Bb

XG

a

ARRA

KBBWX

1

rirdenTeibdi

b

0h

Enzyme and Microbial Technology 52 (2013) 91– 98

Contents lists available at SciVerse ScienceDirect

Enzyme and Microbial Technology

jou rn al h om epage: www.elsev ier .com/ locate /emt

leach boosting effect of xylanase A from Bacillus halodurans C-125 in ECFleaching of wheat straw pulp

iao-qiong Lin, Shuang-yan Han, Na Zhang, Hui Hu, Sui-ping Zheng, Yan-rui Ye, Ying Lin ∗

uangdong Key Laboratory of Fermentation and Enzyme Engineering, School of Bioscience and Bioengineering, South China University of Technology, Guangzhou 510006, PR China

r t i c l e i n f o

rticle history:eceived 15 August 2012eceived in revised form 28 October 2012ccepted 30 October 2012

eywords:acillus halodurans C-125leachingheat straw pulp

ylanase

a b s t r a c t

Past studies have revealed major difficulties in applications of xylanase in the pulp and paper industryas enzymes isolated from many different species could not tolerate high temperatures or highly alkalineconditions. The thermostable xylanase A from Bacillus halodurans C-125 (C-125 xylanase A) was suc-cessfully cloned and expressed in Pichia pastoris with a yield as high as 3361 U/mL in a 2 L reactor. Itsthermophilic and basophilic properties (optimal activity at 70 ◦C and pH 9.0), together with the fact it iscellulase-free, render this enzyme attractive for compatible applications in the pulp and paper industry.The pretreatment of wheat straw pulp with C-125 xylanase A at pH 9.0 and 70 ◦C for 90 min induced therelease of both chromophores (Ab237, Ab254, Ab280) and hydrophobic compounds (Ab465) into the filtrateas well as sugar degradation. Moreover, the addition of 10 U xylanase to 1 g wheat straw pulp (dry weight)as pretreatment improved brightness by 5.2% ISO and decreased the kappa number by 5.0% when fol-lowed by hydrogen peroxide bleaching. In addition, compared with two commercial enzymes, PulpzymeHC and AU-PE89, which are normally incorporated in ECF bleaching of wheat straw pulp, C-125 xylanaseA proved to be more effective in enhancing brightness as well as preserving paper strength properties.

When evaluating the physical properties of pulp samples, such as tensile index, tearing index, burstingindex, and post-color (PC) number, the enzymes involved in pretreating pulps exhibited better or thesame performances as chemical treatment. Compared with chemical bleaching, chlorine consumptioncan be significantly reduced by 10% for xylanase-pretreated wheat straw pulp while maintaining thebrightness together with the kappa number at the same level. Scanning electron microscopy revealedsignificant surface modification of enzyme-pretreated pulp fibers with no marked fiber disruptions.

. Introduction

Environmental issues are leading governments to develop moreestrictive laws against pollution induced by chlorinated diox-ns and other chlorinated compounds during pulp bleaching. Inesponse to environmental concerns and stringent emission stan-ards, modifications of the production process, mainly involvinglemental chlorine free (ECF) and totally chlorine free (TCF) tech-iques at the pulp bleaching stages, have been raised [1–4].hese technologies all aim to reduce or phase out the use oflemental chlorine or chlorine-based chemicals from the bleach-ng sequences. Enzymatic biobleaching of kraft pulp, representedy xylanase, is a promising approach to further reduce chemicalemands and lower poisonous emissions in the pulp and paper

ndustry.Several commercially available xylanase preparations have

een investigated in laboratory-scale biobleaching of pulps,

∗ Corresponding author. Tel.: +86 20 3938 0698; fax: +86 20 3938 0698.E-mail address: feylin@scut.edu.cn (Y. Lin).

141-0229/$ – see front matter © 2012 Elsevier Inc. All rights reserved.ttp://dx.doi.org/10.1016/j.enzmictec.2012.10.011

© 2012 Elsevier Inc. All rights reserved.

concentrating on hardwood and softwood kraft pulp. However,most were active at slightly acidic or neutral pH, such as PulpzymeHA (Novozymes, Denmark) produced by Trichoderma reesei, thefirst commercially available xylanase used in the biobleaching ofwood pulps [5], and Cartazyme (Clariant, Switzerland), reported tobe able to improve the brightness of kraft pulps [6]. The reportedresults suggested that xylanase pretreatment helps decrease theamounts of chemicals needed to achieve the target brightness inthe subsequent bleaching stage.

Up to now, there have been few bulk or industrial-scale appli-cations of xylanase. Excluding the low efficiency and high cost ofthe commercially available xylanases, there remain several bottle-necks preventing their adoption by the pulp and paper industry.Most xylanases are susceptible to denaturation when exposed tothe high temperatures and highly alkaline processes associatedwith pulp processing, and cooling of the pulp substrate must bedone so that enzyme preparations can play a role [7,8]. Hence,

combined with the strength requirements of cellulosic fibers, themost significant features of xylanase for industrial bleaching are itscellulase-free isolation and thermophilic and basophilic properties,which are also the prerequisites for large-scale application in the

9 crobial Technology 52 (2013) 91– 98

ppccd

msrirm

cfrsintapErbmsb

2

2

t(gcim1a

tupcaffH(ooIs

2o

gpPtbp

piap2fi

Table 1Primers used for plasmid construction and quantitative PCR analysis.

Name Sequence (5′–3′) Annotation

Pxyn1 GCGGGAATTCATGATTACTTTGTTTAAG EcoRI site (underlined)Pxyn2 TATGCGGCCGCTTAATCAATAATTCTCC NotI sitePg1 GTATCTCGAGTGTGAGGCTGAAATGTG XhoI sitePg2 CTCAGAATTCCATGCCAACTCAATCC EcoRI sitePrtx1 AGGTGCTGATAAGATTGT qPCR for XYN

2 X.-q. Lin et al. / Enzyme and Mi

ulp and paper industry [9–12]. In addition, the use of enzymes inulp processing will improve the efficiency of the bleaching pro-ess at elevated temperatures. Thus, the development of a moreost-effective and temperature- and pH-tolerant xylanase is highlyesirable.

