Embed Size (px)
Citation preview
Page 1 of 41
Bioassay for determining the concentrations of caffeine and 1
individual methylxanthines in complex samples 2
3
Alejandro E. Gutierrez2, Prachi Shah1, Abigail E. Rex1, Tien C. Nguyen1, Saamiha P. Kenkare1, 4
Jeffrey E. Barrick2,*, Dennis M. Mishler1,2* 5
6
7
1The Freshman Research Initiative, College of Natural Sciences, The University of Texas at 8
Austin, Austin, Texas 78712, USA 9
2Department of Molecular Biosciences, Center for Systems and Synthetic Biology, The 10
University of Texas at Austin, Austin, Texas 78712, USA 11
12
*Correspondence: [email protected], [email protected] 13
14
AEM Accepted Manuscript Posted Online 20 September 2019Appl. Environ. Microbiol. doi:10.1128/AEM.01965-19Copyright © 2019 American Society for Microbiology. All Rights Reserved.
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 2 of 41
Abstract 15
Caffeine and other methylxanthines are stimulant molecules found in formulated 16
beverages, including sodas and energy drinks, and in brewed beverages, such as coffee and 17
teas. Previously, we developed a bioassay for caffeine that involves monitoring the growth 18
of a ∆guaB mutant of E. coli defective in de novo guanine biosynthesis. When supplemented 19
with a plasmid expressing the genes for an N-demethylation pathway from Pseudomonas 20
putida CBB5, these bacteria demethylate caffeine (1,3,7-trimethylxanthine) and other 21
methylxanthines into xanthine, which is then converted into guanine to support cell 22
growth. A major limitation of this bioassay was that it could only measure the total 23
concentration of all methylxanthines in a mixture. Therefore, it could not be used to 24
measure the caffeine content of beverages like teas, which contain substantial quantities of 25
multiple methylxanthines. To overcome this limitation, we created seven new plasmids 26
containing all subsets of the three demethylase genes (ndmA, ndmB, and ndmC). We show 27
that strains of ∆guaB E. coli containing each plasmid are able to demethylate specific 28
subsets of methylxanthines and that they can be used to determine the concentrations of 29
individual methylxanthines in complex mixtures containing multiple methylxanthines, 30
including coffee doped with additional methylxanthine. While validating this assay, we 31
discovered an unexpected demethylation event at the 1-methyl position when NdmB and 32
NdmC were expressed in the absence of NdmA. The improved cell-based bioassay is cheap, 33
easy to use, and gives results comparable to standard HPLC methods for measuring 34
methylxanthine concentrations. 35
36
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 3 of 41
Importance 37
Caffeine (1,3,7-trimethylxanthine) is the dominant neurostimulant found in coffee, teas, 38
sodas, and energy drinks. Measuring the amount of caffeine and other methylxanthines in 39
these beverages is important for quality assurance and safety in food science. 40
Methylxanthines are also used in medicine and as performance-enhancing drugs, two 41
contexts in which accurately determining their concentrations in bodily fluids is important. 42
Liquid chromatography is the standard method for measuring methylxanthine 43
concentrations in a sample, but it requires specialized equipment and expertise. We 44
improved a previous bioassay that links E. coli growth to methylxanthine demethylation so 45
that it can now be used to determine the amounts of individual methylxanthines in complex 46
mixtures or beverages, such as coffee. 47
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 4 of 41
Introduction 48
Caffeine (1,3,7-trimethylxanthine) and other methylxanthines are the primary bioactive 49
chemical components of many beverages. Caffeine is well known as a neurostimulant 50
frequently used by people to stay awake, but it and the dimethylxanthines theophylline and 51
theobromine also have other effects on respiratory and cardiac functions. In some 52
beverages methylxanthines are naturally derived from plant ingredients, such as in coffee, 53
tea, and hot chocolate. In others, chemically pure caffeine is added as part of a formula, 54
such as in sodas and some energy drinks. In both cases, accurately determining the 55
methylxanthine content of these beverages is important for quality assurance and even 56
safety, as these compounds are lethal at high concentrations. For example, theobromine 57
(3,7-dimethylxanthine) is the molecule responsible for the toxicity of chocolate to dogs (1). 58
Accurate quantification of caffeine and methylxanthine levels is also important in 59
other contexts. Caffeine has been identified as a pollutant in surface waters around urban 60
centers and it can be toxic to wildlife (2, 3). Theophylline (1,3-dimethylxanthine) and 61
theobromine are employed as bronchodilators in human and veterinary medicine. 62
Measuring the amounts of these drugs in blood and urine can be important for monitoring 63
correct dosage (4, 5). The pharmacological effects of methylxanthines can also lead to illicit 64
uses. While not currently banned, caffeine is on the World Anti-Doping Agency’s 2018 list 65
of monitored substances (6). Use of caffeine and other methylxanthines as performance-66
enhancing drugs has also been reported in horse racing (7). 67
High-performance liquid chromatography (HPLC) is the standard method currently 68
used for determining the methylxanthine content of a beverage, urine, blood, or water 69
samples (8–11). These samples, especially the ones of biological origin, may be complex 70
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 5 of 41
mixtures, and one must first chemically separate or extract methylxanthines from 71
interfering compounds prior to HPLC analysis. However, even in purified samples, 72
compounds, such as chlorogenic acids and methyluric acids, which are difficult to 73
discriminate from methylxanthines by HPLC, may still be present. It can be laborious to 74
identify their individual peaks in an elution profile and the peaks for more than one of 75
these compounds may overlap with and interfere with quantification (9). These difficulties 76
can often be overcome with optimization, but it typically takes multiple procedural 77
modifications and HPLC runs to find suitable conditions, based on the types of interference 78
seen in a particular sample type and which methylxanthines are to be analyzed (9, 10). 79
Bioassays that use microbial cells offer an alternative to HPLC for many applications 80
in detecting small molecules (12, 13). In the simplest case, bacterial mutants auxotrophic 81
for various amino acids have long been used to detect these compounds (14, 15). Growth of 82
these cultures is proportional to how much of the specific nutrient that the cells cannot 83
synthesize is present in an unknown sample. Another common class of genetically 84
engineered microbial biosensors measures the concentration of a compound of interest by 85
monitoring induction of a reporter gene (e.g., luciferase or GFP) by a transcription factor or 86
riboswitch that specifically recognizes and responds to that compound. For example, 87
bacteria have been engineered to detect micromolar levels of salicylate using the salR 88
repressor(16, 17), and riboswitch-based sensors have been used to detect theophylline, 89
2,4-dinitrotoluene (DNT, a TNT precursor), and coenzyme B12 (18–21). 90
Previously, we created a biosensor based on coupling auxotrophy to a caffeine 91
demethylation pathway (22). The system relies on two components. First, it uses an 92
Escherichia coli strain with its de novo guanine synthesis pathway knocked out via removal 93
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 6 of 41
of the guaB gene, which encodes the enzyme that converts inosine-5ʹ-phosphate (IMP) to 94
xanthosine-5ʹ-phosphate (XMP). These ΔguaB E. coli are guanine auxotrophs. They also 95
retain the ability to synthesize guanine from xanthine through its conversion into XMP. 96
Therefore, growth of this ΔguaB strain is directly proportional to the concentration of 97
guanine or xanthine present in the culture medium, as long as it is the limiting nutrient. 98
The second component of the caffeine biosensor is the pDCAF3 plasmid, which 99
encodes a synthetic operon for demethylating caffeine and other methylxanthines to 100
xanthine. This operon contains genes from Pseudomonas putida CBB5, an organism that is 101
capable of living off caffeine as its sole carbon and nitrogen source (23). The genes encode 102
three distinct N-demethylases (NdmA, NdmB, NdmC), an accessory protein (NdmD), and an 103
NdmE homologue (22, 24). NdmA and NdmB normally associate to form a heterocomplex, 104
and they, respectively, remove the N1 and N3 methyl groups of caffeine and other 105
methylxanthines (25). NdmC demethylates the N7 position. NdmD is a Rieske reductase, 106
which oxidizes NADH to provide electrons to the demethylases. It is required for the 107
