15
Brittany Savage December 2, 2008 Dr. Joshua Smith BMS 110-999 SIRT6 Homolog in Tetrahymena thermophila Brittany Savage and Jacob Thompson, Fall 2008 Abstract Mus musculus SIRT6 is a gene that has been studied and found to play a key role in metabolic aging and cell life. In laboratory studies, it has shown a possible role in DNA damage recognition and Base Excision Repair (BER). In Tetrahymena thermophila, this gene is known as THD12. This is a model organism that contains two nuclei, one reserved solely for protein production and genetic expression. This allows easy research of the effects a specific gene. In this study, we are creating many copies of the gene THD12 and inserting them into plasmids for storage and future use by scientists who study and research the effects of THD12/SIRT6. Introduction In this experiment, we are attempting to make many copies of the SIRT6 gene. Copies of this gene will be inserted into a plasmid that will allow us to store millions of copies of the gene for the use of scientific research in Tetrahymena in other laboratories around the world. SIRT6 is a gene that is most commonly found in the species Mus musculus, or the common house mouse. SIRT6 is a member of the Sir2 family of enzymes (Listz & Ford, 2005). This family of enzymes utilizes NAD + to aid in deacetylation of proteins. Protein deacetylation is the removal of the acetyl group from a protein,

Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

  • Upload
    others

  • View
    2

  • Download
    0

Embed Size (px)

Citation preview

Page 1: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

Brittany SavageDecember 2, 2008Dr. Joshua SmithBMS 110-999

SIRT6 Homolog in Tetrahymena thermophilaBrittany Savage and Jacob Thompson, Fall 2008

Abstract

Mus musculus SIRT6 is a gene that has been studied and found to play a key role in metabolic

aging and cell life. In laboratory studies, it has shown a possible role in DNA damage

recognition and Base Excision Repair (BER). In Tetrahymena thermophila, this gene is known

as THD12. This is a model organism that contains two nuclei, one reserved solely for protein

production and genetic expression. This allows easy research of the effects a specific gene. In

this study, we are creating many copies of the gene THD12 and inserting them into plasmids for

storage and future use by scientists who study and research the effects of THD12/SIRT6.

Introduction

In this experiment, we are attempting to make many copies of the SIRT6 gene. Copies of this

gene will be inserted into a plasmid that will allow us to store millions of copies of the gene for

the use of scientific research in Tetrahymena in other laboratories around the world. SIRT6 is a

gene that is most commonly found in the species Mus musculus, or the common house mouse.

SIRT6 is a member of the Sir2 family of enzymes (Listz & Ford, 2005). This family of enzymes

utilizes NAD+ to aid in deacetylation of proteins. Protein deacetylation is the removal of the

acetyl group from a protein, causing a change in structure. It is mainly used for gene regulation

at the cellular level. However, SIRT6, along with SIRT4 and SIRT7 are unable to deacetylate

the acetylated histone H4 peptide (Listz & Ford, 2005). This inability is an indication that they

are either very target specific or that they are active in processes other than deacetylation.

Through experimentation, scientists found SIRT6 to be a nuclear ADP-ribosyltransferase,

meaning that it aids in the transfer of ADP ribose from NAD+ to proteins, stimulates the

elongation of ADP ribose chains, and assists in chain branching. This shows that it is involved in

and helps to regulate again, genomic silencing, metabolism, cell fate, and recombination. On

studies done in SIRT6-deficient mice, they showed the mice are small and develop

abnormalities ranging from lymphopenia, loss of subcutaneous fat, lordokyphosis, and severe

metabolic defects and die by the age of 4 weeks (Mostoslavsky, 2006). By using scientific

Page 2: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

databases, we were able to research and find that this gene is also found in Tetrahymena

thermophila and is known as THD12. Because Tetrahymena has two nuclei (one allocated for

the sole purpose of reproduction and another for protein expression and replication of DNA), it is

a model organism for studying and researching the effects and functions of specific DNA

sequences and strands as well as proteins. Further research on THD12 in Tetrahymena will

further the knowledge in the scientific realm of the purpose of this gene and how it controls the

things that it does. The roles of this protein raise many questions as to how it can be

manipulated to reverse its roles in the cell.

