20
Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Embed Size (px)

Citation preview

Page 1: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Beads are good for you

and for genotypingFan et al. 2005. Biotechniques 39, 583 (Illumina)Chen et al. 2000. Genome Res 10, 549 (Luminex)

Page 2: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

SNP Detection• Oligonucleotide ligation

– AM Alves and FJ Carr. 1988. Dot blot detection of point mutations with adjacently hybridising synthetic oligonucleotide probes. Nucl. Acids Res. 16: 8733

– NICKERSON DA, R KAISER, S LAPPIN, J STEWART, LEROY HOOD, AND ULF LANDEGREN 1990 Automated DNA diagnostics using an ELISA-based oligonucleotide ligation assay PNAS 87:8923-8927 

• Primer extension– Syvanen AC, Aalto-Setala K, Harju L, Kontula K, Soderlund H. 1990 A

primer-guided nucleotide incorporation assay in the genotyping of apolipoprotein E. Genomics. 8:684-92

– Kuppuswamy MN, Hoffmann JW, Kasper CK, Spitzer SG, Groce SL, Bajaj SP. 1991 Single nucleotide primer extension to detect genetic diseases: experimental application to hemophilia B (factor IX) and cystic fibrosis genes. Proc Natl Acad Sci U S A. Feb 88:1143-7.

Page 3: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Oligonucleotide Ligation

…ACGAGCTTTGAGTATAGAGTCGCCCTCAATCTGCCAA…

TCGAAACTCATATCT CAGCGGGAGTTAGAC

DNA Ligase

3’ 5’

…ACGAGCTTTGAGTATAGTGTCGCCCTCAATCTGCCAA…TCGAAACTCATATC CAGCGGGAGTTAGAC

T

DNA Ligase

Page 4: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Oligonucleotide Ligation Assay (OLA)

amplify target by PCR

ligate oligos

detect ligation product

Page 5: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Primer extension

TCGAAACTCATATCT C

DNA Pol

3’

…ACGAGCTTTGAGTATAGTGTCGCCCTCAATCTGCCAA…TCGAAACTCATATC

…ACGAGCTTTGAGTATAGAGTCGCCCTCAATCTGCCAA…

C

C

Page 6: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

One tube = one reaction = one assay?

C

C

C

C

SNP1

SNP2

SNP3

SNP4

Page 7: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Bead types

rosary beads

=

“test tube” bead

5 uM1 cM

Page 8: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Beads can be marked

5.6 um, polystyrene

Luminex beads

R. J. Fulton et al., Clin. Chem. 443, 1749 (1997)

3 um, silica

Illumina beads

Lee M, Walt DR. 2000 Anal Biochem.282:142-6.

100 color-coded types

1500 color-coded types

Page 9: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Beads can be derivatized

Each bead type can be coated with one specific probe type: e.g. oligonucleotide

=aggctcgatc

Page 10: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Luminex beads are analyzed by flow cytometry

one well=100 different beads=100 reactions

Luminex 100

Page 11: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Luminex, SBCE

Page 12: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Luminex, critical factors

ddA ddG

Page 13: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Illumina beads are analyzed through fiberoptics-ducted fluorescence excitation

1 fiber > 1 bead

1 bundle of 50k fibers -> 50k beads

96-well plate -> 0.5M beads

Page 14: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Illumina genotyping: Golden

gate

Page 15: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Illumina genotypes

Page 16: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Reviewing the product-bead relationship

AGTT

CAGG

home

TCAA

GTCC

address

TCAA

GTCC

snp1

snp2

snp1

snp2

Page 17: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Multiplexing I: basic options

• 100 sphere types• run 100 rx in 100 tubes• pool them and load them as a

single well• not impressive, we do something

like that now with fluorescent primers and the ABI 3100

Page 18: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Multiplexing II: advanced

• Run 100 genotyping rx in a single tube

• Sort each to the assigned sphere color by a zip code

Page 19: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Multiplexing III, more advanced

• oops, the scheme below does not work because different fluors will label the same ball…….

Page 20: Beads are good for you and for genotyping Fan et al. 2005. Biotechniques 39, 583 (Illumina) Chen et al. 2000. Genome Res 10, 549 (Luminex)

Factoids

Luminex Illumina

Sphere types 100 1,500

Cost per snp 0.3 0.03 to 0.4

Genotypes/8 hrs

10K ?

Mx Th. Gen/day 120K 300K

templ. amplif. locus PCR whole genome

multiplex 12-50 50-1000