activity of all three demethylases(26, 27). NdmE is a glutathione S-transferase (28). In 108
place of NdmE, pDCAF3 contains the gene gst9 from Janthinobacterium sp. Marseille, a 109
homologous glutathione S-transferase that supports NdmC activity, most likely by 110
facilitating the interaction between NdmC and NdmD (22, 28). 111
The pDCAF3 plasmid and ∆guaB strain of E. coli were combined to create a cell that 112
can demethylate caffeine and other methylxanthines to xanthine, which can then be used to 113
synthesize the guanine needed for its growth. This bacterial strain was used to implement a 114
quantitative bioassay for caffeine and related molecules in which the number of E. coli cells 115
after growth to saturation can be used to calculate the number of methylxanthine 116
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 7 of 41
molecules that were originally present in a culture (22). While this bioassay is useful for 117
measuring the amount of caffeine in a formulated beverage or unknown sample that 118
contains only caffeine, it does not discriminate between different methylxanthines, and any 119
xanthine or guanine present in the sample will also support growth. Beverages containing 120
plant-based ingredients, including coffee, tea, or hot chocolate, contain significant 121
concentrations of other methylxanthines, including theobromine and theophylline, and 122
they may also contain xanthine or guanine (8, 29). The ΔguaB E. coli with pDCAF3 will use 123
all of these molecules to produce guanine and grow, preventing this bioassay from 124
accurately estimating the concentration of caffeine or any one methylxanthine in a sample. 125
In order to improve this bioassay so that it can be used to determine the 126
concentrations of individual methylxanthines in a mixture, we constructed a suite of 127
plasmids derived from pDCAF3. Each one was designed to be capable of demethylating only 128
a specific subset of monomethylxanthines and/or dimethylxanthines by removing some 129
combination of the key ndmA, ndmB, and ndmC demethylase genes. When grown in media 130
containing a sample of interest, each of these strains grows to a different extent, based on 131
the methylxanthines present. The cell densities attained by the various strains can then be 132
used to calculate individual methylxanthine concentrations. During the creation and 133
testing of this suite of plasmids in ΔguaB E. coli, we found an unexpected demethylation 134
event was catalyzed by cells with a plasmid containing ndmB and ndmC, giving new insight 135
into the substrate specificity of synthetic combinations of these enzymes. Overall, we 136
found that this bioassay allows the amount of caffeine, theobromine, or other 137
methylxanthines present in a sample to be determined with the same precision as HPLC. 138
139
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 8 of 41
Results 140
Construction of a new series of pDCAF plasmids 141
The bioassay for measuring caffeine described in Quandt et al. (3) used ∆guaB E. coli 142
containing the pDCAF3 plasmid (Fig. 1A). This plasmid contains a synthetic operon 143
encoding the N-demethylase genes ndmA, ndmB, and ndmC, which encode enzymes 144
targeting methyl groups attached to the 1, 3, and 7 nitrogens of xanthine, respectively, 145
followed by the ndmD and gst9 accessory genes (Fig. 1B). We observed a progressive loss 146
of caffeine demethylation activity when ∆guaB E. coli cells with pDCAF3 were cultured in 147
rich media, or when the pDCAF3 plasmid was maintained in a nonauxotrophic E. coli strain 148
(e.g., DH5α). Without constant selection for maintaining caffeine demethylation activity to 149
support cell growth, cells with defective plasmids containing mutations appear to be able 150
to rapidly outcompete cells with intact plasmids. 151
We also found that a pDCAF3 plasmid clone submitted to the AddGene repository 152
(Plasmid #65220) accumulated an IS5 insertion between the –35 and –10 consensus 153
elements of the demethylation operon promoter during routine lab maintenance and 154
storage of strains carrying pDCAF3 (Fig. 1A). This pDCAF3-IS5 plasmid variant still 155
maintains sufficient demethylation activity to support caffeine measurement by ∆guaB E. 156
coli in the manner described by Quandt et al. (3). The IS5 insertion presumably alters 157
expression from the interrupted promoter, as has been observed in other studies (30), 158
potentially making this plasmid less burdensome than the original pDCAF3 plasmid. 159
In light of these concerns about plasmid stability, we sought to improve the 160
performance of a second-generation of pDCAF plasmids by editing out repeat sequences 161
that are potential hotspots for generating gene deletions (31). Specifically, the pDCAF3 162
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 9 of 41
plasmid re-used the same 26-base-pair sequence containing a ribosome binding site (RBS) 163
upstream of each gene except ndmA in the synthetic operon. We constructed a new 164
decaffeination plasmid, pDCAF-ABC, which encodes the same demethylation operon but 165
has different intergenic linkers and RBS sequences for each of the five genes (Fig. 1C). 166
Next, we created six additional plasmids in this new pDCAF series containing every 167
combination of either one or two of the ndmA, ndmB, and ndmC genes (Fig. 1D). Each of 168
these plasmids retained the ndmD and gst9 genes. The newly created plasmids are each 169
expected to fully demethylate certain subsets of di- and monomethylxanthines (Table 1). 170
For example, the plasmid with only ndmB and ndmC (pDCAF-BC) is expected to 171
demethylate all methylxanthines lacking a 1-methyl group: 3-methylxanthine, 7-172
methylxanthine, and 3,7-dimethylxanthine (theobromine). Hereafter, we abbreviate the 173
names of methylxanthines as indicated in Table 1 (e.g, 1,3 methylxanthine as 1,3-MX). 174
175
pDCAF plasmids demethylate specific subsets of methylxanthines 176
To verify the predicted functionality of each pDCAF plasmid, we transformed it into ∆guaB 177
E. coli and grew each of these new strains separately in M9CG minimal media containing 178
the highest-order methylxanthine it was predicted to fully demethylate. The total yield of 179
cells, after growth reaches saturation, increases linearly with the concentration of the 180
target methylxanthine up to ~100 µM for each of these strains, consistent with previous 181
reports (22). Above this concentration, methylxanthine is no longer the limiting nutrient 182
for the growth of the strain and the culture density plateaus (Fig. 2A). Attempts to extend 183
this range by using alternative growth conditions and differing spectrophotometer 184
procedures did not significantly change the linear range. The pDCAF strains all grow in the 185
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 10 of 41
presence of their expected target methylxanthines, save for the pDCAF-A strain, which 186
shows no significant growth in the presence of 1-MX (Table 1). This observation is 187
consistent with biochemical analyses of purified NdmA enzyme that show it is proficient at 188
removing the 1-methyl group from 1,3-MX and 1,3,7-MX, but has very low activity when 1-189
MX is the substrate (27). 190
We next tested the ability of our pDCAF strains to measure the concentrations of 191
multiple methylxanthines in a mixture. The pDCAF-B, pDCAF-C, and pDCAF-BC strains were 192
each grown separately in M9CG medium containing 60 µM of total methylxanthines: 20 µM 193
3-MX and 40 µM 7-MX (Fig. 2B). If a strain can demethylate both molecules, then we would 194
expect to see growth consistent with the presence of 60 µM of methylxanthine. The pDCAF-195
B strain grew to an optical density (OD) consistent with a concentration of 20 µM 196
methylxanthine and the pDCAF-C strain grew to an OD consistent with a concentration of 197
40 µM methylxanthine. Both values were as expected since pDCAF-B only removes the 3-198
methyl group and pDCAF-C only removes the 7-methyl group. The pDCAF-BC strain grew 199
to an OD consistent with a concentration of 60 µM methylxanthine, the combined 200
concentration of the methylxanthines present, demonstrating that our multi-strain 201
bioassay can be used to both detect the total amount of methylxanthine present and 202
deconvolute the concentrations of the specific methylxanthines within the mixture. 203
With the basic functionality of the strains established, we assessed the growth of the 204
seven ∆guaB E. coli pDCAF strains on all mono-, di-, and trimethylxanthines. The strains 205
were streaked out on M9CG agar supplemented with nothing, xanthine, or one of the 206
methylxanthines (Fig. 3). The ∆guaB strain of E. coli with no plasmid functioned as a 207
negative control for growth of the ∆guaB strain in the presence of methylxanthines, while 208
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 11 of 41
