Communication Vol. 267, No. 19, Issue of July 5, pp. 13127-13130,1992 THE JOURNAL OF BIOLOGICAL CHEMISTRV

0 1992 by The American Society for Biochemistry and Molecular Biology, Inc. Printed in U. S. A .

Branched-chain a-Ketoacid Dehydrogenase Kinase MOLECULAR CLONING, EXPRESSION, AND SEQUENCE SIMILARITY WITH HISTIDINE PROTEIN KINASES*

(Received for publication, February 10, 1992) Kirill M. Popov, Yu Zhao, Yoshiharu ShimomuraS, Martha J. Kuntz, and Robert A. Harris4 From the Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, Indiana 46202-5122

A cDNA for branched-chain a-ketoacid dehydrogen- ase kinase was cloned from a rat heart cDNA library. The cDNA had an open reading frame encoding a pro- tein of 382 amino acid residues with a calculated mo- lecular weight of 43,280. The clone codes for the branched-chain a-ketoacid dehydrogenase kinase based on the following: 1) the deduced amino acid sequence contained the partial sequence of the kinase determined by direct sequencing; 2) expression of the cDNA in Escherichia coli resulted in synthesis of a 43,000-Da protein that was recognized specifically by kinase antibodies; and 3) enzyme activity that phos- phorylated and inactivated the branched-chain a-ke- toacid dehydrogenase complex was found in extracts of E. coli expressing the protein. Northern blot analysis indicated the mRNA for the branched-chain a-ketoacid dehydrogenase kinase was more abundant in rat heart than in rat liver, as expected from the relative amounts of kinase activity expressed in these tissues. The de- duced sequence of the kinase aligned with a high de- gree of similarity within subdomains characteristic of procaryotic histidine protein kinases. This first mito- chondrial protein kinase to be cloned appears more closely related in sequence to procaryotic histidine pro- tein kinases than to eucaryotic serinelthreonine pro- tein kinases.

Branched-chain a-ketoacid dehydrogenase kinase (BCKDH

* This work was supported by National Institutes of Health Grant DK 19259, the Diabetes Research and Training Center of Indiana University School of Medicine Grant AM 20542, the Grace M. Show- alter Residuary Trust, American Heart Association, Indiana Affiliate, Inc. (postdoctoral fellowship to K. M. P.), and the March of Dimes (predoctoral fellowship to Y. Z.). The costs of publication of this article were defrayed in part by the payment of page charges. This article must therefore be hereby marked “advertisement” in accord- ance with 18 U.S.C. Section 1734 solely to indicate this fact.

The nucleotide sequence(s) reported in thispaper has been submitted to the GenBankTM/EMBL Data Bank with accession number(s) M93271.

$ Current address: Dept. of Bioscience, Nagoya Institute of Tech- nology, Nagoya, Japan.

5 To whom correspondence should be addressed Dept. of Biochem- istry and Molecular Biology, 635 Barnhill Dr., Indiana University School of Medicine Indianapolis, IN 46202-5122. E-mail: IQJQlOO@INDYCMS.IUPUI.EDU, Tel.: 317-274-4827; Fax: 317- 274-4686.

kinase)’ (EC 2.7.1.115) catalyzes phosphorylation and inac- tivation of the branched-chain a-ketoacid dehydrogenase complex (BCKDC) (EC 1.2.4.4 + no EC number + EC 1.8.1.4), the key regulatory enzyme of the valine, leucine, and isoleu- cine catabolic pathways. BCKDH kinase purified from rat heart or rat liver is a monomeric enzyme with a molecular mass of 44,000 Da (1, 2). The enzyme has a strong substrate specificity towards BCKDC and does not phosphorylate the pyruvate dehydrogenase complex (EC 1.2.4.1 + EC 2.3.1.12 + EC 1.8.1.4), an enzyme complex similar to BCKDC in terms of intracellular localization, structure, and mechanism of ca- talysis (3). Short term regulation of the BCKDH kinase is due primarily to direct allosteric inhibitory effect of a-keto- isocaproate (transamination product of leucine) (4, 5). Long term regulation involves an adaptive increase in the activity of BCKDH kinase in response to dietary protein restriction of animals (6-8), but the molecular mechanism responsible has not been defined.

