Behavioral and Other Phenotypes in a Cytoplasmic Dynein Light …sro.sussex.ac.uk/id/eprint/19590/1/5483.full.pdf · 2019. 7. 2. · Please see supplemental material (available at

Behavioral and Other Phenotypes in a Cytoplasmic Dynein Light Intermediate Chain 1 Mutant Mouse

Article (Published Version)

http://sro.sussex.ac.uk

Banks, Gareth T, Haas, Matilda A, Line, Samantha, Shepherd, Hazel L, Al Qatari, Mona, Stewart, Sammy, Rishal, Ida, Philpott, Amelia, Kalmar, Bernadett, Kuta, Anna, Groves, Michael, Parkinson, Nicholas, Acevedo-Arozena, Abraham, Brandner, Sebastian, Banerman, David et al. (2001) Behavioral and Other Phenotypes in a Cytoplasmic Dynein Light Intermediate Chain 1 Mutant Mouse. Journal of Neuroscience, 31 (14). pp. 5483-5494. ISSN 0270-6474

This version is available from Sussex Research Online: http://sro.sussex.ac.uk/id/eprint/19590/

This document is made available in accordance with publisher policies and may differ from the published version or from the version of record. If you wish to cite this item you are advised to consult the publisher’s version. Please see the URL above for details on accessing the published version.

Copyright and reuse: Sussex Research Online is a digital repository of the research output of the University.

Copyright and all moral rights to the version of the paper presented here belong to the individual author(s) and/or other copyright owners. To the extent reasonable and practicable, the material made available in SRO has been checked for eligibility before being made available.

Copies of full text items generally can be reproduced, displayed or performed and given to third parties in any format or medium for personal research or study, educational, or not-for-profit purposes without prior permission or charge, provided that the authors, title and full bibliographic details are credited, a hyperlink and/or URL is given for the original metadata page and the content is not changed in any way.

http://sro.sussex.ac.uk/

Cellular/Molecular

Behavioral and Other Phenotypes in a Cytoplasmic DyneinLight Intermediate Chain 1 Mutant Mouse

Gareth T. Banks,1* Matilda A. Haas,5* Samantha Line,6 Hazel L. Shepherd,6 Mona AlQatari,7 Sammy Stewart,7

Ida Rishal,8 Amelia Philpott,9 Bernadett Kalmar,2 Anna Kuta,1 Michael Groves,3 Nicholas Parkinson,1

Abraham Acevedo-Arozena,10 Sebastian Brandner,3,4 David Bannerman,6 Linda Greensmith,2,4 Majid Hafezparast,9

Martin Koltzenburg,2,4,7 Robert Deacon,6 Mike Fainzilber,8 and Elizabeth M. C. Fisher1,4

1Department of Neurodegenerative Disease, 2Sobell Department of Motor Science and Movement Disorders, 3Division of Neuropathology, and 4MedicalResearch Council (MRC) Centre for Neuromuscular Diseases, University College London (UCL) Institute of Neurology, London WC1N 3BG, UnitedKingdom, 5MRC National Institute for Medical Research, London NW7 1AA, United Kingdom, 6Department of Experimental Psychology, University ofOxford, Oxford OX1 3UD, United Kingdom, 7UCL Institute of Child Health, London WC1N 1EH, United Kingdom, 8Department of Biological Chemistry,Weizmann Institute of Science, 76100 Rehovot, Israel, 9School of Life Sciences, University of Sussex, Brighton BN1 9QG, United Kingdom, and 10MRCMammalian Genetics Unit, Harwell OX11 ORD, United Kingdom

The cytoplasmic dynein complex is fundamentally important to all eukaryotic cells for transporting a variety of essential cargoes alongmicrotubules within the cell. This complex also plays more specialized roles in neurons. The complex consists of 11 types of protein thatinteract with each other and with external adaptors, regulators and cargoes. Despite the importance of the cytoplasmic dynein complex,we know comparatively little of the roles of each component protein, and in mammals few mutants exist that allow us to explore the effectsof defects in dynein-controlled processes in the context of the whole organism. Here we have taken a genotype-driven approach in mouse(Mus musculus) to analyze the role of one subunit, the dynein light intermediate chain 1 (Dync1li1). We find that, surprisingly, an N235Ypoint mutation in this protein results in altered neuronal development, as shown from in vivo studies in the developing cortex, andanalyses of electrophysiological function. Moreover, mutant mice display increased anxiety, thus linking dynein functions to a behavioralphenotype in mammals for the first time. These results demonstrate the important role that dynein-controlled processes play in thecorrect development and function of the mammalian nervous system.

IntroductionIn mammals cytoplasmic dynein 1 is a large complex of proteinswhose constituent members are defined by their molecularweights: the heavy chain (encoded by a single gene Dync1h1); theintermediate chains (Dync1i1, Dync1i2); the light-intermediatechains (Dync1li1, Dync1li2); the light chains (Dynlt1, Dynlt3,Dynlrb1, Dynlrb2, Dynll1, Dynll2) (Pfister et al., 2005, 2006; Hookand Vallee, 2006; Levy and Holzbaur, 2006). The stoichiometry ofthe intact complex is not known exactly, but at its core lies ahomodimer of heavy chains, which binds to microtubules en-abling cytoplasmic dynein to move in an ATP-dependent man-

ner (Gennerich et al., 2007). The other subunits are thought tomaintain the stability of the complex, to modulate its activity, andto interact with accessory and cargo proteins. However, while ithas been established that the individual dynein subunits can havecomplex cell-specific splicing patterns (Pfister et al., 1996a,b;Salata et al., 2001; Ha et al., 2008; Kuta et al., 2010), we knowcomparatively little regarding the specific functions of the sepa-rate subunits.

One way to study dynein function is to investigate individualgenes/protein mutations, however, in mammals the only DYNC1(cytoplasmic dynein) mutations so far described are four allelesof mouse Dync1h1, one of which is a knock-out (Harada et al.,1998; Hafezparast et al., 2003; Chen et al., 2007). The point mu-tants (all detected in phenotype-driven screens) give highly infor-mative phenotypes compared with those seen in knock-outanimals and have uncovered roles that are not detected in nullanimals (Harada et al., 1998; Hafezparast et al., 2003; Kieran etal., 2005; Chen et al., 2007; Banks and Fisher, 2008; Ilieva et al.,2008; Dupuis et al., 2009).

To further investigate the role of individual dynein subunits,we have used a genetic technique, random chemical mutagenesis,and then taken a genotype-driven approach using a mousewith a point mutation in the dynein light intermediate chain 1,DYNC1LI1. We chose this subunit because it binds importantcargos including pericentrin (Tynan et al., 2000) and Na� chan-

Received Oct. 6, 2010; revised Jan. 18, 2011; accepted Jan. 25, 2011.This work was funded by the Wellcome Trust, UK Medical Research Council and Biotechnology and Biological

Sciences Research Council, the ENDOCYTE Research and Training Network funded by the European Union, the BrainResearch Trust, Israel Science Foundation and Legacy Foundation program in neurodegeneration research, and theNational Alliance for Research on Schizophrenia and Depression. We are grateful to Christiana Ruhrberg for devel-opmental analysis of embryos and thank Ray Young for graphics. The Dync1li1 N235 mouse line is freely available viathe European Mutant Mouse Archive.

*G.T.B. and M.A.H. contributed equally.The authors declare no competing financial interest.This article is freely available online through the J Neurosci Open Choice option.Correspondence should be addressed to Elizabeth M.C. Fisher, Department of Neurodegenerative Disease,

MRC Centre for Neuromuscular Diseases, UCL Institute of Neurology, London WC1N 3BG, UK. E-mail: [email protected].

DOI:10.1523/JNEUROSCI.5244-10.2011Copyright © 2011 the authors 0270-6474/11/315483-12$15.00/0

The Journal of Neuroscience, April 6, 2011 • 31(14):5483–5494 • 5483

nels (Zheng et al., 2008), and in Aspergillus DYNC1LI1 stabilizesthe interaction of heavy and intermediate chains (Zhang et al.,2009). Thus it is likely that dynein light intermediate chains playcritical roles within the cell and therefore in the organism as awhole. However, at the time of writing no mammalian model oflight intermediate chain dysfunction has been published.

We identified and characterized a mouse carrying a pointmutation in Dync1li1. We find mutant mice have increasedanxiety-like behavior, changes in cortical and peripheral neuro-nal outgrowth and branching, hypotrophy of sensory neuronsand electrophysiological defects and at the cellular level defects inGolgi reassembly and endosome sorting and trafficking. Thusthis genotype-driven approach, characterizing a mouse with arelatively subtle point mutation, has revealed a range of unsus-pected essential functions dependent on the cytoplasmic dyneincomplex.

Materials and MethodsAnimal studiesWherever possible, all methods were undertaken blind to mouse geno-type, which was decoded after the results were collected. The animalstudies were performed under guidance issued by the UK Medical Re-search Council in Responsibility in the Use of Animals for Medical Research(1993) and under license from the UK Home Office.

Heteroduplex screening the MRC Mammalian Genetics Unit ENUDNA archiveThe Dync1li1N235Y mutation arose in an ENU mutagenesis experiment atthe MRC Mammalian Genetics Unit, MRC Harwell, UK (Nolan et al.,2000). Briefly, BALB/cAnN male mice are treated with ENU which re-sults in random point mutations in the sperm of these animals. Thesemales are crossed with C3H/HeH females to produce F1(C3H/HeH �BALB/cAnN) progeny carrying heterozygous random point mutations.Genomic DNAs are archived from F1(C3H/HeH � BALB/cAnN) malesfor subsequent screening; sperm samples are archived in parallel for re-derivation of mouse lines. Genomic DNAs from archive were analyzed byheteroduplex analysis following the protocols outlined in (Quwailid etal., 2004). Please see supplemental material (available at www.jneurosci.org) for primer sequences and complete methodology.

Rederivation and genotyping of Dync1li1 N235Y mouse strainFrozen sperm from the Dync1li1N235Y mutant F1 male mouse was usedfor in vitro fertilization (IVF) with C57BL/6J females; we used 50 two-cellstage embryos for implantation into two pseudo-pregnant C57BL/6J fe-males, resulting in 12 animals, of which 3 females and 1 male wereheterozygotes and were used as founders for our Dync1li1N235Y colony.Subsequently the sex of the Dync1li1N235Y heterozygote animal used inbackcrosses was alternated for each generation so that nuclear, mito-chondrial and Y chromosome DNA was all of C57BL/6J origin.

