BMP NIH Public Access Author Manuscript Biomaterials Jian ......lentivirus; calvarial defect; bone tissue engineering 1. Introduction Adult mesenchymal stem cells have been isolated

A comparison of bone regeneration with human mesenchymalstem cells and muscle derived stem cells and the critical role ofBMP

Xueqin Gao1, Arvydas Usas1, Ying Tang1,3, Aiping Lu1, Jian Tan2, JohannesSchneppendahl1, Adam Kozemchak4, Bing Wang3, James H Cummins1, Rocky S Tuan2,and Johnny Huard1,*

1 Stem Cell Research Center, University of Pittsburgh, Pittsburgh, PA, United States

2 Center for Cellular and Molecular Engineering, University of Pittsburgh, Pittsburgh, PA, UnitedStates

3 Molecular Therapy laboratory, Department of Orthopaedic Surgery, University of Pittsburgh,Pittsburgh, PA, United States

4 Neuroscence Program, University of Michigan class of 2013, Pittsburgh Tissue EngineeringInitiative Summer Internship

Abstract

Adult multipotent stem cells have been isolated from a variety of human tissues including human

skeletal muscle, which represent an easily accessible source of stem cells. It has been shown that

human skeletal muscle-derived stem cells (hMDSCs) are muscle derived mesenchymal stem cells

capable of multipotent differentiation. Although hMDSCs can undergo osteogenic differentiation

and form bone when genetically modified to express BMP2; it is still unclear whether hMDSCs

are as efficient as human bone marrow mesenchymal stem cells (hBMMSCs) for bone

regeneration. The current study aimed to address this question by performing a parallel

comparison between hMDSCs and hBMMSCs to evaluate their osteogenic and bone regeneration

capacities. Our results demonstrated that hMDSCs and hBMMSCs had similar osteogenic-related

gene expression profiles and had similar osteogenic differentiation capacities in vitro when

transduced to express BMP2. Both the untransduced hMDSCs and hBMMSCs formed very

negligible amounts of bone in the critical sized bone defect model when using a fibrin sealant

scaffold; however, when genetically modified with lenti-BMP2, both populations successfully

regenerated bone in the defect area. No significant differences were found in the newly formed

bone volumes and bone defect coverage between the hMDSC and hBMMSC groups. Although

both cell types formed mature bone tissue by 6 weeks post-implantation, the newly formed bone in

the hMDSCs group underwent quicker remodeling than the hBMMSCs group. In conclusion, our

© 2014 Elsevier Ltd. All rights reserved.* Corresponding author: [email protected].

Publisher's Disclaimer: This is a PDF file of an unedited manuscript that has been accepted for publication. As a service to ourcustomers we are providing this early version of the manuscript. The manuscript will undergo copyediting, typesetting, and review ofthe resulting proof before it is published in its final citable form. Please note that during the production process errors may bediscovered which could affect the content, and all legal disclaimers that apply to the journal pertain.

NIH Public AccessAuthor ManuscriptBiomaterials. Author manuscript; available in PMC 2015 August 01.

Published in final edited form as:Biomaterials. 2014 August ; 35(25): 6859–6870. doi:10.1016/j.biomaterials.2014.04.113.

NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

results demonstrated that hMDSCs are as efficient as hBMMSCs in terms of their bone

regeneration capacity; however, both cell types required genetic modification with BMP in order

to regenerate bone in vivo.

Keywords

human muscle-derived stem cells; human bone marrow mesenchymal stem cells; BMP2;lentivirus; calvarial defect; bone tissue engineering

1. Introduction

Adult mesenchymal stem cells have been isolated from a number human tissue sources

including bone marrow, adipose tissue, dental pulp, and umbilical cord tissue. Although all

adult derived stem cells have been shown to be capable of multipotent differentiation, there

are advantages and disadvantages of using each of the populations. Among the various cell

types, bone marrow and adipose-derived stem cells are two of the most practical for clinical

application because of their availability; however, healthy bone marrow cells are not always

readily available. The abundance of adipose-derived stem cells makes them highly attractive

[1-3]; however, they are less efficient for bone regeneration after freezing [4]. Hence,

identifying other tissue sources for acquiring adult stem cells is highly desirable. Different

populations of human muscle-derived cells possess a multi-lineage differentiation capacity

in vitro and are capable of forming bone and cartilage in vivo [5, 6] and skeletal muscle is

easily accessible through a minimally invasive needle biopsy procedure. Human muscle-

derived stem cells (hMDSCs) isolated by the preplate technique have been shown to be

capable of improving the functionality of myocardial infarcted cardiac muscle more

effectively than myoblasts, and have been shown capable of effectively treating stress

urinary incontinence in human patients[7, 8]. hMDSCs display a similar marker profile as

human bone marrow mesenchymal stem cells (hBMMSCs), with more than 95% of the cells

expressing CD73, CD90, CD105, CD44, and being negative for CD45. Moreover, a high

percentage of hMDSCs express CD56 and CD146. These hMDSCs exhibit myogenic,

osteogenic, chondrogenic, and adipogenic capacities in vitro and are considered to be MSCs

of muscle origin. These cells were also shown to be capable of enhancing the healing of a

critical size calvarial bone defect created in mice when transduced with lenti-BMP2[9] ;

however, it has never been determined if hMDSCs are as efficient as bone marrow MSCs in

terms of their ability to promote bone repair. Consequently, we conducted a parallel

comparison study between these two human cell populations in terms of their osteogenic

differentiation capacities in vitro and their regeneration capacities in vivo utilizing a critical-

size calvarial defect model.

Many different scaffolds have been used for promoting the osteogenesis of bone marrow

MSCs in vivo, including collagen type I, alginate hydrogel [10, 11], gelatin beads [12],

hydroxyapatite [13, 14], small intestine submucosa, and akermanite bioceramics [15, 16]. In

the current study, we utilized fibrin sealant, which is the natural product of blood clot

formation and is completely bio-resorbable. Upon activation by thrombin, it forms a clot like

gel instantly and has been successfully used as scaffold for bone repair[9, 17-19]. It has also

Gao et al. Page 2

Biomaterials. Author manuscript; available in PMC 2015 August 01.

NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

been used as a cell delivery vehicle to repair nerve and articular cartilage[20, 21] and

exhibits no adverse side effects on the transplanted cells or host tissue. Fibrin glue (Tisseel,

BAXTER) is FDA approved and is routinely used in clinic; therefore, this scaffold was used

to compare the bone regeneration capacities of both hBMMSCs and hMDSCs in vivo.

