Bell Work- Monday March 30Bell Work- Monday March 30

What would be most likely to happen if the What would be most likely to happen if the ribosomes in a cell were not functioning? ribosomes in a cell were not functioning?

1. the cell would undergo uncontrolled mitotic cell 1. the cell would undergo uncontrolled mitotic cell divisiondivision

2. the synthesis of enzymes would stop2. the synthesis of enzymes would stop 3. the cell would produce antibodies3. the cell would produce antibodies 4. the rate of glucose transport in the cytoplasm 4. the rate of glucose transport in the cytoplasm

would increasewould increase

Constructing DNAConstructing DNA

Finish coloring and cutting your DNA moleculesFinish coloring and cutting your DNA molecules

Tape the DNA together to make a double ladderTape the DNA together to make a double ladder

When done bring your DNA up frontWhen done bring your DNA up front

Read and outline 286-289 in a foldableRead and outline 286-289 in a foldable

If you unraveled all your chromosomes from all of your If you unraveled all your chromosomes from all of your cells and laid out the DNA end to end, the strands cells and laid out the DNA end to end, the strands

would stretch from the would stretch from the Earth to the Moon about Earth to the Moon about 6,000 times6,000 times..

Chromosomes found in the nucleus carry Chromosomes found in the nucleus carry the the hereditary materialhereditary material -- DNA -- DNA

Basically, DNA tells your body how to grow! Basically, DNA tells your body how to grow!

History of the MoleculeHistory of the Molecule

James Watson and Francis CrickJames Watson and Francis Crick won the won the Nobel Prize by determining the structure of Nobel Prize by determining the structure of the DNA molecule (early 1950's) with X-Ray the DNA molecule (early 1950's) with X-Ray images provided by images provided by Rosalind FranklinRosalind Franklin

determined the structure of the DNA molecule determined the structure of the DNA molecule - figured out that DNA looks like - figured out that DNA looks like two threads two threads twisted around each othertwisted around each other, held together by , held together by many many bridgesbridges between the strands between the strands

** Consists of two chains of nucleotide units in ** Consists of two chains of nucleotide units in a twisted a twisted ladder-like structureladder-like structure. (spiral staircase) . (spiral staircase)

Made up of NucleotidesMade up of Nucleotides

A Better Look at A Better Look at the Structural the Structural

Sub-UnitsSub-Units

DNA nucleotidesDNA nucleotides

Phosphate group

Pentose sugar

Nitrogenous base

Sugar phosphate backbone

Nucleotide

Polynucleotide chain

4 different bases4 different bases

CG

AT

--The Nitrogenous Bases are; --The Nitrogenous Bases are; adenineadenine (A) (A) thyminethymine (T) (T) guanineguanine (G) (G) cytosinecytosine (C) (C)

[Give Candy To All][Give Candy To All]

-- Only 2 combinations of base pairs can form -- Only 2 combinations of base pairs can form the rungs of the DNA molecule. the rungs of the DNA molecule.

Adenine - Thymine (A-T)Adenine - Thymine (A-T) AND AND

Guanine – Cytosine (G-C)Guanine – Cytosine (G-C)

--This specific matching up of the nitrogenous --This specific matching up of the nitrogenous bases is called bases is called complementary basecomplementary base pairing. pairing.

Okay… show the resulting base pairings below!Okay… show the resulting base pairings below!

ATGCCTACGTTAGATTACAACCTAAGCAATATGCCTACGTTAGATTACAACCTAAGCAATTACGGATGCAATCTAATGTTGGATTCGTTATACGGATGCAATCTAATGTTGGATTCGTTA

ReflectionReflection

Write a 3 sentence summary on the structure of DNA. Write a 3 sentence summary on the structure of DNA. Pretend that this person has never heard of DNA what Pretend that this person has never heard of DNA what information would you need to give?information would you need to give?

