lable at ScienceDirect

Biochemical and Biophysical Research Communications 473 (2016) 1125e1132

Contents lists avai

Biochemical and Biophysical Research Communications

journal homepage: www.elsevier .com/locate/ybbrc

The effects of cold atmospheric plasma on cell adhesion,differentiation, migration, apoptosis and drug sensitivity of multiplemyeloma

Dehui Xu a, b, *, Xiaohui Luo c, Yujing Xu a, b, Qingjie Cui a, b, Yanjie Yang d, Dingxin Liu a, b,Hailan Chen e, Michael G. Kong a, b, e, f, **

a State Key Laboratory of Electrical Insulation and Power Equipment, Xi'an Jiaotong University, Xi'an, Shaanxi 710049, PR Chinab Centre for Plasma Biomedicine, Xi'an Jiaotong University, Xi'an, Shaanxi 710049, PR Chinac Department of Urinary Surgery, Central Hospital of Baoji, Bao Ji City, Shaanxi 721000, PR Chinad Department of Cardiovascular Medicine, First Affiliated Hospital of the Medical School, Xi'an Jiaotong University, Xi'an, Shaanxi 710049, PR Chinae Frank Reidy Center for Bioelectrics, Old Dominion University, Norfolk, VA 23508, USAf Department of Electrical and Computer Engineering, Old Dominion University, Norfolk, VA 23529, USA

a r t i c l e i n f o

Article history:Received 5 April 2016Accepted 7 April 2016Available online 8 April 2016

Keywords:Cold atmospheric plasmaMyelomaDifferentiationApoptosisMigrationDrug sensitivity

* Corresponding author. State Key Laboratory of EleEquipment, Xi'an Jiaotong University, Xi'an, Shaanxi 7** Corresponding author. State Key Laboratory of EleEquipment, Xi'an Jiaotong University, Xi'an, Shaanxi 7

E-mail addresses: dehuixu@hotmail.com (D. Xu), m

http://dx.doi.org/10.1016/j.bbrc.2016.04.0270006-291X/© 2016 Elsevier Inc. All rights reserved.

a b s t r a c t

Cold atmospheric plasma was shown to induce cell apoptosis in numerous tumor cells. Recently, someother biological effects, such as induction of membrane permeation and suppression of migration, werediscovered by plasma treatment in some types of tumor cells. In this study, we investigated the biologicaleffects of plasma treatment on multiple myeloma cells. We detected the detachment of adherentmyeloma cells by plasma, and the detachment area was correlated with higher density of hydroxylradical in the gas phase of the plasma. Meanwhile, plasma could promote myeloma differentiation by up-regulating Blimp-1 and XBP-1 expression. The migration ability was suppressed by plasma treatmentthrough decreasing of MMP-2 and MMP-9 secretion. In addition, plasma could increase bortezomibsensitivity and induce myeloma cell apoptosis. Taking together, combination with plasma treatment mayenhance current chemotherapy and probably improve the outcomes.

© 2016 Elsevier Inc. All rights reserved.

1. Instruction

Multiple myeloma (MM) is an incurable B cell malignancecharacterized by the accumulation of malignant plasma cell inpatients' bone marrow (BM), secretion of a unique monoclonalparaprotein, development of osteolytic bone lesions and inductionof neutropenic anemia, aberrant angiogenesis, amyloidosis andhypercalcemia [1e3]. It accounts for 1% of all cancer-related deathsand approximately 10% of hematological cancers in the world [3,4].For patients with symptomatic MMwho are younger than 65 years,high-dose chemotherapy with autologous stem cell transplantation(ASCT) is the first option for treatment [5e8]. For others not eligiblefor ASCT, they generally receive melphalanin combination with

ctrical Insulation and Power10049, PR China.ctrical Insulation and Power10049, PR China.kong@odu.edu (M.G. Kong).

prednisone (MP) plus bortezomib (Velcade, MPV) or thalidomide(MPT) or lenalidomide (Revlimid, MPR) for initial therapy [9e13].Although these new therapies increase response rate and prolongthe overall survival compared to traditional chemotherapy usedbefore, MM patients will relapse and become resistant to chemo-therapy. Thus, new technologies and drugs need to be developed toimprove myeloma clinical outcomes.

Cold atmosphere plasma (CAP), which is a novel technologydeveloped in recent years, is an ionized gas composed of electrons,photons, charged particles and reactive species. It can be conve-niently generated at atmosphere environment with the gas tem-perature as low as room temperature, which makes it possible forapplication in the medical and biological purpose. Due to the highactivity of various reactive species produced by plasma, CAP showspromising prospects in disinfection, wound healing, tissue ablation,coagulation and cancer treatment [14e22]. Many groups have re-ported tumor cell apoptosis by plasma treatment, including hepa-toma carcinoma cells, colorectal cancer cells, lung cancer cells,leukemia cells, melanoma cells, cervical cancer cells, glioma cells

Table 1Primer sequences for real-time PCR.

Gene-name 50-30 sequence Product (bp)