Methods/Procedure

Bioinformatics

Our lab group chose to study and research the gene Mus musculus SIRT6. Using the website

http://www.ncbi.nlm.nih.gov/, we were able to find the amino acid sequence of SIRT6. We then

searched this sequence in the Tetrahymena database, http://www.ciliate.org/ to see if there was

a Tetrahymena homolog for the gene. Also on this scientific database we obtained the protein

sequence of the homolog, as well as the nucleotide sequence. These two sequences were then

compared on the NCBI database to determine how highly aligned the two sequences are. Also,

we used http://www.expasy.ch/prosite to predict the functional domain of the Tetrahymena

gene. <Complete protocol in BMS110 Honors Lab 3: Bioinformatics- Molecular Computational

Tools, Fall 2008> (Smith, 2008).

Tetrahymena Genomic DNA Isolation, Amplification, and Gel Electrophoresis

After obtaining a culture of Tetrahymena, the genomic DNA (gDNA) was isolated from the rest

of the cell. A spectrophotometer was then used to determine the purity of the gDNA by taking

the reading at wavelengths of 260 nanometers (nm) and 280 nm. Then, the DNA was taken

through a polymerase chain reaction (PCR) to amplify the genes we wished to express and

clone. Two primers were required to isolate the THD12 gene: THD12-TF and THD12-TR. These

forward and reverse primers were designed for the 1171 base pair sequence of the SIRT6 gene

to accurately splice and isolate the sequence. Normally, the temperatures required for the

annealing process are between 48˚C and 52˚C; however, the Tm’s required for the THD12

oligonucleotides were 59.4˚C and 63.1˚C respectively. Also, each primer was between 20 and

30 base pairs (bp) in length. The primers for THD12 are as follows:

Page 3: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

THD12-TF

5’- CAC CCT CGA GGA TAC TGC ACA CAA AAC AGA AG-3’

THD12-TR

5’- CCT AGG TCA TAT TTC TTT GCA ACT AAT CC-3’

To prepare the PCR reaction master mix, we used 5.4 microliters (µL) of gDNA, 3.75 µL of 20

micromolar (µm) sense primer (THD12-TF), 3.75 µL of 20 µm antisense primer (THD12-TR), 1.5

µL of Phusion polymerase, 30.0 µL of 10X HF buffer, 3.0 µL of 10 millimolar (mm) dNTPs, and

102.475 µL of water. The thermocycler was set to varying temperatures: 50.0˚C, 52.0˚C, 54.0˚C,

56.2˚C, 58.0˚C, and 60.0˚C. Fifty µL of the master mix was put in each temperature. Finally,

each PCR reaction mix was run through gel electrophoresis to separate, identify, and purify the

DNA. The DNA was mixed with bromphenol blue-purple and xylene cyanol-blue dye and loaded

into the 1.0% agarose gel. The electrophoresis was run for 1 hour and 15 minutes at 90 volts.

The gels also contained ethidium bromide that will cause DNA to fluoresce in ultraviolet light

exposure. To proceed to the cloning exercise, we determined that our PCR product was best

annealed at a temperature of 50.0˚C based on the results of the gel electrophoresis <Complete

protocols in BMS 110 Honors Labs 4, 5, and 6; Fall 2008> (Smith, 2008).

TOPO Cloning and E. Coli Transformation

The PCR-amplified gene was cloned into the pENTR/D-TOPO vector. 0.4 µL of the PCR

product, 1.0 µL of a salt solution (1.2 M NaCl and 0.06 M MgCl2), 3.6 µL of sterile water, and 1.0

µL of TOPO vector were mixed to create a TOPO cloning reaction. This was then added to a

50.0 µL vial of E. coli and heat shocked. SOC Medium was then added and the mixture was

placed in a shaking incubator at 37.0˚C for 1 hour. The mixture was then spread onto a 50.0

µg/mL kanamycin plate and allowed to grow and develop colonies of the gene in the

Tetrahymena plasmid <Complete protocol in BMS 110 Honors Lab 7 and 8; Fall 2008> (Smith,

2008).

Restriction Enzyme Digestion Design

To determine the best restriction enzyme to be used to determine if our bacterial colony

contained our desired PCR product, THD12, we created a plasmid map. This map showed the

specific palindromic sequences in our gene that would be spliced by specific restriction

Page 4: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

enzymes. Based on this map, we determined that the best restriction enzyme would be EcoRI

<Complete protocol in BMS 110 Honors Lab 8: Plasmid Construct Map> (Smith, 2008).