Rat heart BCKDH kinase was cloned in the present study to determine its relationship to other protein kinases and to facilitate future work on the mechanisms responsible for the regulation of its activity.

EXPERIMENTAL PROCEDURES

Material~-[[y-~*P]ATP (222 TBq/mmol), [a-35S]thio-dATP (18.5 TBq/mmol), and [a-32P]dCTP (111 TBq/mmol) were obtained from Du Pont-New England Nuclear. The Xgtll rat heart cDNA library was from Clontech, Palo Alto, CA. Various DNA-modifying enzymes were from Bethesda Research Laboratories. Chemicals for polymerase chain reaction (PCR) amplification of mRNA were from Perkin- Elmer Cetus. The PET expression system was obtained from Nova- gen, Madison, WI. Site-directed mutagenesis reagents were from Pharmacia, Uppsala, Sweden. Sequenase version 2.0 sequencing re- agents were from U. S. Biochemical Corp. Other materials and reagents were of analytical grade.

Protein Sequencing and Generation of an Oligonucleotide Probe for BCKDH Kinase-NH2-terminal protein sequencing was performed with an Applied Biosystems model 477A Pulse Liquid Protein Se- quencer. Internal amino acid sequence analysis was obtained by in situ trypsin digestion on nitrocellulose and separation of the peptide fragments by narrow-bore reverse phase high performance liquid chromatography (9). Degenerate, inosine-containing oligonucleotides synthesized according to the amino-terminal sequence of BCKDH kinase were used to amplify rat heart mRNA by reverse transcriptase PCR. The first strand of cDNA was synthesized with Moloney murine leukemia virus-reverse transcriptase using random hexamers accord- ing to instructions of the manufacturer (Perkin-Elmer Cetus). Forty cycles of amplification were performed with primers GCIACIGA(T/ C)ACICA(C/T)CA(C/T)GTIGA(A/G)CTIGC and GG(C/T)TT(T/ C)GCIACIAC(A/G)TC, corresponding to residues 4-13 and residues 30-36, respectively, of the NH, terminus of the protein as determined by direct protein sequencing. Annealing was at 42 “C for 1 min, extension was at 72 “C for 1 min, and denaturation was at 94 “C for 1 min. The amplification product (98 bp) was subcloned into M13 mp18 (Bethesda Research Laboratories) and sequenced with Sequen- ase version 2.0 according to procedures of the manufacturer (U. S. Biochemical Corp.). A perfectly matching 24-mer oligonucleotide (GAACGCTCCAAGACTGTTACCTCC), synthesized according to the sequence of the PCR product, was used for library screening.

The abbreviations used are : BCKDH, branched-chain a-ketoacid dehydrogenase; BCKDC, branched-chain a-ketoacid dehydrogenase complex; kin-BCKDH, kinase-depleted BCKDH; bp, base pair(s); kb, kilobase pair(s); PCR, polymerase chain reaction; SDS, sodium dodecyl sulfate; PAGE, polyacrylamide gel electrophoresis; IPTG, isopropyl 1-thio-0-D-galactopyranoside.

13127

13128 Branched-chain a-Ketoacid Dehydrogenase Kinase

Library Screening-The oligonucleotide probe was labeled to a specific activity of loy cpm/pg with [Y-~*P]ATP by the reaction catalyzed by T, kinase. This probe was used to screen 5 X lo5 clones from the rat heart library. Hybridization conditions were as follows: 6 X SSC (1 X SSC: 150 mM sodium chloride, 15 mM sodium citrate, pH 7.5), 5 X Denhardt's solution (0.1% bovine serum albumin (w/v), 0.1% polyvinylpyrrolidone, 0.1% (w/v) Ficoll 400), 0.1% (w/v) SDS, 400 pg/ml heat-denatured salmon sperm DNA, and the radiolabeled probe (2 X lo6 cpm/ml) at 57 'C for 17 h. Filters were washed with 6 X SSC, 0.1% (w/v) SDS four times at room temperature, and one time at 60 "C for 15 min. Positive clones were purified through three more cycles of screening. The inserts from the phage clones were recovered as M13 mp18 phagemids and both strands sequenced.