XBP-1 Forward CTGAGTCCGCAGCAGGTG 218Reverse GGCTGGTAAGGAACTGGGTC

Blimp-1 Forward AACGTGTGGGTACGACCTTG 210Reverse GAACCGAAGTACCGCCATCA

EBF Forward CCCAGAAATGTGCCGAGTCT 349Reverse GGGAGTAGCTGCATGTTCCA

CD56 Forward CAACCTGTGTGGAAAAGCCG 233Reverse TCGTTTCTGTCTCCTGGCAC

CD44 Forward CACACCCTCCCCTCATTCAC 195Reverse CAGCTGTCCCTGTTGTCGAA

CD45 Forward TTGTGGCTTAAACTCTTGGCA 70Reverse GGCTTTGCCCTGTCACAAAT

CD11a Forward CATACCGCCCATCCTGAGAC 264Reverse GGCTTCAGCATCTCCACCTT

Mmp-2 Forward TGACTTTCTTGGATCGGGTCG 101Reverse AAGCACCACATCAGATGACTG

Mmp-9 Forward ACGATGACGAGTTGTGGTCC 478Reverse TCGCTGGTACAGGTCGAGTA

b-actin Forward CATGTACGTTGCTATCCAGGC 250Reverse CTCCTTAATGTCACGCACGAT

D. Xu et al. / Biochemical and Biophysical Research Communications 473 (2016) 1125e11321126

and pancreatic cancer cells [23e32]. From pathological physiology,many aspects may affect the treatment efficiency and diseaseprognosis. So more and more researchers investigated other bio-logical functions induced by CAP treatment. It was reported thatplasma could increase cell proliferation in osteoblasts cells andendothelial cells [33,34]. Plasma could decrease cell adhesion inmelanoma cells and liver cancer cells [35,36], while plasma treatedpolymer plates could facilitate cells to attach on it [37]. Severalstudies reported the increase of cell membrane permeability byplasma treatment, which was applied in transferring exogenousmolecules into mammalian cells [38e41]. Besides, some groupsdemonstrated that plasma treatment could decrease cell migrationrate and affect tumor cell invasion [42,43]. The biological effects ofplasma on multiple myeloma has not been studied yet. In thisstudy, we found plasma could induce myeloma cell detachment.Interestingly, the detachment area was correlated with higher hy-droxyl radical density detected by emission spectrometer and massspectrometer. Meanwhile, we found for the first time that plasmacould induce cancer cell differentiation. In addition, we reportedthe effects of plasma on myeloma migration, drug sensitivity andcell apoptotic protein. Our results illustrated multiple functions ofplasma in myeloma biology, which provided new evidences thatplasma could be applied as a novel technique in cancer treatment.

2. Materials and methods

2.1. Plasma generation system

The CAP generation system used in this study is described in ourprevious studies [44]. It consists of a high-voltage AC power supply,gas source, gas flow controller, and oscilloscope as well as theplasma jet device. The plasma jet has a 1.0 mm powered tungstenneedle enclosed in a quartz tube and a grounded outer electrodewrapped around a 6.0 mm diameter dielectric tube [44]. Theworking condition is He gas flow with a power supplied at 10 kHz.

2.2. Cell culture

RPMI8226 and LP-1 MM cell line were used in this study. Cellswere kindly donated by doctor Hu from Department of Moleculeand Genetics, medical school of Xi'an Jiaotong University. Cellswere grown in Roswell Park Memorial Institute (RPMI) 1640 me-dium supplemented with 10% foetal calf serum, 100 U/mL peni-cillin, and 50 mg/mL streptomycin (Corning, Ithaca, NY, USA). Cellswere cultured at 37 �C in an incubator (Thermo Scientific VarioskanFlash, Waltham, MA, USA) containing 5% CO2. Cells were refreshed24 h before performing experiments.

2.3. Cell viability assay

A CellTiter-Glo assay (Promega, Madison, WI, USA) was used toassess cell viability, based on the quantification of ATP. Briefly,100 mL cell suspension was added to 100 mL luminescent reagent ina 96 well non-transparent plate. To fully induce cell lyses, the 96-well plate was placed on an orbital shaker for 2 min and then thecells were incubated at room temperature for 10 min. The lumi-nescence intensity was recorded using the microplate reader(Thermo Scientific Varioskan Flash, Waltham, MA, USA) with theprotocol of “luminometric” measurement (set the measurementtime to 1000 ms without choosing any wavelength).

2.4. Optical emission spectroscopy

The emission spectra of the plasma were measured using a UV/Visible spectrometer (Ocean Optics, Dunedin, USA) within a

wavelength range from 200 nm to 800 nm. The emission spectra ofHe plasmas was analyzed in the vertical direction of the plasma jet,2.0 cm away from the plasma jet.

2.5. Mass spectrometry

Gas plasma composition is determined by mass spectrometry.We detected the positive iron using the SIMS mode. First wescanned all the positive irons by scanningm/z from 1 to 50. Thenwefixed the m/z (such as m/z ¼ 28, N2

þ) to dynamically detect eachunique iron. We could get the distribution in radial direction of theplasma jet by shifting the jet at constant speed. Energy scanning isfrom 0 to 100 eV, the energy solution is 0.5 eV. The density of eachiron was calculated according to the signal detected byspectrometry.

2.6. FACS analysis

The apoptosis of LP-1 cells after plasma treatment was detectedby flow cytometry using an Annexin-V/PI apoptosis kit (BD). Afterplasma treatment for 24 h, cells were harvested and washed twicewith Dulbecco's PBS without calcium and magnesium (Corning).Cells were resuspended in 50 mL 1 � binding buffer (0.01 M Hepes/NaOH (pH 7.4), 0.14 M NaCl, 2.5 mM CaCl2) with 2 mL annexinV-APC(3 mg/mL) and 2 mL PI (50 mg/mL) and incubated at room temper-ature in the dark for 15min. An additional 400 mL 1� binding bufferwas added and samples were analyzed by flow cytometry. CD138expression was detected by anti-CD138-PE (BD). Cells were sus-pended in 50 mL PBS with 1 mL CD138-PE for 30 min, cells werewashed and analyzed by flow cytometry.

2.7. Real-time PCR analysis

Total RNA was prepared with EZNA total RNA kit II (Omega Bio-Tec Inc., Doraville, GA, USA) following manufacturer's instructionsand quantified in Nano Drop spectrophotometry (BioTek® In-struments Inc., Winooski, VT, USA). First strand cDNA was synthe-sized by RevertAid first strand cDNA synthesis kit (ThermoScientific, Waltham, MA, USA), and the reactions were carried outon Applied Biosystems Veriti™ Thermal Cycler (Applied Bio-systems, Foster City, CA, USA). Real-time PCR were performed onBio-Rad CFX Connect™ Real-time System (Bio-Rad, Foster City, CA,

D. Xu et al. / Biochemical and Biophysical Research Communications 473 (2016) 1125e1132 1127

USA), the total reaction volume was 20 mL containing:1) 10 mL2 � QuantiFast SYBR Green PCR MasterMix (Qiagen, Hilden, NRW,Germany); 2) 1 mL DNA template (<100 ng/reaction); 3) 1 mL of10 mM forward and reverse primers respectively (final concentra-tion was 0.5 mM). 4) 8 mL H2O. The primers used for the real-timePCR were listed in Table 1; The optimized amplification protocolconsisted of one cycle of 95 �C for 5 min and then 38 cycles of 95 �Cfor 10 s, 60 �C for 30 s. The melting curves were obtained by slowheating (0.5 �C/s) at temperatures from 60 �C to 95 �C. All sampleswere run in duplicate. The relative expression of target genes werenormalized byb-actin as a house keeping gene. Furthermore, toverify the results of amplification, we tested the products by gelelectrophoresis on 1.5% (w/v) agarose with GelRed (Biotium, Hay-ward, CA, USA). Images of stained agarose gel were captured usingBioDoc-ItTM Imaging System (UVP, Cambridge, UK).

