Basc02 Full Dna

8/13/2019 Basc02 Full Dna

1/70

The Structure and Functionof Nucleic Acids

Revised edition

C .F.A. Bryce* and D . Pacini

*D epartment of B iological Sciences, N apier U niversity, Edinburgh, andBo lton School Boy s D ivision, Bolton


2/70

The B iochemistry Across the School C urriculum G roup (BASC ) w as set

up by the Bio chemical Society in 1985. I ts membership includes edu-

cation prof ession als as w ell as Society members w ith an interest in

schoo l science education. I ts first t ask has been to prod uce this series of

booklets, designed to help teachers of sy llabuses w hich have a high bio-

chemical content.

O ther to pics covered by this series include:Essent ial C hemi st r y forBiochemistry; Enzymes and t heir Role in Bi otechnology; M etaboli sm;

I mmunology; Photosynthesis; Recombinant D N A Technology; Biological

M embranes; and The Biochemical Basis of D isease.

More informat ion on the w ork of B ASC and these booklets is available

fro m the Education O fficer at t he Biochemical Society, 59 P ort land

Place, Londo n W1N 3AJ.

C omments on the content of this booklet w ill be w elcomed by the Series

Editor Mrs D . G ull at the above address.

ISBN 0 90449 834 4

The Biochemical Society 1998

First edition published 1991

All BASC material is copy right by the Bio chemical Society. Extractsmay be photocopied for classroom w ork, but complete reproduction of

the entire text o r incorporation of any of the material with o ther doc-

uments or coursew ork requires approval by the Biochemical Society.

Printed by H olbrooks P rinters Ltd , Portsmouth, U .K.


3/70

iii

Contents

Foreword................................................................................v

1 Nucleic acids and genetic information transfer ................1Learning objectives.................................................................................1

Introduction.............................................................................................1

2 Isolation and structure of nucleic acids..............................5Learning objectives.................................................................................5

Sugars........................................................................................................6

Bases.........................................................................................................7

Inorganic phosphate...............................................................................8

Building nucleic acids from their building blocks..............................8

Nucleoside di- and triphosphates.......................................................9

Nucleic acids.........................................................................................10DNA isolation,base composition and structure...........................12

RNA isolation,base composition and structure............................17

3 DNA replication.................................................................21Learning objectives..............................................................................21

Introduction..........................................................................................21

The Meselson and Stahl experiment................................................23Mechanism of replication....................................................................25

4 The genetic code................................................................29Learning objectives..............................................................................29

Introduction..........................................................................................29

How many bases code for an amino acid?......................................31

Evidence for a triplet code.................................................................32

Deciphering the code..........................................................................33

Nonsense codons................................................................................34


4/70

iv

5 Transcription......................................................................37Learning objectives..............................................................................37

Introduction..........................................................................................37Mechanism of transcription...............................................................38

6 Translation..........................................................................41Learning objectives..............................................................................41

Introduction..........................................................................................41

Activation of tRNA..............................................................................42

Initiation.................................................................................................43

Elongation..............................................................................................44

Termination...........................................................................................45

Polysomes..............................................................................................46

7 Assessment:past examination questions and outlinesolutions..............................................................................47Questions..............................................................................................47

Answers.................................................................................................56

8 Laboratory practicals........................................................59Extraction and characterization of DNA fromMicrococcus

lysodeikticus............................................................................................59

Purification of RNA .............................................................................61

Further practicals.................................................................................62

9Source materials................................................................63

Textbooks..............................................................................................63

Articles...................................................................................................63

Teaching aids..........................................................................................64

Subject index......................................................................65


5/70

v

Foreword

A study of the structure and functio n of nucleic acids is needed t o b e

able to understand how informat ion contro lling the characteristics of an

organism is stored in the form o f genes in a cell and how these genes are

transmitted to future generat ions of o ffspring. The rapid developments

in the area o f genetic engineering and recomb inant D N A technology

(w hich are covered in B oo klet 7 of t he BA SC series) have only been

possible as a result o f d etailed understanding o f t he structure of D N A

and RN A. I t is therefore not surprising t o see nucleic acids included in

the compulsory core subject matt er of all of the linear and mod ular A-

level Biology syllabuses. The major purpose of these guidance notes is to

provide an account o f the role of D N A and R N A in these processes in at

least suff icient detail for A-level study. Addit ional info rmat ion mo re

suited fo r general interest, O xbridge preparatio n or f irst-y ear under-

graduate study is placed in shaded boxes of text.