Write 3 questions that can be answered by your notesWrite 3 questions that can be answered by your notes

Share the best question with a partnerShare the best question with a partner Homework- page 294 2-4Homework- page 294 2-4

Bell Work Tuesday March 31Bell Work Tuesday March 31

Base pairing is an important part of the DNA Base pairing is an important part of the DNA replication processreplication process A. State what is meant by the term base pairing.A. State what is meant by the term base pairing. B. Give examples of base pairingB. Give examples of base pairing

DNA is able to replicate itself DNA is able to replicate itself

1. The double stranded DNA molecule 1. The double stranded DNA molecule unwinds unwinds and unzipsand unzips between the weak hydrogen bonds between the weak hydrogen bonds between the nitrogenous base pairs. between the nitrogenous base pairs.

2. Free nucleotides present in the nucleus attach 2. Free nucleotides present in the nucleus attach themselves by themselves by forming new hydrogen bondsforming new hydrogen bonds with with the exposed bases in the single chain. the exposed bases in the single chain.

Polymerase joins the DNA togetherPolymerase joins the DNA together

RNA (ribonucleic acid RNA (ribonucleic acid

--RNA is also a polymer formed by a sequence of --RNA is also a polymer formed by a sequence of nucleotides nucleotides

HOW DOES IT DIFFER FROM DNA?HOW DOES IT DIFFER FROM DNA?1. The RNA molecule is a 1. The RNA molecule is a SINGLESINGLE nucleotide strand, nucleotide strand,

not a double strand as in DNA. not a double strand as in DNA. 2. The sugar molecule in RNA is 2. The sugar molecule in RNA is RIBOSERIBOSE -- not -- not

deoxyribose as in DNA. deoxyribose as in DNA. 3. The base 3. The base URACILURACIL (U) takes the place of thymine. (T) (U) takes the place of thymine. (T)

Synthesis of RNA Synthesis of RNA

-- The various types of RNA are made from -- The various types of RNA are made from the template (pattern) of the DNA molecule. the template (pattern) of the DNA molecule.

A. Types of RNAA. Types of RNA1. mRNA (messenger RNA) made in nucleus 1. mRNA (messenger RNA) made in nucleus 2. tRNA (transfer RNA) on the ribosomes 2. tRNA (transfer RNA) on the ribosomes 3. rRNA (ribosomal RNA) in the cytoplasm 3. rRNA (ribosomal RNA) in the cytoplasm

How are proteins synthesized from a DNA How are proteins synthesized from a DNA template? (model) template? (model)

1. DNA serves as a template for the synthesis of 1. DNA serves as a template for the synthesis of mRNAmRNA

transcriptiontranscription: transfer of the genetic message : transfer of the genetic message from DNA to mRNA from DNA to mRNA

2. mRNA molecules carrying a specific code 2. mRNA molecules carrying a specific code determined by the base sequence of the determined by the base sequence of the DNA template move from the nucleus to the DNA template move from the nucleus to the cytoplasm. cytoplasm.

3. Strands of mRNA carrying 3. Strands of mRNA carrying codonscodons transcribed transcribed from DNA, move to the ribosomes in the from DNA, move to the ribosomes in the cytoplasm. cytoplasm.

codoncodon: a triplet in a DNA molecule : a triplet in a DNA molecule Ex. UUU= Phenylaline, Ex. UUU= Phenylaline,

AAU=LeucineAAU=Leucine

4. mRNA strands become associated with rRNA 4. mRNA strands become associated with rRNA on the ribosomes. on the ribosomes.

(rRNA arranges “date” between (rRNA arranges “date” between mRNA and tRNA) mRNA and tRNA)

6. Amino acids are put into position on the 6. Amino acids are put into position on the ribosome with instructions from the triplet ribosome with instructions from the triplet codes of tRNA and mRNA. codes of tRNA and mRNA.