DNA Sequencing-DNA sequencing was performed (10, 11) with [a-"'S]thio-dATP and T, DNA polymerase (Sequenase version 2.0) using single-stranded M13 DNA as a template according to the manufacturer's instructions (U. S. Biochemical Corp.). Regions of compression were sequenced with a 7-deaza-GTP sequencing kit (U. S. Biochemical Corp.).

Expression of Rat Heart BCKDH Kinase in E. coli-To construct an expression plasmid for the rat heart BCKDH kinase (PETKIN), a NcoI restriction site was constructed in the 5"noncoding region of the cDNA. A 1.5-kb NcoI-StuI fragment containing the coding region for BCKDH kinase was excised from the M13 mp18 KININcoI and subcloned into a PET-3d vector (12) that had been digested with RamHI, blunt-ended with DNA polymerase 1 (Klenow), digested with NcoI, and dephosphorylated with bacterial alkaline phosphatase. The resulting plasmid was transfected into E. coli HB 101, and ampicillin- resistant colonies were selected. Insert-bearing plasmids were con- firmed by direct sequencing.

To express the recombinant BCKDH kinase, the pETKIN plasmid was transfected into E. coli BL 21 (DE3). A 10-ml culture of E. coli BL 21 (DE3) containing the pETKIN plasmid was grown in M9-ZB ampicillin (50 pg/ml) medium at 37 "C for 10 h. An aliquot (0.5 ml) of the culture was added to 50 ml of M9-ZB ampicillin medium and this culture grown at 37 "C until A~OO., reached 0.4. Isopropyl-l-thio- 8-D-thiogalactopyranoside (IPTG) (0.5 mM) was added to induce transcription, and growth of the culture continued for 2 h at 37 "C. The bacteria were isolated by centrifugation, washed with TE saline (10 mM Tris-HC1, pH 7.5, 0.1 M NaCI, 1 mM EDTA), and then re- isolated. The final pellet was frozen at -70 "C for at least 1 h. The frozen pellet was thawed into 5 ml of buffer A (10 mM Tris-HC1, pH 7.4, 0.1 mM EDTA, 5 mM dithiothreitol, 10 pg/ml trypsin inhibitor, 0.1 mM benzamidine, 10 pg/ml pepstatin A, 10 pg/ml leupeptin, 0.1 mM phenylmethylsulfonyl fluoride, and 0.1 mM N"-p-tosyl-L-lysine chloromethyl ketone) and sonicated 4 X 15 s. The sample was frozen at -70 "C for 1 h and thawed. Bacterial debris was removed by centrifugation at 10,000 X g for 15 min, and the supernatant was made 40% saturated with (NH,),SO,. Precipitated proteins were collected by centrifugation at 20,000 x g for 15 min a t 4 "C, dissolved in a minimum volume of Buffer A, dialyzed overnight against Buffer A plus 10% glycerol, and stored at -70 "C.

Western and Northern Blot Analysis-Proteins of the E. coli ex- tracts were separated by SDS-PAGE according to Laemmli (13) and transferred to nitrocellulose filters. Rabbit anti-BCKDH kinase an- tibodies were used to detect BCKDH kinase protein (14).

Total RNA from rat heart and rat liver was isolated by the RNAzolTM method (Cinna/Biotecx Laboratories International, Inc., Houston, TX). Total RNA (25 pg) was resolved on a 1.5% agarose gel containing 20% formaldehyde and blotted onto NitranTM mem- brane (Schleicher & Schuell). The blot was hybridized with the BCKDH kinase cDNA (labeled with [w3'P]dCTP by random prim- ing) in 50% (v/v) formamide, 5 X SSC, 0.1% (w/v) SDS, 10 X Denhardt's solution, 0.1 mg/ml salmon sperm DNA, and 0.04% (w/ v) sodium pyrophosphate at 42 "C for 17 h. The filter was washed at room temperature in 2 x SSC plus 0.1% (w/v) SDS three times and in 0.5 X SSC plus 0.1% (w/v) SDS at 55 "C twice. Autoradiography was carried out with Kodak XAR-5 film a t -70 "C for 24-72 h.

BCKDH Kinase Activity Assay-BCKDH kinase activity was measured (2) using kinase-depleted BCKDH (kin-BCKDH) as sub- strate.