BMP2 effectively promotes the osteogenic differentiation of hBMMSCs and hMDSCs in

vitro and can mediate bone repair in vivo; therefore, we used a lenti-BMP2 viral vector to

transduce both populations of cells and compared their osteogenic and bone regenerative

potentials. In the current study, we performed a parallel systematic comparison between

transduced and non-transduced hMDSCs and hBMMSCs in terms of their osteogenic gene

expression profiles, in vitro osteogenic potential, and in vivo bone regeneration capacity in a

mouse critical size calvarial defect model using fibrin sealant as a scaffold.

2. Material and methods

The use of human tissues was approved by the Institutional Review Board (University of

Pittsburgh and University of Washington), and all animal experiments and procedures were

approved by Institutional Animal Care and Use Committee of the University of Pittsburgh.

2.1. Cell isolation

Four populations of hMDSCs were isolated, via a modified preplate technique as previously

described [22], from skeletal muscle biopsies purchased from the National Disease Research

Interchange (NDRI) from a 23 y/o male (23M), a 30 y/o female (31F), a 21 y/o male (21M),

and a 76 y/o female (76F). The late adhering (PP6) cells were grown and maintained in

proliferation medium that contained high glucose DMEM (Invitrogen) supplemented with

20% FBS, 1% chicken embryo extract, and 1% penicillin/streptomycin.

hBMMSCs were isolated from bone marrow obtained from the femoral heads of four

patients who had undergone total hip arthroplasty from an 81 y/o female (81F), 66 y/o

female (66F), 68 y/o male (68M), and a 52 y/o male (52M). Briefly, as described previously

[23], trabecular bone was cored out using a curette or rongeur and flushed with rinsing

medium containing [.alpha]-MEM, 1% antibiotic-antimycotic (Invitrogen, CA, USA) using

18-gauge hypodermic needles. The bone chips were then minced with scissors and the

flushed medium was passed through a 40 μm mesh cell strainer to remove debris and

centrifuged for 5 min at 300G. Pellets were washed twice with rinsing medium and

resuspended in mesenchymal stem cells (MSC) proliferation medium containing α-MEM

(Invitrogen, CA, USA), 10% fetal bovine serum (FBS, Invitrogen, CA, USA), 1% antibiotic-

antimycotic (Invitrogen), and 1 ng/ml FGF2 (RayBiotech, Inc., GA, USA) and plated on two

150 cm2 tissue culture flasks. On day 4, the cells were washed with PBS and fresh

proliferation medium was added. Proliferation medium was changed every 3-4 days. Once

the cell cultures reached 70-80% confluency, the cells were dissociated with 0.25% trypsin

containing 1mM EDTA (Invitrogen, CA, USA), frozen, and stored in liquid nitrogen for

future studies.

Gao et al. Page 3


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

2.2. Construction of the lentiviral-BMP2 construct

A lenti-viral construct encoding human BMP2 gene under the control of the human

cytomegalovirus (CMV) promoter was constructed in our laboratory (in collaboration with

Dr. Bing Wang Laboratory). A SV40 early promoter was inserted down-stream of the BMP2

expression cassette to drive a higher level of constitutive expression of an antibiotic

resistance gene to allow us to use blasticidin to select for the BMP2 transduced cells. Lenti-

BMP2 virus was packaged using 293T cells (ATCC).

2.3. Cell transduction

hMDSCs were transduced with lenti-viral-BMP2 construct in the presence of polybrene (8

μg/ml) at passage 8 for 16 hrs and the hBMMSCs were transduced with the same virus at

passage 2. Twenty four hours after transduction, both the hMDSCs and hBMMSCs were

selected with 10 μg/ml blasticidin for 24hrs. After selection, the cells were expanded in their

respective proliferation media. BMP2 secretion levels were measured using ELISA (R&D

system) at different passages post transduction.

2.4. Analysis of osteogenic related genes and early osteogenic markers

Semi-quantitative RT-PCR was performed on the hMDSCs and hBMMSCs to assess their

respective gene expression profile before and after lenti-BMP2 transduction. Total RNA was

extracted from both non-transduced and lenti-BMP2 transduced cells using Trizol reagent

(Invitrogen). cDNA was synthesized using Superscript II reverse transcriptase (Invitrogen).

PCR reactions were performed using a Promega GOtaq Kit. Primers were designed using

Primer 3[24, 25] and are shown in Table 1. Alkaline phosphatase (ALP, Sigma-Aldrich)

staining was performed on both, non-transduced and lenti-BMP2 transduced hMDSCs and

hBMMSCs.

2.5. In vitro osteogenic differentiation using 3D pellet cultures

Four populations of hMDSCs and hBMMSCs were subjected to pellet culture before and

after lenti-BMP2 transduction using a protocol previously described [9]. Four to 8 replicate

pellets were prepared for each population and cultured in osteogenic medium utilizing the

same conditions. At 3 and 4 weeks after initiating the osteogenic cultures, the pellets were

scanned with a microCT (Viva CT 40,Scanco Medical, Switzerland) to detect mineralization

using 21voxel size and medium resolution. The mineralized pellet volumes were evaluated

using the following parameters: Gauss Sigma 0.8, Gauss support 1.0, and threshold 122.

After 4 weeks, the cell pellets were fixed in 4% neutral buffered formaldehyde for 2 hrs at

RT, embedded in NEG 50 freezing medium, snap frozen in liquid nitrogen, and stored at

-80°C until cryosectioned at 8 μm. Von Kossa staining was performed using an online

protocol (IHC world) to verify the calcification of the pellets. Osteocalcin

immunohistochemistry using mouse anti-human osteocalcin (R &D system, USA) primary

antibody was also performed as previously reported [9]. DAB color reaction was used to

reveal osteogenic differentiation of the cells as shown in brown. Pellet culture experiments

were repeated three times for all cell populations.

Gao et al. Page 4


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

2.6. Creation of critical size calvarial bone defects

Critical size calvarial bone defects were created using an established protocol[19]. Briefly,

CD-1 nude mice (Charles River) were anesthetized using 2% isoflurane. An incision was

made just off the middle line of the skull in the scalp and the right parietal bone was

exposed. After removal of the periosteum, a 5 mm bone defect was created using a 5 mm

diameter trephine (Fine Science Tools, USA). The bone was carefully removed and the

defect area was rinsed with normal saline. The cultured cells were resuspended in 25 μl of

PBS and mixed with 15 μl of thrombin immediately before their implantation into the defect

area. Following cell implantation, 15 μl fibrin sealant was put on top of the cells and allowed

1-2 minutes to solidify. The wound was closed with suture and the mice were allowed to

recover in an oxygen chamber.

