Embed Size (px)
Citation preview
BiotechnologyBiotechnology
Use of living things to provide Use of living things to provide needed products or processes needed products or processes
Recombinant DNARecombinant DNA
• DNA produced by joining DNA produced by joining segments of DNA from different segments of DNA from different sourcessources
• eg. To produce human insulin, eg. To produce human insulin, scientists have combined bacterial scientists have combined bacterial plasmid DNA + human DNA plasmid DNA + human DNA
Tools for Producing Tools for Producing Recombinant DNARecombinant DNA
Restriction enzymes: enzymes that Restriction enzymes: enzymes that cleave the DNA double helix at cleave the DNA double helix at specific nucleotide sequencesspecific nucleotide sequences
Use of the Restriction Enzyme Use of the Restriction Enzyme Bam H1Bam H1
5’— G G A T C C — 3’5’— G G A T C C — 3’ 3’— C C T A G G — 5’3’— C C T A G G — 5’
5’— G G A T C C — 3’5’— G G A T C C — 3’ 3’— C C T A G G — 5’3’— C C T A G G — 5’
sticky endsticky end
sticky endsticky end
Results inResults in
Tools for Producing Tools for Producing Recombinant DNARecombinant DNA
Vector: carrier of DNA; can be virus or plasmid Vector: carrier of DNA; can be virus or plasmid
Plasmid: extrachromosomal, independently Plasmid: extrachromosomal, independently replicating, small circular DNA moleculereplicating, small circular DNA molecule
Producing Recombinant DNAProducing Recombinant DNA
restriction enzyme
Treat source Treat source DNA with DNA with restrictionrestrictionenzymeenzyme
Treat plasmid Treat plasmid DNA with DNA with same enzymesame enzyme
restriction enzyme
Mix togetherMix togetherAdd DNA LigaseAdd DNA Ligase
Many recombinant DNAMany recombinant DNAmolecules are produced,molecules are produced,each with a different each with a different piece of source DNA piece of source DNA
TransformTransform bacterial cells bacterial cells
Each bacterial cellEach bacterial cellcarries a different carries a different recombinant plasmidrecombinant plasmid
Tools for Producing Tools for Producing Recombinant DNARecombinant DNA
Probe: sequence of DNA that is Probe: sequence of DNA that is complementary to the gene of interest; complementary to the gene of interest; Used to locate a copy of the gene by Used to locate a copy of the gene by hybridizationhybridization
Add ProbeAdd ProbeProbe Binds to gene Probe Binds to gene
AGCTTAGCGATAGCTTAGCGATTCGAATCGCTATCGAATCGCTA
AATCGCAGCTTAGCGATAGCTTAGCGAT
TCGAATCGCTATCGAATCGCTA
Denature DNA by heatingDenature DNA by heating
Building Building aa
DNA DNA LibraryLibrary
Finding the Gene of Interest by Screening a Gene Library
Applying Your KnowledgeApplying Your KnowledgeApplying Your KnowledgeApplying Your Knowledge
A.A. An enzyme that cleaves DNA at specific An enzyme that cleaves DNA at specific sequences is a __________ .sequences is a __________ .
B.B. A sequence of DNA that is complementary to A sequence of DNA that is complementary to the gene of interest is a _________. the gene of interest is a _________.
C.C. A small, independently replicating DNA A small, independently replicating DNA molecule is a ___________. molecule is a ___________.
1.1. ProbeProbe2.2. CloneClone3.3. PlasmidPlasmid4.4. Restriction EnzymeRestriction Enzyme
Biotechnological Methods: PCRBiotechnological Methods: PCR
Polymerase Chain Reaction (PCR)Polymerase Chain Reaction (PCR)
Amplifies a specific region in the DNAAmplifies a specific region in the DNA Used for identification, especiallyUsed for identification, especially if the amount of DNA is small if the amount of DNA is small Uses repeated cycles of heating to Uses repeated cycles of heating to denature DNA and cooling to synthesize denature DNA and cooling to synthesize new DNA new DNAInvolves the use of Involves the use of
---Taq polymerase (withstands heat)---Taq polymerase (withstands heat)
---primers to begin synthesis---primers to begin synthesis
Polymerase Chain Reaction:Polymerase Chain Reaction:One PCR CycleOne PCR Cycle
OriginalOriginalDouble-Double-helixhelixDNADNA
SeparateSeparateDNADNAStrandsStrands
90 °C90 °C
Primers &Primers &TaqTaqpolymerasepolymerasebindbind
50 °C50 °C
Taq PolymeraseTaq Polymerase PrimerPrimer
72 °C72 °C
DNADNAsynthesizedsynthesized
Polymerase Chain Reaction:Polymerase Chain Reaction:Multiple PCR CyclesMultiple PCR Cycles
DNADNAfragmentfragment
to beto beamplifiedamplified
2 copies2 copies 4 copies4 copies 8 copies8 copies
Biotechnological Methods: RFLPBiotechnological Methods: RFLP
RFLP AnalysisRFLP Analysis
RRestriction estriction FFragment ragment LLength ength PPolymorphismolymorphism
• Use of a probe to identify specific DNA Use of a probe to identify specific DNA fragments derived from restriction enzyme fragments derived from restriction enzyme digestion digestion
• Shows variations in sizes of fragments Shows variations in sizes of fragments between different individuals between different individuals
Separation of Restriction Fragments by Size Separation of Restriction Fragments by Size
DNA separated by sizeDNA separated by sizeis transferred from is transferred from agarose gel to filteragarose gel to filter
DNA on filter is DNA on filter is exposed to probe exposed to probe to detect to detect complementary complementary sequences.sequences.
