View
219
Download
0
Embed Size (px)
Citation preview
Bioinformatics
Lecture 7: Introduction to Perl
Introduction
• • Basic concepts in Perl syntax:– variables, strings, input and output– Conditional and iteration– File handling and error handling– Arrays, lists and hashes
First program
• a basic Strings program: Test.pl– #!/usr/bin/perl– print "Hello boys and girs!\n this is introduction to perl";
• Open with notepad and type the above• Save file as hello.pl• Ensure that hide file extensions option is
unchecked. • Run via the command line
Variables declarations• $variable name : intergers, floats, strings.• @ arrays • Arithmetic operators:
– +, -, *, / , **( exponentation); % modulus • Double v single quotation marks
– $x = ‘ I am from Cork ‘– print “the value of $x is $x\n”– print ’the value of $x is $x\n’– print “the value of \$x is $x\n” # note the \$x– #evaluating expressions in print (# comment line symbol)– $ x = 15;– Print “the value of x is “, $x + 3, “\n” (ArithmeticExample.pl)
Input , output and files handling • Input
– $var = <> (input a line of text and assign it to $var): also iputs return character
– Chomp $var removes the return character from the #also used the word chop
– Alternatively chomp($var = <>);
– $line = <DATA> reads in “hardcoded data”
• Output– print (already covered)
• File Handling– open MYFILE , ‘data.txt’ (open file for reading;)– open MYFILE, ‘>data.txt’ (open file for writing)– Open MYFILE, ‘>> data.txt’ (open file for appending)– $line = <MYFILE > #read one line from file– @entire_file = <MYFILE> ; (called slurping) #reads all the file into an array
– print MYFILE “Do you like computers….”, $number/3, “\n” # write out to file
– close MYFILE;
Conditional Operator
• == Equality $a == $b• != Not equal $a != $b• < Less than $a < $b• > Greater than $a > $b• <= Less than or equal to $a <= $b• >= Greater than or equal to $a >= $b• ! Logical not $ = !$b
String conditional operator
• eq Equality $a eq $b• ne Not equal $a ne $b• lt Less than $a lt $b• gt Greater than $a gt $b• le Less than or equal to $a le $b• ge Greater than or equal to $a ge $b• . Concatenation $a.$c• =~ Pattern match $a =~ /gatc/
Conditional statements• If and elseif and else if_else.pl
• #!/usr/bin/perl
• print “Enter your age: ”;• $age = <>;
• if ($age <= 0) {• print “You are way too young to be using a computer.\n”;• } • elseif ($age >= 100) • {• print “Not in a dog’s life!\n”;• } else • {• print “Your age in dog years is ”,$age/7,“\n”;• }
•
Iteration: loops
• While-loops– #!/usr/bin/perl– $count = 1;– while ($count <= 5) {– print “$count potato\n”;– $count = $count + 1;– }
• Until-loops– #!/usr/bin/perl– $count = 1;– until ($count > 5) {– print “$count potato\n”;– $count = $count + 1;– }
Loops with defined
• #!/usr/bin/perl• # defined fnt is true if $line assigned a value • print “Type something. ‘quit’ to finish\n ”;• while ( defined($line = <>) ) {– chomp $line;– last if $line eq ‘quit’; # breaks out of loop at quit– print “You typed ‘$line’\n\n”;– print “Type something> ”;
• }• print “goodbye!\n”; loops_defined.pl
Shorthand input notation• #!/usr/bin/perl• print “Type something. ‘quit’ to finish\n ”;• while (<>) {– chomp; # $_ generic variable name– last if $_ eq ‘quit’;– print “You typed ‘$_ ’\n\n”;– print “Type something> ”;
• }• print “goodbye!\n”;
Change Standard input/ output
• redirect Sdout to a file– U:\test test.pl > stdout.txt [produces a text file ]• print file goes to file and not to screen
• Run Loops_defined to redirect to output to file
• The <> input has one feature where if a file name is on the command line it beings to read from it otherwise it reads from keyboards– U:\test commandline.pl stdin.txt
Finding length of file • #!/usr/bin/perl #File_size_1.pl • # file size.pl• $length = 0; # set length counter to zero• $lines = 0; # set number of lines to zero
• print “enter text one line at a time and press (ctrl z) to quit”;
• while (<>) { # read file one line at a time– chomp; # remove terminal newline– $length = $length + length $_ ;– $lines = $lines + 1;
• }• print “LENGTH = $length\n”;• print “LINES = $lines\n”;
• Try using keyboard as Stdin (ctrl Z) and file name on command line
Dynamic Arrays• Declaration of an array in perl– @sequences = (‘123a’, ‘23ed4’, ‘2334d’);– Array contains 3 strings!!!