7. With the aid of enzymes and ATP (energy), 7. With the aid of enzymes and ATP (energy), the amino acids are bonded to form a the amino acids are bonded to form a polypeptide chain (protein)polypeptide chain (protein) on the ribosome on the ribosome

Basically, RNA translates the DNA information!Basically, RNA translates the DNA information!

An overview of the entire protein An overview of the entire protein synthesis (transcription and translation) synthesis (transcription and translation)

process:process:

** ** One gene codes for one One gene codes for one polypeptide chainpolypeptide chain

gene = the sequence of nucleotides in a DNA gene = the sequence of nucleotides in a DNA molecule necessary to synthesize a molecule necessary to synthesize a

polypeptide polypeptide

Offspring resemble their parents because they Offspring resemble their parents because they inherit similar genes that code for the production of inherit similar genes that code for the production of proteins that form similar structures and perform proteins that form similar structures and perform similar functionssimilar functions. .

Gene Mutations Gene Mutations

Gene Mutation- When a Gene Mutation- When a change in nucleotide change in nucleotide sequencesequence occurs in the DNA (this changes occurs in the DNA (this changes the codes to build proteins)the codes to build proteins)

Point mutation: This is a single change in one nucleotide: an A might change to a C, for example, or a C to a G. Sometimes a single nucleotide

change will not have any effect. Other times, it can change the type of amino acid that is added to the protein, or it can lead to a shortened

(truncated) protein. (This is like not cooking your recipe as long as the instructions tell you to.) Sickle cell anemia is an example of a disease

caused by point mutations.

Sickle cell anemia is a painful disease caused by Sickle cell anemia is a painful disease caused by red blood cells that become malformed into bent red blood cells that become malformed into bent and distorted shapes. These "sickled" cells don't and distorted shapes. These "sickled" cells don't have the ability to flex like the normal cells as they have the ability to flex like the normal cells as they travel through the capillaries. travel through the capillaries.

Silent Mutations - Most amino acids are Silent Mutations - Most amino acids are encoded by several different encoded by several different codonscodons. For . For example, if the third base in the example, if the third base in the TCTTCT codon codon for for serineserine is changed to any one of the other is changed to any one of the other three bases, serine will still be encoded. three bases, serine will still be encoded.

Such mutations are said to be silent because Such mutations are said to be silent because they cause they cause no changeno change in their product and in their product and cannot be detected without sequencing the cannot be detected without sequencing the gene (or its mRNA).gene (or its mRNA).

Insertions and Deletions:Insertions and Deletions: Extra base pairs may be Extra base pairs may be added (added (insertionsinsertions) or removed () or removed (deletionsdeletions) from the ) from the DNA of a gene. The number can range from one to DNA of a gene. The number can range from one to thousands. thousands.

. .

A number of inherited human disorders are A number of inherited human disorders are caused by the insertion of many copies of the caused by the insertion of many copies of the same triplet of nucleotides. same triplet of nucleotides. Huntington's Huntington's diseasedisease and the and the fragile X syndromefragile X syndrome are are examples of such examples of such trinucleotide repeattrinucleotide repeat diseases. diseases.

Huntington’s Disease- An incurable form of Huntington’s Disease- An incurable form of insanity that does not show up until the age of insanity that does not show up until the age of 35-40. This disease is rather unique because 35-40. This disease is rather unique because it is it is dominantdominant!!!!

Genetic Research Genetic Research

A. A. CloningCloning: producing a group of genetically : producing a group of genetically identical offspring from the cells of an identical offspring from the cells of an organism organism

** This technique shows great promise in ** This technique shows great promise in agriculture. Plants with desirable qualities can agriculture. Plants with desirable qualities can be rapidly produced from the cells of a single be rapidly produced from the cells of a single plant. plant. What are the drawbacks???What are the drawbacks???

In 1996 Wilmut et al used a similar method to clone the first mammal, Dolly. Since then many different species of mammal have been cloned, and their is serious debate about the cloning of humans.