Wheat straw is an important raw material for pulp and paperanufacturing and is seemingly the most suitable among the cereal

traw materials for manufacturing paper, especially in the Asianegion [7,13]. Unlike wood pulps, wheat straw pulp has severalnherent drawbacks, among which rapid discoloration that oftenesults in pulp having a low initial brightness during storage is theost prominent.Bacillus halodurans C-125 is an alkaliphilic bacterium and the

omplete genome sequence has become available [14]. Xylanaserom B. halodurans C-125 is active across a relatively broad pHange, according to the reports [15,16]. It had been expressed as aoluble form of intracellular protein with activity as low as 16 U/mLn Escherichia coli, accompanied by more than half of the recombi-ant protein located in the cytoplasm [17]. In this study, we aimedo express xylanase from B. halodurans C-125 (xynA) in P. pastorisnd investigated its properties and its application in wheat strawulp biobleaching. We were able to extend its application to theCF bleaching of wheat straw pulp. The results revealed that theecombinant xylanase from B. halodurans C-125 could enhance pulpleaching without compromising pulp strength. Scanning electronicroscopy (SEM) analysis allowed us to obtain a better under-

tanding of the effect of xylanase pretreatment in enhancing pulpleachability.

. Materials and methods

.1. Strains and media

B. halodurans C-125 was purchased from DSMZ (no: 18197). E. coli Top10 (Invi-rogen, USA) was used as the host strain for plasmid amplification. P. pastoris GS115Invitrogen, USA) was used for the expression of recombinant xylanases. E. coli wasrown at 37 ◦C in low LB medium (1% tryptone, 0.5% yeast extract, 0.5% NaCl),ontaining 25 �g/mL Zeocin as necessary. P. pastoris was routinely grown eithern YPD medium (1% yeast extract, 2% peptone, and 2% glucose) or BMGY/BMMY

edium (1% yeast extract, 2% peptone, 100 mM potassium phosphate, pH 6.0,.34% yeast nitrogen base (YNB), 4 × 10−5% biotin, 1% glycerol or 1% methanol)t 30 ◦C.

Oat-spelt xylan was used as the substrate for selecting the recombinant P. pas-oris; beechwood xylan and carboxymethyl cellulose (CMC, low viscosity) weresed to analyze the activities of xylanase and cellulase, respectively, which wereurchased from Sigma Chemical Company (St. Louis, MO, USA). Restriction endonu-leases and T4 DNA ligases were from TaKaRa (Tokyo, Japan) and were usedccording to the manufacturer’s recommendation. pPICZ�A vector was obtainedrom Invitrogen (San Diego, CA, USA). QIAquick Gel Purification Kit was purchasedrom QIAGEN (Qiagen Co, Hilden, Germany). Two commercial xylanases, PulpzymeC and AU-PE89, were supplied by Novozymes (Bagsvaerd, Denmark) and Sukahan

Shandong Weifang, China), respectively. Antibodies for Western blot analysis werebtained from Abgent (mouse anti-6 × His monoclonal antibody; USA), and the sec-ndary antibody was from Invitrogen (Alexa Fluor-488-conjugated goat anti-mousegG; USA). All other chemicals used were analytical grade reagents unless otherwisetated.

.2. Construction of recombinant expression vectors for P. pastoris and screeningf the recombinant xylanase

All primers used for plasmid construction are listed in Table 1. The C-125 xynAene (NCBI Gene ID: 891394) was amplified from B. halodurans C-125 using therimers Pxyn1/Pxyn2. The PCR reaction was performed using a routine method. TheCR product was gel-purified and digested with EcoRI and NotI, and then ligated intohe plasmid pPICZ�A, resulting in the recombinant plasmid pPICZ�xynA. The recom-inant plasmid pPICZ�xynA was transformed into E. coli Top10 for amplification andreparation.

10 �g of pPICZ�xynA plasmid were linearized with SacI and integrated into P.astoris using the lithium chloride (LiCl) method, according to the manufacturer’s

nstructions (Invitrogen). The original plasmid pPICZ�A, linearized with SacI, waslso transformed into P. pastoris as a control. The recombinants were selected onlates with YPDS medium containing Zeocin at 100, 200, 500, 1000, 1500, and000 �g/mL. The integration of C-125 xynA into the genome of P. pastoris was con-rmed by PCR using 5′AOX1 and 3′AOX1 primers in the transformants.

Prtx2 TTGCTTGTTAGCCTTT qPCR for XYNPrtg1 GTCGGGACACGCCTGAAACT qPCR for GPrtg2 CCACCTTTTGGACCCTATTGAC qPCR for G

2.3. Quantitative PCR assay of C-125 xynA copy number

The quantitative PCR (qPCR) assay protocol was derived from the Pfaffl method[18]. A standard plasmid, pPICZ�-G-xynA, was constructed containing a 600 bp Gfragment (the interval partial sequence between P. pastoris GS115 genes 8198905and 8198906) and a C-125 xynA gene. The G fragment was amplified from P. pas-toris GS115 genomic DNA by PCR, using the primers Pg1/Pg2 (Table 1), and thencloned in pPICZ�xynA. pPICZ�-G-xynA was transformed into E. coli TOP10F′ strainfor propagation. To prepare the standard plasmid working solution for qPCR assay,pPICZ�-G-xynA was extracted from a positive recombinant and diluted with ultra-pure water to a 100 pg/�L solution. The qPCR assay was performed using a gradientdilution pPICZ�-G-xynA working solution (1 × 100–1 × 10−6) as template and theprimers Prtx1/Prtx2 and Prtg1/Prtg2. For each gradient sample, the crossing points ofthe amplification curve with the threshold line (CT) versus the pPICZ�-G-xynA con-centration input were plotted to calculate the slope. The yeast recombinant DNA andthe standard plasmid were analyzed simultaneously using a real-time PCR instru-ment (ABI7500). For analyzing each gene of different strains, data were treated usingthe method of Sun et al. [19].

2.4. Laboratory scale production of recombinant xylanase by P. pastoris

The fermentation of the recombinant P. pastoris was performed in a 2 L BIOSTATA plus fermentor with containing 900 mL basic salt medium (H3PO4 85%, 26.7 mL/L;CaSO4, 5.58 g/L; K2SO4, 18.2 g/L; MgSO4·7H2O, 14.9 g/L; KOH, 4.13 g/L) plus 4.35 mL/LPTM1 trace metal solution and glycerol 40.0 g/L, with an initial volume of 1 L. A seedculture of P. pastoris (14 h-old) was prepared in BMGY broth and inoculated at 10%(v/v). The temperature was controlled at 30 ◦C in the glycerol phase, and then it wasadjusted to 25 ◦C in the methanol induction phase. The dissolved oxygen set-pointwas 30%, and the pH was maintained at 5.0 using ammonium hydroxide solution.The induction phase was initiated after 44 h of culture. The feed rates were variedin two stages: 4 h in a low rate stage with a rate of 2 mL/h and 140 h in a high ratestage with a rate of 6.5 mL/h. The total consumption of methanol was about 0.92 L.