2.8. Combination effect of bortezomib and plasma treatment

Bortezomib (MedChem Express, Princeton, NJ, USA), known as apotent 20 S proteasome inhibitor, was dissolved in dimethylsulf-oxide (DMSO) as a stock solution (10 mM) and diluted with DMSOto the required concentration. LP-1 cells were seeded in 96-wellplates at 1 � 105 cells/well and then cultured in the presence ofbortezomib (the final concentration of bortezomib in medium was0, 1, 3, 5, 8, 10 and 20 nM) for 24 h and 48 h respectively. After

Fig. 1. Cell detachment induced by CAP and the correlation to reactive species. (A) RPMI8stained with trypan blue. (B) Width of detachment area induced by different voltage of Heemission spectrometer. (D) Absolute intensity of different species in radial direction by ememission spectrum and cell culture distribution. (F) Radial distribution (centre and edge areaspectrometer. (For interpretation of the references to colour in this figure legend, the reade

incubation, cell viability was detected by Cell Titer-Glo as describedpreviously. Moreover, to investigate the concerted influence ofbortezomib and plasma on LP-1 cells, four treatments were per-formed: control group, without any treatment; bortezomib group,3 nM and 5 nM bortezomib; plasma group, 30 s and 40 s He (2slm,10 kV); combined group, 3 nM bortezomib þ 30 s He and 5 nMbortezomib þ 40 s He. Cell viability was determined after 24 hincubation.

2.9. Migration assay

Migration ability of LP-1 cells were accessed by a transwell assay(BD). Briefly, 5� 105 cells in 300 mL serum-freemediumwere addedinto inserts containing 8 mm pores and allowed to migrate towards300 mL complete medium in 24-wells at 37 �C and 5% CO2 for 48 h.Cells that migrated into bottom wells were counted and calculatedto migration rate.

2.10. PathScan® stress and apoptosis signaling antibody array

The PathScan® Stress and Apoptosis Signaling Antibody ArrayKit (Cell Signaling Technology Inc., Danvers, MA, USA) was used todetermine relative proteins involved in plasma induced myelomacell apoptosis. There were 19 different signaling molecules, such asAkt, JNK, Bad, p38, Chk1 and eIF2 etc., which could be detected in

226 cells were treated with 10 kHz, 4 SLM He plasma for different time points and wereplasma. (C) Overall spectrum profile of various reactive species in axial direction byission spectrometer. (E) Space corresponding of plasma jet, hydroxyl radical relativeof the plasma jet) of different species (positive ions, m/z ¼ 14, 16, 17, 18, 28, 30) by massr is referred to the web version of this article.)

D. Xu et al. / Biochemical and Biophysical Research Communications 473 (2016) 1125e11321128

this antibody array kit. When multi-well gasket was affixed to theglass slide, 100 mL array blocking buffer was added to each well anddecanted gently after 15 min incubation. Then 70 mL prepared celllysates (total protein concentration was about 0.5 mg/mL) wasadded and incubated for 2 h at room temperature on an orbitalshaker. After washing with 1 � array wash buffer, 75 mL1 � detection antibody cocktail was added and incubated foranother 1 h. Thereafter, the wells were washed again and followedby an addition of 75 mL 1 � HRP-linked streptavidin and the slidewas incubated for 30 min. Subsequently the gasket was removed,the slide was washed briefly and covered with LumiGLO®/Peroxidereagent. The images were photographed by ChemiDoc-itTM Im-aging System (UVP, Upland, CA, USA) and the spot intensities weredetermined using Image pro-Plus software 6.0.

Fig. 2. Effects of plasma treatment on myeloma adhesion molecules and cell differentiaplasma treatment for 1 min and 2 min. (B) Corresponding bands of each gene by electrophplasma treatment for 1 min and 2 min and corresponding bands for each gene. (E) CD138representative experiments was shown. *P < 0.05.

2.11. Statistical analysis

All experiments were repeated at least three times. Data arepresented as means ± SD. Differences between groups were eval-uated using the ManneWhitney U test. P < 0.05 was consideredstatistically significant.

3. Results

We produced the He plasma at 10.0 kHz with a gas flow of 4.0SLM. The distance between the plasma jet and the medium wasfixed at 2.0 cm. RPMI8226 myeloma adherent cells were treatedwith He plasma at different voltages with different time points.Fig. 1A showed that plasma treatment resulted in a clear celldetachment circle on the plates. Using typan-blue staining wefound that cells were dead in the centre of the plate while sur-rounding a blank circle without any cells. In addition, outside of the

tion. (A) mRNA expression of CD56, CD44, CD45 and CD11a by real-time PCR 24 h afteroresis. (C, D) mRNA expression of Blimp-1, XBP-1 and EBF by real-time PCR 24 h afterexpression by cytometry 24 h after plasma treatment for 1 min and 2 min. One of the

D. Xu et al. / Biochemical and Biophysical Research Communications 473 (2016) 1125e1132 1129

circle the cells remained alive without being affected by plasmatreatment. The detachment area was positively correlated withplasma treatment time and applied voltages as shown in Fig. 1B.