DNA was extracted from mouse tail biopsies using a genomic DNAisolation kit (Promega UK Ltd). Genotyping was performed by allele-specific PCR. Two amplifications were performed per genomic DNAsample: one PCR amplified the wild-type Dync1li1 allele only (DLIC1WTforward: ATCTCTGGCCGCCAAGGTCC; DLIC1WT reverse: AG-CACTGGTAGGCCCAGATT) generating a fragment of 427 bp. The sec-ond PCR amplified the Dync1li1N235Y allele only (DLIC1N235Y forward:TTACCACTGAGCCATCTCTG; DLIC1N235Y reverse: AGCACTGG-TAGGCCCAGGTA) generating a fragment of 440 bp. Both reactionsalso contained primers to amplify an unrelated DNA fragment of 590 bpfrom Dync1i2 (control forward: GTTGACAGGATTTAATTGGCC; con-trol reverse: TGTGACAATGGCAACGTCAG). PCRs were performedfor 35 cycles, annealing temperature 66°C, using MegaMix Gold (Micro-zone) according to the manufacturer’s instructions. Products were visu-alized on a 2% agarose gel. If the control fragment was absent, thereaction was “failed.” If the control fragment was present samples inwhich the wild-type Dync1li1 allele and not the Dync1li1N235Y allele am-plified were genotyped as Dync1li1�/�; those with the Dync1li1N235Y al-lele and not the wild-type allele were scored as Dync1li1N235Y/N235Y;

samples in which both the wild-type allele and the Dync1li1N235Y alleleamplified were genotyped as Dync1li1N235Y/�.

Behavioral testsPlease see supplemental material (available at www.jneurosci.org) formethods for open field behavior, food and water intake, glucose prefer-ence, wheel running, accelerating rotarod, modified SHIRPA, spontane-ous alternation and water maze.

Spontaneous locomotor activity. Spontaneous locomotor activity wasassessed in transparent plastic cages with two horizontal photocell beamslocated along the long axis of each cage, during a single 2 h test session(without habituation to the test cage). Female mice were used only andwere placed individually into the activity cages, and the total number ofbeam breaks made by each mouse was recorded.

Plus maze. The plus maze had four arms (each 27.5 � 5.5 cm) arrangedin a cross formation: two “closed” arms bordered by 30-cm-high wallsand two “open” arms without walls. The maze was elevated 50 cm abovethe ground and illuminated by bright white light. Female mice were usedonly and were placed at the distal end of a closed arm and their move-ments were recorded for 5 min. Behavioral analysis was performed usingan automated tracking system (Ethovision XT) which measured the timespent in each region, the number of entries to each region, the latency toenter an open arm and the distance traveled.

Successive alleys. The successive alleys apparatus consisted of four in-creasingly anxiogenic, linearly connected wooden alleys. Each alley was45 cm in length. The alleys had the following dimensions: alley 1 � 9 cmwide, 29-cm-high walls, painted black; alley 2 � 9 cm wide, 2.5-cm-highwalls, painted gray; alley 3 � 6.7 cm wide, 0.5-cm-high walls, paintedwhite; alley 4 � 5 cm wide, 0.3-cm-high walls, painted white. A 2 cm stepdown led from alley 2 to alley 3, with a further 0.5 cm step down betweenalleys 3 and 4. The apparatus was elevated 1 m above the floor in a well litlaboratory. Female mice used only and were placed individually at theclosed end of Alley 1, facing the wall. Each trial lasted for 300 s, duringwhich time the latency to first enter, the total time spent in, and thenumber of entries into, each section were recorded.

Weight lifting. Strength testing was performed using a set of sevenweights of linearly increasing mass. Each mouse was held by the tail, andits forepaws were allowed to grasp a ball of wire mesh to which a weightwas attached; female mice were used only. If the mouse lifted this weightfor 3 s it was tested on progressively heavier ones. The weight lifting scorewas calculated from the heaviest weight lifted and the number of secondsfor which the weight was held.

CatWalk. Female mice were used only and were allowed to walk spon-taneously up and down the glass CatWalk walkway while images werecollected by a video camera placed below. Three crosses of the walkwaywere analyzed for each animal and the data averaged. A number of pa-rameters were examined, including footstep sequence, front and hindbase of support, regularity, and paw print size, angle and intensity.

Cortical neuron dendrite analysisUterine horns were removed from time-mated heterozygousDync1li1N235Y/� mice at embryonic day 15 (E15) under anesthesia (iso-flurane, 2.5 L/min). Approximately 0.5 �l of solution containing en-hanced green fluorescent protein (GFP)-pCIG2 expression plasmid (2�g/�l) and Fast Green dye was injected into the lateral ventricle using amicropipette under pressure (FemtoJet, Eppendorf). Electroporationpaddles were oriented to target GFP incorporation to neurons eventuallypopulating the PFC. Electroporated embryos were placed back into themother and allowed to develop normally, until either E17 or postnatalday 15 (P15). Embryos harvested at E17 were used to prepare dissociatedcortical neuron cultures, according to established methods (Banker andGoslin, 1998): briefly, dissected cortices were trypsinized (0.125%, Invit-rogen), dissociated and plated into the wells of poly-L-lysine (0.01%,Sigma)-coated Labtek chamber slides at a density of 1 � 10 5 cells perchamber. Cultures were maintained in Neurobasal medium with supple-ments (B-27, Glutamax and penicillin/streptomycin, Invitrogen), untilthey were fixed at 10 days in vitro (DIV) with 4% paraformaldehyde(PFA) and immunolabeled with an antibody to GFP (1:100, Morpho-Sys). Up to 20 GFP-labeled neurons per embryo were imaged using a

5484 • J. Neurosci., April 6, 2011 • 31(14):5483–5494 Banks et al. • Dynein Light Intermediate Chain Mutant Mouse

DeltaVision microscope and Softworks software. Neurolucida softwarewas used to trace photographed neurons and analyze dendritic charac-teristics in wild-type and Dync1li1N235Y/N235Y neurons. In all cases datawere checked for normal distribution using the D’Agostino and Pearsontest, then compared for statistical differences using the t test or nonpara-metric Mann–Whitney U test.

Alternatively, GFP-expressing mice at P15 were transcardially per-fused with 0.9% saline, followed by 4% paraformaldehyde. Brainswere removed, postfixed for 1 h in 4% PFA, then vibratome cutcoronal sections (100 �m) were imaged using an SP5 Multiphoton,Leica confocal system to observe the architecture of the cortex, inparticular the organization of layer II/III projection neurons and theirdendritic arbors. Confocal images were collected using Leica softwareand were processed using Volocity, NIH ImageJ, and Photoshop(Adobe) software. Fluorescence intensity was plotted using NIH Im-ageJ, as a measure of GFP-positive neuron position within theneocortex.

Conditioning lesion and sensory neuron culturesMice of either sex were subjected to unilateral sciatic nerve crush atmid-thigh level. Three days after injury, dissociated cultures were pre-pared from the L4 –5 dorsal root ganglia (DRGs) ipsilateral and con-tralateral to the nerve crush as described previously (Hanz et al.,2003). The dissociated DRGs were plated in DMEM/F12 mediumsupplemented with N1 and 10% horse serum on laminin-coated glasscoverslips at a density of 2–5 neurons/mm 2. After 20 h cultures werefixed in 4% paraformaldehyde, stained with anti-NFH (neurofila-ment heavy chain) and number of branches per neuron was measuredusing MetaMorph software on digital images captured by ImageX-pressMicro (Molecular Devices) fluorescent automatic microscope at10� magnification.

Conduction studies and dorsal root ganglion histologySkin-nerve preparation. Animals of either sex, 3– 4 months of age, 7 wild-type and 8 Dync1li1N235Y/N235Y littermates were killed by cervical dislo-cation. There were no obvious gross morphological differences of thenerves on dissection. The skin nerve preparation was performed as de-scribed previously (Koltzenburg et al., 1997). The saphenous nerve withthe skin of the hind leg attached was dissected free and placed “inside-up” in an organ bath. The preparation was superfused (15 ml/min)with an oxygen-saturated modified synthetic interstitial fluid solu-tion containing the following (in mM): 123 NaCl, 3.5 KCl, 0.7 MgSO4,1.7 NaH2PO4, 2.0 CaCl2, 9.5 sodium gluconate, 5.5 glucose, 7.5 su-crose, and 10 HEPES at a (mean � SD) pH of 7.4 � 0.05 and atemperature of 32.0 � 0.5°C.

Recordings of A- and C-fiber sensory nerve compound action poten-tial (SNAP) were made using a low noise custom-made amplifier and HP1 Hz, LP 1 kHz filter setting without a notch filter. The nerve was stim-ulated with a fine monopolar steel needle as cathode and the anodeplaced close by in the organ bath. Values given are mean � SEM. Statis-tical comparison was made with a nonpaired t test.

Motor nerve conduction velocity studies. Animals of either sex, 4 –5months of age, 5 wild-type and 5 Dync1li1N235Y/N235Y littermates werestudied in vivo. Mice were anesthetized with isoflurane and studied usinga Viking Quest EMG machine (generously donated by CareFusion).Compound action potentials were recorded from small foot muscleswith needle electrodes and 10 Hz HP and 10 kHz LP filters. Therecording electrode was inserted perpendicularly through the plantarskin midway between the metatarsal-phalangeal joints and the ankle.The reference electrode was inserted into the hallux. The tibial nervewas stimulated at the ankle and the sciatic nerve at the sciatic notchusing a pair of monopolar needle electrodes. Needle EMG was ob-tained with a thin (30 ga, “facial”) concentric needle electrode with arecording area of 0.03 mm 2 from intrinsic foot muscles or the medialgastrocnemius muscle using 10 Hz HP and 10 kHz LP filters. Valuesgiven are mean � SEM. Statistical comparison with made with anonpaired t test.

Histological analyses of DRGs. Animals of either sex, 3– 4 months ofage, 4 wild-type and 3 Dync1li1N235Y/N235Y littermates were used in this

analysis. Cervical and lumbar DRGs were fixed in a 4% PFA and subse-quently soaked in a sterile 10% sucrose solution (in PBS) for 2 h and thensuccessively transferred to increasing concentrations of 20% sucrose for afurther 2 h and finally a 30% solution overnight at 4°C. Cryoprotectedlumbar or cervical DRGs were embedded in OCT and sectioned on acryostat at 10 �m.