Page 5: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

Plasmid Purification and Restriction Enzyme Digest

To determine that our E. coli colonies actually contained the plasmid that stored our PCR

product we isolated the plasmid for purification from the bacteria. To do this, we had to grow

liquid bacteria culture, harvest and lyse bacteria cells, and purify the plasmid DNA. The day

before the lab, we had to grow the bacteria by moving a colony from our cloning transformation

plate (Lab 8) to a new LB/KAN plate. The remaining material was then placed in a liquid LB/Kan

test tube and allowed to grow overnight in a 37˚C shaking incubator. To purify the plasmid, we

created three 1 mL tubes for each culture for a total of eighteen tubes. We centrifuged each

culture and then added 250 µL of Buffer P1 (resuspend solution) into 1 tube of each culture and

then resuspended that tube and transferred it to the second tube and so on. By the end, it was

down to six test tubes, one for each culture. We then added 250 µL of Buffer P2 (lysis buffer)

and inverted for under 5 minutes until no white precipitate remained and the precipitate was

blue. Next, 350 µL of Buffer N3 (neutralization buffer) was added and then the solution was

centrifuged for 10 minutes. We next used the spin columns to rid the plasmid DNA of waste.

This was done 3 times, with 500 µL of Buffer PB (wash solution) added the second time and

750 µL of Buffer PE (wash solution) added the third time. The DNA was then eluted in a new

column by adding 50 µL of Elution Buffer and stored at -20˚C overnight. To determine the purity,

a mixture of buffer, our restriction enzymes, water, and our plasmid was used and ran through

an agarose gel. Specifically, we used 14 µL of 10X Buffer, 3.5 µL of EcoRI, and 108.5 µL of

water. 18 µL of this mixture was added into seven test tubes and then 2 µL of plasmid was

added to each and mixed. These reactions were then incubated at 37˚C (based on EcoRI

protocol) for one hour. Then, each was mixed with dye and run through an agarose gel along

with 5 µL of 1 Kb ladder. <Complete protocol in BMS 110 Honors Lab 9: Plasmid Purification

and Restriction Enzyme Digest> (Smith, 2008).

Results

Bioinformatics

CACCCTCGAGGATACTGCACACAAAACAGAAGATGAAAAAAAGGAATACTTCGATGCTCCTGATGTTTTAGAATAAAAGGTTACTCTTTTAGCTGAAATGATTAAAACTTCAAAGCACTTTGTAGCTTTCACAGGAGCAGGAATTTCTACTTCTACAGGAATTCCTGATTTTAGAAGTGGAATTAACACTGTTCTTCCTACTGGACCAGGAGCTTGGGAGAAATTAGCCTAAAAAGTTGATAATAAGCATAAAAATATCAAGACTAGCATGTTGAAAGCTATTCCTTCACCCACACATATGGCTTTGGTTTAGTTACAAAAAATAGGTTATTTGAAATTCCTTATTAGCTAAAATGTAGACGGATTGCACAGAAGAAGTGG

Page 6: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

TTTCTCACCCTAACACTTAGCTGAATTGCATGGCAATACAAATCTTGAAAAATGTAAAAAATGTGGCAAAGAATACTTGAGAGATTTTAGAGTTAGAAATGCATAGAAAGTTCATGATCACAAAACAGGTAGAAAGTGCAGCGATTAAAAATGCAAAGGAGATCTTTATGACTCTATTATAAATTTTGGTGAAAATTTACCTGAAAAAGATTTAAATGAAGGATTTGCTTAATCAAAAAAATCTGATTTGCATTTGGTTTTAGGAAGTAGTTTAAGAGTAACACCTGCTGCAGACATGCCTGCCACCACTGCAGAAAAAGGTCAAAAATTAGTTATAATAAACTTGCAAAAAACTCCTTTAGACTCAGTAGCTACTCTCAGAATAAATGCTATGTGTGATGATGTTATGAAAATGGTTATGAAAAAACTTGGATTAGATATACCAGAATTCACTCTTGAAAGAAGAGTTGTCTTAGAAAAAACAGGTATGAATGCCTTAACAGTTTCAAGCTAAGACTCGGACGATTCCCCCTATGATTTGTTTAAATAAATTAAAGTAGATTACGGCAAAATACATCCTGAATAAACTTTACTTAAGGCTCCATTCAATATCATACCAAAAAATAAAACATTCTCTCTAAATTTAAGCTTTTATGGACACTATGGCGAGCAAGATTTTAACTTAAATATCGATATGGCTGCTCTCTCCATTAATAAAAAAGTGAAATATTTAATACAATATTCACCAAAAGAATAAAAATGGATTAGTTGCAAAGAAATATGACCTAGG

Figure 1: DNA sequence of Mus musculus SIRT6 gene. 1171 bp in length, the genomic sequence is slightly short for this gene considering all of its function. In this sequence, the red is the coding sequence and does not contain any black sequence except for what is at the end, which are restriction sites added to primers.

