from embryonic, fetal, or adult cell) is removed and placed into an unfertilized egg or embryo, whose nucleus has been removed. In this case the nuclear genes remain the same but the mitochondria DNA would be different. This has the potential to create the clone of an adult organism as well as many clones at once.

54

Dolly in detail

– Dolly was cloned using the nuclear replacement method. Again the nucleus with chromosome sets is fused with an unfertilized egg whose nucleus has been removed.

– Motivating factor was that it could help to improve certain qualities in livestock.

– Dolly was not the first sheep to be created from nuclear replacement. Two genetically identical sheep, Megan and Morag were born in 1996 using the technique. The difference was that Dolly was derived from an adult sheep, and Megan and Morag were from a sheep embryo.

55

Dolly’s probability

– Cells taken from a six-year-old Finnish Dorset ewe and cultured in a lab.

– 277 cells then fused with 277 unfertilized eggs (each with the nucleus removed)

– 29 viable reconstructed eggs survived and were implanted in surrogate Blackface ewes.

– 1 gave birth to Dolly

– 0.361% chance at onset, 3.4482% once implanted. In nature between 33-50% of fertilized eggs develop.

56

Cloning Dolly

• Enucleate the eggs produced by Scottish Blackface ewes (female sheep).

– Treat the ewes with gonadotropin-releasing hormone (GnRH) to cause them to produce oocytes ready to be fertilized. Like all mammals, these are arrested at metaphase of the second meiotic division (meiosis II).

– Plunge a micropipette into the egg over the polar body and suck out not only the polar body but the haploid pronucleus within the egg.

57

• Fuse each enucleated egg with a diploid cell growing in culture. – Cells from the mammary gland of an adult Finn Dorset ewe (they have

white faces) are grown in tissue culture.

– Five days before use, the nutrient level in the culture is reduced so that the cells stop dividing and enter G0 of the cell cycle.

– Donor cells and enucleated recipient cells are placed together in culture.

– The cultures are exposed to pulses of electricity to • cause their respective plasma membranes to fuse;

• stimulate the resulting cell to begin mitosis (by mimicking the stimulus of fertilization).

58

• Culture the cells until they have grown into a morula(solid mass of cells) or even into a blastocyst (6 days).

• Transfer several of these into the uterus of each (of 13, in this case) Scottish Blackface ewes (previously treated with GnRH to prepare them for implantation.

• Wait (with your fingers crossed).• The result: one ewe gave birth (148 days later) to

Dolly.

59

60

How do we know that Dolly is not the progeny of an unsuspected mating of the

foster mother?

• She has a white face and the foster mother is a Scottish Blackface

• DNA fingerprinting reveals bands found in Finn Dorset sheep (the breed that supplied the mammary cells), not those of Scottish Blackface sheep

61

What about Dolly's telomeres?

• It turns out that her telomeres are only 80% as long as those in a normal one-year-old sheep.

• The examination of DNA from Dolly's cells revealed that her telomeres were abnormally short.

• It is known that telomeres are sequences located at the end of each chromosome. These sequences protect DNA from degradation by exonucleases. In fact, telomeres are constantly degraded and restored.

62

• The balance becomes negative as the cells age,

• leading to a degradation of chromosomes and to cell death after about 50 multiplications.

• Dolly's telomeres were short but this was also the case for the donor cell line, which was derived from an old sheep and was cultured over a long period of time.

63

• It was prematurely suggested that cloning might generate old newborns.

• In all the cloned animals obtained after Dolly and in which DNA was examined, the length of telomeres was normal or longer than normal.

• This was also true for clones derived from a 17-yearold bull.

• It is also interesting to note that the two lambs born after Dolly was naturally fertilized have normal telomeres.

64

What about Dolly's mitochondria?

• Although her nuclear genome came from the Finn Dorset ewe, her mitochondria came from cytoplasm of the Scottish Blackface ewe. Mitochondria carry their own genome and so with respect to the genes in mitochondrial DNA, she is not a clone of the Finn Dorset parent.

65

Golden Rice technology

• Golden rice is a variety of Oryza sativa

rice produced from genetic engineering

• Biofortification-noun. The creation of

plants that make or accumulate

micronutrients

• Main purpose is to provide pro-vitamin

A to third world, developing, countries

where malnutrition and vitamin A

deficiency are common

Introduction

3

Classification of Oryza sativa

• Common Name: Asian Rice

• Kingdom: Plantae• Phylum: Anthophyta

– Monocot

• Class: Commelinids• Order: Poales• Family: Poaceae• Genus: Oryza• Species: O. sativa• Binomial Nomenclature: Oryza sativa

Why Rice?