Fixed or unfixed skin. Analysis of epidermal nerve fiber density usingPGP9.5 (a marker for unmyelinated fibers) (Achilli et al., 2009), Merkelcells (using cytokeratin 18), and large myelinated fibers stained for neu-rofilament heavy chain (N52) was undertaken. Sections were doubleimmunostained at room temperature following permeabilization withTriton-X and blockade with donkey serum either using a mouse IgG1monoclonal anti-neurofilament 200 (N52, Sigma) antibody and a rabbitpolyclonal anti-peripherin antibody (Millipore Bioscience Research Re-agents, AB1530) or using the mouse IgG1 monoclonal anti-parvalbumin(235 Swant) or a rabbit polyclonal antiserum to calcitonin gene-relatedpeptide (CGRP) (1134, Biomol International). Primary antibodies wereapplied overnight, secondary antibodies were an Alexa Fluor 488 donkeyanti-rabbit IgG (Invitrogen, A21206) and a Cy3 donkey anti-mouse IgG(Jackson ImmunoResearch) and applied for 2 h. Slides were mountedusing a Vectashield mounting media with a nuclear DAPI stain andviewed on a Zeiss Axiophot 2. Images were taken at a 20� fluor objectiveand captured using appropriate filters.

Data analysisCell counts for NFH/peripherin immunostaining. Lumbar and cervicalDRGs from each animal were analyzed separately. Captured images wereviewed in Adobe Photoshop CS4. A minimum of 200 cell profiles, con-stituting approximately three dorsal root ganglion (DRG) sections, wereanalyzed for each animal and the number of cell profiles positive for eachmarker was recorded. Of those profiles showing nuclei, the areas andperimeters of at least 50 cells positive for each marker were recordedusing a 21-inch LCD (liquid crystal display) digitalizing tablet withAdobe Photoshop software. The mean data from individual animals wasthen combined so that group data from mutant animals could be com-pared with the data from the wild-type animals.

Cell counts for parvalbumin/CGRP immunostaining. As with the NFH/peripherin immunostaining, the lumbar and cervical DRGs were ana-lyzed separately. A minimum of 400 cell profiles were counted for eachanimal and areas were recorded for those profiles which showed immu-noreactivity for each marker using the same software as for the NFH/peripherin counts. The nuclei of parvalbumin and CGRP-immunoreactivecells were not always visible so the areas of all the immunoreactive cell pro-files were measured as opposed to just those profiles that had been sectionedin the nuclear plane.

Mouse embryonic fibroblast protocolsCreation of mouse embryonic fibroblasts. A pregnant female was sacrificedat day 13.5 postcoitum by cervical dislocation, embryos were separatedand kept in L-15 medium on ice (Invitrogen) before processing. Headand visceral organs were removed and tissues were minced using razor-blades and suspended in 1.5 ml of 0.05% trypsin (Invitrogen) in DPBSsupplemented with 10 mM MgCl2 and DNase I (200 U, Invitrogen).Tissue was incubated at 37°C, 20 min, transferred into 4 ml of warmmedium [DMEM supplemented with 10% FBS and 1:100 (v/v) penicil-lin/streptomycin]. Remaining pieces of tissue were allowed to settle tothe bottom of the tube and cell suspension was transferred into cellculture flasks (Nunc).

Golgi reassembly after disruption with nocodazole. E13 mouse embry-onic fibroblasts (MEFs) were grown to 70% confluence on round cover-slips in 6 well plates in standard DMEM at 37°C, 3% O2. StandardDMEM was replaced by ice-cold standard DMEM containing 15 mM

HEPES, cells were left on ice for 30 min. This was replaced with DMEMcontaining 10 �g/ml nocodazole, and cells were incubated at 37°C, 3 h,3% O2. Nocodazole was washed from the cells 5 times in DMEM and cellsreturned to 3% O2, 37°C incubator to recover for 0, 30 and 50 min beforebeing fixed in �20°C methanol, 8 min. The cells were then washed 3times in PBS containing 0.2% gelatin from coldwater fish skin (PBSG).Samples were stained for Golgi using rabbit polyclonal anti-giantin (1:

Banks et al. • Dynein Light Intermediate Chain Mutant Mouse J. Neurosci., April 6, 2011 • 31(14):5483–5494 • 5485

1000) (Covance) and cytoskeleton using mouse monoclonal anti-�-tubulin (1:200) (Millipore); secondary antibodies were Alexa Fluor 546-conjugated goat anti-rabbit IgG (1:200) (Invitrogen) and Alexa Fluor488-conjugated goat anti-mouse IgG (1:200) (Invitrogen). Antibodieswere diluted in either PBSG (anti-giantin) or PBS� (PBS without mag-nesium or calcium) for 30 min, room temperature. Finally, cells weremounted on glass slides using ProLong Gold antifade mounting me-dium, containing 4�,6�-diamidino-2-phenylindole dihydrochloride(DAPI) (Invitrogen), and allowed to cure for 24 h at room tempera-ture, then stored at 4°C.

Endosomal trafficking chase of Alexa Fluor-conjugated epidermalgrowth factorE13 MEFs were grown to 80% confluence on round coverslips in 6 wellplates in standard DMEM at 37°C, 3% O2 and then washed twice withPBS, without calcium or magnesium (PBS�). Cells were starved for 2 hin starving medium (DMEM, penicillin/streptomycin, and L-glutamine)at 37°C, 3% O2, before stimulation for 10 min with warmed starvingmedium containing 8 ng/ml Alexa Fluor 555-conjugated epidermalgrowth factor (EGF) (Invitrogen) and 0.1% BSA. Cells were washed twicewith ice-cold PBS� and the internalized EGF was chased for 0, 20, and 40min. Samples were then fixed at the given time points with 4% PFA for 15min, and permeabilized for 5 min in 0.1% Triton X-100 and blocked in2% BSA, 1 h. Samples were then mounted on glass slides using ProLongGold antifade mounting medium containing DAPI (Invitrogen) and al-lowed to cure for 24 h, room temperature, then stored at 4°C.

ResultsOrigin and inheritance of Dync1li1N235Y mutationAn archive of genomic DNAs from novel mice with randompoint mutations has been created at the MRC Mammalian Ge-netics Unit, UK in an N-ethyl-N-urea (ENU) driven mutagenesisprogram (Nolan et al., 2000). To take a genotype driven approachto understanding dynein subunit function, we screened thisarchive for Dync1li1 exon 5 since it is one of the largest proteincoding exons in the gene and the larger the stretch of DNAscreened, the higher the probability that a mutation will befound. We amplified a 248 bp fragment (including complete170 bp of exon 5), multiplexed at four DNA samples per well.A heteroduplex screen of 1248 amplicons (i.e., 4992 pools)showed a possible mutation in one DNA pool (supplementalFig. S1 A, available at www.jneurosci.org as supplemental ma-terial); sequencing revealed the single mutant DNA sample(supplemental Fig. S1 B, available at www.jneurosci.org assupplemental material). Thus in our amplicon we detected 1mutation per 1.24 � 10 6 bp, of which 0.85 � 10 6 bp wereprotein coding.

The Dync1li1 mutation was an A to T change at base pair795 (cDNA numbering; Mouse Genome Informatics accessionnumber MGI:2135610) causing an asparagine to tyrosinechange at the highly conserved residue 235: Dync1li1N235Y

(Fig. 1). This mutation was not found in either parental strain,BALB/cAnN or C3H/HeH, confirming it is not a single-nucleotide polymorphism (nor is it found in C57BL/6).

The Dync1li1N235Y mouse line was rederived by IVF and 4animals (3 female, 1 male) were used as the founders for ourDync1li1N235Y colony. These mice were crossed to C57BL/6J miceand subsequent generations were backcrossed to produce a con-genic strain or intercrossed to produce homozygous animals. AtN5, 8 Dync1li1N235Y/� heterozygous males were crossed with 14Dync1li1N235Y/� heterozygous females, producing 37 litters withan average size of 8 pups per litter. The sex ratio did not vary fromnormal (143 males, 147 females; � 2 � 0.09). Homozygous ani-mals were viable and the genotype ratios were not significantlyaltered from Mendelian norms (79 wild type, 140 heterozygote,

71 homozygote; � 2 � 2.86). Homozygotes were fertile—two in-tercrosses of homozygous males and females produced litters of11 and 7 homozygous pups.

We went on to test the mutant mice for phenotypic differ-ences: all phenotyping was performed blind to genotype on wild-type and homozygous age-, sex-matched littermates. Note thatalthough the backcross generation of mice used varied betweenexperiments, all mice within each experiment were of the samegeneration on C57BL/6J.

Behavioral analysis and histology of brain and spinal cordTo determine whether the Dync1li1 mutation plays a role in be-havior, female mice (12 wild type, 11 Dync1li1N235Y/N235Y ho-mozygotes, N4) were assessed. We found no difference betweengenotypes in open field behavior, food and water intake, glucosepreference or wheel running (supplemental Fig. S2A,B, availableat www.jneurosci.org as supplemental material). However, whenplaced in a novel environment Dync1li1N235Y/N235Y mice dis-played lower levels of spontaneous locomotor activity than wild-type littermates (F(1,21) � 4.35; p � 0.05) (Fig. 2A).

Next, anxiety was examined using the elevated plus maze.Compared with wild types, Dync1li1N235Y/N235Y mice had a longerlatency to first enter an open arm (U(11,12) � 29.0; p � 0.05),spent less time in the anxiogenic open arms (U(11,12) � 100.5; p �0.05) and more in the closed arms (U(11,12) � 13.0; p � 0.01) (Fig.2B) and made fewer entries to the open arms (U(11,12) � 103.0;p � 0.05) and the closed arms (U(11,12) � 112.5; p � 0.005) (Fig.2C). However, the distance moved by the Dync1li1N235Y/N235Y

mice did not differ from that of wild types (t(21) � �1.50; p �0.15), suggesting that the reduced exploration of the openarms could not be explained by hypoactivity. In addition,Dync1li1N235Y/N235Y mice displayed significantly increased defe-cation during the task compared with wild types (U(11,12) � 28.0;p � 0.05).

Anxiety was further examined using the successive alleys task(Deacon et al., 2003). Again, Dync1li1N235Y/N235Y mice wereslower to move into the more anxiogenic second alley (U(11,12) �26.0; p � 0.05), spent less time in the second alley (U(11,12) �106.0; p � 0.05) (Fig. 2 D) and made fewer entries into thesecond alley (U(11,12) � 110.0; p � 0.01) (Fig. 2 E). The smallnumber of animals (4 wild type, 0 Dync1li1N235Y/N235Y) that

Figure 1. Partial sequence and domains of wild-type and mutant DYNC1LI1. A, Multiplesequence alignment of cytoplasmic dynein light intermediate chain 1. Asparagine 235 is mu-tated in the Dync1li1N235Y mouse but is highly conserved throughout the animal kingdom andalso in amoebae and fungi. B, Protein domain map of DYNC1LI1, showing the location of theDYNC1LI11N235Y mutation as a red bar. The map was created using the domains identified byBielli et al. (2001), Hughes et al. (1995), and Tynan et al. (2000).


ventured beyond the second alley meant that valid analysescould not be performed on alleys 3 and 4. Thus the results ofthe plus maze and successive alleys tasks suggest that theDync1li1N235Y/N235Y mice display increased anxiety comparedwith their wild-type littermates.