TGD Gene Number E-ValueTTHERM_01018450 2.9e-49

TTHERM_01018420 6.3e-45

TTHERM_00313730 2.0e-48

Table 1: This table contains the top three hits for the Tetrahymena homolog against the Mus musculus SIRT6 gene. The e-value is the comparison of how likely the two are to be similar. The smaller the e-value, the greater chance there is that the two are homologous genes.

TGD Gene Number Protein Homolog Type E-value

TTHERM_01018450 IPI (Human) 3.0e-49

TTHERM_01018450 SGD 1.0e-07

TTHERM_01018420 IPI (Human) 9.0e-44

TTHERM_01018420 SGD 6.0e-08

TTHERM_00313730 IPI (Human) 1.0e-53

TTHERM_00313730 SGD 4.0e-09

Table 2: This table shows the protein homologs for both IPI and SGD when compared with each Tetrahymena gene. It also shows the e-value, or likelihood of similarity, for each.

MDTAHKTEDEKKEYFDAPDVLEQKVTLLAEMIKTSKHFVAFTGAGISTSTSTGIPDFRSGINTVLPTGPGAWEKLAQKVDNKHKNIKTSMLKAIPSPTHMALVQLQKIGYLKFLISQNVDGLHRRSGFSPQHLAELHGNTNLEKCKKCGKEYLRDFRVRNAQKVHDHKTGRKCSDQKCKGDLYDSIINFGENLPEKDLNEGFAQSKKSDLHLVLGSSLRVTPAADMPATTAEKGQKLVIINLQKTPLDSVATLRINAMCDDVMKMVMKKLGLDIPEFTLERRVVLEKTGMNALTVSSQDSDDSPYDLFKQIKVDYGKIHPEQTLLKAPFNIIPKNKTFSLNLSFYGHYGEQDFNLNIDMAALSINKKVKYLIQYSPKEQKWISCKEI

Page 7: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

Figure 2: This is the amino acid sequence of THD12, the homolog of Mus SIRT6. The amino acid sequence of a gene codes for the gene’s protein sequence which is what is expressed in genomics.

Figure 4: This is a figure of the Blast information that we retrieved when we used the Blast 2 Sequence on the NCBI website. In this Blast, we used our original protein sequence from yeast SIRT6 as Sequence 1 and the sequence of the TGD predicted protein homolog (TTHERM_01018450). The score was 205 bits, with the expect being 8e-51.

Tetrahymena Genomic DNA Isolation, Amplification, and Gel Electrophoresis

Quantification of Genomic DNA by SpectrophotometerWavelength ReadingA260 1.439A280 0.693

Ratio: 2.076

Table 3: This is the reading taken by the spectrophotometer. The spectrophotometer tells the amount of DNA in the solution. The absorbance reading at 260 nm (A260) calculates the concentration of nucleic acid. The ratio of the A260 and A280 readings estimates the nucleic acid purity.

Page 8: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

A B C D E F G

9.0 Kb> <8.0 Kb5.0 Kb>

<4.0 Kb3.0 Kb>

<2.0 Kb

1.0 Kb>

7.0 Kb><—-10.0 Kb

<6.0 Kb

Figure 5: Gel Electrophoresis of THD12 PCR products. The bands in Well A are from the 1 Kb ladder used for base pair readings. Well B contained vial 1-1 at 50.0˚C of PCR mixture, C had 1-2 at 52.0˚C, D had 1-3 at 54.0˚C, E had 2-1 at 56.2˚C, F had 2-2 at 58.0˚C, and G had 2-3 at 60.0˚C.

Restriction Enzyme Digestion Design

Page 9: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

Figure 6: This is a picture of our plasmid map. This map is used to visually represent the plasmid that our gene was inserted into. The green portion represents our genomic sequence.

Figure 7: This is the mock gel created using the genetic program. If we used the EcoR1 restriction enzyme and ran our samples through a gel, the results should be very similar to this in size.