2.5. Assay of xylanase activity and its purification

MM plates (0.8% oat-spelt xylan, 0.3% yeast extract, 2% methanol, 2% agar) at pH6.0 (100 mM phosphate buffer) were used to screen the clones producing xylanase.Specifically, the yeast recombinants were selected on MM plates with oat-spelt xylanand incubated for 48 h at 30 ◦C. The transparent zone indicated roughly the xylanase-producing capacity of P. pastoris transformants.

The supernatant from the culture broth of P. pastoris cells, after centrifugationat 6000 × g for 5 min, was used as the enzyme source. Xylanase activity was mea-sured based on the release of reducing sugar from xylan using the dinitrosalicylicacid (DNS) method [20]. An appropriately diluted enzyme source was added to 1%(w/v) beechwood xylan dissolved in glycine–NaOH buffer (pH 9.0) and incubatedat 70 ◦C for 30 min, and then the reaction was stopped by adding DNS reagent. Cel-lulase activity was measured in a similar manner using carboxymethyl celluloseas substrate. One unit of the above enzyme activity was defined as the amount ofenzyme that releases 1 �mol of reducing sugar equivalent to xylose or glucose permin under the assay conditions. All analytical measurements were performed atleast in triplicate. Protein concentrations were measured by the Lowry method [21]with BSA (bovine serum albumin) as the standard.

Crude xylanase was purified by precipitation with ammonium sulfate (60% sat-uration) followed by centrifugation at 6000 × g for 10 min at 4 ◦C. The precipitatedproteins were then resuspended in Na2HPO4 citric acid buffer (0.2 M Na2HPO4, 0.1 Mcitric acid; pH 6.0). Then, the xylanase protein (containing a C-terminal His-tag) waspurified by immobilized metal-ion affinity chromatography on a HisTrap HP columnwith an AKTA purifier system (GE Healthcare UK Ltd. UK) according to the manufac-turer’s recommendations. Proteins were eluted with a linear gradient of 20–500 mMimidazole in 20 mM sodium phosphate buffer (pH 7.4) containing 0.5 M NaCl.

2.6. SDS-polyacrylamide gel electrophoresis (SDS-PAGE) and Western blotanalysis

Samples (culture supernatants were diluted 50-fold) were boiled in 120 mMTris–Cl buffer (pH 6.8) containing 2% SDS, 3% glycerol, and 1% �-mercaptoethanol

crobia

(na

bawbbU

2

2

arxTrsbx

2

mdob66am

2x

tlsTU

ipArt2ccmb9um2

2

uPxxadoaah

2

ttY

X.-q. Lin et al. / Enzyme and Mi

�-ME) for 10 min. They were centrifuged at 10,000 × g for 5 min, and the super-atants were subjected to 12% SDS-PAGE with 0.1% SDS in a vertical slab gelpparatus (Bio-rad, USA).

Proteins in polyacrylamide gels were transferred to nitrocellulose (NC) mem-ranes. The membranes were blocked with 3% PBS and incubated with annti-6 × His polyclonal antibody (1:500). The NC membranes were washed six timesith PBS before being exposed to the mouse anti-6′His monoclonal antibody. Protein

ands were visualized by exposure on X-ray films (Fujifilm, JPN) after the mem-ranes were treated with enhanced chemiluminescence solution (Thermo Pierce,SA).

.7. The properties of the recombinant xylanase

.7.1. The effect of pH on the recombinant xylanaseIn preliminary experiments, we first determined the temperature of optimum

ctivity of the recombinant C-125 xylanase A under standard conditions within aange of 40–80 ◦C in 50 mM Tris–HCl buffer (7.0). The results showed that C-125ylanase A has a high temperature bias and the optimum temperature was 70 ◦C.hus, the effect of pH on the enzyme activity was determined at 70 ◦C within a pHange of 4.0–12.0 using the above assay conditions. The effect of pH on the enzymetability was investigated by preincubating the enzyme at 50 ◦C in the differentuffers for 12 h and then determining the residual activity at 70 ◦C for 30 min. Theylanase used was from the samples purified by the above method.

.7.2. The effect of temperature on the recombinant xylanaseThe effect of temperature on the enzyme activity was determined at the opti-

um pH. A mixture of the enzyme and xylan solution was incubated for 30 min atifferent temperatures ranging between 45 ◦C and 85 ◦C; then the residual activitiesf these treated enzymes were determined [20]. Thermal stability was measuredy assessing the residual enzyme activity after incubation of the enzyme at 60 ◦C,5 ◦C, and 70 ◦C in 50 mM glycine–NaOH buffer, at the optimum pH, for 15, 30, 45,0, 75, 90, and 120 min. Samples were taken at different time intervals and residualctivity was measured. The xylanase was from the samples purified by the aboveethod.

.8. Pulp sample pretreatment and estimation of biobleaching with C-125ylanase A

Wheat straw was cooked using the following condition: temperature 160 ◦C,ime 60 min, NaOH concentration 16.0% (w/v), AQ concentration 0.05% (w/v) andiquid/solid ratio 6. Pulps were thoroughly washed with deionized water to removeoluble reducing sugars and any free soluble residual lignin before they were used.he raw wheat straw pulp had a kappa number of 17.8 and brightness of 35.5% ISO.nless otherwise specified, all other chemicals used were of analytical grade.

The biobleaching of the treated wheat straw pulp was carried out using vary-ng dosages of the crude C-125 xylanase A, ranging from 0 to 20 IU/g, and the pulproperties were investigated at regular intervals. All studies of the C-125 xylanase

were performed at 70 ◦C and pH 9.0, unless otherwise mentioned. The release ofeducing sugars was determined by the dinitrosalicylic acid (DNS) method [20], andhe release of chromophores from the pulp was measured spectrophotometrically at37, 254, 280, and 465 nm in the enzyme filtrates after different incubation periodsaused the release of chromophores (Ab237 nm, Ab254 nm, Ab280 nm). Hydrophobicompounds were determined by measuring at Ab465 nm. During the bleaching treat-ent, enzyme-treated and untreated pulp samples at 10% pulp consistency were

leached in a single stage bleaching process using 4% hydrogen peroxide for 3 h at0 ◦C. Kappa number was evaluated in the pulp sample. Hand sheets were preparednder standardized condition according to TAPPI standard methods and used toeasure the brightness [22]. The average error for this determination was less than

%. All reported data are averages of experiments performed in at least six replicates.