At 6 months of age the performance of Dync1li1N235Y/N235Y

mice on the accelerating rotarod did not differ from that of wildtypes (t(21) � 0.47; p � 0.64). However, Dync1li1N235Y/N235Y micetended to be slightly stronger than wild types on a weightliftingtest of grip strength (U(11,12) � 35.5; p � 0.06) (supplemental Fig.S2C, available at www.jneurosci.org as supplemental material).In addition, examination of gait using the CatWalk analysis sys-tem found that the ratio of forepaw base of support (BOS) tohindpaw BOS was significantly reduced in the homozygous mu-tant animals (t(21) � 3.21; p � 0.005) compared with wild-typelittermates. This was due to a relative narrowing of the forepawBOS coupled with an increase in the hindpaw BOS (Fig. 2F). Weperformed the modified SHIRPA test (Rogers et al., 1997,2001), which included further rotarod and grip strength mea-surements, upon male and female mice up to 52 weeks of agebut found no difference between homozygotes and wild-typecontrols (supplemental material, supplemental Fig. S2 I, J,available at www.jneurosci.org as supplemental material) and nodifferences in tests of hippocampal spatial working memory(spontaneous alternation) (supplemental Fig. S2D, available atwww.jneurosci.org as supplemental material), or reference mem-ory acquisition and reversal (supplemental material, supplemen-tal Fig. S2D–H, available at www.jneurosci.org as supplementalmaterial).

Given the behavioral and gait abnormalities, brain and cervi-cal and lumbar spinal cord were assessed histologically. Attentionwas paid to prefrontal cortex (PFC), hippocampus, striatum andcerebellum, but we detected no differences between wild-typeand mutant littermates in brain or spinal cord morphology or

motor neuron counts in the sciatic motorpool (supplemental material, supplemen-tal Fig. S3A–D, available at www.jneurosci.org as supplemental material).

Cortical neuron dendrite outgrowthand branchingAs axonal and dendritic development isknown to be mediated by cytoplasmicdynein-dependent processes, we investi-gated the morphology of cortical neurons,including those in the PFC. A GFP expres-sion plasmid was transfected into thecortex of embryos at E15 by in utero elec-troporation, selectively labeling neuronsthat would in the developed brain becomelayer II/III cortical projection neurons.Two days after electroporation dissoci-ated cortical cultures were preparedfrom fluorescing hemispheres. Ten dayslater GFP-expressing cells were analyzedto determine patterns of dendritic out-growth and branching (Fig. 3A). We foundthe mean dendritic tree length was signifi-cantly increased in Dync1li1N235Y/N235Y

neurons (Fig. 3Bi; wild type, 370.3 �33.46 �m; Dync1li1N235Y/N235Y, 452.6 �34.52 �m; p � 0.0029). Furthermore,individual dendrites terminated sig-

nificantly further from the soma in Dync1li1N235Y/N235Y neuronsthan wild-type controls (Fig. 3Bii; wild type, 170.9 � 4.637 �m;Dync1li1N235Y/N235Y, 182.6 � 4.411 �m; p � 0.0281). Thus ho-mozygous mutant dendrites grew longer and extended furtherfrom the soma than those of wild-type animals, which may haveimplications for correct connectivity between neurons in vivo.Despite these differences in dendritic tree length, wild-type andDync1li1N235Y/N235Y neurons had the same average number ofdendritic trees (supplemental Fig. S4A, available at www.jneurosci.org as supplemental material; wild type, 5.405 �0.3388; Dync1li1N235Y/N235Y, 4.923 � 0.2807; p � 0.4697) and thetrees displayed similar branching patterns: the average num-ber of branch points, or nodes, per dendrite was not statisti-cally different (supplemental Fig. S4 B, available at www.jneurosci.org as supplemental material; wild type, 3.985 �0.3221; Dync1li1N235Y/N235Y, 4.236 � 0.2391; p � 0.4697). In ad-dition, the frequency of nodes per dendritic tree was statisticallyindistinguishable between wild-type and Dync1li1N235Y/N235Y

neurons. This indicates that the variability in branching patternsobserved between neurons within each genotype, was consistentbetween the two genotypes (supplemental Fig. S4C, available atwww.jneurosci.org as supplemental material). Finally, a Shollanalysis showed virtually identical number of intersec-tions within given radii of the cell body for wild-type andDync1li1N235Y/N235Y neurons (supplemental Fig. S4D, available atwww.jneurosci.org as supplemental material). Therefore, increaseddendrite outgrowth, but not increased branching, characterizes corticalneurons in Dync1li1N235Y/N235Y neuron cultures.

To determine whether dendritic branching and organizationdefects occur in Dync1li1N235Y/N235Y neurons in vivo, embryossubjected to electroporation with GFP at E15 were left to developnormally and brains were harvested at P15. In these experimentselectroporation was targeted toward the PFC, an area that hasbeen associated with anxiety studies in lesion studies (Deacon et

Figure 2. Behavior of Dync1li1N235Y/N235Y mice. A, Dync1li1N235Y/N235 mice displayed significantly lower levels of spontaneouslocomotor activity compared with wild-type littermates. B, On the elevated plus maze (EPM), the Dync1li1N235Y/N235Y mice spentsignificantly less time in the open arms and more time in the closed arms. C, They also made significantly fewer entries toboth the open and closed arms. D, On the successive alleys task Dync1li1N235Y/N235Y mice spent less time in the moreanxiogenic alleys compared with wild types. E, They also made fewer entries to these alleys (the Dync1li1N235Y/N235Y micedid not make any entries to alleys 3 or 4). F, Footprint analysis using the CatWalk system found that compared with wildtypes, Dync1li1N235Y/N235Y mice displayed a significantly greater difference between the BOS of their front legs and hindlegs due to a relative narrowing of the front BOS and a widening of the hind BOS; a representative sample from one animalis shown. Green, Right front foot; dark green, right hind foot; red, left front foot; dark red, left hind foot. Animals walkedfrom right to left.


al., 2003). We found mutant phenotypesthat could not be observed in in vitro cul-tures: in the PFC of Dync1li1N235Y/N235Y an-imals more neurons that had migratedpast their appropriate layer II/III positionand into the uppermost part of the cortex(Fig. 3C,E; quantitation shown in H).More caudally (Fig. 3 I, J) there was amarked increase in GFP-labeled neuronsin the uppermost layer of the cortex inDync1li1N235Y/N235Y mice. Many of theseneurons displaced from layer II adoptedabnormal orientation in Dync1li1N235Y/

N235Y animals compared with wild types(Fig. 3D,F) and also a proportion withinlayer II/III showed abnormal orientation(Fig. 3G). Figure 3 shows that this mis-orientation was characterized by the apicaldendrite not projecting radially, toward thepial surface, but instead to varying degreestangentially. In addition we observed neu-rons with abnormal apical dendrite mor-phology including thickening of thedendrite and often irregular trajectories(Fig. 3K, arrow).

Adult sensory neuron branchingTo establish whether the Dync1li1N235Y mu-tation affected neuronal branching in theperiphery we examined neuronal culturesfrom wild-type and Dync1li1N235Y/N235Y

DRGs. We also examined the possibility thatthe Dync1li1 mutation might affect dynein-based retrograde injury signaling by per-forming conditioning lesion experiments asdescribed previously (Hanz et al., 2003).

Two wild-type and twoDync1li1N235Y/N235Y male mice of 2– 4-months old were used for each experi-ment, and three independent replicateswere carried out. Mice were subjected tounilateral sciatic nerve crush at mid-thighlevel; 3 d later, dissociated cultures wereprepared from L4 –5 DRGs ipsilateral andcontralateral to the nerve crush. Neuronswere fixed after 20 h in culture, stainedwith anti-NFH, and branching was mea-sured. As shown in Figure 4A,B, in naiveconditions NFH-positive sensory neuronsfrom Dync1li1N235Y/N235Y mice had agreater number of branches than wild-type controls. We found similar results for neurons underinjury conditions, although differences were less significantthan for naive conditions, apparently due to a more markedinjury response in wild-type neurons (47.6% increase inbranching after injury, compared with 33.5% increase in themutants).

To assess nerve branching in developing animals we per-formed whole mount neurofilament immunohistochemistryin the limbs of E13.5 animals; we found no significant differ-ence between wild-type and Dync1li1N235Y/N235Y animals in thenumber of branch points (supplemental material, supplemen-tal Figure S4, available at www.jneurosci.org as supplemental

material) and whole-mount neurofilament staining did notshow any obvious abnormalities in the peripheral nervoussystem of homozygotes at P12.5 (Christiana Ruhrberg, per-sonal communication).

Neurophysiology of sensory neurons and dorsal rootganglia histologyMice with mutations in the dynein heavy chain 1 subunit have aloss of cutaneous and proprioceptive sensory neurons, and so forcomparison we undertook sensory nerve conduction studies ofthe saphenous nerve on 8 wild-type and 7 Dync1li1N235Y/N235Y

homozygous male littermates (3 months of age, N3). Recordings

Figure 3. Morphology of wild-type and mutant Dync1li1N235Y/N235Y cortical neurons. A, Cortical neurons were electroporated invivo at E15, then cultured in vitro from E17 embryos. At 10 DIV they were analyzed to compare morphology of wild-type andDync1li1N235Y/N235Y cortical neurons. GFP-positive neurons (i) were hand-traced using Neurolucida software (ii). B, The length ofdendritic trees for wild-type and Dync1li1N235Y/N235Y neurons, in vitro. i, Dync1li1N235Y/N235Y dendrites were significantly longerthan in wild-type neurons ( p � 0.0029). ii, Dync1li1N235Y/N235Y dendrites terminated significantly further from the soma thanwild-type dendrites ( p � 0.00281). C, Low magnification of the cortex from a wild-type brain electroporated with GFP at E15 andharvested at P15. GFP-positive neurons occupy a discreet band corresponding to cortical layers II/III. D, i, Higher-magnificationimage showing the orientation of a pyramidal neuron in layer II. ii, Neighboring neurons align in the same orientation with apicaldendrites projecting toward the pial surface. E, The cortex from a Dync1li1N235Y/N235Y brain electroporated with GFP at E15 andharvested at P15 (rostrocaudally matched with C). Compared with C, GFP-positive cells were more distributed, with more neuronsresiding in the uppermost part of the cortex (arrows). F, The cell body and apical dendrite of neurons located closer to the pialsurface in Dync1li1N235Y/N235Y mutants were mis-oriented. G, Neurons in layer II of Dync1li1N235Y/N235Y cortex also often displayedincorrect orientation. H, Comparison of the proportion of electroporated neurons located in upper layers of the neocortex, asmeasured by fluorescence intensity. I, Higher-magnification imaging from wild-type cortex in more caudal sections showed mostGFP-positive neurons within layer II/II. J, In contrast to I, GFP-expressing cells in Dync1li1N235Y/N235Y cortex occupied a locationmuch closer to the pial surface. K, The apical dendrite of neurons Dync1li1N235Y/N235Y cortex were often thickened and projected inan incorrect orientation. Scale bars: A, C, E, I, J, 100 �m; D, F, G, K, 50 �m.