its non-auxotrophic progenitor containing an intact guaB gene, strain BW25113, served as 209
a positive control for growth in the presence of methylxanthines. The control strains and 210
the pDCAF-ABC strain (the top row on each plate) displayed the expected phenotypes: the 211
∆guaB negative control strain grew only when xanthine was present, the BW25113 212
positive control strain grew on every plate, and the pDCAF-ABC decaffeination strain grew 213
as long as any methylxanthine other than 1-MX was present. 214
Most of the newly created strains behaved as expected, growing only in the presence 215
of the predicted methylxanthine substrates that could be fully demethylated by their subset 216
of the NdmA, NdmB, and NdmC enzymes (Table 1) (27, 28). There were three notable 217
exceptions. First, none of the strains (other than the positive control) grew on 1-MX. As 218
explained above, this occurs because NdmA does not efficiently remove the 1-methyl group 219
from 1-MX (27). Second, the pDCAF-AC strain (bottom row, center on each plate) displayed 220
low levels of off-target growth on plates containing 3-MX, 1,3-MX and 1,3,7-MX (Fig. 3). 221
This may suggest that the combination of NdmA and NdmC may be able to very weakly 222
target the 3-methyl position. We did not observe this phenotype for any of the other strains 223
and the levels of growth are minor over the course of 24 or 48 hours on solid or in liquid 224
media. Finally, and most surprisingly, the pDCAF-BC strain (bottom row, right on each 225
plate) grew well in the presence of 1,7-MX despite lacking the ndmA gene, which has been 226
reported to be the only one of the three demethylases capable of removing the 1-methyl 227
group. This activity has not been observed previously and was the only significant off-228
target growth among all combinations of pDCAF strains and methylxanthine substrates. 229
230
Unexpected growth of pDCAF-BC strain on 1,7-dimethylxanthine 231
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 12 of 41
To further probe the unexpected growth of the pDCAF-BC strain on 1,7-MX, its growth was 232
tested in liquid culture with varying concentrations of each methylxanthine (Fig. 4A). The 233
strain was able to grow as expected with xanthine, 3-MX, 7-MX, and 3,7-MX, but it also grew 234
just as well with 1,7-MX. This suggests that the strain is able to fully and efficiently 235
demethylate 1,7-MX under these conditions, even though it is not able to grow to any 236
significant degree on 1-MX, 1,3-MX, or 1,3,7-MX (Fig. 4A). 237
To confirm that this apparent off-target activity was not a result of cross-238
contamination between our strains, the pDCAF-BC strain was streaked out twice on M9CG 239
agar supplemented with only 3,7-MX and sequence verified. After picking isolated colonies, 240
the pDCAF-BC strain was then grown in liquid cultures containing equal amounts of 1,7-241
MX, 3,7-MX, and/or 1,3,7-MX. The strain was able to utilize 1,7-MX or 3,7-MX, but did not 242
grow at all if only 1,3,7-MX was present (Fig. 4B). Furthermore, when the different 243
methylxanthines were mixed together in equal amounts in the same culture (Fig. 4B), 244
growth of the strain roughly doubled when both 1,7-MX and 3,7-MX were present, but the 245
addition of 1,3,7-MX did not further increase the growth of the strain. These results are 246
consistent with results in Figure 3, suggesting that pDCAF-BC can efficiently target and 247
demethylate 1,7-MX and 3,7-MX, but is unable to fully demethylate 1,3,7-MX. Since growth 248
was seen for the expected MX substrates, we know that both demethylase enzymes 249
encoded on pDCAF-BC are functional. Thus, the observation of no pDCAF-BC growth on 250
1,3,7-MX must have a different explanation. 251
We considered two possibile scenarios that could yield this unexpected result. First, 252
1,3,7-MX (caffeine) may not be targeted at all; it may not be recognized as a substrate for 253
the demethylation process that involves NdmB and NdmC. Second, 1,3,7-MX may be 254
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 13 of 41
targeted, but NdmC might demethylate the 7-methyl position first, yielding 1,3-MX as an 255
off-pathway intermediate that cannot be fully demethylated by NdmB and NdmC. 256
To test these hypotheses, we turned to our newly created bioassay. If the pDCAF-BC 257
strain partially demethylates 1,3,7-MX, then this product would become a substrate for 258
another one of our pDCAF strains. Therefore, the pDCAF-BC strain was grown in the 259
presence of both 3,7-MX (to support growth) and 1,3,7-MX (to test whether it was partially 260
demethylated). Then, cell-free filtered supernatant from this culture was added to cultures 261
containing one of three other pDCAF strains to determine which methylxanthines were 262
present (Fig. 5A). pDCAF-AB and pDCAF-AC showed only background levels of growth, 263
whereas pDCAF-ABC showed significant growth, confirming that no dimethylxanthine 264
product had been produced by pDCAF-BC acting on 1,3,7-MX. To confirm our bioassay 265
findings, we also analyzed these samples by HPLC to identify the methylxanthines present 266
before and after incubation with the pDCAF-BC E. coli strain (Fig. 5B,C). Prior to 267
incubation with pDCAF-BC, we see a peak for 3,7-MX at ~4.5 minutes and a peak for 1,3,7-268
MX at ~10 minutes. After incubation, the peak for 3,7-MX is gone, while the peak for 1,3,7-269
MX is still present, which agrees with the results of the bioassay. 270
Determination of methylxanthine concentrations in a complex beverage 271
One possible advantage of our cell-based bioassay for methylxanthines is that it may 272
potentially discriminate against compounds found in complex samples containing plant-273
derived ingredients that interfere with chemical analysis methods. To demonstrate that the 274
bioassay functions in complex samples, we tested its ability to accurately determine the 275
concentrations of 1,3,7-MX (caffeine) and 1,3-MX (theophylline) in coffee. For this test, we 276
grew the ∆guaB, pDCAF-AB, and pDCAF-ABC strains with a 1:100 dilution of coffee or 277
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 14 of 41
coffee doped with 2 mM of one of these two methylxanthines (Fig. 6). We compared the 278
results of the bioassay to an HPLC analysis of the same samples (Table 2). In the most 279
complex mixture, containing 2 mM of doped 1,3-MX and ~2 mM of naturally occurring 280
caffeine, the bioassay found 1879 µM of 1,3-MX and 1943 µM of 1,3,7-MX. This compares 281
favorably to the HPLC analysis, which found 1971 µM of 1,3-MX and 2054 µM of 1,3,7-MX. 282
Overall, percent errors on the bioassay values relative to HPLC were < 7% for all samples 283
(Table 2), demonstrating that the bioassay can accurately determine the concentrations of 284
multiple different methylxanthines in a chemically complex natural beverage. 285
286
Discussion 287
We created a bioassay that can be used to detect the presence of various methylxanthines 288
in a sample and accurately report their concentrations. The system is composed of a suite 289
of eight E. coli measurement strains. All of these strains are guanine/xanthine auxotrophs 290
due to the deletion of the guaB gene. Seven of these strains each have a different 291
engineered pDCAF plasmid that is capable of demethylating a subset of methylxanthines to 292
complement the auxotrophy, and the eighth strain has no plasmid so that it reads out the 293
baseline concentrations of guanine and xanthine in a sample. Each strain with a pDCAF 294
plasmid was tested against its own highest-order target methylxanthine and found to grow 295
in a predictable fashion, largely consistent with previous characterizations of the genes 296
involved. By using each strain in parallel with the same solution of media and 297
methylxanthines, the precise amounts of different methylxanthines and their individual 298
contributions to culture growth can be calculated (Table 3). 299
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 15 of 41
Most of the engineered E. coli strains behaved as expected with regards to their 300
growth on different methylxanthines. However, during this characterization, we also 301
detected an unexpected off-target N1 demethylation event for pDCAF-BC (Fig. 3). This 302
strain fully metabolized 1,7-dimethylxanthine in addition to its predicted target, 3,7-303
dimethylxanthine. This activity could reflect a natural promiscuity with respect to 304
substrate for this set of enzymes, or it could be the result of an artificial characteristic of 305
our system. NdmA and NdmB normally function as an A3:B3 heterocomplex of trimers 306
when both are expressed in the same bacterial cell (25). A reverse binding configuration in 307
which the xanthine ring is flipped in the substrate binding site between the two enzyme 308
trimers explains the specificity of NdmA and NdmB for the N1 versus N3 methyl groups, 309