RESULTS AND DISCUSSION

Degenerate, inosine-containing oligonucleotides corre- sponding to the amino-terminal sequence of BCKDH kinase were used as PCR primers to amplify rat heart mRNA. A 98-

bp PCR product was sequenced and found to match exactly the amino-terminal sequence (ATDTHHVELARERSKTV- TSFYNQSAIDVVAEKP) determined for BCKDH kinase by direct sequencing. An oligonucleotide probe (GA- ACGCTCCAAGACTGTTACCTCC) synthesized according to the sequence of the PCR product was used to screen 5 X lo5 plaques from a rat heart X g t l l cDNA library. Three hybridizing plaques were purified for further analysis. One clone contained an insert of 2,250 bp with a single 1,257-bp open reading frame, a 120-bp 5"noncoding region, an ATG initiation signal, and a 873-bp 3'-noncoding region containing a polyadenylation signal and a poly(A) tail (Fig. 1). The two other clones (0.6 and 1.2 kb) provided no additional sequence information. The deduced amino acid sequence (382 residues) predicted a protein of 43,280 Da, which is close to the size (44,000 Da) estimated for BCKDH kinase by SDS-PAGE (1). The authenticity of this clone was confirmed by a complete match of 37 deduced amino acids with the sequence of the amino terminus of BCKDH kinase determined by direct pep- tide sequence analysis (Fig. 1). In addition, an exact match was obtained with three internal peptides of BCKDH kinase also determined by direct peptide sequence analysis (Fig. 1). The cloned cDNA encodes a 30-amino acid mitochondrial

CGI IGC C T G I C G A G C CCI I A G KC CAI 161 i i lc ALC CIA G l l C A A C A A ALA K C GGG A C A -120 GCT LA& A T C C G C .am 11\11 ccc ,GI CCI CIL K I ClL I C 1 C I I L I L LIL Cll ILG GLI CAC -60

20 A T G A T & C T C A C T 1CA G T G C I G ddC ACC GGC C C I CbG AGC GLG T C 1 IC1 C I T liG C C C CIC -100 wet I l C L C " I h r scr " D l LC" G l , scr ' I Y P r o r(r9 srr GI" svr scr LC" I r P P r o LC"

T T C CCG ICC TCL C I G T C A CIC ccc ' 7 7 CGC I C I LCI ~ r i i LCL K C GAT IC1 C I C C A T GII -240 Leu GIy Icr Scr LCY Scr Lcu Arg V a l Ars Srr l h r Srr A k J b r AS" I l w KtLULU

CLC C T G GCC LCG GAA CGC I c c A A C A C T '11 lcC I C C 1 1 1 I A C A A C CLG l C l GCI LII CLC -100

1

2 1

srr L v r Ibr "a1 Ihr ser ehr - ( 1

C T G CIA CCA GAG LAG ccc 1cA CTC CGC CIC ACI CCC A C C A l C AlC CIC Ill 1 C T C G l CGC -360 w y.1 la V a l A l g Leu I h r P r o lhr Mer UBI Leu l l r Scr G l Y IC9

61 TCA CAG C A T GGC AGC C A C C T T C T C A G ~ GI ccc I A C I I G CAG C & A GaG I T A CLC G I G -&IO Ser Gln Asp Gly Scr H I S Leu Leu Lyr Ser G l Y A r Y

81 AGG AIC G C T CAC CCC *IC AAG GGC T T C C T A C T C T T C CTI r c a ICL I I C CTI CCA K C CIA .LBO Arg I l c Ala R I I Arg l l e Lys G l y Phe Vol Val Phc LC" Scr Scr Leu Val A I S lhr L W

CCA TLC TGC A C T G T G CAC GAG c l & l ~ c AIC CGG GCC 1 1 C CAG AAG IlG A C A GAC T I C C C l -540 101

pro l y r cyr Ihr vat H I S ~ l u LCU lyr I l e Arg I 1 0 Phr Gln Lyr LCY Ihr A S P Phe P m

CCG A T C AAG GAC CAG GCA GAC GLA CCC C A G I l l IGC CAG C I G G I G CGA CAG C I G CIA GAT -600 121

Pro Ilc Lyr Asp Gin I I a Asp Glu A l a Gln I y r Cy3 Gin LC" Val Arg Gin LCU LCY Asp