In order to maximize the benefit of this boo klet for A-level students

and their teachers, a set of learning ob jectives have been included at the

star t o f cha pters 16. These ob jectives are based upo n t he relevan tknow ledge and understanding statements of current A-level B iolo gy

syllabuses. C hapter 7 consists o f recent A-level examinatio n q uestions

and answ ers and this should help students get a feel for the level of detail

required. We are grateful to the various Examinations Boards, especially

the N ort hern Examinations and Assessment B oard (N EAB ), for their

permission to include this material.


6/70


7/70

1

Nucleic acids and geneticinformation transfer

Learning objectives

Each student should, w ithout reference to his or her notes, be able to :

st a t e tha t the genotype describes the genet ic composi t ion o f an

organism in terms of specific genes, i.e. alleles that it contains;

state that the phenoty pe is the collection of visible characterist ics

w hich identify an individual organism;

sta te that the phenotype of an individual depends not only on i t sgenoty pe but also on the environment in w hich it lives; and

state that D N A, w hich is found in the nucleus of a cell, contains and

is responsible fo r the tra nsfer of g enetic info rmat ion, i .e. the

genotype.

Introduction

N ormally, w hen w e talk about genes and heredity w e perhaps thinkimmediately of how children resemble their parents or, depending o n

our background kno w ledge, w e may even think about Mendel and the

height and colour of his pea plant s. This level of genetics is know n as

phenotypic expression, w here the phenotypeof an individual is the col-

lection o f visible and recogn izab le characteristics by w hich that ind i-

vidual is identif ied.

The pheno ty pe is influenced b y the environm ent as w ell as th e

genotype; but this aspect is more appropriate to classical genetics and w ill

not concern us at the present t ime. In this section w e are more concerned

w ith the collection o f the inherited factors w hich determine these trait s,

1


8/70

and this is a cells genotypic expression. The genotypeis the genetic com-

position of an organism in terms of the forms of specific genes, i.e. alleles,

that it contains, and its study is referred to as molecular genetics.

The very fact that a child can resemble one or bo th parents meansthat there w as some w ay in w hich the genetic information w as passed

fro m th e parent to the child. What then is the nat ure of t he genetic

material? The answ er to t his question came fro m th e experimental

observat ions show n in Table 1.

More to heredity than DNA

In similar types of nuclear transplantation experiments,scientists have recently

revealed that the environment of the nucleus (i.e.the cytoplasm in which it finds

itself) can alter the functioning of key genes,including those which determine

body size.These have been referred to asepigeneticchanges,these being

changes which affect the way DNA works rather than sequence changes.These

findings could have implications for in vitrofertilization in humans.

New Scientist(19 April 1997)

Single-cell organisms take a siesta

In 1997 a short report appeared which indicated that a study on the patterns of

DNA synthesis in single-cell organisms revealed that cells synthesized DNA from

sunrise to about noon,then shut down synthesis for between three and six

hours,then restarted before sunset.The explanation given for this phenomenon is

that this represents an evolutionary throwback to the Precambrian times when

there was no ozone layer and hence the suns ultraviolet light at its peak could

have damaged the DNA.This may have a future significance if the ozone layer

does continue to degrade.

New Scientist(4 January 1997)

Such stud ies represent th e most co nclusive evidence that D N A is

responsible fo r t he transfer o f genetic info rmatio n, at least in micro-

or gan isms and viruses. The evidence tha t t his is also t rue in higher

org anisms (plants and animals), alth ough somew hat less conclusive,

leaves no doubt t hat this is the case. Since some virus particles have been

found that have no D N A, but w hich have RN A instead , i t is more

correct to say that nucleic acids are the genetic information carriers.

The exact ro les of D N A and RN A in the complex process of the

transfer of genetic informat ion are the subjects of subsequent sections of

this booklet.

2 Nucleic acids:structure and function


9/70

Table 1. Steps in the discovery of DNA as the genetic materialExperimenter(s) and dates Details of procedure Conclusion

Late 19th century biologists Removal of the nucleus of the cell produced death, Something

but removal of the same volume of cytoplasm did not. cells surviva

Late 19th century biologists Removal of a cell nucleus followed by transplantation Something

of the nucleus from a different cell type changed the the phenoty

shape and function of the donor cell.

Griffiths (1929) Dead,disease-producing,virulent strains ofPneumococcus Something

were able to transform harmless cells of non-virulent dead organis

Pneumococcusinto lethal organisms. the living cel

Avery and MacLeod (1944) These workers extracted the DNA from the virulent DNA is respPneumococcusbacterium.On adding it to non-virulent i.e.a cells ph

strains these were transformed into disease-causing

organisms.The DNA contained no detectable protein

and was unaffected by proteases,but the transformation

was affected by use of DNase.