.9. Application of C-125 xylanase A in the elemental chlorine free (ECF) bleaching

Wheat straw pulp was pretreated by C-125 xylanase A in polyethylene bagsnder the optimum conditions and compared with two commercial xylanases,ulpzyme HC and AU-PE89. In order to compare the effectiveness of the threeylanases in the biobleaching sequences, the added doses of the commercialylanases and the process conditions were taken from the companies’ guidelinesnd the reported optimum conditions [23,24]. In the first biobleaching stage, (D),ifferent doses of chlorine dioxide (1.5% and 1.35%) were used as active chlorinen oven dry pulp (odp). In the second stage of chelation treatment, (Q), chelatinggents were used to reduce metal ions that were liable to degrade the bleachinggents and cellulose in the next peroxide bleaching treatment. The final stage ofydrogen peroxide treatment, (P), was the same for all of the samples (Table 2).

.10. Analysis of the physical and chemical characteristics of the wheat straw pulp

All characteristics of the pulp or paper made of pulp were analyzed according tohe TAPPI Test Methods. The kappa numbers of the pulps were determined accordingo TAPPI Test Methods T236om-85. The ISO pulp brightness was measured on theQ-Z-48B brightness color tester according to the TAPPI standards (T452 om-92).

l Technology 52 (2013) 91– 98 93

The paper was tested for tensile index, tear index, and burst index according to TAPPImethods T494om-88, T414om-88, and T403om-91, respectively.

The post color number is calculated according to Eqs. (1) and (2). In these equa-tions k and s refer to the absorption and scattering coefficients, respectively, and R∞is ISO brightness expressed as a fractional value [25]. The relationship between andthe chromophore concentration is non-linear, whereas the PC number is linearlyrelated to chromophore concentration for homogeneous samples. The PC numberis an indicator of the new chromophores generated in the paper sheets. A higher PCnumber indicates a greater number of chromophore bodies generated during aging:

PC =((

k

g

)after

−(

k

g

)before

)× 100 (1)

k

s= (1 − R∞)2

2R∞(2)

The average error for this determination was less than 5%. All reported data areaverages of experiments performed in at least six replicates.

2.11. Scanning electron microscopy (SEM)

Samples of untreated and enzyme-treated pulps or samples taken following thesubsequent fully bleached DQP process were observed by normal scanning elec-tron microscopy. The fibers suspended in water were placed on a cover glass andallowed to dry. The preparation was coated with gold particles (24 carat, 12 nm;20 nm thick layer). The samples were thoroughly examined at 10 kV under SEM(Hitachi, S-3700 N) at various magnifications, and micrographs were prepared asappropriate.

3. Results

3.1. Expression of xylanase gene (C-125 xynA) in P. pastoris

The gene xynA from B. halodurans C-125 was integrated into theP. pastoris GS115 genome. The recombinant strains were selectedon YPDS plates supplemented with different concentrations ofZeocin. The recombinant strains appearing in transparent zoneswere measured semi-quantitatively in the MM agar plates with oat-spelt, and a distinct diversity of xylanase activities was seen amongthem after induction for 48 h (Fig. 1A). In contrast, no xylanaseactivity was detected in yeasts transformed with the control strainGS115/pPICZ�A or the yeast host GS115. After several rounds rese-lecting with shake-flask culture, a recombinant strain yielding thehighest levels of xylanase (332 U/mL, data not shown) in shakeflasks was selected and qPCR was performed to evaluate the genecopy number. The results showed that the recombinant strain con-tained four copy numbers (ExynA was 3.968, Fig. 1B).

Prepared liquid seeds were inoculated in a 2 L fermentor to pro-duce xylanase. The fermentation curve indicated that the highestrecombinant xylanase activity reached 3361 U/mL after methanolinduction for about 132 h in the 2 L fermentor, which is the one ofthe highest levels of xylanase activity reported thus far. Simulta-neously, the secretory protein yield was found to be 5.2 g/L in theculture supernatant (Fig. 1C). The molecular weight of recombi-nant xylanase was approximately 45 kDa, assayed by SDS-PAGE andWestern blot, which is slightly heavier than the calculated valueof xylanase (43.0 kDa) from B. halodurans C-125 strain, which wasattributed to glycosylation in P. pastoris to some extent (Fig. 1D).

3.2. Thermophilic and basophilic characteristics of therecombinant C-125 xylanase A

The C-125 xylanase A in E. coli was inferred to have thermophilicand basophilic characteristics [17,26]. In the preliminary experi-ment, we found that C-125 xylanase A from P. pastoris showed ahigh temperature bias and the optimum temperature was 70 ◦Cat pH 7.0. Then, evaluation of the enzyme activity at 70 ◦C at pH

values ranging from 4.0 to 12.0 showed that the purified C-125xylanase A was highly active over a wide pH range (Fig. 2A). Theoptimum catalysis was at pH 9.0 and retained more than 80% activ-ity at pH 6.0–7.0 and at 9.0–10.5. The enzyme stability was studied

94 X.-q. Lin et al. / Enzyme and Microbial Technology 52 (2013) 91– 98

Table 2The bleaching conditions used in ECF sequences.

Symbol Xylanase and chemical charge Reaction time (min) Treatment temp (◦C) pH Consistency (%)

Xa 10 U/g pulp 90 70 9.0 6Xb 7.5 U/g pulp 120 50 7.0 8Xc 3.0 U/g pulp 120 70 7.0 10D ClO2: 1.5% or 1.35% 45 60 3.0 10Q EDTA: 0.2% 30 60 3.0 10P NaOH:H2O2:MgSO4:1.2%:3.0%:0.2% 240 90 >11.0 10

P ans C-

idaotoaAmrdetbriw

Fxswapm

ercentage based on oven dried pulp. (a) the recombinant xylanase from B. halodur

n an initial pH range of 4.0–12.0 at 50 ◦C for 12 h. The enzyme alsoisplayed good alkaline stability, and it retained more than 90%ctivity in the pH range 5.5–10.5 (Fig. 2B). The alkaline tolerancef C-125 xylanase A is crucial, considering its potential applica-ion in bleaching pulp at high pH value. The effect of temperaturen the purified C-125 xylanase A from P. pastoris was determinedt pH 9.0 and different temperatures (45–85 ◦C). C-125 xylanase

displayed a distinct thermophilic preference in that the opti-um temperature was high at 70 ◦C, and 52% enzyme activity still

emained at 85 ◦C (Fig. 2C). The thermal stability of the enzyme wasetermined at 60, 65 and 70 ◦C at the same pH values. At 60 ◦C, thenzyme retained over 93% after 2 h incubation at pH 9.0. At 65 ◦C,he enzyme retained over 75% of its initial activity after 2 h at pH 9.0,