As plasma contains a mixture of various active species, we triedto detect the species distribution by emission spectrometer andfigure out the principle species that affected the myeloma cells.Fig. 1C showed an overall spectrum profile of various reactivespecies in axial direction of the plasma jet. Several characteristicpeaks (OH, N2, He, O) were marked in the figure. Next, we used themacro mobile platform to detect the characteristic species in radialdirection of the plasma jet. The optic probe were shifted every0.5 mm along the diametrical line of the plasma jet. Fig. 1D showedthat all these characteristic peaks were high in the centre whilereducing gradually to the edge of the jet. Interestingly, whentransformed the absolute intensity to relative intensity (comparedto He peak), we found that intensity of OH$ spike (hydroxyl radicalindicator) was higher at the edge of the jet, which was correlated tocell detachment area (Fig. 1E).

We further detected the distribution of reactive species by massspectrometer. Plasma jet was fixed on the macro mobile platformand passed though the centre pin of the mass spectrometer alongthe diametrical line so that we could obtain the distribution inradial direction. We could detect several species' indicators withcharge-mass ratio (m/z ¼ 14, 16, 17, 18, 28, 30 et al.) by massspectrometer (Fig. 1F). It showed thatm/z of 14 (Nþ), 28 (N2

þ) and 30(NOþ) had no difference in the centre and edge of the jet, m/z of 16(O2

þ) and 18 (H2Oþ) were higher in the centre whilem/z of 17 (OHþ,hydroxyl radical indicator) was higher at the edge of the jet (Fig.1F).The results indicated that only OH$ showed a higher intensity at the

Fig. 3. Effects of plasma treatment on myeloma migration and drug sensitivity to bortetreatment for 1 min and 2 min. (B) Corresponding bands of each gene by electrophoresis. (C2 min. (D) Dose dependent cell death induced by bortezomib treatment for 24 h and 48 h. (E)of both. *P < 0.05.

edge of the jet, correlated to cell detachment area.Next, we focused on the biological effects induced by plasma in

myeloma cells. We used the LP-1 suspension cells in the followingexperiments. Because LP-1 cells could be directly collected fordetection without trypsinization or scraping, which made it moreconvenient and precise for further analysis. By real-time PCR wedetected several adhesion molecules of myeloma cells after plasmatreatment for 1 min and 2 min. It showed that CD44 and CD11awere up-regulated by plasma while CD56 and CD45 were notaffected (Fig. 2A). Fig. 2B showed the corresponding bands of eachgene by electrophoresis.

Blimp-1, XBP-1 and EBF are three major cell differentiationmarkers of myeloma cells. We investigated whether gas plasmacould have an effect on myeloma cell differentiation. Real-time PCRresults showed that plasma treatment for 2 min could up-regulateBlimp-1 and XBP-1 expression while EBF expression was decreased(Fig. 2C), indicating plasma could shift myeloma cells to a moredifferentiated status. Fig. 2D showed the corresponding bands ofeach gene by electrophoresis. Furthermore, we confirmed by FACSanalysis (Fig. 2E) that plasma treatment could increase the per-centage of the CD138 þ cells (surface marker of differentiation).

Metastasis is a feature of MM, MMP-2 and MMP-9 are twocritical factors for myeloma cell invasion. We analyzed theexpression of MMP-2 and MMP-9 by real-time PCR and found thatboth of them were down-regulated by plasma treatment for 1 minand 2 min (Fig. 3A). Fig. 3B showed the specific PCR products ofMMP-2 and MMP-9 by electrophoresis. By transwell assay, weconfirmed that themigration ability of LP-1 cells was suppressed byplasma treatment for 1 and 2 min (Fig. 3C).

zomib. (A) mRNA expression of MMP-2 and MMP-9 by real-time PCR 24 h after plasma) Migration ability was evaluated by transwell assay after plasma treatment for 1 andCell viability of LP-1 cells 24 h after treatment with plasma, bortezomib or combination

D. Xu et al. / Biochemical and Biophysical Research Communications 473 (2016) 1125e11321130

Meanwhile, drug resistance is one of the big challenge inmyeloma therapy. Bortezomib is a first-line drug used in myelomachemotherapy. First we showed that cell viability was decreasedgradually after bortezomib treatment for 24 h and 48 h in a doesdependent manner (Fig. 3D). Then, we tried to investigate whetherplasma could increase bortezomib sensitivity. As shown in Fig. 3E,combination of plasma treatment (30 s and 40 s) with bortezomib(3 nM and 5 nM) for 24 h could significantly decrease the myelomacell viability compared to either plasma treatment or bortezomibtreatment alone.

Lastly, we investigated the effect of plasma on myeloma cellapoptosis. Compared to the control group, myeloma cell apoptosisshowed a time dependent manner after plasma treatment fordifferent durations as measured by annexin-V/PI staining (Fig. 4A).We further did a cell apoptosis protein array to detect the expres-sion changes of various proteins involved in cell apoptosissignaling. The array data revealed that most of the proteins showedno difference after plasma treatment for 1 min and 2 min. Whiletwo of them, JNK was decreased but eIF2a was increased graduallyafter plasma treatment for 1 min and 2min (Fig. 4B), indicating thatthey might be involved in plasma induced cell apoptosis.

Fig. 4. Cell apoptosis of LP-1 cells induced by plasma treatment. (A) Cell apoptosis analyapoptotic protein array after plasma treatment for 1 and 2 min. Data were standardized by

4. Discussion

In this study, we first found that plasma treatment could lead tocell detachment, depending on the applied voltage and the treat-ment time. We found the detachment area was at the edge of theplasma jet, so we detected distribution of species in the radial di-rection to found out whether the density of some species werehither at the edge of the jet. By emission spectrometer and massspectrometer, we detected indicators of several species and foundthat only OH$ density was higher at the edge of the jet. In gas phaseof plasma, OH$ was mostly produced by the following reaction[45,46]: eþ H2O/H$þ OH$þ e: Therefore, He plasma couldproduce hydroxyl radical when reacting with the vapour in theambient environments. It also explains why the density of OH$ishigher at the edge of the He plasma jet. The concentration of OH$ inthe liquid could be directly measured by ESR (electron spin reso-nance) [47], yet it is impossible to detect the distribution of OH$inthe radial direction in the liquid. Besides, we demonstrated thatOH$ in the gas phase of the plasma could only permeate into liquidless than 0.1 mm [48], so that OH$ in the gas phase of plasma couldnot directly affect cells in the medium. However, OH$ in the gasphase may interact with liquid and convert into long-lived H2O2 orO2�, mainly by the reaction of

zed by flow cytometry after plasma treatment for 0.5, 1 and 2 min. (B) Analysis of cella-Tubulin as a house keeping protein control. *P < 0.05.