2.7. In vivo bone regeneration using non-transduced hBMMSCs and hMDSCs

Eight week-old male CD-1 nude mice (Charles River) were divided into 2 groups (N=8).

One group received 1.5×106 hBMMSCs from 2 donors (81F and 52 M) with each of the

donor cell populations were implanted into 4 mice. The other group received 1.5×106

hMDSCs from two donors (76F and 21M). hBMMSCs at passage 5 and hMDSCs at passage

13 were implanted into the defect area using fibrin sealant as the scaffold (Tisseel, Baxter).

MicroCT scans (Viva CT -40, Scanco Medical, Switzerland) were performed at days 1, 14,

28, and 42 post-implantation (PI) using 30 μm voxel size and medium resolution. Bone

volume was quantified using Scanco evaluation software according to the guidelines of the

American Society of Bone and Mineral Research [26] . Bone defect coverage was measured

using Image J software (NIH).

2.8. In vivo bone regeneration using BMP2 transduced hBMMSCs and hMDSCs

Thirty two male CD-1 nude mice at 8 weeks of age were divided into two groups (N=16):

Group 1 received 4 populations of lenti-BMP2 transduced hBMMSCs (N=4 for each

population at passage 3-4 after blasticidin selection); Group 2 received 4 populations of

lenti-BMP2 transduced hMDSCs at passage 5-6 after blasticidin selection (N=4 for each

population). 5mm critical size calvarial defects were created in the right parietal bone of the

mice as stated above and 1.5×106 cells were mixed with thrombin and implanted in the

defect, with fibrin sealant then being added onto the cells. The fibrin was allowed to solidify

and the wound was then closed with sutures. MicroCT scans (Scanco Medical) were

performed at days 1, 14, 28, and 42 PI using 30μm voxel size and medium resolution as

stated above.

2.9. Histology

Herovici's staining was used to identify collagen type I as previously described [27-29].

H&E staining was used to reveal the newly regenerated bone and bone marrow. Tartrate

resistant acid phosphatase (TRAP) staining was performed on the decalcified paraffin

sections using a 387A kit (Sigma, Milwaukee, USA). TRAP positive osteoclasts on the bone

surface were normalized to bone area (excluding bone marrow area) and expressed as cell

number/mm2.

Gao et al. Page 5


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

2.10. Statistical analysis

One way analysis of variance or Student's t-test was used to analyze bone volume and defect

coverage and TRAP positive cells between the different hBMMSC and hMDSC populations

and between the two groups. For the data that had high standard deviations, such as the in

vitro pellet cultures of the hMDSC (76F) and hBMMSC (52M), we used the Wilcoxon Rank

sum non-parametric test. A value of p<0.05 was considered statistically significant.

3. Results

3.1. Osteogenic gene expression profiles of hMDSCs and hBMMSCs

It took about 10 days to isolate and expand the hBMMSCs and 2 weeks to isolate the

hMDSCs. The hBMMSCs could be used up to passage 10 and the hMDSCs could be

cultured up to passage 20 without any noticeable change in their phenotype. The BMP2

secretion levels of the 4 populations of hBMMSCs at the time of implantation were: 29.9,

12.7, 14.1, 14.1 ng/million/ 24hrs for donors 81F, 66F, 68M, and 52M respectively. The

BMP2 secretion levels of the 4 populations of hMDSCs were: 2.7, 1.3, 0.5, and 0.35 ng/

million/24hrs for donors 23M, 30F, 21M, and 76F respectively. Both hMDSCs and

hBMMSCs expressed the osteogenic-related genes BMPR2, BMPR1b, COX-2, and SOX-9

(Fig.1A). Quantification of the relative gene expression levels indicated that lenti-BMP2

transduction increased COX-2 expression in both cell groups (Fig.1B). ALP staining

indicated that only a very small percentage of hMDSCs and hBMMSCs expressed ALP

(Fig.1C). Quantification of the number of positive cells after lenti-BMP2 transduction

showed that hBMMSCs 81F exhibited higher ALP positivity while hBMMSCs 66F

displayed a lower ALP positivity. All other populations had no significant changes (Fig.1D).

3.2. In vitro osteogenic capacities of hMDSCs and hBMMSCs

MicroCT evaluation of the 3D pellet cultures showed that all 4 populations of hBMMSCs

underwent mineralization by 3 to 4 weeks after initiating the osteogenic cultures; in contrast,

the non-transduced cells exhibited only very minimal mineralization (Fig. 2A showing two

populations). Lenti-BMP2 transduction greatly enhanced the pellets’ mineralization volumes

(Fig. 2B, C). Similarly, the 4 populations of hMDSCs cultured in osteogenic medium also

exhibited mineralization as detected by microCT at 3 and 4 weeks, although the mineralized

pellet volumes varied more among the different hMDSC populations. Of the four

populations of hMDSCs, three populations of cells (76F, 31F, and 23M) displayed

significant increases in mineralization volume after lenti-BMP2 transduction at the 3 and 4-

week time points (Fig.2D, showing 1 donor); however, one population of untransduced

hMDSCs (21M) actually displayed a significantly higher mineralized pellet volumes at both

the 3 and 4-week time points than the lentiBMP2 transduced cells (Fig.2 E). This

phenomenon could have been caused by the different growth rates between the untransduced

and lenti-BMP2 transduced hMDSCs, since we observed that this population of

untransduced cells grew much faster than the lenti-BMP2 transduced cells (data not shown).

Von Kossa staining demonstrated that all the hBMMSCs pellets underwent mineralization.

Notably, the mineralization of the untransduced cells was located at the periphery of the

pellets, while the lenti-BMP2 transduced cells mineralized at both the edge and center of the

Gao et al. Page 6


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

pellets. Similarly, the untransduced hMDSCs mineralized at the periphery of the pellets

while the lenti-BMP2 transduced cells mineralized both centrally and peripherally. For the

21M population, both the untransduced and transduced cells demonstrated extensive

mineralization throughout their pellets. As a result of this high level of mineralization, some

parts of the pellets peeled off especially in those areas that were highly mineralized (Fig.

3A).

Immunohistochemical staining of osteocalcin indicated that the cells in the pellets of the

hBMMSCs expressed the early mineralization marker osteocalcin (brown staining) as did

the hMDSCs(Fig. 3B).

3.3. In vivo bone regeneration capacities of untransduced hMDSCs and hBMMSCs

We tested the capacity of the hMDSCs and hBMMSCs to regenerate bone, using fibrin

sealant as a scaffold, in a critical size calvarial defect model. After implantation of the

nontransduced hBMMSCs or hMDSCs into the calvarial defects, microCT analyses revealed

no obvious bone formation in either the hMDSCs or hBMMSCs transplantation groups (Fig.