• Array operations:– $one_seq = @sequences[2] {zero based array}– @seq = @sequences; assigns arrays– @seq = (@seq, ‘125f’); adding an value – @combined = (@seq, @seq2)– Removing (splice) @removed = splice @seq, 1, 2– slicing : @slice = @seq[1,2];
• Splice_slice_array.pl
Dynamic Arrays
– push @sequences, ‘2345d’; (adds element to end of array)
– Pop @sequences removes and returns (function returns) last element of array
– Shifting: removes and returns the first element of an array.
– Unshifting: Adds an element or list of elements onto the beginning of an array.
Shift Pop push unshift example• #! /usr/bin/perl
• # The 'pushpop' program - pushing, popping, shifting and unshifting.
• @sequences = ( 'TTATTATGTT', 'GCTCAGTTCT', 'GACCTCTTAA', • 'CTATGCGGTA', 'ATCTGACCTC' );• • print "@sequences\n";• $last = pop @sequences;• print "@sequences\n";• $first = shift @sequences;• print "@sequences\n";• unshift @sequences, $last;• print "@sequences\n";• push @sequences, ( $first, $last ); • print "@sequences\n";
• What is the expected output (run code to confirm)
Arrays: two more functions• Substr (extracting a substring from a string)
– $sub = substr ($string, offset position[position to begin extraction], size of substring)
• Substr and index:
• To obtain the reverse complement of a DNA sequence: assume the sequence is stored in array: (GGGGTTTT becomes AAAACCCC)
• Iterating through an array:– foreach $dna (@dna) – {
• $dna = reverse $dna; # reverse the contents of a scalar $dna• $dna =~ tr/gatcGATC/ctagCTAG/;
– # tr (translate first set into second; e.g. g becomes c ) complement (replace)
– }
Questions
• how would you read in a file of DNA sequence into an array and print both the original and reverse complementary copy
• What use could this program have? (biology related answer)
Array and lists
• Lists are an array of constants or variables– Values of a list assigned to any array
• @clones = (’192a8’,’18c10’,’327h1’,’201e4’);– Values in an array assigned to a list– ($first,$second,$third) = @clones;
Hashes: associative arrays• Similar arrays but elements are unordered – Two parts: the identifer (name), a scalar value
(string) – Add Elements are referred to by strings: • %oligos = ();• $oligos{’192a8’} = ‘GGGTTCCGATTTCCAA’;• $oligos{’18c10’} = ‘CTCTCTCTAGAGAGAGCCCC’;• $oligos{’327h1’} = ‘GGACCTAACCTATTGGC’;
– Note in the name part use ‘ ‘
– Removing elements:• Delete $oligos{’192a8’};
Hashes
• Outputting hash results• $s = $oligos{’192a8’};• print “oligo 192a8 is $s\n”;• print “oligo 192a8 is ”,length $oligos{’192a8’},“ base
pairs long\n”;• print “oligo 18c10 is $oligos{’18c10’}\n”;
• Expected output: input_output_hash.pl• oligo 192a8 is GGGTTCCGATTTCCAA• oligo 192a8 is 16 base pairs long• oligo 18c10 is CTCTCTCTAGAGAGAGCCCC
Hashes• Example of the use of a Hash table– hash_bases.pl program
• For loops and hash tables– foreach $clone (’327h1’,’192a8’,’18c10’) {– print “$clone: $oligos{$clone}\n”;– }– %oligos is refers to the hash table– $oligos is used to refer to elements
• $size = keys %oligo; returns the number of entries
Displaying all entries in a hash table
• while ( ( $genome, $count ) = each %gene_counts )• { • print "`$genome' has a gene count of $count\n";
}
• foreach $genome ( sort keys %gene_counts )• { • print "`$genome' has a gene count of $gene_counts• { $genome }\n";}• Refer to genes.pl
Error Handling
• die function:• open myfile, ‘stdin.txt’ or• Die “could not open file aborting…\n”;
– If file does not exits the program terminates with the above message
• Write a program to read in data from a file to an array and when all the data is input to output in reverse order
• Create a hash table that performs the condon to AA conversion and use it to convert codons {entered from the key board} into their corresponding Amino Acids