respectively. When expressed on their own NdmA and NdmB form homocomplexes 310
between trimers of the one enzyme. Thus, it seems likely that expressing NdmB on its own 311
in the pDCAF-BC strain allows NdmB trimers to form a homocomplex with distinct binding 312
pockets for each trimer, one that targets the N1 position and the other that targets the N3 313
position, but that only substrates with certain N-methyl groups are able to productively 314
associate with each active site (e.g., 1,3,7-MX and 1-MX are excluded from both, but 3,7-MX 315
and 1,7-MX can both bind). Similarly, the formation of a homocomplex consisting solely of 316
the NdmA protein may also explain the minor amounts of growth of pDCAF-AC when 317
grown in the presence of methylxanthines containing a methyl group at the 3ʹ position. 318
Alternatively or in addition, the inclusion of the gst9 ortholog from Janthinobacterium sp. 319
Marseille in place of the cognate ndmE glutathione S-transferase from Pseudomonas putida 320
CBB5 (28) may alter the substrate selection properties of NdmA and NdmB. In any case, 321
this information is important for those interested in using these or related enzymes for the 322
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 16 of 41
industrial production of various methylxanthines (32–34). However, this off-target activity 323
is not problematic for making measurements with our bioassay. One can still determine 324
the concentrations of all dimethylxanthines in a sample from the growth of different 325
combinations of the bioassay strains (Table 3). 326
We demonstrated the functionality of our bioassay in laboratory growth media 327
containing mixtures of methylxanthines as well as with a doped coffee sample. We 328
validated that it can selectively and accurately detect the presence of specific 329
methylxanthines, generating results that are typically within 5-7% of HPLC analysis of the 330
same solutions. The assay accurately detected caffeine (1,3,7-MX) added to coffee, as well 331
as selectively detecting the addition of theophylline (1,3-MX) to coffee. Applying this assay 332
to more complex brewed beverages and bodily fluids presents interesting opportunities for 333
future applications. Brewed beverages, including coffee, teas, and hot chocolate, commonly 334
have wide ranges of caffeine and can contain significant concentrations of other 335
methylxanthines, dependent on the bean or leaf being used and the preparation of the 336
drink (8, 29, 35, 36). Patients using methylxanthine as medicine or athletes being tested for 337
doping are commonly examined to monitor the correct dosage of the medicine or to detect 338
the illicit use of the molecules (4–7). These tests can be conducted on bodily fluids and 339
potentially even on the residue left by fingertips (37–39). A potential advantage of cell-340
based bioassays is that they can often be applied to complex samples, such as these, with 341
contaminants that would interfere with other analytical techniques. 342
However, before the bioassay can be reliably deployed to detect methylxanthine 343
concentrations in these liquids a number of challenges must be overcome. Currently, the 344
linear range of the assay is restricted to a final caffeine concentration of 10-100 µM. The 345
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 17 of 41
lower limit of detection appears to be due to one or more contaminating sources of 346
xanthine or guanine in our growth medium (Fig. 4A and 5A). We concluded that casein, 347
which is purified from a biological source, was the mostly likely culprit. We found that 348
using casamino acids (an acid hydrolysate of casein) for our coffee analysis lowered the 349
background growth (Fig. 6). If we can fully eliminate contaminants by reformulating the 350
bacterial growth medium or if we employ alternative methods to count bacterial growth, 351
we may be able to detect submicromolar concentrations of methylxanthines in solution. 352
This is an important limit to pass as traditional HPLC-UV detection of methylxanthines in 353
bodily fluids can detect amounts as small as ~1 µM (40–42), and the newest HPLC-MS 354
techniques can detect as little as ~0.1 µM (37–39). A second challenge is characterizing the 355
possible presence in these liquids of molecules that are toxic or may impact cell growth in 356
some other way. While we can dilute samples and control for slower growth, our bioassay 357
will not be able to work with any liquid that completely prevents cell growth or interferes 358
with methylxanthine utilization. 359
Lastly, while we have used HPLC to confirm that the bioassay is working in a coffee 360
sample, analytical proof that our system functions reliably in other complex beverages may 361
be harder to come by as other molecules in a sample, such as the other HPLC peaks seen in 362
Figure 5, may interfere with quantitation of some methylxanthine peaks (8, 9, 29). The use 363
of bodily fluids or brewed beverages may only compound this problem. For example, mate 364
tea possesses other molecules with elution profiles that can be confused with 365
methylxanthines, such as chlorogenic acid (9). While this is not a problem for the 366
bioassay—in fact it illustrates a potential advantage of our approach—it does complicate 367
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 18 of 41
obtaining independent evidence from a separate method to validate that the bioassay 368
accurately measures methylxanthine concentrations. 369
One possible concern with a bioassay versus HPLC is the genetic stability of the 370
performance of the bacterial strains. Since these bacteria are guanine/xanthine 371
auxotrophs, they must preserve their demethylation pathways if they are maintained on 372
media supplemented with their corresponding highest-order MX. Thus, unlike most 373
synthetic biology programming, the genes cannot mutate to become nonfunctional. 374
Additionally, since internal controls include a standard curve of the strain, should the strain 375
begin to evolve, exhibiting faster/slower growth, this will be accounted for in the standard 376
curve. Larger variances will be easy to detect and can be addressed, by returning to a 377
frozen stock. However, we do not anticipate this to be a major concern because we 378
redesigned these plasmids for greater genetic stability compared to pDCAF3 and saw no 379
evidence of strain failure when performing our assays. 380
With more testing, this bioassay promises to be broadly useful for detecting 381
methylxanthines in a wide range of beverages and bodily fluids. The plasmid suite that we 382
have characterized here brings this application one step closer. With further development, 383
the cell-based biosensor may even prove a more attractive alternative to HPLC-UV or 384
HPLC-MS techniques, as it requires less expertise to use and could potentially be cheaper. 385
In fact, the assay is highly scalable, as the basic controls needed for the standard curves 386
only need to be performed once, whether you have 1 sample or 100, and all 100 samples 387
can be grown and measured in roughly the same amount of time as 1 sample. For example, 388
the 2014 University of Texas at Austin undergraduate iGEM team analyzed coffee from 389
over 35 local Austin coffee shops over the course of one week using the original pDCAF3 390
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 19 of 41
system, undergraduate researchers, and a spectrophotometer (43). These lower barriers 391
to entry might empower more individuals and small companies, such as coffee roasters and 392
coffee shops to monitor their brewing process. It could also lead to improved monitoring of 393
methylxanthine levels in patients, athletes, and the environment. 394
395
Materials and Methods 396
Media and reagents. M9CG media used for growth of the pDCAF strains was comprised of 397
M9 salts (33.7 mM Na2HPO4, 22.0 mM KH2PO4, 8.55 mM NaCl, and 9.35 mM NH4Cl), 2 g/L 398
glucose, 1 mM MgSO4, 0.3 mM CaCl2, 1 µg thiamin, 2 g/L casein (BD Biosciences), and trace 399
elements (134 µM EDTA, 31 µM FeCl3, 6.2 µM ZnCl2, 760 pM CuCl2, 420 pM CoCl2, 1.62 µM 400
H3BO4, and 81 pM MnCl2) (22). 1-MX (>97%), 3,7-MX, and 1,3,7-MX were purchased from 401
Sigma Aldrich, 3-MX from MP Biomedicals, 7-MX (98%) from Alfa Aesar, and 1,7-MX 402
(>97%) from Santa Cruz Biotechnology. Methylxanthine stock solutions (10 mM) were 403
made in 10 mL water with ~40 µL of 6 M NaOH added to help dissolve all the 404
methylxanthines except 1,3,7-MX, which dissolved readily. 405
406
Plasmid assembly. The new pDCAF plasmids were constructed using BioBrick Standard 407
Assembly (44). To make the genes in the pDCAF3 operon into individual BioBricks, primers 408
were designed to amplify the ndmA, ndmB, ndmC, ndmD, and gst9 genes from the pDCAF3 409
plasmid (22). These primers also added the BioBrick prefix and suffix, as well as ribosome 410