CAC CAC AAG C A I CTG G T A A C C C T G I T A C C I CAC CGl ClG L L I G A G A G C CGG A** CAC A 1 1 "0 141

asp 111s Lyr Asp Val V a l rhr LC" LC" A l a G l u G l y LC" Arg Glu S e i Urg L y l H I S I I C 161

GAG G A T GAA LAG CIG G T C CGC IAC I T C C T G G A T A A A K A CTI ncG T C C A G A ( 1 1 LGG A I C -720 Glu I r p Glu Lyr Leu V a l Arg Tyr Dhe Leu A<o ( 1 3 I t < , L C " I h r l r r Arg Lru G I " I I c

CGA A l G C l G GCT ACT CAC CAC T T G CCG CIA c11 CAA G1C 1% LC1 OA1 111 G I 1 GGC A I C -780 181

Arg Met Leu A l a I h r H l s H I S LFY a18 Leu H I S Glu Arp L p Pro Asp Phe V a l GI" I l c 201

ATE T C C LC, CdT C l d T C A C C C l l d A A G l r i A l l Lli ALL 1GG 616 d l 1 T I T GCC LGh CGC -840 I I c Ser I h r Arg Leu Ser Pro LYI Lyr / l e I l e GI" LI\ l r p Yo1 Lbp Phe A 1 0 lrri A T 9

C I G IGC GAG CAC A A G T A T G G C A A T GCC C C I m c r c CGC arc a*r GGC C A C G I G CCI ccc -900 221

L W cy5 GI" nss L Y S T V G I Y A," a l a p r o W Y V I I 119 HI, v a t u CGI ITC C C C T I C A I , CCI 17s CCG CIG GAC T A T A l C C T L i CCI GAG C 1 G CIC A A 6 LAC C C C -960 Arg Phc Pro Phe I I c Pro Hcf Pro i c u A\p l y r I I c Leu P i 0 Lilu Lau Leu L y ' A>n Ala

2'1

- 1440 -1500 - 1560 .I620 . I680

-1800 .I710

. le40 1920 1900

-20'0 -2100 ? loo

.2250 221u

FIG. 1. Nucleotide and predicted amino acid sequence of BCKDH kinase. The amino-terminal and internal tryptic peptide sequences determined for the purified protein and found in the open reading frame of the cDNA clone are underlined.

Branched-chain a-Ketoacid Dehydrogenase Kinase 13129

entry sequence (residues -30 to -l), which like most mito- chondrial entry sequences (15) is void of acidic residues. Three Arg residues provide the positive charge required for mito- chondrial uptake of the protein.

Northern blot analysis was used to establish the size of the BCKDH kinase mRNA present in rat liver and rat heart. One major transcript of approximately 2.4 kb hybridized with the BCKDH kinase cDNA in both tissues (Fig. 2). Thus, the sequence established by the largest clone obtained covered practically the entire kinase mRNA. The relative amounts of message for BCKDH kinase in liver and heart correlated well with kinase activity in these tissues as estimated previously (1,6,16). In contrast, the relative amounts of message for the E2 component of BCKDC showed the opposite relationship (Fig. 2), as would also be expected from the relative quantities of BCKDC activity in these tissues (17).

Additional evidence that the cloned cDNA encodes BCKDH kinase was obtained from expression studies with E. coli. Extracts of E. coli transfected with the vector only and with the expression plasmid pETKIN were analyzed by West- ern blotting using anti-BCKDH kinase antibodies. No im- munoreactive protein was expressed with cells transfected with the vector only (Fig. 3, lane 2). Upon induction by IPTG,

1 2 3 4 5 6

- E2

- KINASE

FIG. 2. Northern blot analysis of RNA from rat liver and heart. Lanes 1-3, rat liver RNA; lanes 4-6, rat heart RNA. The size of the hybridizing band was determined by using 28 and 18 S ribo- somal RNA as markers. Filters were probed with labeled cDNAs for the BCKDC E2 subunit and BCKDH kinase. The ribosomal RNA bands from heart and liver were of equal intensity by ethidium bromide staining, indicating comparable amounts of RNA were sub- jected to electrophoresis.