D. Xu et al. / Biochemical and Biophysical Research Communications 473 (2016) 1125e1132 1131

2OH$/H2O2;OH$þ H2O2/HO2 þ H2O and HO2/O�2 þ Hþ[48].

We further pointed out the possibility of OH$ regeneration in situ ofthe cells from O2

� and H2O2 at the presence of Fe3þ [49]. OH$is ahighly reactive particle that could react with almost every biolog-ical molecule [50]. Based on these aspects, we proposed that thehigh density of OH$at the edge of the jet might converted into O2

� orH2O2 that permeated deeper to reach the cells. And they could reactwith cells by regeneration of OH$, thus resulting in cell detachment.

Next, we investigated the effects of plasma on adhesionmolecules, cell differentiation, migration, cell apoptosis and drugsensitivity in MM cells. CD56, CD44, CD45 and CD11a are severalmajor adhesion molecules of myeloma cells [51]. We found thatplasma treatment could increase CD44 and CD11a mRNAexpression, which may indirectly affect myeloma cells as CD44and CD11a were reported to be involved in drug resistance, tu-mor metastasis and myeloma cell growth arrest [52e54]. Celldifferentiation status of tumor cells may affect therapy outcomesas poor cell differentiation may indicate a shorter overall sur-vival. Our results showed that Blimp-1 and XBP-1 were up-regulated while EBF was down-regulated by plasma treatment,indicating that plasma could change myeloma cells to a moredifferentiated status [55e57], which could be a potential benefitfor the chemotherapy. MMP-2 and MMP-9 were metal-loproteinases that could degrade extracellular matrix (ECM) andfacilitate myeloma cell invasion and migration [58,59]. It wasreported that MMP-2 and MMP-9 were highly expressed inmyeloma cells [60]. Plasma treatment could reduce the expres-sion of MMP-2 and MMP-9, which results in the suppression ofmyeloma cell migration. In addition, we found that plasmatreatment could increase the sensitivity of myeloma cells tobortezomib, which provided a new strategy to overcome drugresistance in myeloma treatment. Previous study reported thatCYP1A1 was involved in bortezomib drug resistance by acceler-ating bortezomib metabolism in myeloma cells [61]. Whetherplasma treatment of myeloma cells could decrease CYP1A1expression thus improving the sensitivity to bortezomib needs tobe further investigated. Moreover, we demonstrated that plasmatreatment could induce myeloma cell apoptosis through a timedependent manner. To further analyze which proteins wereinvolved in plasma induced cell apoptosis, a cell apoptosis pro-tein array which includes 19 apoptosis related proteins wasperformed 24 h after plasma treatment of LP-1 cells for 1 minand 2 min. We found that JNK was decreased while eIF2a wasincreased after plasma treatment. Chauhan et al. reported theJNK-dependent mitochondrial pathway during myeloma cellapoptosis [62], indicating the possibility of induction of mito-chondrial apoptotic signaling by plasma treatment of myelomacells. Another paper showed that eIF2a, as an endoplasmic re-ticulum (ER) stress response protein [63], was increased aftertreatment with a proteasome inhibitor MLN9708 in myelomacells. Along with our results, we supposed that the production ofreactive species by plasma, triggered the ER stress response andinduced mitochondrial associated apoptosis. In a whole, wedemonstrated that CAP, as a new technology, has a multiplebiological effects on myeloma cells, especially on the induction ofapoptosis, stimulation of cell differentiation, increasing drugsensitivity and suppression of migration ability. These benefits ofplasma treatment, showed a potential application of plasma incombination with chemotherapy to myeloma patients.

In conclusion, we found that CAP could detach the adherentmyeloma cells, and the detachment area was correlated withhigher density of hydroxyl radical in the gas phase of the plasma.Furthermore, plasma could promote myeloma cell differentiationand suppress the migration ability. In addition, plasma treatmentcould efficiently induce cell apoptosis and increase bortezomib

sensitivity. These results showed the promising potential ofplasma treatment in improving myeloma therapy.

Conflict of interest

The authors declare no conflict of interest.

Acknowledgments

This research was supported by the National Natural ScienceFoundation of China (grant nos. 51307135 and 51221005), and theFundamental Research Funds for Central Universities (grant nos.08143069).

References

[1] M.S. Raab, K. Podar, I. Breitkreutz, P.G. Richardson, K.C. Anderson, Multiplemyeloma, Lancet 374 (2009) 324e339.

[2] S.V. Rajkumar, Multiple myeloma, Curr. Probl. Cancer 33 (2009) 7e64.[3] A. Palumbo, K. Anderson, Multiple myeloma, N. Engl. J. Med. 364 (2011)

1046e1060.[4] J. Laubach, P. Richardson, K. Anderson, Multiple myeloma, Annu. Rev. Med. 62

(2011) 249e264.[5] B. Sirohi, R. Powles, J. Mehta, C. Rudin, S. Kulkarni, C. Horton, R. Saso,

S. Singhal, J. Treleaven, An elective single autograft with high-dose melphalan:single-center study of 451 patients, Bone Marrow Transpl. 36 (2005) 19e24.