binding site sequences. A full list of primers can be found in Table 4. The ndmA, ndmB, and 411
ndmC genes were amplified individually. The ndmD and gst9 genes were amplified 412
together. Primers iGEM15-02C and iGEM-03C were used to remove a PstI restriction site 413
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 20 of 41
from the ndmA gene and primers iGEM15-06C and iGEM15-07C were used to remove an 414
EcoRI restriction site from the ndmB gene in order to make them BioBrick compatible. 415
These two genes were each amplified in two pieces, split at the restriction site being 416
removed. Then, the full-length ndmA and ndmB genes lacking the restriction sites were 417
regenerated via overlap extension PCR with outside primers (iGEM15-01C with iGEM15-418
26C for ndmA and iGEM15-05C with iGEM15-23C for ndmB). 419
All of the PCR reactions to amplify the genes from the pDCAF3 plasmid were 50 µL 420
reactions containing 100 ng DNA template (1 ng of both DNA templates for the overlap 421
extension PCRs), 0.25 µM forward primer, 0.25 µM reverse primer, 1× Phusion HF buffer 422
(Thermo Scientific), 200 µM dNTPs, 4% DMSO, 2 mM Mg2+, and 0.5 µL Phusion DNA 423
polymerase (New England Biolabs). PCR reactions were run with a denaturation step of 424
98°C for 15 seconds, an annealing step with temperature equal to 5°C less than the lower 425
melting temperature between the two primers for 30 seconds, and an extension step of 426
72°C for a length of time dependent on the product being amplified (one minute for ndmA, 427
ndmB, and ndmC, and two minutes for ndmD with gst9). 428
The PCR products were gel extracted and individually cloned into the standard 429
BioBrick pSB1C3 vector. PCR products and the pSCB1C3 vector were digested with XbaI 430
and SpeI restriction enzymes (New England Biolabs) for 30 minutes in CutSmart buffer. 431
The digested DNA fragments were gel extracted and ligated together in a 20 µL reaction at 432
room temperature for 30 minutes using T4 DNA ligase buffer and T4 DNA ligase (New 433
England Biolabs) with a 3-fold molar excess of the gene insert to the pSB1C3 vector. These 434
ligations were purified by adding 400 µL of cold 1-butanol, centrifuging at 15,000+g for ten 435
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 21 of 41
minutes, decanting the supernatant, adding 200 µL cold 70% ethanol, centrifuging at 436
15,000+g for five minutes, and again decanting to remove excess salts. 437
Plasmids were resuspended in 10 µL water and introduced into TOP10 E. coli by 438
electroporation. Transformed E. coli were then plated on LB plates supplemented with 20 439
µg/mL chloramphenicol (CAM) and incubated overnight at 37°C. Isolated colonies were 440
used to grow 5 mL LB cultures supplemented with 20 µg/mL CAM. These cultures were 441
used to make glycerol stocks. Plasmid DNA was also isolated from these cultures using a 442
Qiagen miniprep kit. These plasmids were then sequence verified. 443
To create plasmids containing multiple ndm genes within an operon, the ndmA, 444
ndmB, and ndmC genes were postfixed into a vector under the control of a promoter, 445
BioBrick BBa_K1330003 (iGEM parts registry), by digesting the insert genes with XbaI and 446
PstI (New England Biolabs) and the vector with SpeI and PstI for 30 minutes with CutSmart 447
buffer. The insert genes were then ligated into the vector using the same ligation procedure 448
as before, with the XbaI and SpeI cut sites creating a scar site (44). Ligated plasmids were 449
then introduced to Top 10 E. coli via electroporation and sequence verified as described 450
above. In order to create the full pDCAF plasmids, the next gene needed was digested and 451
postfixed into the appropriate intermediate construct using the process described above. 452
For instance, the pDCAF-A construct was completed by taking the intermediate construct 453
with the ndmA gene under control of the K1330003 promoter and postfixing the ndmD and 454
gst9 genes behind it. For pDCAF-AB, the same intermediate ndmA construct first had ndmB 455
postfixed behind it followed by the ndmD and gst9 genes. Each gene added required the 456
creation, transformation, and sequence verification of a new intermediate construct. Each 457
pDCAF plasmid was completed by the addition of the ndmD and gst9 genes. The sequence-458
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 22 of 41
verified pDCAF plasmids were then introduced by electroporation into ∆guaB E. coli and 459
plated on M9CG agar with 20 µg/mL CAM and 200 µM of the highest-order methylxanthine 460
that plasmid can demethylate. pDCAF-A was grown in the presence of xanthine. Plasmid 461
was isolated and sequence verified from picked colonies as described above. All plasmids 462
were confirmed to contain the correct sequences without mutations. The pDCAF plasmids 463
were submitted to the iGEM Registry of Standard Biological Parts (BioBrick numbers 464
K1627000 through K1627006). 465
466
pDCAF strain growth on M9CG plates with methylxanthines. In order to test the 467
demethylation specificity of the bioassay strains, each strain was individually streaked out 468
on M9CG agar plates supplemented with 250 µM of one methylxanthine. The pDCAF strains 469
plus ∆guaB and BW25113 E. coli were grown overnight in 2 mL M9CG media supplemented 470
with 125 µM of the specific methylxanthine that each strain can degrade (BW25113 471
received an equal volume of water) and 20 µg/mL CAM (except for ∆guaB and BW25113). 472
The plates were divided into 9 sections, and the saturated cultures from each of the strains 473
were streaked out in the same spot on each plate. The plates were incubated at 30°C 474
overnight and photographed the next day. 475
476
Growing pDCAF strains in media and creating standard curves. pDCAF strains were 477
individually streaked out from glycerol stocks on M9CG agar plates supplemented with 20 478
µg/mL CAM and 100 µM of the methylxanthine specific to each strain (xanthine was used 479
for the ∆guaB and pDCAF-A strain). Note: 50 µg/mL kanamycin (KAN) must be used 480
instead of CAM for the ∆guaB strain. Plates were incubated overnight at 30°C. Colonies 481
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 23 of 41
were picked from each plate and put into separate 2 mL M9CG cultures supplemented with 482
50 µg/mL kanamycin (KAN), 20 µg/mL CAM, and 100 µM methylxanthine specific to each 483
strain. Again, CAM was not used for the ∆guaB strain. Each culture contained only one 484
pDCAF strain and cultures were grown overnight at 30°C shaking at 200 rpm. These 485
cultures were then diluted 1:1000 into 2 mL triplicate M9CG cultures supplemented with 486
KAN and CAM (as described above) and a range from 0 to 250 µM of the different 487
methylxanthines based on the linear range of the standard curve reported previously for 488
the ∆guaB E. coli with the pDCAF3 construct (22). These cultures were then grown 489
overnight shaking at 30°C and 200 rpm for 22 hours. The next day 150 µL of each culture 490
was pipetted into a 96-well plate and measured for OD600 using an Infinite 200 PRO Tecan 491
microplate reader. These endpoint OD600 measurements were then plotted against the 492
final concentration of methylxanthine present in each culture, and a linear trendline was fit 493
to each plot. 494
495
pDCAF-BC demethylation analysis. To test the pDCAF-BC strain in media containing 496
multiple methylxanthines, we first isolated three fresh colonies of the strain. These 497
colonies were grown to saturation overnight as described in the section above. The 498
saturated cultures were then added 1:100 to liquid media containing 20 µM of 1,7-MX, 3,7-499
MX, and/or 1,3,7-MX. Growth conditions and the recording of OD600 values were as 500
described above. To determine if pDCAF-BC could target the caffeine molecule for 501
demethylation, we grew the strain in the presence of both 20 µM 3,7-MX and 20 µM 1,3,7-502
MX as described above. The cultures were then spun down and the supernatant was 503
removed and put through a 0.22 µm filter. The sterilized media was transferred to fresh 504
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 24 of 41
culture tubes and a second pDCAF strain was added to this sterile media and grown as 505
described in the previous section. 506
HPLC analysis of methylxanthines in media. To confirm our bioassay findings, we ran a 507
sample of the sterile media containing the methylxanthines through an HPLC before and 508
after incubation with pDCAF-BC (as described above). A Shimadzu SIL-20AC HPLC system 509
equipped with a SPD-M20A photodiode array detector and a Zorbax StapleBond C18 510
column (4.6 mm X 250 mm, 5 µm) was used. All samples were filtered through a 0.22 µm 511
filter prior to analysis. For all samples, methanol/water/acetic acid (30:70:0.5, v/v/v) was 512
used as the mobile phase and each run was at 1 ml/min for 15 minutes (22). The results 513
were read at a wavelength of 280 nm, and methylxanthine retention times and maximum 514