Hershey and Chase (1953) These workers infectedEscherichia colibacteria using a DNA is resp

radioactive strain of T2 bacteriophage virus in which the i.e.a cells ph

phosphorus atoms in the DNA and the sulphur atoms inthe coat protein were labelled.This revealed that only the

DNA entered the bacteria,causing transformation.


10/70


11/70

2

Isolation and structure ofnucleic acids

Learning objectives


state that D N A is composed of phosphate, deoxyribose and the four

major bases: adenine, guanine, cytosine and thymine;

state that RN A is composed of phosphate, ribose, adenine, guanine,

cytosine and uracil;

state that D N A and RN A are polymers of nucleotide subunits; state that a nucleotide is composed of a phosphate group, a pentose

sugar and one of the four corresponding bases;

state that the backbone of a D N A molecule is a chain of repeat ing

deoxyribosephosphate units;

state that the backbone of an RN A molecule is a chain of repeating

ribosephosphate units;

state that each molecule of D N A is usually composed of tw o chains;

state that in D N A, adenine w ill only bind with thymine on opposite

chains and guanine will only bind w ith cytosine on opposite chains; state that the tw o linked chains in D N A are arranged in a double helix;

st a t e tha t there a re three princ ipa l t ypes o f RN A, these being

messenger RN A (mRN A), transfer RN A (tR N A) and ribosomal

RN A (rRN A), which are all single-stranded molecules;

state the function of the three principal types of RN A;

d raw a d iagram o f a simple ladder-like representat ion o f a D N A

molecule; and

st a te that D N A is a st ab le po lynucleo t ide w hich contains codedgenetic information for inherited characteristics.

5


12/70

Introduction

Altho ugh t he nucleic acids w ere first d iscovered in 1868, by Friedrich

Miescher w or king w ith pus cells ob tained fro m discarded surgical

band ages, it w as not r eally until the early 1940s that t he chemistry andbiology of the nucleic acids w ere set on f irm foundations.

B asically, nucleic acids can be subd ivided into t w o t y pes: deoxy-

ribonucleic acid (DNA)and ribonucleic acid (RNA). Both D N A and

RN A have been show n to consist o f three groups of molecules: pento se

(5-carbon-atom) sugars; organic bases; and inorganic phosphate.

Sugars

There are only tw o ty pes of sugar present in nucleic acids, ribosewhich

is present solely in R N A (hence its name) and deoxyribosew hich is

present solely in D N A (again, the sugar gives rise to t he name deoxy -

ribo nucleic acid). The chemical structures fo r t hese compo unds ar e

show n here:

The pref ix deoxy means without oxygen , and w e can see fro m

the structures that the only difference betw een them is the absence of an

oxy gen in the deoxyribose sugar (see shaded area). Both sugars contain 5carbo n atoms (pento se sugars) and fo r convenience w e number these as

show n in the next figure. The dash o r prime () on, fo r example, the 5

indicates the carbon in the ribo se ring. The purine or py rimidine rings

(see Bases, below ) are numbered w ithout primes in order to distinguish

them.

6 Isolation and structure of nucleic acids

Ribose Deoxyribose

OHOHOH

OH OH

No OHgroup

O

H

O HOCH2HOCH2


13/70

Bases

The nucleot ide bases fo und in nucleic acids are related either t o t he

purinering system or to the pyrimidinering system.

In D N A w e f ind principally f our dif ferent bases : adenine (A),

guanine(G), cytosine(C) and thymine (T). The first tw o a re derivedfrom purine w hereas the remaining tw o are derived from py rimidine. In

R N A w e find principally fo ur different bases; adenine, guanine and

cyto sine as in D N A. The fourth base in RN A, how ever, is not thy mine

but instead the py rimidine-derived base, uracil (U).

The chemical structures for each o f t he five bases are show n below .

Nucleic acids:structure and function 7

OH OH

OH

C

HC C

H

C

O

H H

HOCH2

5

4 1

23

Purine Pyrimidine

N N N

N

H

N N

Purines

Adenine Guanine

Cytosine Uracil Thymine

Pyrimidines N HN

HN

H2N

HNCH

3

N

NH2

NH2

H

NN HNN

NN

H

NH

NH

O O O

O

O

CN

C

O


14/70

N ote: A - lev el st udent s are not expected t o recogni ze t hese st r uctu ral

formulae. For fur ther help in understandi ng the chemistry of these com-

pounds, refer to BASC Booklet 1, Essent ial Chemistry for B iochemistry.