◦

ut there was only 65% activity at after 1 h at 70 C (Fig. 2D). Theseesults were a bit better than those obtained for xylanase expressedn E. coli [17,26]. Thus, its thermal stability is an attractive feature

ith regard to industrial applications.

ig. 1. Screening and expression of the xylanase from B. halodurans C-125 in P. pastorisylanase A. Recombinant P. pastoris was grown on MM agar plates with oat-spelt xylan anelection of P. pastoris clones. (B) Quantitative PCR assay of the C-125 xynA copy numbeas set as background for C-125 xynA copy number calculation. The values indicate the av

nd xylanase production time course of P. pastoris GS115/pPICZ�A-xynA during the 44 h grotein content (filled circles). (D) SDS-PAGE assay of the collected culture supernatant (ethanol induction for 132 h and Western blot analysis of C-125 xylanase A using anti-6

125; (b) xylanase AU-PE89 of Sukahan; (c) Pulpzyme HC supplied by Novozymes.

3.3. Recombinant C-125 xylanase A boosts the effect of hydrogenperoxide bleaching of wheat straw pulp

For xylanase pretreatments of pulps, efficiency is readily influ-enced by the enzyme charge [27]. In view of this, different xylanasedosages (5–20 U/g) were used to treat the wheat straw pulp for90 min at 70 ◦C and pH 9.0. Assays of the xylanase pretreated liquidindicated that enzyme treatment could remove some substancessuch as carbohydrate degradation products or even lignin com-pounds by inducing the release of chromophores (Ab237, Ab254,Ab280), hydrophobic compounds (Ab465), and sugar degradationproducts into the filtrate, thereby also improving the bleachabil-ity of wheat straw pulp during the subsequent hydrogen peroxide

bleaching stage (Table 3). After being subjected to the subsequentbleaching process with 4% hydrogen peroxide, the handsheetsmade from the enzyme pretreated pulp exhibited higher bright-ness values together with lower kappa numbers compared with

. (A) Selection of the recombinant P. pastoris clone producing B. halodurans C-125d incubated at 30 ◦C for 48 h. A transparent zone indicated xylanase activity for the

r in the recombinant yeast strain genomic DNA. Standard plasmid pPICZ�-G-xynAerage ± standard deviations from three independent qPCR experiments. (C) Growthrowth phase (filled diamonds), 144 h induction phase (filled triangles), and secretorydiluted 50-fold) containing C-125 xylanase A (stained with Coomassie blue) after

× His antibody; P. pastoris GS115 was used as the control.

X.-q. Lin et al. / Enzyme and Microbial Technology 52 (2013) 91– 98 95

Fig. 2. The properties of the recombinant C-125 xylanase. (A) Effect of pH on the activity of recombinant C-125 xylanase A. The enzyme was incubated at 70 ◦C with 1% (w/v)beechwood xylan dissolved in 50 mM sodium acetate (4.0–5.0), sodium phosphate (6.0–7.0), Tris–HCl (7.0–8.5), or glycine-NaOH (9.0–12.0) buffers at various pHs. (B) Effectof pH on the stability of recombinant C-125 xylanase A. The enzyme was incubated with buffers at different pH values (50 mM sodium acetate 4.0–5.0, sodium phosphate6 ◦ ual acto cubatb 5 xylat as de

t1eanhgow1

3b

s

TE

.0–7.0, Tris–HCl 7.0–8.5, or glycine–NaOH 9.0–12.0) at 50 C for 12 h and the residn the activity of recombinant C-125 xylanase A. The activity was determined by inuffer, at pH 9.0, at various temperatures. (D) Thermal stability of recombinant C-12riangles). Samples were taken at different time intervals, and the residual activity w

he non-enzyme-treated sample. Specifically, pretreatment with0 U/g of recombinant C-125 xylanase A at 70 ◦C and pH 9.0nhanced the brightness of wheat straw pulp by 5.2% ISO andlso decreased the pulp kappa number by 5.0%, compared to theon-enzyme-pretreated sample as the control after a single 4%ydrogen peroxide bleaching stage. Taking account of the negli-ible enhancement or decrement in kappa number and brightnessbserved when xylanase dosages greater than 10 U/g were used asell as the economic cost, the optimal xylanase concentration was

0 U/g in the enzymatic pretreatment stage.

.4. Application of recombinant C-125 xylanase A in the ECF

leaching process of wheat straw pulp

C-125 xylanase A was used in the ECF bleaching process of wheattraw pulp and compared with both the commercial xylanase

able 3ffect of recombinant C-125 xylanase A on hydrogen peroxide bleaching.

Enzyme dose (U/g pulp) 0 5

Ab237 – 0.6

Ab254 – 0.1

Ab280 – 0.1

Ab465 – 0.4

Reducing sugars (mg/g pulp) 0 8.0 ± 0.1

Kappa number 12.1 ± 0.1 11.7 ± 0.1

Kappa decrease (%) – 3.5

Brightness % ISO 57.3 ± 0.1 60.5 ± 0.2

ivity was measured under the standard assay conditions. (C) Effect of temperatureing the enzyme with 1% (w/v) beechwood xylan dissolved in 50 mM glycine–NaOHnase A at pH 9.0 at 60 ◦C (empty diamonds), 65 ◦C (empty squares), and 70 ◦C (emptytermined.

Pulpzyme HC supplied by Novozymes (Bagsvaerd, Denmark) andAU-PE89 supplied by Sukahan (Shandong Weifang, China). In orderto compare the enzymes under conditions of highest efficiency ofthe biobleaching process, the wheat straw pulp pretreatments bythe three xylanases were performed at their individual optimumdosages, temperatures, reaction times, pH values, and pulp consis-tencies (Table 2). For C-125 xylanase A, pretreatment at a dosage of10 U/g dry pulp caused a 34.3% reduction in kappa number and 1.8%ISO increase in final brightness when compared to the control DQP-treated pulps. In addition, when the enzymatically-prebleachedpulp was subsequently treated with 1.35% chlorine dioxide, thebrightness of the handsheets and the other properties of paper

made from the corresponding enzyme pretreated pulp, such astensile index, tearing index, and bursting index, were compara-ble to those of full dose chemically treated samples (1.5% chlorinedioxide), thereby indicating at least 10% reduction in chlorine

10 15 20

0.7 0.7 0.70.3 0.4 0.40.3 0.3 0.30.4 0.4 0.4

12.6 ± 0.1 14.0 ± 0.2 17.7 ± 0.011.5 ± 0.0 11.5 ± 0.0 11.5 ± 0.1

5.0 5.0 5.162.5 ± 0.1 62.6 ± 0.1 62.4 ± 0.1

96 X.-q. Lin et al. / Enzyme and Microbial Technology 52 (2013) 91– 98

Table 4Effect of C-125 xylanase treatment on wheat straw pulp DQP bleaching.