4A). Quantification of the bone defect area demonstrated less than 30% healing of the defect

in all groups with no significant difference between groups (Fig.4 B). Herovici's staining

indicated no bone matrix collagen type I (red) formation in the defect area; however,

collagen type 3 (blue) staining, which stains fibrotic tissues, was present in the defect area of

both the hBMMSCs and hMDSCs groups (Fig.5A). H&E staining displayed no bone

formation, but did demonstrate a layer of fibrotic tissue in both the hBMMSCs and hMDSCs

implantation groups (Fig. 5B).

3.4. In vivo bone regeneration capacities of BMP-2 transduced hMDSCs and hBMMSCs

All 4 populations of lenti-BMP2 transduced hBMMSCs were capable of forming new bone

in the calvarial bone defect site as early as 2 weeks post implantation, as shown by 3D

reconstruction of the microCT scans. Some animals showed complete healing (81F) at 4 and

6 weeks (Fig.6A). Similarly, the 4 populations of hMDSCs also displayed significant new

bone formation in the defect area with some of the animals showing complete defect healing

(31F) (Fig.6B); however, both cell types demonstrated variability between the different

populations. The quantification of the newly regenerated bone volumes is shown in Fig. 6C.

There were no statistical differences in the newly regenerated bone volumes or bone defect

coverage among the 4 populations of hBMMSCs or the different populations of hMDSCs

(Fig.6B). There were also no differences between the hMDSC and hBMMSC groups when

the data was combined and compared (Fig.6D). Quantification of the bone defect healing

areas revealed 50-90% healing in the 4 populations of hBMMSCs (Fig.6E). The defect

healing of the lenti-BMP2 transduced hMDSCs ranged from 60%-80% (Fig.6E). There were

no statistical differences among the 4 populations in terms of their percentage of total defect

healing. When the data from the 4 populations from both the hBMMSCs and hMDSCs were

combined and compared, there was no statistical difference between two groups (Fig.6 F).

3.5. Functional bone tissue formation by BMP2 transduced hBMMSCs and hMDSCs

Herovici's staining revealed the formation of bone matrix which consisted of collagen type I

(red) in the defect site (the area between the two black arrows), that resembled normal host

Gao et al. Page 7


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

bone on the contralateral side of the skull in both the hBMMSC and hMDSCs groups (Fig.

7A). The newly regenerated bone in the defect area was found to be fully integrated with the

host bone (Fig.7B). Bone matrix (shown in red) and typical cancellous bone could be seen at

high magnification (Fig. 7C). Collagen type III is detected as dark blue and bone marrow

stains light blue. H&E staining revealed the formation of cancellous bone and bone marrow.

We found myeloid cells (blue arrows), erythrocytes (green arrows ), and megakaryocytes in

the newly formed bone marrow (enlarged in insert boxes) and blood vessels in all the defect

sites implanted with the lenti-BMP2 transduced hBMMSCs and hMDSCs transplanted

populations (Fig.7D showing two populations).

3.6. Remodeling of the newly formed bone

To assess the bone remodeling of the newly formed bone, osteoclast formation was

examined by TRAP staining. Violet red TRAP positive osteoclasts (green arrows) were

found on the bone surface of the newly formed bone, similar to the contralateral side of the

native host bone in all the transplanted groups transduced with lenti-BMP2 (Fig.8A).

Quantification of the TRAP positive osteoclasts in the bone area indicated variability

between the different populations of hBMMSCs; however, the 4 populations of hMDSCs

displayed similar trends (Fig.8B). When the 4 populations were combined and compared

between the hBMMSCs and the hMDSCs, we found significantly more TRAP positive

osteoclasts in the new bone areas in the hMDSCs group than in the hBMMSCs group (Fig.

8C).

4. Discussion

In the current study, we performed a parallel comparison of the osteogenic capacity of

hMDSCs and hBMMSCs both in vitro and in vivo using a critical size bone defect model

and bioresorbable fibrin sealant scaffold. Our results demonstrated that both cell types had

similar osteogenic related gene expression profiles and exhibited equivalent osteogenic

differentiation capacities in vitro and bone regeneration capacities in vivo.

hBMMSCs have been extensively studied for their bone regeneration capacities and have

become the “gold standard” adult stem cells for bone repair. Autologous bone marrow stem

cells have been shown to be effective for treating non–union bone fractures [30-34] and

have been used to promote bone elongation [35]. Furthermore, genetic modification of

hBMMSCs with osteogenic genes like BMP has been shown to greatly increase their

osteogenic potential of the and effectively promote bone defect repair in different animal

models [36-39]. Recently, comparison studies of the hBMMSCs with other adult stem cells

have been performed. A comparative study of hBMMSCs and human adipose derived stem

cells in a rat spine fusion model using ex vivo adenoviral based gene transfer of BMP2

showed that both cell populations induced abundant bone formation and promoted similar

posterolateral spinal fusion [40]. hBMMSCs have also been shown to be more efficient at

promoting functional bone fracture healing than mesenchymal stem cells derived from

human embryonic stem cells [41]. However, until now, there have been no reports that

compared human bone marrow derived stem cells with other sources of adult stem cells for

bone repair using a critical size calvarial bone defect model.

Gao et al. Page 8


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Human muscle derived multipotent progenitor cells(MPCs) isolated from traumatized

muscle tissues have been shown to express the mesenchymal stem cell markers CD73,

CD90 andCD105 and were negative for CD45. MPCs have been shown to be capable of

differentiating into osteoblasts, chondrocytes and adipocytes, but not myoblasts [42, 43].

Although they appeared to have a limited lineage commitment compared to bone marrow

derived MSCs, they are remain a promising cell source for bone regeneration due to their

availability and abundance following orthopaedic injuries [44] and are putative

osteoprogenitor cells that initiate ectopic bone formation in heterotopic ossification [45].

Recently, it has been shown that hMDSCs isolated via the preplate technique also display a

mesenchymal stem cell marker profile which is highly positive for CD73, CD90, CD105,

CD44, CD56, and CD146, and negative for CD45 and are capable of differentiating into

osteogenic, chondrogenic, adipogenic and myogenic lineages, and are considered to be a

muscle-derived mesenchymal stem cell population [9]. Indeed, hMDSCs, like hBMMSCs,

also expressed BMPR1b, BMPR2, COX-2, and SOX9 which allow them to be responsive to

BMP2 signaling through the BMP2-BMPR2 and BMPR1b pathways to activate the

osteogenic differentiation processes [46].