[6] P. Moreau, H. Avet-Loiseau, T. Facon, M. Attal, M. Tiab, C. Hulin, C. Doyen,L. Garderet, E. Randriamalala, C. Araujo, G. Lepeu, G. Marit, D. Caillot,M. Escoffre, B. Lioure, L. Benboubker, B. Pegourie, B. Kolb, A.M. Stoppa,J.G. Fuzibet, O. Decaux, M. Dib, C. Berthou, C. Chaleteix, C. Sebban, C. Traulle,J. Fontan, M. Wetterwald, P. Lenain, C. Mathiot, J.L. Harousseau, Bortezomibplus dexamethasone versus reduced-dose bortezomib, thalidomide plusdexamethasone as induction treatment before autologous stem cell trans-plantation in newly diagnosed multiple myeloma, Blood 118 (2011)5752e5758 quiz 5982.

[7] D.H. Vesole, L. Zhang, N. Flomenberg, P.R. Greipp, H.M. Lazarus, C.A. Huff,A phase II trial of autologous stem cell transplantation followed by mini-allogeneic stem cell transplantation for the treatment of multiple myeloma:an analysis of Eastern Cooperative Oncology Group ECOG E4A98 and E1A97,Biol. Blood Marrow Transpl. 15 (2009) 83e91.

[8] B. Bjorkstrand, G. Gahrton, High-dose treatment with autologous stem celltransplantation in multiple myeloma: past, present, and future, Semin.Hematol. 44 (2007) 227e233.

[9] S. Sacchi, R. Marcheselli, A. Lazzaro, F. Morabito, A. Fragasso, N. Di Renzo,E. Balleari, S. Neri, G. Quarta, R. Ferrara, M.L. Vigliotti, G. Polimeno, P. Musto,U. Consoli, A. Zoboli, G. Buda, A. Pastorini, L. Masini, A randomized trial withmelphalan and prednisone versus melphalan and prednisone plus thalido-mide in newly diagnosed multiple myeloma patients not eligible for autolo-gous stem cell transplant, Leuk. Lymphoma 52 (2011) 1942e1948.

[10] M.V. Mateos, A. Oriol, J. Martinez-Lopez, N. Gutierrez, A.I. Teruel, R. de Paz,J. Garcia-Larana, E. Bengoechea, A. Martin, J.D. Mediavilla, L. Palomera, F. deArriba, Y. Gonzalez, J.M. Hernandez, A. Sureda, J.L. Bello, J. Bargay, F.J. Penalver,J.M. Ribera, M.L. Martin-Mateos, R. Garcia-Sanz, M.T. Cibeira, M.L. Ramos,M.B. Vidriales, B. Paiva, M.A. Montalban, J.J. Lahuerta, J. Blade, J.F. Miguel,Bortezomib, melphalan, and prednisone versus bortezomib, thalidomide, andprednisone as induction therapy followed by maintenance treatment withbortezomib and thalidomide versus bortezomib and prednisone in elderlypatients with untreated multiple myeloma: a randomised trial, Lancet Oncol.11 (2010) 934e941.

[11] P. Kapoor, S.V. Rajkumar, A. Dispenzieri, M.A. Gertz, M.Q. Lacy, D. Dingli,J.R. Mikhael, V. Roy, R.A. Kyle, P.R. Greipp, S. Kumar, S.J. Mandrekar, Melphalanand prednisone versus melphalan, prednisone and thalidomide for elderlyand/or transplant ineligible patients with multiple myeloma: a meta-analysis,Leukemia 25 (2011) 689e696.

[12] P. Wijermans, M. Schaafsma, F. Termorshuizen, R. Ammerlaan, S. Wittebol,H. Sinnige, S. Zweegman, M. van Marwijk Kooy, R. van der Griend, H. Lokhorst,P. Sonneveld, Phase III study of the value of thalidomide added to melphalanplus prednisone in elderly patients with newly diagnosed multiple myeloma:the HOVON 49 Study, J. Clin. Oncol. 28 (2010) 3160e3166.

[13] A. Islam, J.L. Ambrus, Bortezomib plus melphalan and prednisone for multiplemyeloma, N. Engl. J. Med. 359 (2008) 2613 author reply 2613e2614.

[14] D.B. Graves, Reactive species from cold atmospheric plasma: implications forcancer therapy, Plasma Process. Polym. 11 (2014) 1120e1127.

[15] M. Keidar, A. Shashurin, O. Volotskova, M.A. Stepp, P. Srinivasan, A. Sandler,B. Trink, Cold atmospheric plasma in cancer therapy, Phys. Plasmas 20 (2013).

[16] E. Kvam, B. Davis, F. Mondello, A.L. Garner, Nonthermal atmospheric plasmarapidly disinfects multidrug-resistant microbes by inducing cell surfacedamage, Antimicrob. agents Chemother. 56 (2012) 2028e2036.

[17] C. Gurol, F.Y. Ekinci, N. Aslan, M. Korachi, Low temperature plasma fordecontamination of E. coli in milk, Int. J. Food Microbiol. 157 (2012) 1e5.

D. Xu et al. / Biochemical and Biophysical Research Communications 473 (2016) 1125e11321132

[18] M. Keidar, R. Walk, A. Shashurin, P. Srinivasan, A. Sandler, S. Dasgupta, R. Ravi,R. Guerrero-Preston, B. Trink, Cold plasma selectivity and the possibility of aparadigm shift in cancer therapy, Br. J. Cancer 105 (2011) 1295e1301.

[19] G. Isbary, G. Morfill, H.U. Schmidt, M. Georgi, K. Ramrath, J. Heinlin, S. Karrer,M. Landthaler, T. Shimizu, B. Steffes, W. Bunk, R. Monetti, J.L. Zimmermann,R. Pompl, W. Stolz, A first prospective randomized controlled trial to decreasebacterial load using cold atmospheric argon plasma on chronic wounds inpatients, Br. J. Dermatol. 163 (2010) 78e82.

[20] M. Ishaq, M. Evans, K. Ostrikov, Effect of atmospheric gas plasmas on cancercell signaling, Int. J. Cancer 134 (2014) 1517e1528.

[21] S.U. Kalghatgi, G. Fridman, M. Cooper, G. Nagaraj, M. Peddinghaus,M. Balasubramanian, V.N. Vasilets, A.F. Gutsol, A. Fridman, G. Friedman,Mechanism of blood coagulation by nonthermal atmospheric pressuredielectric barrier discharge plasma, IEEE Trans. Plasma Sci. 35 (2007)1559e1566.