Genetic engineering: (recombinant DNA) Genetic engineering: (recombinant DNA)

-- transfer of genetic information from one -- transfer of genetic information from one organism to another organism to another

-- includes the transfer of entire genes and -- includes the transfer of entire genes and gene splicing gene splicing

** A cell can synthesize a new chemical ** A cell can synthesize a new chemical coded for by its new gene(s) coded for by its new gene(s)

-- examples include interferon, insulin, and -- examples include interferon, insulin, and growth hormone. growth hormone.

Genetic engineering can correct genetic defects Genetic engineering can correct genetic defects & produce agriculturally more efficient plants & produce agriculturally more efficient plants and animals. and animals.

restriction enzymes -- used to cut segments of restriction enzymes -- used to cut segments of DNA in one organism so they can be DNA in one organism so they can be transferred into another organism transferred into another organism

1. Characteristics produced by the segments of 1. Characteristics produced by the segments of DNA may be expressed when these segments are DNA may be expressed when these segments are inserted into new organisms such as bacteria. inserted into new organisms such as bacteria.

2. Inserting, deleting, or altering DNA segments can 2. Inserting, deleting, or altering DNA segments can alter genes. An altered gene may be passed on to alter genes. An altered gene may be passed on to every cell that develops from it. (every cell that develops from it. (GENE SPLICINGGENE SPLICING - When DNA from two different species are joined - When DNA from two different species are joined together. This type of genetic engineering provides together. This type of genetic engineering provides a way to produce rare substances)a way to produce rare substances)

human genome project human genome project

has allowed humans to know the basic has allowed humans to know the basic framework of their genetic code framework of their genetic code

1. Knowledge of genetics is making possible new 1. Knowledge of genetics is making possible new fields of health care. Genetic mapping is making fields of health care. Genetic mapping is making it possible to detect and possibly correct, it possible to detect and possibly correct, defective genes that may lead to poor health. defective genes that may lead to poor health.

A down side to this is that health insurance A down side to this is that health insurance agencies and other organizations may use agencies and other organizations may use this genetic information against individuals. this genetic information against individuals.

Substances from genetically engineered Substances from genetically engineered organisms may reduce the cost and side organisms may reduce the cost and side effects of replacing body chemicals. Human effects of replacing body chemicals. Human insulin produced in bacteria is already an insulin produced in bacteria is already an example of this. example of this.

MendelMendel Modern genetics had its beginnings in an abbey Modern genetics had its beginnings in an abbey

garden, where a monk named Gregor Mendel garden, where a monk named Gregor Mendel documented a mechanism of particulate documented a mechanism of particulate inheritance.inheritance.

He discovered the basic principles of heredity by He discovered the basic principles of heredity by breeding garden peas in carefully planned breeding garden peas in carefully planned experiments.experiments.

He had NO KNOWLEDGE of He had NO KNOWLEDGE of genes or genes or chromosomes!chromosomes!

allelesalleles: different forms of a gene associated with a : different forms of a gene associated with a particular characteristic (ex. Height: tall/short) particular characteristic (ex. Height: tall/short)

chromosomeschromosomes: hereditary units of an organism : hereditary units of an organism homologous chromosomeshomologous chromosomes: pair of associated : pair of associated

chromosomes chromosomes ** Alleles are located in the same position or locus ** Alleles are located in the same position or locus

on homologous chromosomes on homologous chromosomes

What did Mendel do?What did Mendel do?

Mendel studied what happened when you bred Mendel studied what happened when you bred organisms togetherorganisms together

Thought he would study something that grew quick Thought he would study something that grew quick and was easy to grow and controland was easy to grow and control

PEAS!PEAS!

WooHoo for Peas!

It is SO MUCH FUN watching pea plants grow for generation after generation. I’m a PROUD great-

great-great-great grandpa!