Page 10: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

Plasmid Purification and Restriction Enzyme Digest

Figure 8: This is the gel from our Restriction Enzyme Digest. Based on this gel, we were able to determine that the DNA that was run in Wells 3 and 7 are in fact THD12 and the experiment was successful. The bands were in the accurate spots as was represented and idealized using the mock gel created in the Plasmid Map construction lab.

Figure 1 is the result of the bioinformatics lab. It contains the genomic sequence of Mus

musculus SIRT6 gene. Since we need the Tetrahymena homolog for SIRT6, we used the

Tetrahymena database, www.ciliate.org, to search for the homolog. Table 1 displays the top

three genomic hits for the Mus gene in Tetrahymena. TTHERM_01018450, also knows as

THD12, has the lowest e-value, meaning it is more likely to be similar to SIRT6 than the others.

From this information, we obtained the amino acid sequence of THD12. Figure 4 displays a

photographic review of the information, visually representing the comparison of yeast SIRT6 to

the TGD predicted homolog (THD12). Once all of the bioinformatics were obtained, we used this

information to decide what primers to use to amplify out the THD12 gene from the Tetrahymena

genomic DNA (gDNA). Table 3 displays the readings from the spectrophotometer, which reveals

the purity of the gDNA before we begin to extract the THD12. The ratio 2.016 shows that the

DNA was very pure. After taking the gDNA through PCR reactions in order to copy THD12, we

used gel electrophoresis to determine if the gene was successfully amplified. This gel showed

668

3079

Page 11: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

that we obtained a high yield; but we also had a small band of a foreign substance, possibly a

contaminant or an extra piece of DNA that was inadvertently replicated. Table 5 shows what vial

of our PCR product was placed into each well of the gel. Based on this gel, we determined that

it would be best to continue our experiment with Vial 1-1 because it showed a lower amount of

the extra band than did the other samples. After choosing which sample to use, we then

inserted this DNA into a TOPO/pENTR cloning vector in which it would be stored. This was then

visually created using a genetic program and is seen in Figure 6. From this, we were able to

determine that the best restriction enzyme to use for our digest would be EcoR1 because it is

located in two places on our genomic sequence. Figure 7 contains an ideal representation of

what our gel should look like if we used EcoR1 to splice the DNA sequence out and ran it

through a gel. From there, we used EcoR1 to excise the genomic sequence and then ran our

different samples through another gel electrophoresis, as seen in Figure 8. This gel shows that

THD12 was successfully cloned in Wells 2 and 6 because there are bands located at the right

length in base pairs.

Discussion

So far, the project has gone very well as far as results. We had very pure DNA, as well as a lot

of it. We did make one major mistake along the way that we know of. In the PCR reaction

mixture, instead of adding 102 µL of water, we accidentally set the micropipette to 120 µL.

However, this did not impede or ruin our results. Also, as seen in Figure 5, there is an extra

band of substance beneath the bands of DNA. This foreign substance is not a “primer dimer,”

but it is something that should not be there. There is a possibility that it is a sequence of the

gDNA that inadvertently was cloned and was able to withstand the annealing process. Or, it is

possibly a foreign contaminant like sweat or spit that happened to be the right sequence to be

cloned and annealed from another organism. Between all of the pipetting and mixing we have

done, a foreign substance might have accidentally been transferred without our knowledge. Our

experiment proved to be successful in the end when our results showed that we had correctly

extracted and cloned the SIRT6 Tetrahymena homolog THD12.

From here, scientists and researchers around the world have the opportunity to use our THD12

clone in their research. The gene can now be used to research the effects it has on aging and

DNA repair at the cellular level.

Page 12: Bibliography - Claremont Collegesfaculty.jsd.claremont.edu/ewiley/files/r28n2.docx  · Web viewIntroduction. In this experiment, we are attempting to make many copies of the SIRT6

BibliographyListz, G., & Ford, E. (2005). Mouse Sir2 Homolog SIRT6 Is a Nuclear ADP-ribosyltransferase. The Journal of Biological Chemistry , 21313-21320.

Mostoslavsky, R. (2006). Genomic Instability and Aging-like Phenotype in the Absence of Mammalian SIRT6. Cell 124 , 315-329.

Rodgers, J. T., & Puigserver, P. (2006). Certainly can't live without this: SIRT6. Cell Metabolism , 77-78.

Smith, J. J. (2008). BMS 110-999: Lab Protocol. Springfield.