were taken of the A (myelinated)- or C (unmyelinated)-fiberSNAPs; we found a small but significant ( p � 0.05) reduction ofthe peak-to-peak amplitude of the A-fiber SNAP from 3.2 � 0.3mV in wild types to 2.5 � 0.2 mV in homozygous mutants (Fig.5A) but no difference in the conduction velocity (wild type,28.8 � 0.8 m/s; Dync1li1N235Y/N235Y, 27.1 � 1.2 m/s; p � 0.2).With respect to the C-fibers, we found no significant reduction ofthe peak-to-peak amplitude of the C-fiber SNAP (wild type,391 � 48 �V; Dync1li1N235Y/N235Y, 385 � 61 �V, p � 0.4) and nosignificant reduction of the conduction velocity (wild type,0.86 � 0.06 m/s; Dync1li1N235Y/N235Y, 0.92 � 0.04 m/s; p � 0.4).

To determine whether the sensory electrophysiological defectin A-fiber SNAP was reflected histologically, DRGs from the cer-vical and lumbar spinal cord were stained for NFH (a marker formyelinated fibers) and peripherin (a marker for thin myelinatedand unmyelinated fibers) (supplemental Figure S5A, available atwww.jneurosci.org as supplemental material). We found no dif-ferences in the NFH- and peripherin-immunoreactive cell pro-files in cervical or lumbar DRGs of wild-type or mutant animals(supplemental Table S1, available at www.jneurosci.org as sup-plemental material). However, analysis of the size distribution oflabeled neuronal profiles revealed a significant shift to the left(smaller neurons) in homozygous mutants compared with wild-

type littermates in lumbar DRG. Changes in cervical DRGs weresmaller which is compatible with a length-dependent effect asseen in many neuropathies (Fig. 5B; Table 1).

We also stained cervical and lumbar DRGs for calcitoningene-related peptide (CGRP, a marker of peptidergic nocicep-tors) and parvalbumin (stains prioprioceptors and mechanore-ceptors) (supplemental Fig. S5B, available at www.jneurosci.orgas supplemental material). Similarly, we found no differences inthe percentage of CGRP- and parvalbumin-immunoreactive cellsin the cervical and lumbar DRGs of wild-type and mutant ani-mals (supplemental Table S2, available at www.jneurosci.org assupplemental material), but there was a significant shift tosmaller neurons in homozygous mutants compared with wild-type littermates (Table 2).

We found no loss of epidermal nerve fiber density betweenwild-type and mutant animals, and no reduction in the numberof Merkel cells, whose survival depends on innervation by mech-anoreceptive sensory neurons. Together these findings indicatethat there is no distal degeneration of large myelinated or unmy-elinated sensory neurons. To establish whether the Dync1li1N235Y

mutation had any effect upon the saphenous nerve itself, a histo-logical analysis was performed upon the saphenous nerves of 3wild types and 3 homozygotes and we found no difference inaverage fiber size, fiber size distribution, g-ratio, or average ax-onal diameter (supplemental material, supplemental Fig. S5C–F,supplemental Table S3, available at www.jneurosci.org as supple-mental material).

Figure 4. Dync1li1 N235Y point mutation increases branching in cultured sensory neurons. A,Fluorescent images of DRG neurons from wild-type and Dync1li1N235Y homozygous mice undernaive and injury conditions. Right leg sciatic nerves of wild-type and mutant mice were crush-lesioned 3 d before dissection of L4 –5 DRGs for primary culture of sensory neurons; correspond-ing contralateral DRGs were used for naive controls. Cultures were imaged by automatedfluorescent microscopy after 20 h in vitro, to obtain 150 images per slide, at magnification 10�.B, Quantification shows a significant increase in branching of naive sensory neurons fromDync1li1N235Y/N235Y homozygotes (29.4% increase over wild type). Increased branching wasalso observed in homozygous Dync1li1N235Y/N235 sensory neurons after injury, although thedifference is less pronounced than in naive neurons, apparently due to a more robust injury responsein the wild-type neurons. ***p � 10 �6; *p � 0.05 (Student’s t test). Scale bar, 100 �m.

Figure 5. Neurophysiological and histological analysis of Dync1li1N235Y/N235Y mice. A,Dync1li1N235Y/N235 have mice a significant reduction of the peak-to-peak amplitude of A-fibercompound action potential in the saphenous nerve compared with wild-type littermates. *p �0.05. B, QSum plots of the neuronal profile area distribution of neurofilament-immunoreactiveneurons (giving rise to large myelinated A-fibers; round symbols) and of peripherin-immunoreactive cells (giving rise to C-fibers; square symbols) in lumbar dorsal root ganglia. Thecell profile size in both populations is reduced in Dync1li1N235Y/N235Y mice compared with wild-type littermates.


As Dync1li1N235Y/N235Y animals have a different gait from wild-type littermates, motor nerve conduction velocity was assessedwild-type and Dync1li1N235Y/N235Y littermates and we found nodifferences between genotypes (supplemental material, availableat www.jneurosci.org). In aggregate these findings indicate thatthere is no loss of subpopulations of neurons, but a hypotrophy ofall cell types and no dying back neuropathy of motor, or large andsmall diameter sensory neurons.

Dynein-controlled processes in Dync1li1N235Y/N235Y mouseembryonic fibroblastsWe studied the effect of the Dync1li1N235Y mutation on two im-portant cellular processes known to involve cytoplasmic dynein:maintenance of Golgi integrity and endosomal movements.Golgi abnormalities have been reported in both Dync1h1Loa

(Hafezparast et al., 2003) and in Drosophila with a mutation inthe dynein light intermediate chain (Zheng et al., 2008; Palmer etal., 2009). We analyzed the effect of the Dync1li1N235Y mutationon reassembly of Golgi complex in MEFs, following exposure tonocodazole. We found Golgi reassembly progressed throughoutthe recovery time and was almost complete in wild-type cellswithin 50 min, thus there was no significant difference in the ratioof Golgi spots per unit area in wild-type cells compared with thecorresponding untreated wild-type cells at the 50 min time point( p � 0.31) (Fig. 6A,B; supplemental Fig. S6, available at www.jneurosci.org as supplemental material). However, there was adefect in Golgi complex reassembly in Dync1li1N235Y/N235Y cells,when untreated and treated cells at the 50 min recovery timepoint were compared ( p � 0.008). No statistically significantdifferences ( p � 0.06) were observed in the ratio of Golgi spotsper unit area in heterozygous Dync1li1N235Y/� cells under thesetwo conditions (supplemental Fig. S6, available at www.jneurosci.org as supplemental material).

As dynein is responsible for the trafficking and sorting of en-dosomes within the cell (Driskell et al., 2007) we investigated theeffect of the Dync1li1N235Y mutation on endosomal dynamics.Wild-type and homozgygous MEFs were pulsed with Alexa Fluor555-conjugated EGF, then fixed at set time points (Fig. 7A,B),and the number of EGF-positive vesicles in each cell was counted.When we compared the number of EGF-positive vesicles, as ameasure of their trafficking to the lysosome for degradation, at 20and 40 min time points, we observed significant differencesbetween wild-type and homozygous MEFs ( p � 0.0032 andp � 0.0007 respectively) which may indicate a slower rate ofdegradation.

Dynein subunit levels and interactionsWe generated antibodies against wild-type DYNC1LI1, and thedynein intermediate chain protein 1, DYNC1I1 (supplementalmaterial, supplemental Fig. S7, available at www.jneurosci.org assupplemental material). To investigate whether the DYNC1LI1mutation affected its stability or expression, or its interactionswith other components of the dynein complex, we assessed vari-ous cytoplasmic dynein subunit levels in brain from 12-monthold wild-type and Dync1li1N235Y/N235Y mice and found no differ-ences in individual protein levels, except for a significant increasein the levels of DYNLT3 in Dync1li1N235Y/N235Y mice comparedwith wild-type controls ( p � 0.001; supplemental Fig. S8A,B,supplemental Table S4, available at www.jneurosci.org as supple-mental material). Coimmunoprecipitation studies indicatedDYNC1LI1 N235Y was still bound within the complex, and alsothat there was a significant decrease in the amount of coprecipi-tating DYNLL in mutant samples when compared with wild type( p � 0.000005; supplemental material, supplemental Fig. S8C–E,supplemental Table S5, available at www.jneurosci.org as supple-mental material). We found no differences in the autophagy

Table 1. Cell profile size distribution in cervical and lumbar DRGs for NFH- and peripherin-positive neurons in wild-type and Dync1li1N235Y/N235Y mice

Cervical Lumbar

Wild type (n � 3) Dync1li1N235Y/N235Y (n � 4) Wild type (n � 3) Dync1li1N235Y/N235Y (n � 4)

Total number of NFH-positive profile areas measured 201 286 165 240Mean NFH cell profile area 739 � 80 (579 – 833) 676 � 37 (568 –739) 773 � 46 (714 – 864) 680 � 33 (595–734)Total number of peripherin-positive profile areas measured 338 496 319 430Mean peripherin cell profile area 339 � 32 (279 –387) 307 � 6 (279 –323) 351 � 31 (294 –299) 285 � 18 (245–319)

For mean � SEM values, the values in parentheses are ranges.

Neurofilament: There was no significant difference ( p � 0.1, Kolmogorov–Smirnov test) in the distribution of the profile areas of cervical NFH-immunoreactive DRG neurons between wild-type mice (719 � 324 �m 2, mean � SD; ncells �201, nanimals � 3) and Dync1li1N235Y/N235Y littermates (664 � 275 �m 2, mean � SD; ncells � 286, nanimals � 4). Data not shown. The distribution of the profile areas of lumbar NFH-immunoreactive DRG neurons is significantly different( p � 0.025, Kolmogorov–Smirnov test) between wild-type mice (765 � 296 �m 2, mean � SD; ncells � 165, nanimals � 3) and Dync1li1N235Y/N235Y littermates (686 � 280 �m 2, mean � SD; ncells � 240, nanimals � 4) (Fig. 5B).