wavelengths were compared to standards of media supplemented with different 515
compounds and previous studies to confirm their identities (8, 29, 45, 46). 516
Bioassay usage with a coffee sample. To prove the bioassay functions in a complex 517
solution, we used coffee from a caramel-flavored Starbucks Keurig K-cup supplemented 518
with 2 mM of either 1,3-MX or 1,3,7-MX. The ∆guaB, pDCAF-AB, and pDCAF-ABC strains 519
were then grown in media containing these samples, as described above with minor 520
changes. Importantly, instead of using casein, we used casamino acids (Fisher, BP1424-521
500) to minimize background growth. As growth is noticeably slower when using casamino 522
acids, we increased growth times to approximately 48 hrs to allow for growth to saturation. 523
Otherwise, we performed the bioassay in triplicate, as described above. HPLC analysis of 524
diluted coffee samples and methylxanthine standards used an Agilent Technologies 1260 525
Infinity II HPLC system equipped with a Poroshell 120 EC-C18 column (4.6 mm x 100 mm, 526
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 25 of 41
2.7 µm). For all samples, methanol/water/acetic acid (15:85:0.5, v/v/v) was used as the 527
mobile phase and each run was at 1 ml/min for 15 minutes. We used methylxanthine 528
standards of 10, 100, 500, and 1000 µM to determine the amount of each methylxanthine in 529
the coffee samples, analyzing all coffee samples three times using a wavelength of 280 nm. 530
Calculations of methylxanthine concentrations. To determine the concentration of a 531
specific methylxanthine in a mixture, the growth of each strain must be compared to its 532
specific standard curve (described above). Once the total methylxanthine concentration 533
has been determined for the strain in question, the concentrations of all lower-order 534
molecules must be subtracted out. This includes guanine and xanthine. In Table 3, we 535
show how to do this by calculating the concentration of each individual molecule as 536
detected by each strain. For example, to determine the amount of 1,3,7-MX present, we 537
first calculate the concentration of each molecule present in the mixture using every strain, 538
including the ∆guaB strain. We start by calculating how much guanine+xanthine are 539
present using the ∆guaB strain. Then, we calculate how much 3MX and 7MX are present 540
using the pDACF-B and pDCAF-C strains, respectively, and subtracting from those values 541
the amount of guanine+xanthine measured. To determine the concentrations of the higher 542
order methylxanthines, we subtract the concentrations of each of these lower-order 543
molecules, where appropriate. For example, to determine how much 3,7MX is present, we 544
need to subtract the concentration of 3MX, 7MX, and guanine+xanthine in the liquid. 545
However, to determine how much 1,3MX is present, we only subtract the 3MX and 546
guanine+xanthine concentrations. This logic is then applied for determining the 547
concentration of 1,3,7MX (Table 3). Note that due to some terms cancelling out, it is 548
sometimes possible to calculate the concentration of a target methylxanthine without 549
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 26 of 41
individually measuring the concentrations of every one of the lower-order 550
methylxanthines. However, we do not present this methodology here. 551
552
Acknowledgements 553
We thank members of the UT Austin Freshman Research Initiative (FRI) “Microbe Hackers” 554
undergraduate research stream, and specifically Ian Overman, David Barrera, and Lindsay 555
Collier for their assistance in preparing specialized media; Erik Quandt and Barrick lab 556
members for helpful discussions; and Jason Niehaus of Addgene for alerting us to the IS5 557
mutation in pDCAF3. This research was supported by the National Science Foundation 558
(NSF) (CBET-1554179), the NSF BEACON Center for the Study of Evolution in Action (DBI-559
0939454), and the Defense Advanced Research Projects Agency (DARPA) (HR0011-15-560
C0095). The FRI program is supported by the Howard Hughes Medical Institute 561
(52008124). 562
563
564
References 565
566
1. Kovalkovičová N, Šutiaková I, Pistl J, Šutiak V. 2009. Some food toxic for pets. 567
Interdiscip Toxicol 2:169–176. 568
2. Rodriguez del Rey Z, Granek EF, Sylvester S. 2012. Occurrence and concentration of 569
caffeine in Oregon coastal waters. Mar Pollut Bull 64:1417–1424. 570
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 27 of 41
3. Adamafio NA. 2013. Theobromine toxicity and remediation of cocoa by-products: an 571
overview. J Biol Sci 13:570–576. 572
4. Mitenko PA, Ogilvie RI. 1973. Rational intravenous doses of theophylline. N Engl J Med 573
289:600–603. 574
5. Eid NS, O’Hagan A, Bickel S, Morton R, Jacobson S, Myers JA. 2016. Anti-inflammatory 575
dosing of theophylline in the treatment of status asthmaticus in children. J Asthma 576
Allergy. 577
6. World Anti-Doping Agency. 2017. Prohibited_list_2018_en.pdf. 578
7. Budhraja A, Camargo FC, Hughes C, Lehner AF, Stirling K, Brennan N, Dowling M, 579
Tobin T. 2007. Caffeine and theobromine identifications in post-race urines: threshold 580
levels and regulatory significance of such identifications. Proc 53rd Annu Conv Am 581
Assoc Equine Pract Orlando Fla USA 1-5 Dec 2007 87–92. 582
8. Bispo MS, Veloso MCC, Pinheiro HLC, De Oliveira RFS, Reis JON, De Andrade JB. 2002. 583
Simultaneous determination of caffeine, theobromine, and theophylline by high-584
performance liquid chromatography. J Chromatogr Sci 40:45–48. 585
9. Deladino L, Teixeira AS, Reta M, García ADM, Navarro AS, Martino MN. 2013. Major 586
phenolics in yerba mate extracts (Ilex paraguariensis) and their contribution to the 587
total antioxidant capacity. Food Nutr Sci 04:154–162. 588
10. Martínez-López S, Sarriá B, Gómez-Juaristi M, Goya L, Mateos R, Bravo-Clemente L. 589
2014. Theobromine, caffeine, and theophylline metabolites in human plasma and 590
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 28 of 41
urine after consumption of soluble cocoa products with different methylxanthine 591
contents. Food Res Int 63:446–455. 592
11. Leakey TEB. 1990. Simultaneous analysis of theophylline, caffeine and eight of their 593
metabolic products in human plasma by gradient high-performance liquid 594
chromatography. J Chromatogr A 507:199–220. 595
12. Khalil AS, Collins JJ. 2010. Synthetic biology: applications come of age. Nat Rev Genet 596
11:367–379. 597
13. Smanski MJ, Zhou H, Claesen J, Shen B, Fischbach MA, Voigt CA. 2016. Synthetic 598
biology to access and expand nature’s chemical diversity. Nat Rev Microbiol 14:135–599
149. 600
14. Davis BD, Mingioli ES. 1950. Mutants of Escherichia coli requiring methionine or 601
vitamin B12. J Bacteriol 60:17–28. 602
15. Bertels F, Merker H, Kost C. 2012. Design and characterization of auxotrophy-based 603
amino acid biosensors. PLOS ONE 7:e41349. 604
16. King JMH, DiGrazia PM, Applegate B, Burlage R, Sanseverino J, Dunbar P, Larimer F, 605
Sayler GS. 1990. Rapid, sensitive bioluminescent reporter technology for naphthalene 606
exposure and biodegradation. Science 249:778–781. 607
17. Huang WE, Wang H, Zheng H, Huang L, Singer AC, Thompson I, Whiteley AS. 2005. 608
Chromosomally located gene fusions constructed in Acinetobacter sp. ADP1 for the 609
detection of salicylate. Environ Microbiol 7:1339–1348. 610
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 29 of 41
18. Suess B, Fink B, Berens C, Stentz R, Hillen W. 2004. A theophylline responsive 611
riboswitch based on helix slipping controls gene expression in vivo. Nucleic Acids Res 612
32:1610–1614. 613
19. Desai SK, Gallivan JP. 2004. Genetic screens and selections for small molecules based 614
on a synthetic riboswitch that activates protein translation. J Am Chem Soc 615
126:13247–13254. 616
20. Fowler CC, Brown ED, Li Y. 2010. Using a riboswitch sensor to examine coenzyme B12 617
metabolism and transport in E. coli. Chem Biol 17:756–765. 618
21. Davidson ME, Harbaugh SV, Chushak YG, Stone MO, Kelley-Loughnane N. 2013. 619
Development of a 2,4-dinitrotoluene-responsive synthetic riboswitch in E. coli cells. 620
ACS Chem Biol 8:234–241. 621
22. Quandt EM, Hammerling MJ, Summers RM, Otoupal PB, Slater B, Alnahhas RN, 622
Dasgupta A, Bachman JL, Subramanian M V, Barrick JE. 2013. Decaffeination and 623
measurement of caffeine content by addicted Escherichia coli with a refactored N‑624
demethylation operon from Pseudomonas putida CBB5. ACS Synth Biol 2:301-307. 625
23. Yu CL, Louie TM, Summers R, Kale Y, Gopishetty S, Subramanian M. 2009. Two distinct 626
pathways for metabolism of theophylline and caffeine are coexpressed in 627
Pseudomonas putida CBB5. J Bacteriol 191:4624–4632. 628
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 30 of 41
24. Quandt EM, Summers RM, Subramanian MV, Barrick JE. 2015. Draft genome sequence 629