[22] G. Fridman, G. Friedman, A. Gutsol, A.B. Shekhter, V.N. Vasilets, A. Fridman,Applied plasma medicine, Plasma Process Polym. 5 (2008) 503e533.

[23] X. Zhang, M. Li, R. Zhou, K. Feng, S. Yang, Ablation of liver cancer cells in vitroby a plasma needle, Appl. Phys. Lett. 93 (2008) 021502e021503.

[24] M. Thiyagarajan, A. Sarani, X.F. Gonzales, Characterization of an atmosphericpressure plasma jet and its applications for disinfection and cancer treatment,Stud. Health Technol. Inf. 184 (2013) 443e449.

[25] Kim Chul-Ho, S.H.J. Kwon, Effects of atmospheric nonthermal plasma on in-vasion of colorectal cancer cells, Appl. Phys. Lett. 96 (2010) 243701e243703.

[26] X. Yan, F. Zou, Sh. Zhao, X.P. Lu, G.Y. He, Z.L. Xiong, Q. Xiong, Q.Q. Zhao,P.Y. Deng, J.G Huang, G.G Yang, IEEE Trans. Plasma Sci. 38 (2010) 2451e2457.

[27] M. Vandamme, E. Robert, S. Pesnel, E. Barbosa, S. Dozias, J. Sobilo, S. Lerondel,A.L. Pape, J.M. Pouvesle, Plasma Process Polym. 38 (2010) 748e757.

[28] L. Brulle, M. Vandamme, D. Ries, E. Martel, E. Robert, S. Lerondel, V. Trichet,S. Richard, J.M. Pouvesle, A. Le Pape, Effects of a non thermal plasma treatmentalone or in combination with gemcitabine in a MIA PaCa2-luc orthotopicpancreatic carcinoma model, PLoS One 7 (2012) e52653.

[29] H.J. Ahn, K.I. Kim, G. Kim, E. Moon, S.S. Yang, J.S. Lee, Atmospheric-pressureplasma jet induces apoptosis involving mitochondria via generation of freeradicals, PLoS One 6 (2011) e28154.

[30] A. Majumdar, R. Ummanni, K. Schroder, R. Walther, R. Hippler, Cancer cells(MCF-7, Colo-357, and LNCaP) viability on amorphous hydrogenated carbonnitride film deposited by dielectric barrier discharge plasma, J. Appl. Phys. 106(2009) 034702e034705.

[31] H. Min Joh, S. Ja Kim, T. Chung, S. Leem, Reactive oxygen species-relatedplasma effects on the apoptosis of human bladder cancer cells in atmo-spheric pressure pulsed plasma jets, Appl. Phys. Lett. 101 (2012)053703e053705.

[32] R.M. Walk, J.A. Snyder, P. Srinivasan, J. Kirsch, S.O. Diaz, F.C. Blanco,A. Shashurin, M. Keidar, A.D. Sandler, Cold atmospheric plasma for the abla-tive treatment of neuroblastoma, J. Pediatr. Surg. 48 (2013) 67e73.

[33] E.D. Yildirim, H. Ayan, V.N. Vasilets, A. Fridman, S. Guceri, W. Sun, Effect ofdielectric barrier discharge plasma on the attachment and proliferation ofosteoblasts cultured over poly(epsilon-caprolactone) scaffolds, Plasma Pro-cess. Polym. 5 (2008) 58e66.

[34] S. Kalghatgi, G. Friedman, A. Fridman, A.M. Clyne, Endothelial cell proliferationis enhanced by low dose non-thermal plasma through fibroblast growthfactor-2 release, Ann. Biomed. Eng. 38 (2010) 748e757.

[35] H.J. Lee, C.H. Shon, Y.S. Kim, S. Kim, G.C. Kim, M.G. Kong, Degradation ofadhesion molecules of G361 melanoma cells by a non-thermal atmosphericpressure microplasma, New J. Phys. 11 (2009).

[36] B. Gweon, M. Kim, D.B. Kim, D. Kim, H. Kim, H. Jung, J.H. Shin, W. Choe, Dif-ferential responses of human liver cancer and normal cells to atmosphericpressure plasma, Appl. Phys. Lett. 99 (2011).

[37] M. Leduc, S. Coulombe, R.L. Leask, Atmospheric pressure plasma jet depositionof patterned polymer films for cell culture applications, IEEE Trans. Plasma Sci.37 (2009) 927e933.

[38] M. Leduc, D. Guay, R. Leask, S. Coulombe, Cell permeabilization using a non-thermal plasma, New J. Phys. 11 (2009) 115021.

[39] Y. Sakai, V. Khajoee, Y. Ogawa, K. Kusuhara, Y. Katayama, T. Hara, A noveltransfection method for mammalian cells using gas plasma, J. Biotechnol. 121(2006) 299e308.

[40] Y. Ogawa, N. Morikawa, A. Ohkubo-Suzuki, S. Miyoshi, H. Arakawa, Y. Kita,S. Nishimura, An epoch-making application of discharge plasma phenomenonto gene-transfer, Biotechnol. Bioeng. 92 (2005) 865e870.

[41] C.M. Edelblute, L.C. Heller, M.A. Malik, R. Heller, Activated air produced byshielded sliding discharge plasma mediates plasmid DNA delivery tomammalian cells, Biotechnol. Bioeng. 112 (2015) 2583e2590.

[42] C.H. Kim, S. Kwon, J.H. Bahn, K. Lee, S.I. Jun, P.D. Rack, S.J. Baek, Effects ofatmospheric nonthermal plasma on invasion of colorectal cancer cells, Appl.Phys. Lett. 96 (2010).

[43] A. Shashurin, M. Keidar, S. Bronnikov, R.A. Jurjus, M.A. Stepp, Living tissueunder treatment of cold plasma atmospheric jet, Appl. Phys. Lett. 93 (2008).