Bleaching stage Brightness (% ISO) Tensile index(N·m/g)

Tearing index(N·m2/g)

Bursting index(kPa·m2/g)

Kappa number Kappa decrease (%) Post colornumber

DQP 79.1 ± 0.2 76.9 ± 3.4 2.4 ± 0.3 4.3 ± 0.4 2.1 ± 0.0 – 0.4XaDQP 80.9 ± 0.1 77.7 ± 2.8 2.6 ± 0.2 4.7 ± 0.4 1.4 ± 0.1 34.3 0.4XaD*QP 78.9 ± 0.2 79.1 ± 2.0 2.7 ± 0.2 4.7 ± 0.2 2.3 ± 0.0 −9.9 0.4XbDQP 79.6 ± 0.2 80.2 ± 3.6 2.7 ± 0.2 4.9 ± 0.3 1.7 ± 0.1 19.2 0.4XcDQP 80.2 ± 0.2 82.2 ± 3.4 2.7 ± 0.2 4.5 ± 0.3 1.6 ± 0.2 27.2 0.5

D e fromb

dlttlicmbPfPa

itbxpbp(firrcaiaPth[i

4

tewfcngitwioh

hp

*: reduction of 10% of chlorine dioxide consumption; (a) the recombinant xylanasy Novozymes.

ioxide consumption could be achieved (Table 4). Two paral-el samples of wheat straw pulp were comparably treated withhe two commercial xylanases (Pulpzyme HC and AU-PE89), andhe properties of the pulp and handsheets produced were ana-yzed. Obviously, accompanying all enzyme pretreatments was anmproved tensile index and tearing index as well as bursting indexompared with those derived from a single chemical process. Treat-ent with the commercial xylanases achieved improvements in

rightness of only 0.5% ISO for AU-PE89 xylanase and 1.1% ISO forulpzyme HC xylanase and a decrease of 19.3% in kappa numberor AU-PE89 xylanase and a reduction of 27.2% in kappa number ofulpzyme HC xylanase. This proved that C-125 xylanase A exertedt least as good a bleach boosting effect as the commercial enzymes.

Furthermore, in order to understand more about the bleach-ng enhancer effect of the xylanases, the surface morphologies ofhe fibers after the enzyme pretreatment stage or after full DQPleaching were examined by SEM. The SEM studies of the threeylanase-treated pulps revealed an increase in the porosities of theulp fibers to different extents, which may improve the accessi-ility of the pulp to bleaching chemicals compared to the initialulp (Fig. 3). The surfaces of untreated or fully DQP bleached fibersFig. 3A and B) looked smoother than those of the xylanase-treatedbers or XDQP-treated fibers (Fig. 3C–H). Fibers treated with theecombinant C-125 xylanase A and bleached (Fig. 3C and D) had aough surface, heterogeneous and striated, with some grooves orracks appearing at certain surface regions of the fibers, especiallyfter enzyme treatment Xa DQP (Fig. 3D), indicating that they weren the process of peeling. Approximately the same phenomenonppeared in the treated pulp samples involving both xylanase AU-E89 and xylanase Pulpzyme HC (Fig. 3E–H), probably caused byhe removal of xylans from the fiber surfaces. Since similar effectsad been observed for Pulpzyme HC [28] and xylanase AU-PE8929], C-125 xylanase A seems as effective as commercial xylanasen opening the closed cell-wall pores of wheat straw pulps.

. Discussion

The recombinant xylanase A from B. halodurans C-125, withhermophilic, basophilic, and cellulase-free properties, was firstlyxpressed in P. pastoris at a yield as high as 3361 U/mL, whichas superior by far to previous reports. According to the report

rom Mamo et al., 16 U/mL of xylanase activity was obtained in E.oli, which was the sum of activity in the cell-free culture super-atant and the lysate of sonicated cells [17]. In our research, thereat breakthrough in yield of C-125 xylanase A makes its use inndustrial-scale applications possible. It should be noted again thathe high-yield recombinant xylanase was naturally cellulase-free,hich makes it attractive with potential as a bleach-boosting agent

n the pulp and paper industry [30]. In fact, Zhao et al. have pointedut that the high cellulase activity accompanying crude xylanase

as a negative influence on soda pulping and lignin removal [31].

In addition, the bias of recombinant C-125 xylanase A toigh-temperature (70 ◦C) and highly alkaline (pH 9.0) conditionsrovides a competitive edge for its application in the pulp and paper

B. halodurans C-125; (b) xylanase AU-PE89 of Sukahan; (c) Pulpzyme HC supplied

industry. Quite a few xylanases from different microorganismshave been reported to be stable either at elevated temperaturesor under alkaline conditions. However, most could not performas expected at both high pH and high temperature. For instance,the xylanase produced by Thermotoga maritima MSB8 has per-fect hyperthermophily, whereas the optimum pH was only 6.1for wheat straw pulp pretreatment [32]. Purified xylanase from T.lanuginosus strain DSM 5826 exhibited its highest activity in thetemperature range 60–70 ◦C while requiring a pH of around 7.0.Another xylanase from ATCC 4682 was optimally active at 75 ◦Cbut between pH 6.0 and 6.5 [33,34]. Since the incoming pulp inthe manufacturing process before enzymatic bleaching is actuallyhot and alkaline, recombinant C-125 xylanase A is very attractivefrom an economical and technical point of view. In fact, the ther-mophilic and basophilic characteristics of the recombinant enzyme,along with its desirable expression level in P. pastoris, present greatpossibilities for incorporation in the pulp and paper industry.