Genetic crossesGenetic crosses He physically fertilized the He physically fertilized the

pollen of one colored pea pollen of one colored pea plant with another colored plant with another colored pea plantpea plant

Tracking heritable Tracking heritable characteristicscharacteristics Mendel noticed that the first Mendel noticed that the first

set of offspring were all set of offspring were all purplepurple

Mendel stated that the Mendel stated that the purple was more powerful purple was more powerful or dominant trait. or dominant trait.

When he bred the offspring When he bred the offspring or the F1 75% were purple or the F1 75% were purple and 25% were white or and 25% were white or recessiverecessive

True-Breeding Parent generation

F1 generation – ALL purple

F2 generation

– 705 purple

F2 generation – 224 white

X

First Generation Crossing yields ONLY Purple flowers

Second generation crosses yield a 3:1 ratio of Purple to White flowers

The The Law of DominanceLaw of Dominance states that for states that for contrasting traits only the dominant trait can contrasting traits only the dominant trait can be seen.be seen.

Codominance Codominance

a case of contrasting alleles in which a case of contrasting alleles in which neither alleleneither allele isis dominantdominant over the other (alleles have equal over the other (alleles have equal power) power)

Both alleles can be expressed Both alleles can be expressed For example, red cows crossed with white will For example, red cows crossed with white will

generate roan cows. Roan refers to cows that have generate roan cows. Roan refers to cows that have red coats with white blotches. red coats with white blotches.

Blood TypeBlood Type Phenotype GenotypePhenotype GenotypeA (homozygous)A (homozygous) Type A bloodType A blood IAIAIAIAA (heterozygous)A (heterozygous) Type A bloodType A blood IAiIAiB (homozygous)B (homozygous) Type B bloodType B blood IBIBIBIBB (heterozygous)B (heterozygous) Type B bloodType B blood IBiIBiAB (A&B heterozygous)AB (A&B heterozygous) Type AB bloodType AB blood IAIBIAIBO (homozygous)O (homozygous) Type O bloodType O blood iiii

Mendel’s impactMendel’s impact

Mendel’s theories of inheritance, first discovered in Mendel’s theories of inheritance, first discovered in garden peas, are equally valid for figs, flies, fish, garden peas, are equally valid for figs, flies, fish, birds and human beings.birds and human beings.

Mendel’s impact endures, not only on genetics, but Mendel’s impact endures, not only on genetics, but on all of science, as a case study of the power of on all of science, as a case study of the power of hypothesis/deductive thinking.hypothesis/deductive thinking.

The laws of probability The laws of probability

In tossing a coin there is a In tossing a coin there is a 50%50% percent chance that percent chance that a head will turn up. a head will turn up.

However, it is quite possible for you to toss a coin However, it is quite possible for you to toss a coin 10 times and obtain 8 heads and 2 tails. The law of 10 times and obtain 8 heads and 2 tails. The law of probability is based on probability is based on sample size & number of sample size & number of trialstrials..

Lab 18-Genetic VariationLab 18-Genetic Variation

S- What will the offspring look like if we cross two S- What will the offspring look like if we cross two organisms? Will everyone’s look the same?organisms? Will everyone’s look the same?

P-P- I- I-

Materials: Genetic code, mom, dad, marshmallows, Materials: Genetic code, mom, dad, marshmallows, toothpicks, pipe cleaners, push pinstoothpicks, pipe cleaners, push pins

Procedures- directions and conversions on the tableProcedures- directions and conversions on the table

C- Collect dataC- Collect data

TraitTrait GenotypeGenotype PhenotypePhenotypeAntennaAntennaNoseNoseEyesEyesBody segmentsBody segmentsHumpsHumpsTailTaillegslegs Draw a picture of your baby Draw a picture of your baby

EvaluateEvaluate

Could you predict what your baby would look like?Could you predict what your baby would look like? Did everyone’s look the same?Did everyone’s look the same? Why or why not?Why or why not?