We found that BMP2 secretion levels were much higher in the lenti-BMP2 transduced

hBMMSCs than in the lenti-BMP2 transduced hMDSCs; however, this difference was not

reflected in the in vitro or in vivo osteogenic potential of the cells. Both cell types formed

comparable sized pellets that underwent similar mineralization in vitro and formed

comparable mature bone in vivo; however, neither the hBMMSCs nor the hMDSCs

underwent osteogenic differentiation after lenti-BMP2 transduction in vitro without being

grown in osteogenic medium in pellet cultures.

Both non-transduced hBMMSCs and hMDSCs formed negligible amounts of bone after

implantation into critical size calvarial bone defects in mice. This indicated that although

both stem cell types possess the ability to differentiate toward an osteogenic lineage in vitro,

sufficient osteoinductive signaling is required to initiate the bone regeneration processes in

vivo. It has been shown that hBMMSCs could facilitate bone regeneration and repair without

gene modification or stimulation with BMPs [47, 48]; however, the enhanced bone repair

capacity of the hBMMSCs in these studies was probably due to the osteogenic inductive

effect that the scaffolds had on the hBMMSCs. The fibrin sealant scaffold used in the

current study has no bone inductive effects on the transplanted cells and only served to keep

the cells at the defect site. Fibrin sealant is resorbed in approximately 7 days post-

transplantation, as can be observed at early time points of several of our previous studies[9,

19].

In contrast, the current study demonstrated that both hMDSCs and hBMMSCs could

efficiently promote critical size bone defect healing when genetically modified with lenti-

BMP2. Although the secretion levels of BMP2 were much lower in the lenti-BMP2

transduced hMDSCs than in the lenti-BMP2 transduced hBMMSCs, they formed similar

amounts of new bone. This finding cannot be explained by the age differences of the

patients from which the hMDSCs and hBMMSCs cells were isolated because we found that

the hMDSCs and hBMMSCs isolated from the older donor were not inferior to those of the

Gao et al. Page 9


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

younger donor (81F hBMMSC versus 52M, 66F, 68M hMDSCs; 76F hMDSC versus 21M,

23M, 31F hMDSCs).

Importantly, we found that all the populations of lentiBMP2 transduced hBMMSCs and

hMDSCs formed mature bone and bone marrow as shown by the presence of typical

cancellous (trabecular) bone structure which is composed of a highly organized dense

collagen type I matrix and is vascularized and populated by at least three hematopoietic cell

lineages (erythrocytes, myeloid cells, and megakaryocytes) in the newly formed bone

marrow, which was very similar to the native contralateral host bone (data not shown). In

the past, most research in the field of bone tissue engineering has focused on the formation

of mineralized tissue and not on the formation of truly mature bone; however, recently,

Scotti et al. were able to establish a mature hematopoietic stem cell niche using in vitro

cartilage based engineering in combination with in vivo implantation of hBMMSCs. In their

study, they seeded the stem cells in a collagen scaffold, stimulated them with different

factors for 5 weeks until the cells differentiated toward a cartilaginous lineage, and

subsequently implanted the scaffold and cells subcutaneously into host mice. Five to 12

weeks after implantation they found that the implants attracted host cells to form

vascularized bone and mature bone marrow [49]. In our study, both the lenti-BMP2

transduced hMDSCs and hBMMSCs demonstrated similar capacities to form functional

bone by 6 weeks post-implantation, and the newly formed bone marrow was populated by at

least three different hematopoietic lineages. These results were very encouraging because

our method omitted the necessity of the in vitro culture process, did not require the use of a

complicated scaffold, and took a shorter time to form mature bone which actually integrated

with the host bone.

We also found that the newly formed bone in the hMDSCs group underwent faster

remodeling (a measure of bone maturation) than the hBMMSCs group, as indicated by the

appearance of a greater number of TRAP positive osteoclasts in the newly formed bone

created by the hMDSCs. This is important because the faster bone remodeling occurs, the

quicker functional integration can occur with the host bone.

Limitations of the current study included the fact that we could not obtain bone marrow and

skeletal muscle biopsies from the same donors to perform side-by-side comparative studies

of the isolated hBMMSCs and hMDSCs. Also, the skull defect model is not an easy model

to determine biomechanical testing post-treatment, and therefore additional studies using a

long bone defect is required in the future.

5. Conclusion

In summary, we found that hMDSCs were as efficient as hBMMSCs in terms of their in

vitro osteogenesis and in vivo bone regeneration capacity, and all the populations studied

formed mature bone and bone marrow by 6 weeks when genetically modified with a lenti-

BMP2 viral vector. Genetic modification or stimulation with BMP of both cell populations

was a key requirement for the cells to efficiently regenerate bone. Therefore, skeletal muscle

is a potential reliable alternative source of adult mesenchymal stem cells (hMDSCs) for

applications in bone tissue engineering and bone defect repair.

Gao et al. Page 10


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Acknowledgments

We highly appreciate Deanna Rhodes from Histology core of McGowan Institute For Regenerative Medicine fromUniversity of Pittsburgh Medical Center for performing Herovici's staining and H&E staining. We thank NickOyster for his assistance performing the microCT scanning and evaluation of non-transduced cells in vivoexperiments. This project was funded by NIH grant 5RO1-DE13420-09 to Dr. Johnny Huard and Commonwealthof Pennsylvania Department of Health funding to Dr. Rocky S Tuan.

References

1. Behr B, Tang C, Germann G, Longaker MT, Quarto N. Locally applied vascular endothelial growthfactor A increases the osteogenic healing capacity of human adipose-derived stem cells bypromoting osteogenic and endothelial differentiation. Stem Cells. 2011; 29(2):286–296. [PubMed:21732486]

2. Levi B, Nelson ER, Li S, James AW, Hyun JS, Montoro DT, et al. Dura mater stimulates humanadipose-derived stromal cells to undergo bone formation in mouse calvarial defects. Stem Cells.2011; 29(8):1241–1255. [PubMed: 21656608]

3. Cowan CM, Shi YY, Aalami OO, Chou YF, Mari C, Thomas R, et al. Adipose-derived adultstromal cells heal critical-size mouse calvarial defects. Nat Biotechnol. 2004; 22(5):560–567.[PubMed: 15077117]

4. James AW, Levi B, Nelson ER, Peng M, Commons GW, Lee M, et al. Deleterious effects offreezing on osteogenic differentiation of human adipose-derived stromal cells in vitro and in vivo.Stem Cells Dev. 2011; 20(3):427–439. [PubMed: 20536327]