In order to explore the potential of C-125 xylanase A in the pulpand paper industry, the enzyme dose for bleach boosting was opti-mized. An enzyme dose of 10 U/g odp was found to be optimumfor pretreatment of wheat straw pulp. Similarly, an enzyme dose of10 U/g of pulp was reported to be most effective in the case of wheatstraw, rice straw, and bagasse [12,35]. It should be noted that bothboosting of bleach performance and the processing conditions ofdifferent kinds of xylanases varied considerably. Xylanase (15 U/gdry pulp) from Thermomyces lanuginosus CBS288.54, reacting at pH7.5 and 60 ◦C for 1 h, improved the brightness of wheat straw pulpby 3.93% ISO in comparison with controls [36]. Another xylanaseprepared from culture filtration of Aspergillus niger strain An-76 wasused in wheat straw pulp pretreatment with an enzyme dosage of4 U/g dry pulp at 48 ◦C and pH 4.8 for 2 h, resulting in about 3% ISOhigher than controls [13]. Pretreatment of wheat straw pulp usingcellulase-free xylanase produced from Bacillus stearothermophilusSDX at 60 ◦C for 120 min resulted in a 4.75% increase in brightness[35]. Thus, C-125 xylanase A demonstrated a competitive combina-tion of obvious bleach boosting capacity and strictly thermophilicand desirable basophilic qualities.

Results using a crude C-125 xylanase A treatment of wheat strawpulp showed that reducing the chlorine dioxide consumption by10% could yield the same level of brightness in the ECF bleachingprocess. Better or similar pulp physical properties, such as tensileindex and tearing index as well as bursting index, were maintainedwhen compared with the commercial enzyme-aided bleaching orsingle chemical bleaching. It should be noted as well, however, thatexaminations of the post-color (PC) number adopted for the eval-uation of brightness stability showed that the sheets made fromC-125 xylanase A treated pulp had improved brightness stabilitycompared to that of Pulpzyme HC used to aid bleaching or singleDQP bleaching. As to the results that weaker handsheet physi-cal properties were obtained for C-125 xylanase A compared with

the other two xylanases (Table 4), another commercial xylanase,Cartazyme HS 10 (Sandoz), is in the same situation. It seems thatC-125 xylanases exhibit the largest bleach boosting effect as deter-mined by the measurement of brightness but are possibly slightly

X.-q. Lin et al. / Enzyme and Microbial Technology 52 (2013) 91– 98 97

Fig. 3. SEM micrographs of the fiber surface: (A) an unbleached control pulp sample; (B) a fully bleached pulp (DQP); (C) a pulp sample pretreated with C-125 xylanase A; (D)a anase

w

dfimfi

pulp sample treated with XC125 xylanase ADQP; (E) a pulp sample pretreated with xylith Pulpzyme HC; (H) a pulp sample treated with XPulpzymeHCDQP.

etrimental in terms of strength properties, as shown by the values

or tearing index and tensile index [6]. This again emphasizes themportance of considering the balance between maximizing enzy-

atic bleach boosting and preserving the strength properties of thenal paper product.

AU-PE89; (F) a pulp sample treated with XAU-PE89DQP; (G) a pulp sample pretreated

SEM results clearly indicated that the control wheat straw

pulp fibers were smooth and had a uniform surface devoid ofprotruding fiber formation, whereas xylanase pretreated sampleshad irregular and heterogeneous surfaces with the occurrence ofcracked and peeled fibers. Similar observations on pulp fiber after

9 crobia

xodoxacxmnorltbAma

A

cG2

R

[

[

[

[

[

[

[

[

[

[

[

[

[[

[

[

[

[

[

[

[

[

[

[

[

[

[

[

8 X.-q. Lin et al. / Enzyme and Mi

ylanase treatment have previously been reported [1,28,37]. More-ver, grooves or cracks after xylanase treatment were not regularlyistributed all over the fiber surface, leading to the belief that theyccurred in the less crystalline regions of the fiber or where theylans had been deposited [1,27,38]. Thus, although all xylanasesssayed produced some effects on fiber morphology, the holes andracks produced by the release of xylans were observed for C-125ylanase A and Pulpzyme HC. Moreover, C-125 xylanase A was theost effective enzyme in enhancing brightness and reducing kappa

umber, suggesting that the more grooves produced on the surfacef the fibers, the more easily and effectively the bleaching chemicaleagents penetrate into the inner parts of the fiber, thus improvingignin solubility and increasing brightness. These results contributeo a better understanding of the benefits of C-125 xylanase A inleaching. Here, the development of recombinant C-125 xylanase

offers a new alternative for xylanase preparations applied in enzy-atic bleaching of non-wood plant fibers and could help to develop

cost-effective environmentally friendly bleaching process.

cknowledgments

This research is supported by Industrial and Technologi-al Project of Guangdong Province (No. 2009A010700004) anduangdong Science and Technology key Research Program (No.010A010500003).

eferences

[1] Torres A, Roncero MB, Colom J, Pastor F, Blanco A, Vidal T. Effect of a novelenzyme on fibre morphology during ECF bleaching of oxygen delignified Euca-lyptus kraft pulps. Bioresource Technology 2000;74:135–40.

[2] Ibarra D, Camarero S, Romero J, Martínez MJ, Martínez AT. Integrating laccase-mediator treatment into an industrial-type sequence for totally chlorine-freebleaching of eucalypt kraft pulp. Journal of Chemical Technology and Biotech-nology 2006;81:1159–65.

[3] Roncero M, Vidal T. Optimization of ozone treatment in the TCF bleaching ofpaper pulps. Afinidad 2007;529:420.

[4] Maltha CRA, Barbosa LCA, Azevedo MAB, Colodette JL. Behavior of Euca-lyptus Kraft Pulp Extractives Components across ECF Bleaching and TheirImpact on Brightness Reversion. Journal of Wood Chemistry and Technology2011;31:103–20.

[5] Zamost BL, Nielsen HK, Starnes RL. Thermostable enzymes for industrial appli-cations. Journal of Industrial Microbiology and Biotechnology 1991;8:71–81.

[6] Garg A, Roberts J, McCarthy A. Bleach boosting effect of cellulase-free xylanaseof Streptomyces thermoviolaceus and its comparison with two commercialenzyme preparations on birchwood kraft pulp. Enzyme and Microbial Tech-nology 1998;22:594–8.

[7] Jiang Z, Li X, Yang S, Li L, Li Y, Feng W. Biobleach boosting effect of recombinantxylanase B from the hyperthermophilic Thermotoga maritima on wheat strawpulp. Applied Microbiology and Biotechnology 2006;70:65–71.

[8] Sabourin MJ, Hart PW. Enhanced fiber quality of black spruce (Picea mariana)Thermomechanical pulp fiber through selective enzyme application. Industrialand Engineering Chemistry Research 2010;49:5945–51.