1 2 3 4 M r

- 94.000

- 67.000

- 43,000

- 30,000

- 18,000

FIG. 3. Western blot analysis of BCKDH kinase expressed in E. coli. 50 pg of E. coli extract protein were separated by SDS- PAGE, transferred to a nitrocellulose membrane, and probed with anti-BCKDH kinase antibodies as described previously (14). Lane 1, BCKDH kinase purified from rat heart (2 pg of protein); lane 2, vector bearing E. coli plus IPTG (0.5 mM); lane 3, plasmid bearing E. coli induced with IPTG; lane 4, plasmid bearing E. coli not induced with IPTG.

E. coli cells transfected with PETKIN-expressed proteins that were immunoreactive with anti-BCKDH antibodies (Fig. 3, lane 3). The molecular mass of the upper most immunoreac- tive band coincided with the molecular mass of BCKDH kinase purified from rat heart (44,000 Da, lane I ), demonstrat- ing that the cloned cDNA encodes a protein recognized by antibodies against BCKDH kinase that is the same size as the kinase. Probably because of T7 promoter leak, a small amount of immunoreactive protein was synthesized without induction (Fig. 3, lane 4 ) . Omitting protease inhibitors from the extraction buffer increased the lower immunoreactive band at the expense of the upper band (data not shown), suggesting that limited proteolysis of BCKDH kinase is re- sponsible for the appearance of more than one immunoreac- tive protein:

Recombinant BCKDH kinase present in E. coli extracts catalyzed phosphorylation of the E l a subunit of kin-BCKDH (Fig. 4, upper panel) with concomitant inactivation of BCKDH (Fig. 4, lower panel). Therefore, phosphorylation must occur at Ser-293 of the E l a subunit, known to be the primary inactivating site of BCKDH (16, 18).

A search of protein data banks available through GenInfo with respect to the deduced amino acid sequence of BCKDH kinase did not reveal significant homologies with known eucaryotic serine/threonine protein kinases. Even if compar- isons were restricted only to the protein kinase catalytic domains (19), overall position identity was below 15%. The consensus Gly-X-Gly-X-X-Gly, characteristic of many nu- cleotide-binding proteins (20) including subdomain I of pro- tein kinases, is not present in the sequence of BCKDH kinase. Likewise, the highly conserved Ala-X-Lys-X-(Leu, Ile, Val) of subdomain I1 of serine/threonine protein kinases (19) is not found in the sequence of BCKDH kinase. The triplet Asp-Phe-Gly of subdomain VII, considered the most highly conserved short stretch of the catalytic domains of serine/ threonine protein kinases (19), may be present as Asp-Phe-

1 2 3 4 5 6 M, . , -""

- 94.000

- 67.000

- 43.000

- 30.000

40

30

20

10

0 1 2 3 4 5 6 7 8 9 1 0

TIME. mil

FIG. 4. Phosphorylation of kin-BCKDH by recombinant BCKDH kinase. Upper panel, autoradiogram of proteins separated by SDS-PAGE. Lane 1, extract from uninduced E. coli (25 pg of protein); lane 2, extract from E. coli induced with 0.5 mM IPTG (25 pg of protein); lane 3, kin-BCKDH (2 pg of protein); lane 4 , extract of uninduced E. coli plus kin-BCKDH; lane 5, extract of induced E. coli plus kin-BCKDH; lane 6, kin-BCKDH plus purified rat heart BCKDH kinase (0.2 pg of protein). Lower panel, ATP-dependent inactivation of kin-BCKDH in the presence of recombinant BCKDH kinase (0); extracts of uninduced E. coli were used as a control (0).

13130 Branched-chain a-Ketoacid Dehydrogenase Kinase I

E L H I N L N M N I E A N L N L

I1 I11

A H [Ill H G P S [15] G G A P [19] G G A P [19] S G P E [17] G G D L [30] S K

A E [15] S G P E [15] K G

P T S I

A I A I

A S

H V F I

S I

FIG. 5. Alignment of the BCKDH kinase (BK) sequence with subdomains of histidine protein kinases. Sequences are from the following sources: NRII from Klebsiella pneumoniae (23), ProR from E. coli (24), EnvZ from E. coli (25), VirA from Agrobacter- ium tumejuciens (26), DegS from Bacillus subtilis (27), SIIj from Bacillus subtilis (28), and Npv from Brudyrhizobium japonicum (29). Consensus amino acids of histidine protein kinases (His-181, Asn- 250, Asp-285, Gly-287, Gly-289, Gly-319, and Gly-321 for BCKDH kinase) are boxed.