5. Mastrogiacomo M, Derubeis AR, Cancedda R. Bone and cartilage formation by skeletal musclederived cells. J Cell Physiol. 2005; 204(2):594–603. [PubMed: 15744752]

6. Musgrave DS, Pruchnic R, Bosch P, Ziran BH, Whalen J, Huard J. Human skeletal muscle cells inex vivo gene therapy to deliver bone morphogenetic protein-2. J Bone Joint Surg Br. 2002; 84(1):120–127. [PubMed: 11837817]

7. Okada M, Payne TR, Drowley L, Jankowski RJ, Momoi N, Beckman S, et al. Human skeletalmuscle cells with a slow adhesion rate after isolation and an enhanced stress resistance improvefunction of ischemic hearts. Mol Ther. 2012; 20(1):138–145. [PubMed: 22068427]

8. Smaldone MC, Chancellor MB. Muscle derived stem cell therapy for stress urinary incontinence.World J Urol. 2008; 26(4):327–332. [PubMed: 18470515]

9. Gao X, Usas A, Lu A, Tang Y, Wang B, Chen CW, et al. BMP2 is superior to BMP4 for promotinghuman muscle-derived stem cell-mediated bone regeneration in a critical-sized calvarial defectmodel. Cell Transplant. 2013; 22(12):2393–2408. [PubMed: 23244588]

10. Schneider RK, Puellen A, Kramann R, Raupach K, Bornemann J, Knuechel R, et al. Theosteogenic differentiation of adult bone marrow and perinatal umbilical mesenchymal stem cellsand matrix remodelling in three-dimensional collagen scaffolds. Biomaterials. 2010; 31(3):467–480. [PubMed: 19815272]

11. Chang SC, Chung HY, Tai CL, Chen PK, Lin TM, Jeng LB. Repair of large cranial defects byhBMP-2 expressing bone marrow stromal cells: comparison between alginate and collagen type Isystems. J Biomed Mater Res A. 2010; 94(2):433–441. [PubMed: 20186742]

12. Yang Y, Hallgrimsson B, Putnins EE. Craniofacial defect regeneration using engineered bonemarrow mesenchymal stromal cells. J Biomed Mater Res A. 2011; 99(1):74–85. [PubMed:21800417]

13. Zannettino AC, Paton S, Itescu S, Gronthos S. Comparative assessment of the osteoconductiveproperties of different biomaterials in vivo seeded with human or ovine mesenchymal stem/stromal cells. Tissue Eng Part A. 2010; 16(12):3579–3587. [PubMed: 20666614]

14. Chang SH, Tung KY, Wang YJ, Tsao YP, Ni TS, Liu HK. Fabrication of vascularized bone graftsof predetermined shape with hydroxyapatite-collagen gel beads and autogenous mesenchymalstem cell composites. Plast Reconstr Surg. 2010; 125(5):1393–1402. [PubMed: 20440159]

15. Kim KS, Lee JY, Kang YM, Kim ES, Kim GH, Rhee SD, et al. Small intestine submucosa spongefor in vivo support of tissue-engineered bone formation in the presence of rat bone marrow stemcells. Biomaterials. 2010; 31(6):1104–1113. [PubMed: 19854502]

Gao et al. Page 11


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

16. Huang Y, Jin X, Zhang X, Sun H, Tu J, Tang T, et al. In vitro and in vivo evaluation of akermanitebioceramics for bone regeneration. Biomaterials. 2009; 30(28):5041–5048. [PubMed: 19545889]

17. Hale BW, Goodrich LR, Frisbie DD, McIlwraith CW, Kisiday JD. Effect of scaffold dilution onmigration of mesenchymal stem cells from fibrin hydrogels. Am J Vet Res. 2012; 73(2):313–318.[PubMed: 22280396]

18. Kretlow JD, Spicer PP, Jansen JA, Vacanti CA, Kasper FK, Mikos AG. Uncultured marrowmononuclear cells delivered within fibrin glue hydrogels to porous scaffolds enhance boneregeneration within critical-sized rat cranial defects. Tissue Eng Part A. 2010; 16(12):3555–3568.[PubMed: 20715884]

19. Usas A, Ho AM, Cooper GM, Olshanski A, Peng H, Huard J. Bone regeneration mediated byBMP4-expressing muscle-derived stem cells is affected by delivery system. Tissue Eng Part A.2009; 15(2):285–293. [PubMed: 19061430]

20. Zhao Z, Wang Y, Peng J, Ren Z, Zhang L, Guo Q, et al. Improvement in nerve regenerationthrough a decellularized nerve graft by supplementation with bone marrow stromal cells in fibrin.Cell Transplant. 2014; 23(1):97–110. [PubMed: 23128095]

21. Ahmed TA, Giulivi A, Griffith M, Hincke M. Fibrin glues in combination with mesenchymal stemcells to develop a tissue-engineered cartilage substitute. Tissue Eng Part A. 2011; 17(3-4):323–335. [PubMed: 20799906]

22. Gharaibeh B, Lu A, Tebbets J, Zheng B, Feduska J, Crisan M, et al. Isolation of a slowly adheringcell fraction containing stem cells from murine skeletal muscle by the preplate technique. NatProtoc. 2008; 3(9):1501–1509. [PubMed: 18772878]

23. Caterson EJ, Nesti LJ, Danielson KG, Tuan RS. Human marrow-derived mesenchymal progenitorcells: isolation, culture expansion, and analysis of differentiation. Mol Biotechnol. 2002; 20(3):245–256. [PubMed: 11936255]

24. Koressaar T, Remm M. Enhancements and modifications of primer design program Primer3.Bioinformatics. 2007; 23(10):1289–1291. [PubMed: 17379693]

25. Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, et al. Primer3--newcapabilities and interfaces. Nucleic Acids Res. 2012; 40(15):e115. [PubMed: 22730293]

26. Bouxsein ML, Boyd SK, Christiansen BA, Guldberg RE, Jepsen KJ, Muller R. Guidelines forassessment of bone microstructure in rodents using micro-computed tomography. J Bone MinerRes. 2010; 25(7):1468–1486. [PubMed: 20533309]

27. Levame M, Meyer F. Herovici's picropolychromium. Application to the identification of type I andIII collagens. Pathol Biol (Paris). 1987; 35(8):1183–1188. [PubMed: 2446240]

28. Pieraggi MT, Julian M, Bouissou H, Stocker S, Grimaud JA. Dermal aging. Immunofluorescencestudy of collagens I and III and fibronectin. Ann Pathol. 1984; 4(3):185–194. [PubMed: 6383413]