• Other plants, such as sweet potatoes have varieties that are either

rich (orange-fleshed) or poor (white fleshed) in pro-vitamin A

• Carrots were originally white or purple in the 1600’s. A Dutch

horticulturist mutated the carrot to produce carotenes to symbolize

the color of the Dutch Royal House of Orange

• Global staple food. Cultivated for

over 10,000 years

• Rice provides as much as 80

percent or more of the daily caloric

intake of 3 billion people, which is

half the world’s population

Who Began the Golden Rice Project?

• Started in 1982 by Ingo Potrykus-Professor emeritus of the Institute for Plant

Sciences

• Peter Beyer-Professor of Centre for Applied Biosciences, Uni. Of Freiburg,

Germany

• Funded by the Rockefeller Foundation, the Swiss Federal Institute of

Technology, and Syngenta, a crop protection company.

• Golden Rice Humanitarian Board-

responsible for the global development,

introduction and free distribution of Golden

Rice to target countries.

Effects of Malnutrition• Symptoms of vitamin A deficiency (VAD) include;

night blindness, increased susceptibility to infection

and cancer, anemia (lack of red blood cells or

hemoglobin), deterioration of the eye tissue, and

cardiovascular disease

• Nearly 9 million children die from malnutrition each

year. A large proportion of those children die from

common illnesses that could have been avoided

through adequate nutrition

• The reduced immune competence increases the

morbidity and mortality rates of children

Goals: More is What We Aim For

• Mutate rice plants to produce carotenoids, or organic

pigments, specifically β-carotene (pro-vitamin A) in

the endosperm, the edible part of the grain

• Make Golden Rice accessible locally, free of charge to

farmers, who are able to grow, save, consume,

replant and locally sell Golden Rice

Vitamin A(Retinol)

How Does It Work?• The addition of 2 genes in the rice genome will complete the

biosynthetic pathway

– 1. Phytoene synthase (psy) – derived from daffodils

(Narcissus pseudonarcissus)

– (Phytoene synthase is a transferase enzyme involved in

the biosynthesis of carotenoids. It catalyzes the conversion

of geranylgerany pyrophosphate to phytoene.)

– 2. Lycopene cyclase (crt1) – from soil bacteria Erwinia

uredovora

• Produces enzymes and catalysts for the biosynthesis of

carotenoids (β-carotene) in the endosperm

• The end product of the engineered pathway

is lycopene, but if the plant accumulated

lycopene, the rice would be red.

• Recent analysis has shown the plant's

endogenous enzymes process the lycopene

to beta-carotene in the endosperm, giving

the rice the distinctive yellow color for which

it is named. The original golden rice was

called SGR1, and under greenhouse

conditions it produced 1.6 µg/g of

carotenoids.

4

ADVANTAGE

• Golden rice give more quantity vitamin-A

• Easy distribution when released to needy

• Cheaper option to supply vitamin A requirement compared to other

supplementary measures

• Sustainable option as once released for common cultivation can be

cultivated every growing season by farmer saved seeds, therefore no

need of yearly budgetary investment for distribution

• Health

– May cause allergies or fail to perform desired effect

– Supply does not provide a substantial quantity as the

recommended daily intake

• Environment

– Loss of Biodiversity. May become a gregarious weed and

endanger the existence of natural rice plants

– Genetic contamination of natural, global staple foods

• Culture

– Some people prefer to cultivate and eat only white rice

based on traditional values and spiritual beliefs

DISADVANTAGE

References • Images references:

1.

https://lh5.ggpht.com/EdoHRei05BEjK96Qf0jwKaXPX_pWx4zLWbXQrf4Gl

yy2B5aBbKu4F6R0RSwcrVtVQ0MXzA=s85

2. https://lh6.ggpht.com/aD8KIJk82lKoSXzfALpHrOc7K6TnPYdRHXyQcvnvK

bCWYqWWZWRjIDuzxH8C5TDdRJBA=s149

3. https://lh6.ggpht.com/jkL6UjXwi_4Tlg21Pcs4Obgx-QRD6-

oDK1Mv9HJ_j8SMOY5tNT4MrJUuqNxMkPJDhLt6Lw=s85

4. https://lh3.ggpht.com/xFW64QK5okgeprEU-

2fDDAzRofcKksbPVIxCs3ieYE_vFd18NmXKJVGxTjOnJoXk39XckQ=s85

• Reading references:

• Gene cloning and DNA analysis by TA Brown