Ala (residues 206-208) in BCKDH kinase, although flanking amino acids downstream would be atypical of serine/threo- nine protein kinases. The consensus triplet Ala-Pro-Glu, con- sidered the key protein kinase catalytic sequence defining subdomain VI11 of serine/threonine protein kinases (20), is not present in BCKDH kinase unless represented by Leu- Pro-Glu (residues 243-245). Thus, although some sequence similarity may be present in subdomains VI1 and VIII, these findings indicate that BCKDH kinase can be only distantly related to other eucaryotic serine/threonine protein kinases cloned thus far. In contrast, a much higher degree of sequence identity and similarity of BCKDH kinase was found with members of the procaryotic histidine protein kinase family. Three subdomains located near the carboxyl terminus of these kinases are highly conserved in all members of this family (21). Considerable sequence identity and similarity were found in BCKDH kinase within all three of these domains (Fig. 5 ) . Subdomain I11 of histidine protein kinases almost invariably contains Asp-X-Gly-X-Gly followed by Gly-X-Gly- X-Gly within 20-50 residues, and this same pattern is found in BCKDH kinase (Fig. 5 ) along with considerable sequence identity and similarity with other histidine protein kinases in flanking residues. For example, over a stretch of 43 amino acids of this domain, the histidine protein kinase of Bacillus subtilis SIIj (Fig. 5) and BCKDH kinase exhibit 33% identities and 60% similarities. Subdomain 11 of histidine protein kinases, characterized by an invariant Asn residue located 15-45 residues closer to the amino terminus than subdomain 111, is also present in BCKDH kinase (Fig. 5). Subdomain I, preceding subdomain I1 by up to 100 amino acids, is charac- terized by an invariant His in a short but rather highly conserved stretch of amino acids (Fig. 5). Thus, even though BCKDH kinase is a serine protein kinase according to sites phosphorylated (Ser-293 and Ser-303 in the E l a subunit of BCKDC), the enzyme is more closely related in sequence to the histidine protein kinases identified previously only in procaryotes (21).

A search of the combined databases of GenInfo revealed high scores of identity and similarity between BCKDH k' lnase and a hypothetical protein of Trypanosoma brucei. The cDNA for the latter was cloned as a consequence of a strong up- regulation at the mRNA level during in vitro differentiation of T. brucei (22). Sequence identities and similarities as high as 40 and 77%, respectively, were found in long sequence stretches of these proteins. Although not previously recog- nized, all three consensus domains of the histidine protein

kinases are also present in the hypothetical protein of T. brucei, suggesting that it also may correspond to a eucaryotic histidine protein kinase.

The catalytic cycle of the histidine protein kinases involves transfer of phosphoryl groups from ATP to a specific histidine residue of the protein kinase itself. Proteins modified in procaryotes by histidine protein kinases are usually phos- phorylated on specific Asp residues by direct transfer of phosphate from the phosphohistidinyl residue of the histidine protein kinase. Although not known at this time, His-181 of BCKDH kinase may accept a phosphoryl group from ATP and this phosphohistidinyl residue in turn may participate in phosphorylation of Ser residues 293 and 303 of the BCKDC E l a subunit. Whether pyruvate dehydrogenase kinase, pres- ent like BCKDH kinase in the mitochondrial matrix space, shares sequence similarity with procaryotic histidine protein kinases is unknown. Also of considerable interest will be whether histidine protein kinases are confined to the mito- chondrial matrix space in eucaryotes or, alternatively, whether unknown members of this protein kinase family function as signal transduction components throughout the intracellular compartments of eucaryotic cells.

Acknowledgments-We thank Patricia A. Jenkins for help in prep- aration of this manuscript. We also appreciate Drs. Peter Roach, Mark Goebl, and David W. Crabb for their help and encouragement.