Peripherin: The distribution of the profile areas of cervical peripherin-immunoreactive DRG neurons is significantly different ( p � 0.025, Kolmogorov–Smirnov test) between wild-type mice (335 � 152 �m 2, mean � SD; ncells � 338,nanimals � 3) and Dync1li1N235Y/N235Y littermates (307 � 165 �m 2, mean � SD; ncells � 496, nanimals � 4). Data not shown. The distribution of the profile areas of lumbar peripherin-immunoreactive DRG neurons is significantly different( p � 0.001, Kolmogorov–Smirnov test) between wild-type mice (353 � 199 �m 2, mean � SD; ncells � 319, nanimals � 3) and Dync1li1N235Y/N235Y littermates (286 � 151 �m 2, mean � SD; ncells � 430, nanimals � 4) (Fig. 4C).

Table 2. Cell profile size distribution in cervical and lumbar DRG for CGRP- and parvalbumin-positive neurons

Cervical Lumbar

Wild type (n � 3) Dync1li1N235Y/N235Y (n � 4) Wild type (n � 3) Dync1li1N235Y/N235Y (n � 3)

Total number of CGRP-positive profile areas measured 239 315 255 389Mean CGRP cell profile area 459 � 69 (378 –595) 420 � 27 (383– 498) 485 � 26 (469 –502) 435 � 26 (395– 484)Total number of parvalbumin-positive profile areas measured 264 285 233 339Mean parvalbumin cell profile area 508 � 26 (477–559) 477 � 21 (416 –509) 474 � 7 (418 –578) 378 � 7 (364 –388)

For mean � SEM values, the values in parentheses are ranges.

CGRP: The distribution of the profile areas of cervical CGRP-immunoreactive DRG neurons is significantly different ( p � 0.005, Kolmogorov–Smirnov test) between wild-type mice (478 � 276 �m 2, mean � SD; ncells � 239, nanimals �3) and Dync1li1N235Y/N235Y littermates (421 � 229 �m 2, mean � SD; ncells � 315, nanimals � 4). Data not shown. The distribution of the profile areas of lumbar CGRP-immunoreactive DRG neurons is significantly different ( p � 0.005,Kolmogorov–Smirnov test) between wild-type mice (484 � 280 �m 2, mean � SD; ncells � 255, nanimals � 3) and Dync1li1N235Y/N235Y littermates (432 � 254 �m 2, mean � SD; ncells � 389, nanimals � 4). Data not shown.

Parvalbumin: The distribution of the profile areas of cervical parvalbumin-immunoreactive DRG neurons is significantly different ( p � 0.001, Kolmogorov–Smirnov test) between wild-type mice (503 � 260 �m 2, mean � SD; ncells �264, nanimals � 3) and Dync1li1N235Y/N235Y littermates (468 � 282 �m 2, mean � SD; ncells � 285, nanimals � 4). Data not shown. The distribution of the profile areas of lumbar parvalbumin-immunoreactive DRG neurons is significantlydifferent ( p � 0.001, Kolmogorov–Smirnov test) between wild-type mice (465 � 276 �m 2, mean � SD; ncells � 233, nanimals � 3) and Dync1li1N235Y/N235Y littermates (376 � 196 �m 2, mean � SD; ncells � 393, nanimals � 4) (Fig. 5D).


marker LC3 II or in the cellular localization of DYNC1LI1 or itscargo RAB4 between wild-type and mutant animals in cortical neu-rons (supplemental material, supplemental Fig. S8F–K, available atwww.jneurosci.org as supplemental material).

DiscussionWe have identified and characterized a novel mouse line carryingan ENU-derived mutation causing an asparagine to tyrosinechange in DYNC1LI1 at highly conserved residue 235. This is thefirst published mammalian mutant of a dynein light intermediatechain and allows us to assess aspects of dynein function that havenot been highlighted thus far in the available mouse models ofdynein dysfunction. Dync1li1N235Y/N235Y homozygote mice showincreased anxiety-like behavior and altered gait in behavioraltests and have neurons with altered morphologies and electro-physiological properties. The Dync1li1N235Y mutation changesGolgi formation and endosomal trafficking, and the level ex-pression and association of two other subunits of the dyneincomplex.

Our behavioral studies reveal that Dync1li1N235Y/N235Y ho-mozygotes display greater levels of anxiety-like behavior thanwild-type littermates on both the elevated plus maze and succes-sive alleys task. Although these tasks can be influenced by changesin baseline levels of locomotor activity, the two groups did notdiffer in the distance traveled on the elevated plus maze, suggest-ing that the reduced exploration of the open arms by the

Dync1li1N235Y/N235Y mice could not be explained by hypoactivity,and no hypoactivity was found in wheel running tests. Despitethis, it is difficult to conclusively disassociate anxiety and loco-motor activity as these two factors are closely linked (reducedlocomotor activity potentially may result from increased anxietyas well as potentially acting as a confound in the measurement ofanxiety) (Milner and Crabbe, 2008). Because of this difficulty,defecation was used as a non-locomotor measure of anxiety(DeFries et al., 1978). The increased defecation observed inDync1li1N235Y/N235Y mice during behavioral testing supportsthe hypothesis that these animals display increased levels ofanxiety.

Dync1li1N235Y/N235Y homozygotes have defects in cortical pro-jection neuron morphology and the laminar positioning of thisneuronal population, which indicates a migration defect affect-ing the cortex and prefrontal cortex. Alterations in neuronalmorphology in the medial PFC have been found to be induced bychronic stress (Goldwater et al., 2009), as well as anxiety (Pascualand Zamora-Leon, 2007). Stress linked neuronal migration de-fects have also been observed in the hippocampus (Keays et al.,2007; Scobie et al., 2009) and basolateral amygdala (Kudo et al.,2007; Carim-Todd et al., 2009). A number of other mouse modelswith PFC-related behavioral deficits show defects in neuronalmorphology or migration. However, linking behavior and migra-tion defects is complex, for example migration defects observedin this study are similar to those in the Lmx1a (dreher) mutantmouse (overmigration of layer II neurons into layer I), but thetwo mouse lines show markedly different behavioral pheno-types—dreher mice show circling behavior, balance abnormali-

Figure 6. Golgi reassembly in wild-type and Dync1li1N235Y/N235Y MEFs. A, MEFs were treatedwith cold (4°C) for 20 min and nocodazole for 3 h, washed and then allowed to recover at 37°Cfor the times indicated. Golgi are shown in red, cytoskeleton in green (�-tubulin) and nuclei inblue (DAPI). The scale bar represents 30 �m. B, The total number of discrete spots and the totalarea of Golgi complex were measured to calculate the ratio of spots/total area per cell; 5 cells pergenotype were assessed. In wild-type and heterozygous cells, after 50 min of recovery, the Golgicomplex has reformed and is not significantly different from that in untreated cells. However, inthe Dync1li1N235Y/N235Y homozygous mutant cells, the Golgi complex has a significant defect inrecovery after 50 min compared with untreated cells and treated wild-type and heterozygouscells at the same time point.

Figure 7. Endosomal trafficking chase of Alexa Fluor 555-conjugated EGF in wild-type andDync1li1N235Y/N235Y MEFs. A, MEFs were pulsed with EGF for 10 min and chased at 37°C for thetimes indicated. EGF is shown in red, cytoskeleton (�-tubulin) in green and nuclei in blue(DAPI). Ten cells per genotype per time point were assessed. Scale bar, 30 �m. B, The numberof EGF-positive vesicles per cell in wild-type and homozygous MEFs at 0, 20, and 40 min timepoints. At 0 min wild-type and Dync1li1N235Y/N235Y homozygous mutant cells have similar num-bers of vesicles, however, after 20 and 40 min Dync1liN235Y/N235 homozygous mutant cells havesignificantly more vesicles remaining than wild-type cells.


ties, hyperactivity and deafness, none of which we see inDync1li1N235Y/N235Y homozygotes) (Costa et al., 2001).

Dynein is involved in neuronal migration through its interac-tions with LIS1 (Tsai et al., 2007). Lis1 mutant mice have severedefects in neuronal migration in the brain, including in the samecortical regions disrupted in Dync1li1N235Y/N235Y homozygotes(Hirotsune et al., 1998). However, Lis1 mutant mice do not showchanges in anxiety (Paylor et al., 1999) suggesting the interestingpossibility that neuronal defects observed in Dync1li1N235Y/N235Y

mice may be due to interactions with pathways other than thoseregulated by LIS1.

We note that importins, transported by cytoplasmic dynein(Perry and Fainzilber, 2009), are involved in synapse-to-nucleussignaling downstream of NMDA receptors (Thompson et al.,2004; Dieterich et al., 2008; Jeffrey et al., 2009), and NMDA re-ceptors are important mediators of anxiety (Barkus et al., 2010).It is possible the Dync1li1N235Y mutation affects importin trans-port in response to NMDA receptor activation, thus altering anx-iety in these mice.

Previous mouse studies have shown DYNC1H1 plays an im-portant role in prioprioception and sensory neuronal function(Chen et al., 2007; Ilieva et al., 2008). Similarly the Dync1li1N235Y

mutation alters the firing properties, neuron size and morphol-ogy of sensory nerves. Thus as sensory nerve deficits have beenfound now in mouse models with mutations in two differentcytoplasmic dynein subunits, possibly DRG neurons are morereliant on dynein-mediated processes than other neuron popula-tions. Cell type specificity may be due to different cargos transportedby dynein within the different cells—studies in Drosophila show thedynein light intermediate chain interacts with a class of degenerin/epithelial sodium channels (Zheng et al., 2008) that in mammalsappear to be found exclusively in DRG (Benson et al., 2002).

Mutation of the light intermediate chain in Drosophila causedendritic and axonal defects in neurons, such as branching de-fects and a reduction of the dendritic arbor (Satoh et al., 2008;Zheng et al., 2008). However, these neuronal phenotypes differfrom those found in the present study: in Drosophila mutations inthe light intermediate chain cause a reduction in the length andnumber of dendrite branches (Satoh et al., 2008; Zheng et al.,2008), whereas the Dync1li1N235Y/N235Y mice have an increase indendrite length in cortical neurons (with no changes in branch-ing) and an increase in the number of dendrite branches in DRGneurons. These differences may arise because the reported Dro-sophila mutations cause loss of function, while the Dync1li1N235Y

may be a novel gain of function.The light intermediate chains play an essential role in endo-

somal dynamics in cells through their interactions with the RABprotein family (Bielli et al., 2001; Satoh et al., 2008; Zheng et al.,2008). Studies of the cytoplasmic dynein light intermediate chainin Drosophila suggest the cellular machinery controlling dendritebranching is transported in endosomes and Golgi outposts(Satoh et al., 2008; Zheng et al., 2008). Our data from theDync1li1N235Y mutation support this view to some extent: wefound the Dync1li1N235Y mutation reduces the trafficking ofGolgi fragments and endosomes. However, while branchingdefects were observed in DRG neurons in Dync1li1N235Y/N235Y

mice, we found no such defects in cortical neurons or inthe peripheral nerves in the developing limb. In contrast, thecortical neurons of Dync1li1N235Y/N235Y mice showed othermorphological abnormalities such as increased dendrite out-growth. These results imply that dynein-mediated processesmay mediate different aspects of neuronal morphology in dif-ferent neuronal populations.