[44] D.H. Xu, D.X. Liu, B.Q. Wang, C. Chen, Z.Y. Chen, D. Li, Y.J. Yang, H.L. Chen,M.G. Kong, Situ OH generation from O-2(�) and H2O2 plays a critical role inplasma-induced cell death, Plos One 10 (2015).

[45] C. Vasko, D.-X. Liu, E. van Veldhuizen, F. Iza, P. Bruggeman, Hydrogen peroxideproduction in an atmospheric pressure RF glow discharge: comparison ofmodels and experiments, Plasma Chem. Plasma Process. 34 (2014)1081e1099.

[46] D.-X. Liu, P. Bruggeman, F. Iza, M.-Z. Rong, M.G. Kong, Global model of low-temperature atmospheric-pressure He þ H2O plasmas, Plasma Sour. Sci.Technol. 19 (2010) 025018.

[47] P. Sun, Y. Sun, H. Wu, W. Zhu, J.L. Lopez, W. Liu, J. Zhang, R. Li, J. Fang, At-mospheric pressure cold plasma as an antifungal therapy, Appl. Phys. Lett. 98(2011) 021501.

[48] C. Chen, D. Liu, Z. Liu, A. Yang, H. Chen, G. Shama, M. Kong, A model of plasma-biofilm and plasma-tissue interactions at ambient pressure, Plasma Chem.Plasma Process. 34 (2014) 403e441.

[49] D. Xu, D. Liu, B. Wang, C. Chen, Z. Chen, D. Li, Y. Yang, H. Chen, M.G. Kong, Insitu OH generation from O 2� and H2O2 plays a critical role in plasma-induced cell death, PloS one 10 (2015) e0128205.

[50] S. Hippeli, E.F. Elstner, OH-radical-type reactive oxygen species: a short re-view on the mechanisms of OH-radical- and peroxynitrite toxicity, Zeitschriftfur Naturforschung. C, J. Biosci. 52 (1997) 555e563.

[51] C. Pellat-Deceunynck, S. Barille, D. Puthier, M.J. Rapp, J.L. Harousseau,R. Bataille, M. Amiot, Adhesion molecules on human myeloma cells: signifi-cant changes in expression related to malignancy, tumor spreading, andimmortalization, Cancer Res. 55 (1995) 3647e3653.

[52] C.C. Bjorklund, V. Baladandayuthapani, H.Y. Lin, R.J. Jones, I. Kuiatse, H. Wang,J. Yang, J.J. Shah, S.K. Thomas, M. Wang, D.M. Weber, R.Z. Orlowski, Evidenceof a role for CD44 and cell adhesion in mediating resistance to lenalidomide inmultiple myeloma: therapeutic implications, Leukemia 28 (2014) 373e383.

[53] C. Pellat-Deceunynck, M. Amiot, N. Robillard, J. Wijdenes, R. Bataille, CD11a-CD18 and CD102 interactions mediate human myeloma cell growth arrestinduced by CD40 stimulation, Cancer Res. 56 (1996) 1909e1916.

[54] I.M. Dahl, T. Rasmussen, G. Kauric, A. Husebekk, Differential expression ofCD56 and CD44 in the evolution of extramedullary myeloma, Br. J. Haematol.116 (2002) 273e277.

[55] A.M. Reimold, N.N. Iwakoshi, J. Manis, P. Vallabhajosyula, E. Szomolanyi-Tsuda, E.M. Gravallese, D. Friend, M.J. Grusby, F. Alt, L.H. Glimcher, Plasma celldifferentiation requires the transcription factor XBP-1, Nature 412 (2001)300e307.

[56] M. Shapiro-Shelef, K. Calame, Plasma cell differentiation and multiplemyeloma, Curr. Opin. Immunol. 16 (2004) 226e234.

[57] H. Maier, J. Hagman, Roles of EBF and Pax-5 in B lineage commitment anddevelopment, Semin. Immunol. 14 (2002) 415e422.

[58] M. Parmo-Cabanas, I. Molina-Ortiz, S. Matias-Roman, D. Garcia-Bernal,X. Carvajal-Vergara, I. Valle, A. Pandiella, A.G. Arroyo, J. Teixido, Role ofmetalloproteinases MMP-9 and MT1-MMP in CXCL12-promoted myelomacell invasion across basement membranes, J. Pathol. 208 (2006) 108e118.

[59] T. Kelly, M. Borset, E. Abe, D. Gaddy-Kurten, R.D. Sanderson, Matrix metal-loproteinases in multiple myeloma, Leuk. lymphoma 37 (2000) 273e281.

[60] D. Urbaniak-Kujda, K. Kapelko-Slowik, I. Prajs, J. Dybko, D. Wolowiec,M. Biernat, M. Slowik, K. Kuliczkowski, Increased expression ofmetalloproteinase-2 and -9 (MMP-2, MMP-9), tissue inhibitor ofmetalloproteinase-1 and -2 (TIMP-1, TIMP-2), and EMMPRIN (CD147) inmultiple myeloma, Hematology 21 (2016) 26e33.

[61] D.H. Xu, J.S. Hu, E. De Bruyne, E. Menu, R. Schots, K. Vanderkerken, E. VanValckenborgh, Dll1/Notch activation contributes to bortezomib resistance byupregulating CYP1A1 in multiple myeloma, Biochem. Biophys. Res. Commun.428 (2012) 518e524.

[62] D. Chauhan, G. Li, T. Hideshima, K. Podar, C. Mitsiades, N. Mitsiades,N. Munshi, S. Kharbanda, K.C. Anderson, JNK-dependent release of mito-chondrial protein, Smac, during apoptosis in multiple myeloma (MM) cells,J. Biol. Chem. 278 (2003) 17593e17596.

[63] D. Chauhan, Z. Tian, B. Zhou, D. Kuhn, R. Orlowski, N. Raje, P. Richardson,K.C. Anderson, In vitro and in vivo selective antitumor activity of a novelorally bioavailable proteasome inhibitor MLN9708 against multiple myelomacells, Clin. cancer Res. Off. J. Am. Assoc. Cancer Res. 17 (2011) 5311e5321.