of the bacterium Pseudomonas putida CBB5, which can utilize caffeine as a sole carbon 630
and nitrogen source. Genome Announc 3:e00640-15. 631
25. Kim JH, Kim BH, Brooks S, Kang SY, Summers RM, Song HK. 2019. Structural and 632
mechanistic insights into caffeine degradation by the bacterial N-demethylase 633
complex. J Mol Biol. 634
26. Summers RM, Louie TM, Yu CL, Subramanian M. 2011. Characterization of a broad-635
specificity non-haem iron N-demethylase from Pseudomonas putida CBB5 capable of 636
utilizing several purine alkaloids as sole carbon and nitrogen source. Microbiology 637
157:583–592. 638
27. Summers RM, Louie TM, Yu C-L, Gakhar L, Louie KC, Subramanian M. 2012. Novel, 639
highly specific N-demethylases enable bacteria to live on caffeine and related purine 640
alkaloids. J Bacteriol 194:2041–2049. 641
28. Summers RM, Seffernick JL, Quandt EM, Yu CL, Barrick JE, Subramanian M V. 2013. 642
Caffeine junkie: an unprecedented glutathione S-transferase-dependent oxygenase 643
required for caffeine degradation by Pseudomonas putida CBB5. J Bacteriol 195:3933–644
3939. 645
29. Srdjenovic B, Djordjevic-Milic V, Grujic N, Injac R, Lepojevic Z. 2008. Simultaneous 646
HPLC determination of caffeine, theobromine, and theophylline in food, drinks, and 647
herbal products. J Chromatogr Sci 46:144–149. 648
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 31 of 41
30. Humayun MZ, Zhang Z, Butcher AM, Moshayedi A, Jr MHS. 2017. Hopping into a hot 649
seat: Role of DNA structural features on IS5-mediated gene activation and inactivation 650
under stress. PLOS ONE 12:e0180156. 651
31. Jack BR, Leonard SP, Mishler DM, Renda BA, Leon D, Suárez GA, Barrick JE. 2015. 652
Predicting the genetic stability of engineered DNA sequences with the EFM calculator. 653
ACS Synth Biol 4:939–943. 654
32. Algharrawi KHR, Summers RM, Gopishetty S, Subramanian M. 2015. Direct conversion 655
of theophylline to 3-methylxanthine by metabolically engineered E. coli. Microb Cell 656
Factories 14:203. 657
33. Summers RM, Mohanty SK, Gopishetty S, Subramanian M. 2015. Genetic 658
characterization of caffeine degradation by bacteria and its potential applications. 659
Microb Biotechnol 8:369–378. 660
34. McKeague M, Wang Y-H, Cravens A, Win MN, Smolke CD. 2016. Engineering a 661
microbial platform for de novo biosynthesis of diverse methylxanthines. Metab Eng 662
38:191–203. 663
35. McCusker RR, Goldberger B a, Cone EJ. 2003. Caffeine content of specialty coffees. J 664
Anal Toxicol 27:520–522. 665
36. Ludwig IA, Mena P, Calani L, Cid C, Del Rio D, Lean MEJ, Crozier A. 2014. Variations in 666
caffeine and chlorogenic acid contents of coffees: what are we drinking? Food Funct 667
5:1718–1726. 668
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 32 of 41
37. Kuwayama K, Tsujikawa K, Miyaguchi H, Kanamori T, Iwata YT, Inoue H. 2013. Time-669
course measurements of caffeine and its metabolites extracted from fingertips after 670
coffee intake: a preliminary study for the detection of drugs from fingerprints. Anal 671
Bioanal Chem 405:3945–3952. 672
38. Gassner A-L, Schappler J, Feinberg M, Rudaz S. 2014. Derivation of uncertainty 673
functions from validation studies in biological fluids: Application to the analysis of 674
caffeine and its major metabolites in human plasma samples. J Chromatogr A 675
1353:121–130. 676
39. Chen F, Hu Z-Y, Parker RB, Laizure SC. 2017. Measurement of caffeine and its three 677
primary metabolites in human plasma by HPLC-ESI-MS/MS and clinical application. 678
Biomed Chromatogr 31:e3900. 679
40. Kim KH, Park YH, Park HK, Kim HS, Lee M-H. 1996. Determination of theophylline and 680
its metabolites in human urine by high-performance liquid chromatography. Arch 681
Pharm Res 19:396–399. 682
41. Rasmussen BB, Brøsen K. 1996. Determination of theophylline and its metabolites in 683
human urine and plasma by high-performance liquid chromatography. J Chromatogr B 684
Biomed Sci App 676:169–174. 685
42. Kamberi M, Hajime N, Kamberi P, Uemura N, Nakamura K, Nakano S. 1999. 686
Simultaneous determination of grepafloxacin, ciprofloxacin, and theophylline in 687
human plasma and urine by HPLC. Ther Drug Monit 21:335. 688
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 33 of 41
43. UT Austin iGEM team. Caffeinated coli @SXSW Create. 689
http://2014.igem.org/Team:Austin_Texas. 690
44. Knight T. 2003. Idempotent vector design for standard assembly of biobricks 691
Idempotent Vector Design for Standard Assembly of Biobricks. 692
45. Chi LY, Tai ML, Summers R, Kale Y, Gopishetty S, Subramanian M. 2009. Two distinct 693
pathways for metabolism of theophylline and caffeine are coexpressed in 694
Pseudomonas putida CBB5. J Bacteriol 191:4624–4632. 695
46. Ramli N, Yatim A, Said M, Hok H. 2001. HPLC Determination of methylxanthines and 696
polyphenols levels in cocoa and chocolate products. Malasian J Anal Sci 7:377–386. 697
698
699
700
701
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 34 of 41
702
Figure 1. pDCAF plasmid design. (A) pDCAF3 contained a synthetic operon with ndmA, 703
ndmB, ndmC, ndmD, and gst9 under the control of a single promoter. The three 704
demethylases have been color coded to match the methyl groups they target. Promoters 705
are displayed as right-angle arrows. Ribosome binding sites are shown as half-circles. The 706
pink arrow depicts the site of the IS5 insertion. (B) The redesigned pDCAF-ABC plasmid. 707
(C) Caffeine (1,3,7-trimethylxanthine) as well as other methylxanthines can be fully 708
demethylated to xanthine by three demethylases. The genes required for each methylation 709
event are included: ndmD and gst9, which encode for accessory proteins, ndmA for 710
demethylation of the 1-position (blue), ndmB for the 3-position (red), and ndmC for the 7-711
position (purple). (D) The suite of pDCAF plasmids containing different subsets of the 712
ndmA, ndmB, and ndmC genes. The methylxanthine inside of each plasmid depicts the 713
highest order methylxanthine that the plasmid can demethylate. The color scheme is as in 714
the other panels. Grey lines replace demethylase genes that are absent from a plasmid. 715
716
Figure 2. Standard curves of pDCAF strains grown with their target methylxanthines. (A) 717
The pDCAF strains were each grown in the presence of varying concentrations of their 718
highest-order target methylxanthine, as shown in Figure 1D. The BW25113 strain was 719
grown with xanthine, and the ∆guaB strain was grown with 1,3,7-MX. Each data point 720
represents the average of three cultures. Error bars represent standard deviations. 721
Dashed lines are least-squares fits to data points for concentrations of methylxanthine 722
below 100 µM. They represent standard curves that can be used to estimate MX 723
concentrations from OD600 values. (B) The pDCAF-B, pDCAF-C, and pDCAF-BC strains 724
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 35 of 41
were grown in a mixture of 20 µM 3-MX and 40 µM 7-MX. Their growth on those mixtures 725
was compared to a standard curve determined for each of the strains as in A, represented 726
by the dashed colored lines. The data points indicate the average recorded OD600 values 727
of three different cultures of each strain grown in the methylxanthine mixture. These data 728
points were plotted onto the chart using the recorded OD600 values and the known 729
methylxanthine concentration in the media of 20 µM, 40 µM, or 60 µM. Error bars 730
represent standard deviations, but are mostly too small to be seen. 731
732 733
Figure 3. Growth of guaB pDCAF strains on agar plates supplemented with each of the 734
methylxanthines. (A) Diagram showing the location where each of the pDCAF strains was 735
streaked out on every plate in panel B. BW25113 is the non-auxotrophic parental strain 736
with an intact guaB gene. (B) The pDCAF strains were streaked out onto M9CG agar plates 737
containing the molecule indicated above each plate. See Table 1 for abbreviations. 738
739 740 Figure 4. Growth of pDCAF-BC with methylxanthines. (A) The pDCAF-BC strain was grown 741
in the presence of each of the methylxanthines in varying concentrations. The 1-MX, 1,3-742
MX, and 1,3,7-MX conditions did not support growth. Each data point represents the 743
average of three cultures. Error bars represent standard deviations. (B) The pDCAF-BC 744
strain was grown in media containing 25 µM of 3,7-MX, 1,7-MX, and/or 1,3,7-MX. The x-745
axis denotes the total concentration of methylxanthine present, which can be either 25 µM 746
of a single methylxanthine, depicted as triangles, 50 µM of two methylxanthines, depicted 747
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 36 of 41
as squares, or 75 µM of three methylxanthines, depicted as a circle. Each data point 748
represents the average of three cultures. Error bars represent standard deviation. 749
750
Figure 5. Determining pDCAF-BC demethylase activity on 1,3,7-MX. (A) Media containing 751