REFERENCES 1. Shimomura, Y., Nanaumi, N., Suzuki, M., Popov, K. M., and Harris, R. A.

2. Popov, K. M., Shimomura, Y., and Harris, R. A. (1991) Protein Exp. Pur$ (1990) Arch. Eiochern. Eiophys. 283,293-299

2. 278-28fi 3. Reed, L. J., and Yeaman, S. J. (1987) in The Enzymes (Boyer, P. D., and

4. Lau, K. S., Fatania, H. R., and Randle, P. J. (1982) FEES Lett. 144, 57- Krebs, E. G., eds) Vol. XVIII, pp. 77-95, Academic Press, New York

,~ ~ ~ . .

fi3 5. Pai<on, R., and Harris, R. A. (1984) Arch. Eiochern. Eiophys. 231,48-57 6. Espinal, J., Beggs, M., Patel, H., and Randle, P. J. (1986) Eiochern. J. 237,

7. Beggs, M., Patel, H., Espinal, J., and Randle, P. J. (1987) FEES Lett. 215,

8. Harris, R. A., Paxton, R., Powell, S. M., Goodwin, G. W., Kuntz, M. J.,

9. Aebersold, R. H., Leavitt, J., Saavedra, R. A,, Hood, L. E., and Kent, S. B.

10. Sanger, F., Nlcklen, S., and Coulson, A. R. (1977) Proc. Natl. Acad. Sci.

11. Viera, J., and Messin J. (1982) Gene ( A n s t . ) 19, 259-268 12. Studier, F. W., and d f f a t t , B. A. (1986) J. Mol. Eiol. 189, 113-130 13. Laemmli, U. K. (1970) Nature 227,680-685 14. Shimomura, Y., Nanaumi, N., Suzuki, M., and Harris, R. A. (1991) FEES

15. Roise, D., and Schatz, G. (1988) J. Eiol. Chern. 263,4509-4511 16. Paxton, R., Kuntz, M., and Harris, R. A. (1986) Arch. Biochern. Eiophys.

17. Gillim, S. E., Paxton, R., Cook, G. A,, and Harris, R. A. (1983) Eiochern. 244, 187-201

18. Cook, K. G., Bradford, A. P., Yeaman, S. J., Aitken, A,, Fearnley, I. M., Eiophys. Res. Cornrnun. 11 1,74-81

19. Hanks, S. K., Quinn, A. M., and Hunter, T. (1988) Scrence 241,42-52 and Walker, J. E. (1984) Eur. J. Biochern. 146,587-591

20. Wierengra, R. K., and Hol, W. G. J. (1983) Nature 302,842-846 21. Stock, J. B., Ninfa, A. J., and Stock, A. M. (1989) Microbiol. Reu. 63, 450-

22. Wirtz, E., Sylvester, D., and Hill, G. C. (1991) Mol. Eiochern. Parasitol. 47,

23. McFarlane, S. A,, and Merrick, M. (1985) Nucleic Acids Res. 13, 7591-

285-288

13-15

and Han, A. C. (1986) Adu. Enr. Regul. 25, 219-237

H. (1987) Pmc. Natl. Acad. Sci. U. S. A . 84,6970-6974

U. S. A . 74,5463-5467

Lett. 288,95-97

490

119-128

7606 24. Makjio, K., Shinagawa, H., Amemura, M., and Nakata, A. (1986) J. Mol.

25. Comearu, D. E., Ikenaka, K., Tsung, K., and Inouye, M. (1985) J. Eacteriol. E d . 192,549-556

164. 578-584 26. Leroux, B., Yanofsky, M. F., Winans, S. C., Ward, J. E., Ziegler, S. F., and

27. Henner, D. J., Yang, M., and Ferrari, E. (1988) J. Eacteriol. 170, 5102-

_-- Nester, E. W. (1987) EMEO J. 6,849-856

51 ns 28. Perego, M., Cole, S. P., Burhulys, D., Trach, K., and Hoch, J. A. (1989) J.

29. Goettfert, M., Grob, P., and Hennecke, H. (1990) Proc. Natl. Acad. Sci. Bactercol. 171, 6187-6196

U. S. A. 87, 2680-2684