29. Turner NJ, Pezzone MA, Brown BN, Badylak SF. Quantitative multispectral imaging of Herovici'spolychrome for the assessment of collagen content and tissue remodelling. J Tissue Eng RegenMed. 2013; 7(2):139–148. [PubMed: 22072426]

30. Connolly JF, Guse R, Tiedeman J, Dehne R. Autologous marrow injection as a substitute foroperative grafting of tibial nonunions. Clin Orthop Relat Res. 1991; (266):259–270. [PubMed:2019059]

31. Tiedeman JJ, Garvin KL, Kile TA, Connolly JF. The role of a composite, demineralized bonematrix and bone marrow in the treatment of osseous defects. Orthopedics. 1995; 18(12):1153–1158. [PubMed: 8749293]

32. Hernigou P, Poignard A, Beaujean F, Rouard H. Percutaneous autologous bone-marrow graftingfor nonunions. Influence of the number and concentration of progenitor cells. J Bone Joint SurgAm. 2005; 87(7):1430–1437. [PubMed: 15995108]

33. Quarto R, Mastrogiacomo M, Cancedda R, Kutepov SM, Mukhachev V, Lavroukov A, et al.Repair of large bone defects with the use of autologous bone marrow stromal cells. N Engl J Med.2001; 344(5):385–386. [PubMed: 11195802]

34. Marcacci M, Kon E, Moukhachev V, Lavroukov A, Kutepov S, Quarto R, et al. Stem cellsassociated with macroporous bioceramics for long bone repair: 6- to 7-year outcome of a pilotclinical study. Tissue Eng. 2007; 13(5):947–955. [PubMed: 17484701]

Gao et al. Page 12


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

35. Kitoh H, Kitakoji T, Tsuchiya H, Mitsuyama H, Nakamura H, Katoh M, et al. Transplantation ofmarrow-derived mesenchymal stem cells and platelet-rich plasma during distraction osteogenesis--a preliminary result of three cases. Bone. 2004; 35(4):892–898. [PubMed: 15454096]

36. Srouji S, Ben-David D, Fromigue O, Vaudin P, Kuhn G, Muller R, et al. Lentiviral-mediatedintegrin alpha5 expression in human adult mesenchymal stromal cells promotes bone repair inmouse cranial and long-bone defects. Hum Gene Ther. 2012; 23(2):167–172. [PubMed:21958321]

37. Kleinschmidt K, Ploeger F, Nickel J, Glockenmeier J, Kunz P, Richter W. Enhancedreconstruction of long bone architecture by a growth factor mutant combining positive features ofGDF-5 and BMP-2. Biomaterials. 2013; 34(24):5926–5936. [PubMed: 23680368]

38. Kanczler JM, Ginty PJ, White L, Clarke NM, Howdle SM, Shakesheff KM, et al. The effect of thedelivery of vascular endothelial growth factor and bone morphogenic protein-2 to osteoprogenitorcell populations on bone formation. Biomaterials. 2010; 31(6):1242–1250. [PubMed: 19926128]

39. Meinel L, Hofmann S, Betz O, Fajardo R, Merkle HP, Langer R, et al. Osteogenesis by humanmesenchymal stem cells cultured on silk biomaterials: comparison of adenovirus mediated genetransfer and protein delivery of BMP-2. Biomaterials. 2006; 27(28):4993–5002. [PubMed:16765437]

40. Miyazaki M, Zuk PA, Zou J, Yoon SH, Wei F, Morishita Y, et al. Comparison of humanmesenchymal stem cells derived from adipose tissue and bone marrow for ex vivo gene therapy inrat spinal fusion model. Spine. 2008; 33(8):863–869. [PubMed: 18404105]

41. Undale A, Fraser D, Hefferan T, Kopher RA, Herrick J, Evans GL, et al. Induction of fracturerepair by mesenchymal cells derived from human embryonic stem cells or bone marrow. J OrthopRes. 2011; 29(12):1804–1811. [PubMed: 21674605]

42. Nesti LJ, Jackson WM, Shanti RM, Koehler SM, Aragon AB, Bailey JR, et al. Differentiationpotential of multipotent progenitor cells derived from war-traumatized muscle tissue. J Bone JointSurg Am. 2008; 90(11):2390–2398. [PubMed: 18978407]

43. Jackson WM, Aragon AB, Djouad F, Song Y, Koehler SM, Nesti LJ, et al. Mesenchymalprogenitor cells derived from traumatized human muscle. J Tissue Eng Regen Med. 2009; 3(2):129–138. [PubMed: 19170141]

44. Jackson WM, Lozito TP, Djouad F, Kuhn NZ, Nesti LJ, Tuan RS. Differentiation and regenerationpotential of mesenchymal progenitor cells derived from traumatized muscle tissue. J Cell MolMed. 2011; 15(11):2377–2388. [PubMed: 21129154]

45. Jackson WM, Aragon AB, Bulken-Hoover JD, Nesti LJ, Tuan RS. Putative heterotopic ossificationprogenitor cells derived from traumatized muscle. J Orthop Res. 2009; 27(12):1645–1651.[PubMed: 19517576]

46. Lavery K, Swain P, Falb D, Alaoui-Ismaili MH. BMP-2/4 and BMP-6/7 differentially utilize cellsurface receptors to induce osteoblastic differentiation of human bone marrow-derivedmesenchymal stem cells. J Biol Chem. 2008; 283(30):20948–20958. [PubMed: 18436533]

47. Ko EK, Jeong SI, Rim NG, Lee YM, Shin H, Lee BK. In vitro osteogenic differentiation of humanmesenchymal stem cells and in vivo bone formation in composite nanofiber meshes. Tissue EngPart A. 2008; 14(12):2105–2119. [PubMed: 18788980]

48. Degano IR, Vilalta M, Bago JR, Matthies AM, Hubbell JA, Dimitriou H, et al. Bioluminescenceimaging of calvarial bone repair using bone marrow and adipose tissue-derived mesenchymal stemcells. Biomaterials. 2008; 29(4):427–437. [PubMed: 17950456]

49. Scotti C, Piccinini E, Takizawa H, Todorov A, Bourgine P, Papadimitropoulos A, et al.Engineering of a functional bone organ through endochondral ossification. Proc Natl Acad Sci U SA. 2013; 110(10):3997–4002. [PubMed: 23401508]

Gao et al. Page 13


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Fig. 1.Gene expression and ALP staining of hBMMSCs and hMDSCs, before and after lenti-

BMP2 transduction. A) Gene expression analysis by semi-quantitative RT-PCR. B)

Quantification of the expression of osteogenic genes by hMDSCs and hBMMSCs. C) ALP

staining. D) Quantification of ALP positive cells indicated that their abundance was

significantly higher in the hBMMSC81F population and significantly lower in the hBMMSC

66F population after transduction. No difference was found in other populations after lenti-

BMP2 transduction. Scale bars in C represent 200μm. **P<0.01, *** P<0.001.