3,7-MX and 1,3,7-MX were incubated with the pDCAF-BC strain. This media was then filter 752
sterilized and added to the strains depicted. The final growth of these strains in the filtered 753
media is depicted. Each bar represents the average of three cultures. Error bars represent 754
standard deviations. (B) HPLC traces of media with or without 3,7-MX and 1,3,7-MX. The 755
peaks representing each methylxanthine are clearly identifiable relative to the trace of the 756
media alone at ~4.5 and 10 minutes. (C) HPLC traces of the media containing 757
methylxanthines before and after incubation with the pDCAF-BC strain. The 1,3,7-MX peak 758
at ~10 minutes is still present and unchanged, but the 3,7-MX peak has disappeared. 759
760
Figure 6. Determining methylxanthine content in coffee. Media containing coffee, coffee 761
doped with 1,3-MX, or coffee doped with 1,3,7-MX were incubated with each of the ΔguaB 762
(grey), pDCAF-AB (orange), and pDCAF-ABC (green) strains. These data points are 763
presented along the dashed lines, which represent the standard curves for the pDCAF-AB 764
and pDCAF-ABC strains. While all of the pDCAF-ABC samples: coffee only (▲), coffee doped 765
with 1,3-MX (●), and coffee doped with 1,3,7-MX (◼), had significant growth, for pDCAF-766
AB only the coffee doped with 1,3-MX sample (●) yielded noticeable growth. All other 767
combinations of bacteria and coffee samples, including the ΔguaB data points, which are 768
largely obscured at 0 µM by the pDCAF-AB data points, yielded no significant growth (y-769
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 37 of 41
axis value). X-axis values represent the predicted methylxanthine concentration, based on 770
the standard curve regression, using the observed optical density of each culture. Data 771
points represent the average of three replicates. Error bars represent standard deviations, 772
but are mostly obscured by data points. 773
774
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 38 of 41
775
Table 1. Methylxanthines and pDCAF plasmid specificity 776
777 Methylxanthine (synonyms and abbreviations)
pDCAF plasmid designed to
target compound
pDCAF plasmids capable of full demethylation
(predicted)
pDCAF plasmids capable of full demethylation
(observed)
1-methylxanthine (1-MX)
A A None a
3-methylxanthine (3-MX)
B B, AB, BC, ABC B, AB, BC, ABC
7-methylxanthine (7-MX)
C C, AC, BC, ABC C, AC, BC, ABC
1,3-dimethylxanthine (theophylline, (1,3-MX)
AB AB, ABC AB, ABC
1,7-dimethylxanthine (paraxanthine, 1,7-MX)
AC AC, ABC AC, BC b, ABC
3,7-dimethylxanthine (theobromine, 3,7-MX)
BC BC, ABC BC, ABC
1,3,7-trimethylxanthine (caffeine, 1,3,7-MX)
ABC ABC ABC
778
a Consistent with previous work (27) 779
b Plasmid unexpectedly capable of demethylating this methylxanthine 780
781
782
783
784
785
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 39 of 41
Table 2. Methylxanthine concentrations in coffee or coffee doped with methylxanthine 786 787 788
1,3-dimethylxanthine content (µM)
Coffee Sample Bioassay [95% CI] a HPLC [95% CI] a % Error
Coffee only n.d. b NA n.d. b NA NA
+ 1,3-dimethylxanthine 1879 [1813, 1945] 1971 [1912, 2030] 4.67%
+ 1,3,7-trimethylxanthine n.d. b NA n.d. b NA NA
1,3,7-trimethylxanthine content (µM)
Coffee Sample Bioassay [95% CI] a HPLC [95% CI] a % Error
Coffee only 2041 [1987, 2095] 2183 [2096, 2270] 6.50%
+ 1,3-dimethylxanthine 1943 [1561, 2325] 2054 [2000, 2108] 5.40%
+ 1,3,7-trimethylxanthine 4122 [3947, 4297] 3876 [3858, 3894] 6.35%
789 790 a Confidence intervals and average values reported from three measurements. 791 b n.d. = none detected. Concentration is below the threshold of detection. 792 793 794 795 796 797 798 799 800 801 802 803 804 805
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 40 of 41
Table 3. Step by step calculations for measuring individual methylxanthines with the 806
bioassay 807
ΔguaB strain containing pDCAF plasmid a Compounds b None B C AB AC BC ABC Guanine + Xanthine +1 3-Methylxanthine –1 +1 7-Methylxanthine –1 +1 1,3-Dimethylxanthine –1 –1 +1 1,7-Dimethylxanthine –1 –1 +1 3,7-Dimethylxanthine –1 –1 –1 –1 +1 1,3,7-Trimethylxanthine –1 –1 –1 –1 –1 –1 +1
a Growth of each E. coli strain with the plasmid indicated is compared to a standard curve 808
to determine the total concentration of all compounds it can demethylate in a sample. For 809
each row, a value of +1 indicates the strain that detects this molecule, while –1 indicates a 810
lower-order strain/molecule combination that must be subtracted to determine the 811
concentration the target methylxanthine. As an example, for 1,7-dimethylxathine , you 812
would use the pDCAF-AC strain to first determine the total concentration of all metabolized 813
molecules. Then, you would subtract out the concentrations determined for “guanine + 814
xanthine” (for “None”, ΔguaB without plasmid) and “7-methylxanthine” (for pDCAF-C). The 815
resulting value is the concentration of 1,7-dimethylxanthine. In some cases, it is not 816
necessary to use all of the lower-order strains to measure a certain target compound 817
because lower-order terms cancel each other out if they are substituted into the higher-818
order formula. (see methods for more details). 819
b 1-Methylxanthine has been omitted since its concentration cannot be determined with the 820
bioassay, as described in the text. 821
822
823
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
Page 41 of 41
Table 4. List of primers used to construct the pDCAF plasmids 824
Primer Sequence (5ʹ- 3ʹ) Tm (°C) Reaction(s)
iGEM15-01C GAATTCGCGGCCGCTTCTAGAGAAATCAAATTAAGGAGGTAAGATAAATGGAACAG
64.6 °C Used with iGEM15-02C and iGEM15-26C
iGEM15-02C CCATCTACGTTCCGCAGTCGCATCCCACC 73.1 °C Used with iGEM15-01C
iGEM15-03C GGGATGCGACTGCGGAACGTAGATGGGAAAATT
72.8 °C Used with iGEM15-26C
iGEM15-05C GAATTCGCGGCCGCTTCTAGAGTCACACAGGAAAGTATACTAGATGAAAGAACAGCTCAA
59.2 °C Used with iGEM15-06C and iGEM15-08C
iGEM15-06C TGGCGCGTTCGAACTCATTAAGGGTACACAC 71.7 °C Used with iGEM15-05C
iGEM15-07C TGTGTACCCTTAATGAGTTCGAACGCGCCAAC
71.7 °C Used with iGEM15-23C
iGEM15-09C GAATTCGCGGCCGCTTCTAGAGATTAAAGAGGAGAAATACTAGATGTCTACTGACCAAGT
59.7 °C Used with iGEM15-10C
iGEM15-10C CTGCAGCGGCCGCTACTAGTATTAGTCCCGCAGAGCAC
60.4 °C Used with iGEM15-09C
iGEM15-11C GAATTCGCGGCCGCTTCTAGAGTCACACAGGAAAGTACTAGATGAACAAACTTGACGTC
60.3 °C Used with iGEM15-27C
iGEM15-23C GCATATCTGCAGCGGCCGCTACTAGTATTACTGTTCTTCTTCAATAACATTCG
60.0 °C Used with iGEM15-07C and iGEM15-05C
iGEM15-24C TCAACCATTAGTAAATGCGT 57.3 °C Sequencing Primer
iGEM15-25C TCGAAACTGTATCTGCTGTCG 61.5 °C Sequencing Primer
iGEM15-26C TTTGCCGGACTGCAGCGGCCGCTACTAGTATTATATGTAGCTCCTATCGCTTTCAATGA
63.9 °C Used with iGEM15-03C and iGEM15-01C
iGEM15-27C TTGCCGGACTGCAGCGGCCGCTACTAGTATTATTGACAGGTTTCTTCCGC
60.3 °C Used with iGEM15-11C
iGEM15-34C TATGATTATTGTGCGTGAGAAGGA 61.8 °C Sequencing Primer
iGEM15-35C AACCTGTAGACGAAGATTGG 58.9 °C Sequencing Primer
825
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
A B
DC
N
O N N
O
NH
H
pDCAF-A
N
O N N
O
NH
H
pDCAF-B
N
O N N
O
N
H
H
pDCAF-C
N
O N N
O
NH
pDCAF-AB
N
O N N
O
N
H
pDCAF-AC
N
O N N
O
NH
pDCAF-BC
N
O
H
NH
N
O
NH
Xanthine
pDCAF3
or
pDCAF-ABC
N
O N N
O
N1
6
23
4
5 7
8
9
CH3
H3C
CH3
H3C
CH3
CH3
Caffeine
ndmCndmA
+ ndmD + ndmD
+ gst9
ndmB
+ ndmD
ndmA
ndmB
ndmC
ndmD
Camr
pMB1
gst9
pDCAF-ABC
N
O N N
O
N
ndmA
ndmB
ndmC
ndmD
Camr
pMB1
gst9
pDCAF3
IS5 insertion
in pDCAF3-IS5
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
0
0.2
0.4
0.6
0.8
1
1.2
0 50 100 150 200 250
OD
60
0
Methylxanthine Concentration (µM)
∆guaB
BW25113
pDCAF-A
pDCAF-B
pDCAF-C
pDCAF-AB
pDCAF-AC
pDCAF-BC
pDCAF-ABC
0
0.1
0.2
0.3
0.4
0.5
0.6
0 20 40 60 80 100
OD
60
0
Methylxanthine Concentration (µM)
pDCAF-B
pDCAF-C
pDCAF-BC
A
B on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
pDCAF
B
pDCAF
ABCNo
plasmid(–control)
BW
25113(+control)
pDCAF
A
pDCAF
C
pDCAF
AB
pDCAF
AC
pDCAF
BC
Unsupplemented 1,3,7-MX Xanthine
1-MX 3-MX 7-MX
1,3-MX 1,7-MX 3,7-MX
A B
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1.0
0 50 100 150
OD
60
0
Methylxanthine Concentration (µM)
Xanthine
1-MX
3-MX
7-MX
1,3-MX
1,7-MX
3,7-MX
1,3,7-MX
0.00
0.05
0.10
0.15
0.20
0.25
0.30
0.35
0.40
0.45
0 20 40 60 80
OD
60
0
Methylxanthine Concentration (µM)
None
3,7-MX
1,7-MX
1,3,7-MX
1,7-MX + 3,7-MX
3,7-MX + 1,3,7-MX
1,7-MX + 1,3,7-MX
1,7-MX + 3,7-MX
+ 1,3,7-MX
A
B on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
0
0.05
0.1
0.15
0.2
0.25
0.3
0.35
pDCAF-AB pDCAF-AC pDCAF-ABC
OD
600
0
4500
9500
14500
19500
24500
0 2 4 6 8 10 12
Media only
Media with 1,3,7-MX
Media with 3,7-MX + 1,3,7-MX
0
4500
9500
14500
19500
24500
0 2 4 6 8 10 12
Before pDCAF-BC incubation
After pDCAF-BC incubation
A
C
B3
,7-M
X
1,3
,7-M
X
Minutes
Minutes
1,3
,7-M
X
3,7
-MX
Mill
i A
bso
rba
nce
Un
its (
28
0n
m)
Mill
i A
bso
rba
nce
Un
its (
28
0n
m)
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
0
0.1
0.2
0.3
0.4
0.5
0 10 20 30 40 50 60 70 80
OD
60
0
Methylxanthine Concentration (µM)
guaB
pDCAF-AB
pDCAF-ABC
on April 8, 2021 by guest
http://aem.asm
.org/D
ownloaded from