We also note that the Dync1li1N235Y mutation lies at the pe-riphery of a known binding site for pericentrin. The primaryfunction of pericentrin is thought to be the control of the mitoticspindle and the assembly of the centriole. Interestingly, a recentstudy of Cep120 (a centriole localized protein) hypothesized thatdefects in centriole formation may lead to alterations in neuronalmigration (Mahjoub et al., 2010). Furthermore, there is also ev-idence to suggest that pericentrin may play a role in ciliogenesis(Miyoshi et al., 2006) and that ependymal cilia are responsible fordirecting CSF flow (Lang et al., 2006). Because abnormal CSFflow is linked to gait abnormalities [for example, in the humancondition, normal pressure hydrocephalus (Gideon et al., 1994)],it is possible that the Dync1li1N235Y mutation causes abnormali-ties in pericentrin localization/function that affect cilia and CSFflow, and thus locomotion in this mouse. Future studies of theDync1li1N235Y mutation should look at the interaction betweenthe mutated light-intermediate chain 1 and pericentrin.

In Dync1li1N235Y/N235Y mice our quantified Western blot stud-ies indicate increased levels of DYNLT3. We cannot tell whetherthis light chain lies within the complex or not from our westerns,but our immunoprecipitation experiments reveal that while theinteraction of the intermediate chains in the core complex ismaintained, (1) the increased DYNLT3 levels were not incorpo-rated into the complete complex, and (2) there is a reduction inbinding of the DYNLL light chains. Currently there is no evidenceof a direct interaction between the dynein light intermediate andlight chains. Instead the light chains are thought to interact withthe intermediate chains within the core complex. It is possible theDync1li1N235Y mutation alters the confirmation of the intermedi-ate chains in the complex and this change affects the associationof the light chains.

Our knowledge of the roles of the individual cytoplasmic dy-nein subunits comes from studies in nonmammalian organismsand in transfected cell lines, with the exception of the heavy chain,for which four mutant alleles are known in mouse: (1) a genetargeted knock-out; the point mutants (2) Legs at odd angles(Dync1h1Loa) and (3) Cramping 1 (Dync1h1Cra1); (4) a 9 bp cod-ing deletion Sprawling (Dync1h1Swl) (Harada et al., 1998; Hafez-parast et al., 2003; Chen et al., 2007). Homozygous knock-out(null) mice die early in embryogenesis and there is no reportedphenotype for heterozygous knock-outs (Harada et al., 1998). Incontrast Dync1h1Loa, Dync1h1Cra1 and Dync1h1Swl heterozygoteshave major defects in the proprioceptive system and locomotorabnormalities (homozygotes die in embryogenesis/at birth)(Harada et al., 1998; Hafezparast et al., 2003; Kieran et al., 2005;Chen et al., 2007; Banks and Fisher, 2008; Ilieva et al., 2008;Dupuis et al., 2009). We note that the phenotype of theDync1li1N235Y mouse strain is different from that of the fourheavy chain mutants, particularly with respect to behavior. Theheavy chain and Dync1li1N235Y mutants all give rise to defects inGolgi reassembly (Hafezparast et al., 2003) and EGF trafficking(Hafezparast et al., 2003; our unpublished data) both of which areknown to be dynein-dependent processes. However, heterozy-gous Dync1h1Loa/� mice develop an obvious gait abnormality(“low-based, reptilian”) easily visible by eye, plus significant de-fects in rotarod and grip-strength, none of which we find in theDync1li1N235Y/N235Y mutants at comparable ages (Hafezparast etal., 2003). There are also significant reductions in axon numbersin the saphenous nerve of Dync1h1Loa/� mice and more profoundneurophysiological changes in nerve conduction properties com-pared with the Dync1li1N235Y/N235Y mutants (AlQatari et al.,2009). We note that we did not find significant alterations inperipheral nerve branching at E13.5, whereas this was see in both


heterozygous and homozygous Dync1h1Loa mutants. A deepercomparison of the different subunit mutants at the cellular levelwould shed more light on the role of specific subunits, versus theentire complex, and here we clearly show phenotypes that havenot been described before for in any of the heavy chain mutants.We note that Ori-McKenney, Vallee and colleagues have recentlyshown altered processivity of dynein with the Dync1h1Loa heavychain mutation (Ori-McKenney et al., 2010), such a change isunlikely in the Dync1li1N235Y light intermediate chain mutation,which would presumably explain the somewhat different pheno-types of mutant mice, although this needs to be investigated.

Here we have used freely available mouse genetics resources totake a focused genotype-driven approach, working with a pointmutation likely to be more informative than a knock-out, toanalyzing one more of the 11 cytoplasmic dynein subunit pro-teins and have uncovered diverse roles at the level of the wholeorganism, nervous system and cell. The Dync1li1N235Y mouse hasopened up new avenues for investigation of the roles of cytoplas-mic dynein and its individual components, and gives new insightinto the functioning and architecture of the mammalian nervoussystem.

ReferencesAchilli F, Bros-Facer V, Williams HP, Banks GT, AlQatari M, Chia R, Tucci V,

Groves M, Nickols CD, Seburn KL, Kendall R, Cader MZ, Talbot K, vanMinnen J, Burgess RW, Brandner S, Martin JE, Koltzenburg M, Green-smith L, Nolan PM, et al. (2009) A novel mouse model with a pointmutation in glycyl-tRNA synthetase (Gars) has sensory and motor phe-notypes and profoundly reduced enzyme activity in homozygotes. DisMod Mech 2:359 –373.

AlQatari M, Vastani N, Bros-Facer V, Groves M, Greensmith L, Fisher EMC,Koltzenburg M (2009) Mutations of the cytoplasmic dynein heavy chaingene Dync1h1 cause a severe sensory neuropathy. J Peripher Nerv Syst 14(S2):6.

Banker G, Goslin K (1998) Culturing nerve cells. Cambridge, MA: Massa-chusetts Institute of Technology.

Banks GT, Fisher EM (2008) Cytoplasmic dynein could be key to under-standing neurodegeneration. Genome Biol 9:214.

Barkus C, McHugh SB, Sprengel R, Seeburg PH, Rawlins JN, Bannerman DM(2010) Hippocampal NMDA receptors and anxiety: at the interface be-tween cognition and emotion. Eur J Pharmacol 626:49 –56.

Benson CJ, Xie J, Wemmie JA, Price MP, Henss JM, Welsh MJ, Snyder PM(2002) Heteromultimers of DEG/ENaC subunits form H�-gated chan-nels in mouse sensory neurons 1. Proc Natl Acad Sci U S A 99:2338 –2343.

Bielli A, Thornqvist PO, Hendrick AG, Finn R, Fitzgerald K, McCaffrey MW(2001) The small GTPase Rab4A interacts with the central region of cy-toplasmic dynein light intermediate chain-1. Biochem Biophys Res Com-mun 281:1141–1153.

Carim-Todd L, Bath KG, Fulgenzi G, Yanpallewar S, Jing D, Barrick CA,Becker J, Buckley H, Dorsey SG, Lee FS, Tessarollo L (2009) Endoge-nous truncated TrkB: T1 receptor regulates neuronal complexity andTrkB kinase receptor function in vivo. J Neurosci 29:678 – 685.

Chen XJ, Levedakou EN, Millen KJ, Wollmann RL, Soliven B, Popko B(2007) Proprioceptive sensory neuropathy in mice with a mutation inthe cytoplasmic dynein heavy chain 1 gene. J Neurosci 27:14515–14524.

Costa C, Harding B, Copp AJ (2001) Neuronal migration defects in theDreher (Lmx1a) mutant mouse: role of disorders of the glial limitingmembrane. Cereb Cortex 11:498 –505.

Deacon RM, Penny C, Rawlins JN (2003) Effects of medial prefrontal cortexcytotoxic lesions in mice. Behav Brain Res 139:139 –155.

DeFries JC, Gervais MC, Thomas EA (1978) Response to 30 generations ofselection for open-field activity in laboratory mice. Behav Genet 8:3–13.

Dieterich DC, Karpova A, Mikhaylova M, Zdobnova I, Konig I, Landwehr M,Kreutz M, Smalla KH, Richter K, Landgraf P, Reissner C, Boeckers TM,Zuschratter W, Spilker C, Seidenbecher CI, Garner CC, Gundelfinger ED,Kreutz MR (2008) Caldendrin-Jacob: a protein liaison that couplesNMDA receptor signalling to the nucleus. PLoS Biol 6:e34.

Driskell OJ, Mironov A, Allan VJ, Woodman PG (2007) Dynein is required

for receptor sorting and the morphogenesis of early endosomes. Nat CellBiol 9:113–120.

Dupuis L, Fergani A, Braunstein KE, Eschbach J, Holl N, Rene F, Gonzalez DeAguilar JL, Zoerner B, Schwalenstocker B, Ludolph AC, Loeffler JP(2009) Mice with a mutation in the dynein heavy chain 1 gene displaysensory neuropathy but lack motor neuron disease. Exp Neurol215:146 –152.

Gennerich A, Carter AP, Reck-Peterson SL, Vale RD (2007) Force-inducedbidirectional stepping of cytoplasmic dynein. Cell 131:952–965.

Gideon P, Ståhlberg F, Thomsen C, Gjerris F, Sørensen PS, Henriksen O(1994) Cerebrospinal fluid flow and production in patients with normalpressure hydrocephalus studied by MRI. Neuroradiology 36:210 –215.

Goldwater DS, Pavlides C, Hunter RG, Bloss EB, Hof PR, McEwen BS,Morrison JH (2009) Structural and functional alterations to rat me-dial prefrontal cortex following chronic restraint stress and recovery.Neuroscience 164:798 – 808.

Ha J, Lo KW, Myers KR, Carr TM, Humsi MK, Rasoul BA, Segal RA, PfisterKK (2008) A neuron-specific cytoplasmic dynein isoform preferentiallytransports TrkB signaling endosomes. J Cell Biol 181:1027–1039.