Southern Blotting for RFLP AnalysisSouthern Blotting for RFLP Analysis
Applications of BiotechnologyApplications of Biotechnology in Agriculture in Agriculture
Transgenic: organism that contains a Transgenic: organism that contains a gene from another species in all of its gene from another species in all of its cellscells
Transgenic plants thatTransgenic plants thatResist herbicidesResist herbicidesResist pestsResist pestsHave improved storage qualitiesHave improved storage qualitiesHave enhanced nutritionHave enhanced nutrition
Roundup Ready SoybeansRoundup Ready Soybeans
Traditional SoybeansTraditional Soybeans
Effects of Treatment with the Herbicide RoundupEffects of Treatment with the Herbicide Roundup
Bt Corn: ProducesBt Corn: Producesits own Pesticideits own Pesticide
Flavr-Savr TomatoFlavr-Savr Tomatosoftens more slowly softens more slowly
after ripeningafter ripening
““Golden” rice with Golden” rice with beta-carotene and beta-carotene and extra ironextra iron
Applications of BiotechnologyApplications of Biotechnology in Agriculture in Agriculture
Transgenic Animals thatTransgenic Animals thatProvide models for human diseasesProvide models for human diseases
Mice with BRCA1 gene to studyMice with BRCA1 gene to study inherited breast cancer inherited breast cancer““knockout” mouse missing ADA knockout” mouse missing ADA gene to study immune deficiency gene to study immune deficiency
Produce pharmaceuticals and Produce pharmaceuticals and release them in milk release them in milk
Goats producing TPA, tissue Goats producing TPA, tissue plasminogen activator, for treatment of plasminogen activator, for treatment of heart attacksheart attacks
CC SSRR CCII EE
MM NNEE EE
Applications of Biotechnology Applications of Biotechnology for Identification: Forensicsfor Identification: Forensics
11 22 33 44 55 66 77
SuspectsSuspects SuspectsSuspects
Applications of Biotechnology Applications of Biotechnology for Identification: Paternity Testingfor Identification: Paternity Testing
X
X
X
X
X
X
X
X
Applications of Biotechnology Applications of Biotechnology in Medicine: Therapeuticsin Medicine: Therapeutics
PharmaceuticalPharmaceutical Used for Used for
Factor VIIIFactor VIII Blood ClottingBlood Clotting
Human Growth Human Growth HormoneHormone
Pituitary Pituitary DwarfismDwarfism
InsulinInsulin DiabetesDiabetes
InterferonInterferon Cancer Cancer
VaccineVaccine Hepatitis BHepatitis B
Applications of Biotechnology Applications of Biotechnology in Medicine: Genetic Testing in Medicine: Genetic Testing
carr
ier
sick
le-c
ell
anem
ia
carr
ier
no
n-c
arri
er
Applications of Biotechnology Applications of Biotechnology in Medicine: Gene Therapyin Medicine: Gene Therapy
Andrew Gobea was diagnosed with ADA deficiencyAndrew Gobea was diagnosed with ADA deficiency before he was born. before he was born. This lack of the ADA enzyme causes an immune This lack of the ADA enzyme causes an immune deficiency disease called SCID. deficiency disease called SCID. Andrew was given the gene for a functional ADAAndrew was given the gene for a functional ADA enzyme four days after his birth in 1993. enzyme four days after his birth in 1993.
Umbilical cord blood was collected at birth. Umbilical cord blood was collected at birth. Stem cells were isolated and mixed with a virus Stem cells were isolated and mixed with a virus carrying a functional ADA gene. carrying a functional ADA gene. Stem cells were returned to Andrew with the aim of Stem cells were returned to Andrew with the aim of populating his bone marrow with cells that could populating his bone marrow with cells that could make the ADA enzyme. make the ADA enzyme.
Two Years LaterTwo Years Later
Andrew has been maintained on costly injections of Andrew has been maintained on costly injections of purified ADA enzyme while waiting to see if the purified ADA enzyme while waiting to see if the gene therapy has been effective. gene therapy has been effective. Tests have shown that the functional ADA gene Tests have shown that the functional ADA gene was introduced into 0.01% of Andrew’s stem cells was introduced into 0.01% of Andrew’s stem cells and this population has given rise to 5-7% of his and this population has given rise to 5-7% of his white blood cells. Is this enough for a cure? white blood cells. Is this enough for a cure?
Four Years LaterFour Years Later
Andrew’s physician decides to taper off the enzymeAndrew’s physician decides to taper off the enzyme injections to see if Andrew’s immune system can injections to see if Andrew’s immune system can protect him. protect him.
What is the outcome?What is the outcome?
What was learned? What was learned?