Gao et al. Page 14


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Fig. 2.MicroCT imaging of mineralization of in vitro 3D pellet cultures at 3 and 4 weeks after

osteogenic differentiation. A) Representative 3D microCT images of two populations of

hBMMSCs and hMDSCs. B-C) Quantification of mineralized volumes of the hBMMSC

pellets. D-E) Quantification of the mineralized volumes of hMDSC pellets. Transduction

with lenti-BMP2 enhanced mineralization of the pellets with the exception of donor

hMDSCs 21M.

* p<0.05, ** p<0.01, ***<0.001 compared to the untransduced cells.

Gao et al. Page 15


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Fig. 3.Von Kossa staining and osteocalcin immunohistochemistry of hBMMSCs and hMDSCs

pellet cultures. A) Von Kossa staining. Untransduced hBMMSCs mineralized mainly at the

periphery of the pellets and lenti-BMP2 transduction resulted in both peripheral and central

mineralization of the pellets. hMDSCs tended to mineralize throughout the entire pellet.

LentiBMP2 transduction enhanced the extent of mineralization. B) Osteocalcin

immunohistochemistry. Osteocalcin positive cells stained dark brown. Osteocalcin was

identified in the same location as the Von Kossa positive cells in both the hBMMSCs and

hMDSCs pellets.

Gao et al. Page 16


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Fig. 4.Comparison of in vivo bone regeneration by untransduced hBMMSCs and hMDSCs. A)

MicroCT 3D images of the calvarial bone defect at different times points post implantation

of the stem cells. B) Quantification of the defect healing percentage. The defect closure

ranged from 15-26% on average for both the hBMMSCs and hMDSCs. No statistical

differences were found.

Gao et al. Page 17


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Fig.5.Histological analysis of the regenerated tissues formed by the untransduced hBMMSCs and

hMDSCs. A) Herovici's staining. The defect area is shown between the two black arrows at

20X magnification. Both the hBMMSCs and hMDSCs transplantation groups stained

positively for collagen type III (blue) in the defect area while the host bone stained

positively for collagen type I (red) matrix. B) High magnification (200X) showing the defect

area was mainly filled with collagen type III (blue) in both populations of hBMMSCs and

hMDSCs while the host bones stained positively for collagen type I (red). C) H&E staining

further indicated the formation of fibrotic tissue in the defect area while the host bone

showed a dense bone matrix. COL3; Collagen type III. HB: Host bone; Br: Brain; COL1:

Collagen type I; FT: Fibrotic tissue.

Gao et al. Page 18


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Fig. 6.Comparison of bone regeneration capacity of lenti-BMP2 transduced hBMMSC and

hMDSCs. A-B) Representative microCT images of 4 populations of lenti-BMP2 tranduced

hBMMSCs and 4 populations of lenti-BMP2 transduced hMDSCs at various time points

post implantation. C) Quantification of newly formed bone volume by microCT for all

populations of both hBMMSCs and hMDSCs groups. D) Combined bone volume of

hBMMSCs and hMDSCs indicated no statistical differences. E) Quantification of defect

coverage (%) for both groups. N=4 for each population. F) Combined bone defect coverage

showing no statistical differences between the hBMMSCs and hMDSCs groups.

Gao et al. Page 19


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Fig. 7.Histological analysis of the newly formed bone in the defect area by the lenti-BMP2

transduced hBMMSCs and hMDSCs. A) Herovici's staining. The newly formed bone in

both groups contained similar collagen type I positive bone matrix (red) (20X

magnifications) as host bone. The region between the two black arrows indicates the defect

area. B) Herovici's staining indicated the whole defect area in detail. C). Herovici's staining

at high magnification indicated the structure of the bone matrix (red) and bone marrow (light

blue). D) H&E staining displayed the formation of bone and functional bone marrow. Both

the hBMMSCs and hMDSCs groups formed new functional bone as indicated by the dense

bone matrix (red) and functional bone marrow was demonstrated by the appearance of blood

vessels (yellow arrows) and three lineages of bone marrow cells including erythrocytes

(green arrows), myeloid cells (blue arrows), and megakaryocytes (blue box). Inserts are the

enlarged megakaryocytes in the blue boxes. COL1: Collagen type 1; COL3, collagen type 3;

BM: Bone marrow; B, Bone; Br, Brain.

Gao et al. Page 20


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Fig. 8.TRAP staining revealed osteoclasts mediated bone remodeling. A) Representative TRAP

staining images of the newly regenerated bone in the defect area of two populations of

hBMMSCs and hMDSCs. TRAP positive osteocalsts stain violet red (green arrows) on the

bone surface seen in the newly regenerated bone of 4 populations ofhBMMSCs and

hMDSCs, inserts in each picture showing TRAP positive osteoclasts. B). Quantification of

TRAP positive osteoclasts for each cell population. C. Comparison of hBMMSCs and

hMDSCs groups indicated more TRAP positive osteoclasts in the hMDSCs group than the

hBMMSCs group.

* P<0.05 compared to hBMMSCs group.

Gao et al. Page 21


NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

NIH

-PA

Author M

anuscriptN

IH-P

A A

uthor Manuscript

NIH

-PA

Author M

anuscript

Gao et al. Page 22

Table l

Primer information

Gene name Accession number Primers (5’-3’) Product size (bp) Annealing temperature

SOX9 NM 000346.3 F: GCTCAGCAAGACGCTGGGCA 249 55

R: CCGGAGGAGGAGTGTGGCGA

BMPR1B NM 001203.2 F:AGGCCTCCCTCTGCTGGTCC 108 55

R: TTCGCCACGCCACTTTCCCA

BMPR2 NM 001204.6 F: TCCCATGCTGCCACAACCCA 231 55

R: TGGCCGTTCCCTCCTGTCCA

COX-2 NM 000963.2 F: GCGAGGGCCAGCTTTCACCA 225 55

R: CCTGCCCCACAGCAAACCGT

GAPDH NM_002046.4 F: GCCTTCCGTGTCCCCACTGC 211 55

R: CAATGCCAGCCCCAGCGTCA

F: Forward; R: Reverse


Documents

BMP NIH Public Access Author Manuscript Biomaterials Jian ......lentivirus; calvarial defect; bone tissue engineering 1. Introduction Adult mesenchymal stem cells have been isolated