Hafezparast M, Klocke R, Ruhrberg C, Marquardt A, Ahmad-Annuar A,Bowen S, Lalli G, Witherden AS, Hummerich H, Nicholson S, MorganPJ, Oozageer R, Priestley JV, Averill S, King VR, Ball S, Peters J, TodaT, Yamamoto A, Hiraoka Y, et al. (2003) Mutations in dynein linkmotor neuron degeneration to defects in retrograde transport. Science300:808 – 812.

Hanz S, Perlson E, Willis D, Zheng JQ, Massarwa R, Huerta JJ, KoltzenburgM, Kohler M, van-Minnen J, Twiss JL, Fainzilber M (2003) Axoplasmicimportins enable retrograde injury signaling in lesioned nerve. Neuron40:1095–1104.

Harada A, Takei Y, Kanai Y, Tanaka Y, Nonaka S, Hirokawa N (1998) Golgivesiculation and lysosome dispersion in cells lacking cytoplasmic dynein.J Cell Biol 141:51–59.

Hirotsune S, Fleck MW, Gambello MJ, Bix GJ, Chen A, Clark GD, LedbetterDH, McBain CJ, Wynshaw-Boris A (1998) Graded reduction ofPafah1b1 (Lis1) activity results in neuronal migration defects and earlyembryonic lethality. Nat Genet 19:333–339.

Hook P, Vallee RB (2006) The dynein family at a glance. J Cell Sci119:4369 – 4371.

Hughes SM, Vaughan KT, Herskovits JS, Vallee RB (1995) Molecular anal-ysis of a cytoplasmic dynein light intermediate chain reveals homology toa family of ATPases. J Cell Sci 108:17–24.

Ilieva HS, Yamanaka K, Malkmus S, Kakinohana O, Yaksh T, Marsala M,Cleveland DW (2008) Mutant dynein (Loa) triggers proprioceptiveaxon loss that extends survival only in the SOD1 ALS model with highestmotor neuron death. Proc Natl Acad Sci U S A 105:12599 –12604.

Jeffrey RA, Ch’ng TH, O’Dell TJ, Martin KC (2009) Activity-dependent an-choring of importin alpha at the synapse involves regulated binding to thecytoplasmic tail of the NR1-1a subunit of the NMDA receptor. J Neurosci29:15613–15620.

Keays DA, Tian G, Poirier K, Huang GJ, Siebold C, Cleak J, Oliver PL, Fray M,Harvey RJ, Molnar Z, Pinon MC, Dear N, Valdar W, Brown SD, DaviesKE, Rawlins JN, Cowan NJ, Nolan P, Chelly J, Flint J (2007) Mutationsin alpha-tubulin cause abnormal neuronal migration in mice and lissen-cephaly in humans. Cell 128:45–57.

Kieran D, Hafezparast M, Bohnert S, Dick JR, Martin J, Schiavo G, Fisher EM,Greensmith L (2005) A mutation in dynein rescues axonal transportdefects and extends the lifespan of ALS mice. J Cell Biol 169:561–567.

Koltzenburg M, Stucky CL, Lewin GR (1997) Receptive properties of mousesensory neurons innervating hairy skin. J Neurophysiol 78:1841–1850.

Kudo T, Fujii T, Ikegami S, Inokuchi K, Takayama Y, Ikehara Y, Nishihara S,Togayachi A, Takahashi S, Tachibana K, Yuasa S, Narimatsu H (2007)Mice lacking alpha1,3-fucosyltransferase IX demonstrate disappearanceof Lewis x structure in brain and increased anxiety-like behaviors. Glyco-biology 17:1–9.

Kuta A, Deng W, Morsi El-Kadi A, Banks GT, Hafezparast M, Pfister KK,Fisher EM (2010) Mouse cytoplasmic dynein intermediate chains: iden-tification of new isoforms, alternative splicing and tissue distribution oftranscripts. PLoS One 5:e11682.

Lang B, Song B, Davidson W, MacKenzie A, Smith N, McCaig CD, HarmarAJ, Shen S (2006) Expression of the human PAC1 receptor leads to dose-dependent hydrocephalus-related abnormalities in mice. J Clin Invest116:1924 –1934.


Levy JR, Holzbaur EL (2006) Cytoplasmic dynein/dynactin function anddysfunction in motor neurons. Int J Dev Neurosci 24:103–111.

Mahjoub MR, Xie Z, Stearns T (2010) Cep120 is asymmetrically localized tothe daughter centriole and is essential for centriole assembly. J Cell Biol191:331–346.

Milner LC, Crabbe JC (2008) Three murine anxiety models: results frommultiple inbred strain comparisons. Genes Brain Behav 7:496 –505.

Miyoshi K, Onishi K, Asanuma M, Miyazaki I, Diaz-Corrales FJ, Ogawa N(2006) Embryonic expression of pericentrin suggests universal roles inciliogenesis. Dev Genes Evol 216:537–542.

Nolan PM, Peters J, Strivens M, Rogers D, Hagan J, Spurr N, Gray IC, Vizor L,Brooker D, Whitehill E, Washbourne R, Hough T, Greenaway S, HewittM, Liu X, McCormack S, Pickford K, Selley R, Wells C, Tymowska-Lalanne Z, et al. (2000) A systematic, genome-wide, phenotype-drivenmutagenesis programme for gene function studies in the mouse. NatGenet 25:440 – 443.

Ori-McKenney KM, Xu J, Gross SP, Vallee RB (2010) A cytoplasmic dyneintail mutation impairs motor processivity 1. Nat Cell Biol 12:1228 –1234.

Palmer KJ, Hughes H, Stephens DJ (2009) Specificity of cytoplasmic dy-nein subunits in discrete membrane-trafficking steps. Mol Biol Cell20:2885–2899.

Pascual R, Zamora-Leon SP (2007) Effects of neonatal maternal deprivationand postweaning environmental complexity on dendritic morphology ofprefrontal pyramidal neurons in the rat. Acta Neurobiol Exp (Wars)67:471– 479.

Paylor R, Hirotsune S, Gambello MJ, Yuva-Paylor L, Crawley JN, Wynshaw-Boris A (1999) Impaired learning and motor behavior in heterozygousPafah1b1 (Lis1) mutant mice. Learn Mem 6:521–537.

Perry RB, Fainzilber M (2009) Nuclear transport factors in neuronal func-tion. Semin Cell Dev Biol 20:600 – 606.

Pfister KK, Salata MW, Dillman JF 3rd, Torre E, Lye RJ (1996a) Identifica-tion and developmental regulation of a neuron-specific subunit of cyto-plasmic dynein. Mol Biol Cell 7:331–343.

Pfister KK, Salata MW, Dillman JF 3rd, Vaughan KT, Vallee RB, Torre E, LyeRJ (1996b) Differential expression and phosphorylation of the 74-kDaintermediate chains of cytoplasmic dynein in cultured neurons and glia.J Biol Chem 271:1687–1694.

Pfister KK, Fisher EM, Gibbons IR, Hays TS, Holzbaur EL, McIntosh JR,Porter ME, Schroer TA, Vaughan KT, Witman GB, King SM, Vallee RB(2005) Cytoplasmic dynein nomenclature. J Cell Biol 171:411– 413.

Pfister KK, Shah PR, Hummerich H, Russ A, Cotton J, Annuar AA, King SM,

Fisher EM (2006) Genetic analysis of the cytoplasmic dynein subunitfamilies. PLoS Genet 2:e1.

Quwailid MM, Hugill A, Dear N, Vizor L, Wells S, Horner E, Fuller S, WeedonJ, McMath H, Woodman P, Edwards D, Campbell D, Rodger S, Carey J,Roberts A, Glenister P, Lalanne Z, Parkinson N, Coghill EL, McKeone R,et al. (2004) A gene-driven ENU-based approach to generating an allelicseries in any gene. Mamm Genome 15:585–591.

Rogers DC, Fisher EM, Brown SD, Peters J, Hunter AJ, Martin JE (1997)Behavioral and functional analysis of mouse phenotype: SHIRPA, a pro-posed protocol for comprehensive phenotype assessment. Mamm Ge-nome 8:711–713.

Rogers DC, Peters J, Martin JE, Ball S, Nicholson SJ, Witherden AS, Hafez-parast M, Latcham J, Robinson TL, Quilter CA, Fisher EM (2001)SHIRPA, a protocol for behavioral assessment: validation for longitudinalstudy of neurological dysfunction in mice. Neurosci Lett 306:89 –92.

Salata MW, Dillman JF 3rd, Lye RJ, Pfister KK (2001) Growth factor regu-lation of cytoplasmic dynein intermediate chain subunit expression pre-ceding neurite extension. J Neurosci Res 65:408 – 416.

Satoh D, Sato D, Tsuyama T, Saito M, Ohkura H, Rolls MM, Ishikawa F,Uemura T (2008) Spatial control of branching within dendritic arborsby dynein-dependent transport of Rab5-endosomes. Nat Cell Biol10:1164 –1171.

Scobie KN, Hall BJ, Wilke SA, Klemenhagen KC, Fujii-Kuriyama Y, Ghosh A,Hen R, Sahay A (2009) Kruppel-like factor 9 is necessary for late-phaseneuronal maturation in the developing dentate gyrus and during adulthippocampal neurogenesis 1. J Neurosci 29:9875–9887.

Thompson KR, Otis KO, Chen DY, Zhao Y, O’Dell TJ, Martin KC (2004)Synapse to nucleus signaling during long-term synaptic plasticity; a rolefor the classical active nuclear import pathway. Neuron 44:997–1009.

Tsai JW, Bremner KH, Vallee RB (2007) Dual subcellular roles for LIS1 anddynein in radial neuronal migration in live brain tissue. Nat Neurosci10:970 –979.

Tynan SH, Purohit A, Doxsey SJ, Vallee RB (2000) Light intermediate chain1 defines a functional subfraction of cytoplasmic dynein which binds topericentrin. J Biol Chem 275:32763–32768.

Zhang J, Li S, Musa S, Zhou H, Xiang X (2009) Dynein light intermediatechain in Aspergillus nidulans is essential for the interaction between heavyand intermediate chains. J Biol Chem 284:34760 –34768.

Zheng Y, Wildonger J, Ye B, Zhang Y, Kita A, Younger SH, Zimmerman S, JanLY, Jan YN (2008) Dynein is required for polarized dendritic transportand uniform microtubule orientation in axons. Nat Cell Biol 10:1172–1180.


Documents

Behavioral and Other Phenotypes in a Cytoplasmic Dynein Light …sro.sussex.ac.uk/id/eprint/19590/1/5483.full.pdf · 2019. 7. 2. · Please see supplemental material (available at