[9] Viikari L, Kantelinen A, Sundquist J, Linko M. Xylanases in bleaching: from anidea to the industry. FEMS Microbiology Review 1994;13:335–50.

10] Polizeli M, Rizzatti A, Monti R, Terenzi H, Jorge J, Amorim D. Xylanasesfrom fungi: properties and industrial applications. Applied Microbiology andBiotechnology 2005;67:577–91.

11] Beg Q, Kapoor M, Mahajan L, Hoondal G. Microbial xylanases and their

industrial applications: a review. Applied Microbiology and Biotechnology2001;56:326–38.

12] Ziaie-Shirkolaee Y, Talebizadeh A, Soltanali S. Comparative study on applicationof T. lanuginosus SSBP xylanase and commercial xylanase on biobleaching ofnon wood pulps. Bioresource Technology 2008;99:7433–7.

[

l Technology 52 (2013) 91– 98

13] Zhao J, Li X, Qu Y, Gao P. Xylanase pretreatment leads to enhancedsoda pulping of wheat straw. Enzyme and Microbial Technology 2002;30:734–40.

14] Takami H, Nakasone K, Takaki Y, Maeno G, Sasaki R, Masui N, et al. Com-plete genome sequence of the alkaliphilic bacterium Bacillus halodurans andgenomic sequence comparison with Bacillus subtilis. Nucleic Acids Research2000;28:4317–31.

15] Honda H, Kudo T, Ikura Y, Horikoshi K. Two types of xylanases of alka-lophilic Bacillus sp. no. C-125. Canadian Journal of Microbiology 1985;31:538–42.

16] Honda H, Kudo T, Horikoshi K. Molecular cloning and expression of the xylanasegene of alkalophilic Bacillus sp. strain C-125 in Escherichia coli. Journal of Bac-teriology 1985;161:784–5.

17] Mamo G, Delgado O, Martinez A, Mattiasson B, Hatti-Kaul R. Cloning, sequenceanalysis, and expression of a gene encoding an endoxylanase from Bacillushalodurans S7. Molecular Biotechnology 2006;33:149–59.

18] Pfaffl MW. A new mathematical model for relative quantification in real-timeRT-PCR. Nucleic Acids Research 2001;29:e45–50.

19] Sun YF, Lin Y, Zhang JH, Zheng SP, Ye YR, Liang XX, et al. Double Candidaantarctica lipase B co-display on Pichia pastoris cell surface based on a self-processing foot-and-mouth disease virus 2A peptide. Applied Microbiology andBiotechnology 2012:1–12.

20] Miller GL. Use of dinitrosalicylic acid reagent for determination of reducingsugar. Analytical Chemistry 1959;31:426–8.

21] Lowry OH, Rosebrough NJ, Farr AL, Randall RJ. Protein measurement with theFolin phenol reagent. Journal of Biological Chemistry 1951;193:265–75.

22] Committee T. TAPPI Test Methods. Atlanta, GA, USA: TAPPI; 2000–2002.23] Aracri E, Vidal T. Xylanase-and laccase-aided hexenuronic acids and lignin

removal from specialty sisal fibres. Carbohydrate Polymers 2011;83:1355–62.24] Hailong L, Jiachun C, Huaiyu Z, Shiyu F, Guihua Y, Weihua H. Effects of AU-PE89

Xylanase treatment on CEH bleaching of wheat straw pulp. Paper Science andTechnology 2007;26:6–9.

25] McGarry P, Heitner C, Schmidt J, Rodenhiser A, St John Manley R, Cunkle G,et al. A dramatic solvent effect on high-yield pulp yellowing inhibition fora benzophenone-based ultraviolet absorber. Journal of Photochemistry andPhotobiology A: Chemistry 2002;151:145–55.

26] Mamo G, Hatti-Kaul R, Mattiasson B. A thermostable alkaline active endo-�-1-4-xylanase from Bacillus halodurans S7: purification and characterization.Enzyme and Microbial Technology 2006;39:1492–8.

27] Dwivedi P, Vivekanand V, Pareek N, Sharma A, Singh RP. Bleach enhancement ofmixed wood pulp by xylanase–laccase concoction derived through co-culturestrategy. Applied Biochemistry and Biotechnology 2010;160:255–68.

28] Roncero M, Torres A, Colom J, Vidal T. Effects of xylanase treatment on fibremorphology in totally chlorine free bleaching (TCF) of Eucalyptus pulp. ProcessBiochemistry 2000;36:45–50.

29] Chen J, Yang G, Kong F, Lucia L, Liu Y. Influence of xylanase pretreatmenton refining energy and brightness of P-RC APMP pulp of Italian black poplarbranches. Cellulose Chemistry and Technology 2012;46:283.

30] Singh S, Madlala AM, Prior BA. Thermomyces lanuginosus: properties of strainsand their hemicellulases. FEMS Microbiology Review 2003;27:3–16.

31] Zhao J, Li X, Qu Y. Application of enzymes in producing bleached pulp fromwheat straw. Bioresource Technology 2006;97:1470–6.

32] Bergouist PL, Gibbs MD, Morris DD, Thompson DR, Uhl AM, Daniel RM. Hyper-thermophilic xylanases. Methods in Enzymology 2001;330:301–19.

33] Cesar T, Mrsa V. Purification and properties of the xylanase produced by Ther-momyces lanuginosus. Enzyme and Microbial Technology 1996;19:289–96.

34] Bennett NA, Ryan J, Biely P, Vrsanska M, Kremnicky L, Macris BJ, et al.Biochemical and catalytic properties of an endoxylanase purified from the cul-ture filtrate of Thermomyces lanuginosus ATCC 46882. Carbohydrate Research1998;306:445–55.

35] Garg G, Dhiman SS, Mahajan R, Kaur A, Sharma J. Bleach-boosting effect ofcrude xylanase from Bacillus stearothermophilus SDX on wheat straw pulp. NewBiotechnology 2011;28:58–64.

36] Li X, Jiang Z, Li L, Yang S, Feng W, Fan J, et al. Characterization of a cellulase-free,neutral xylanase from Thermomyces lanuginosus CBS 288.54 and its biobleach-ing effect on wheat straw pulp. Bioresource Technology 2005;96:1370–9.

37] Bissoon S, Christov L, Singh S. Bleach boosting effects of purified xylanase

from Thermomyces lanuginosus SSBP on bagasse pulp. Process Biochemistry2002;37:567–72.

38] Roncero MB, Torres AL, Colom JF, Vidal T. The effect of xylanase on lignocellu-losic components during the bleaching of wood pulps. Bioresource Technology2005;96:21–30.