I n add ition t o t hese major b ases there is also a large range of so-

called minor basesw hich occur less freq uently than the ot hers, e.g. 5-

methy l cy tosine.

Inorganic phosphate

There are pho sphate residues in nucleic acids and t hey are of the ty pe

derived fro m phosphoric acid, the structure of w hich is show n below.

Building nucleic acids from their building blocks

When any one of the bases is joined to either one of the tw o sugar mol-ecules, w e have a compound know n as a nucleoside. I f t he sugar residue

is ribose then w e have a ribonucleoside, w hereas if it is deoxyribose then

w e have a deoxyribonucleoside. The bond linking t hese struct ures is

know n as a glycoside bond.

Add ition o f a pho sphate group to the sugar residue of a nucleoside

molecule prod uces a d ifferent molecule called a nucleotide. Examples of

various nucleotides are show n below.


OH

OH

O

POH

Deoxycytidine 5-monophosphate Uridine 5-monophosphate

HO P

O

OH

OH2C HO P

O

OH

OH2C

HN

OH

NH2

H OHH OHHH

NN

N

O

O

O

O

O


15/70

N ucleot ides can be regard ed as the building blo cks fo r the larger

nucleic acid molecules, D N A and RN A.

Nucleoside di- and triphosphates

O ne or tw o add itional phosphates can be added to t he first phosphate

group of a nucleoside molecule (a nucleoside monophosphate, N MP ) by

means of a pyrophosphate linkage. The molecules formed in th is w ay

are called nucleoside diphosphates (N D P s) and nucleoside triphosphates

(N TP s). The most impo rta nt base involved in th ese compound s is

adenine, forming the adenosine mono-, di- and t riphosphate molecules

(AMP, AD P and ATP ), w hich fulfil vital ro les in many cellular processes

as you may know from y our study of respiration and photosynthesis

[fo r furt her details see BASC B oo klets 4 (M etabol ism) and 6 (Photo-

synthesis)].


OH OH OH

OH OH

O O O

O O O O

Base

NMP

NDP

NTP

H HHH

CH2P P POH


16/70

Nucleic acids

N ucleic acids are fo rmed by the combinat ion o f nucleot ide molecules

through sugarphosphate bond s know n as phosphodiester linkages.

Because a nucleic acid is a poly mer of many nucleot ide molecules, D N Aand RN A molecules are called polynucleotides.

The structure of a poly nucleot ide is show n d iagrammatically above.

In common w ith the formation o f o ther biological polymers, e.g. starch

and pro teins, w ater molecules are produced by condensationreactions

and energy fro m ATP mo lecules, prod uced in cellular respirat ion , isused.


35phosphodiester

linkage

35phosphodiesterlinkage

35phosphodiester

linkage

3end

5end

Adenine (A)

Guanine (G)

Thymine (T)

Cytosine (C)

O

O

P

O

H H

N

N N

NH2

H3C

NH2

NH2

NH

OH

NH

CH2

CH2

CH2

CH2

N

N

N

N

N

N

H

H

H

H HH

H

H

H H

N

H

H

H

H HH

H

H

OO

O

O

P

O

O

O

O

P

O

OO O

O

O

P

O

OO

O O

O

O

5

4

3 2

5

4

3 2

5

4

3 2

5

4

3 2


17/70

Fro m this figure it can b e seen tha t t he phosphodiester bo nd is

formed betw een the 5carbon of one sugar molecule and the 3 carbon o f

the next. The double-stranded nature of D N A is show n schematically

above.Since it w ould b e very time consuming to h ave to w rite out such a

structure every t ime it was needed, abbreviated forms have been

introduced. These are essentially of three ty pes:

If the P is on the left o f a b ase then it is att ached t o t he 5-carbon

(five); if it is on the right then it is attached to the 3-carbon (three).


Sugar

Phosphategroup

Phosphodiesterbond

A T

C G

G C

T A

ApGpCpGpUp 5

AGCGU3


18/70

DNA isolation,base composition and structure

Isolation

In order to study the chemistry of D N A it must be isolated and purifiedfrom the nucleus of a cell. In the isolat ion of D N A from cell samples, the

major contaminant is histone proteinw hich is closely associated w ith

D N A to form visible chromatin threads in the nucleus. To remove th is

contaminant the cell is first deproteinized by treatment w ith phenol and

the D N A is precipitated using ice-cold ethanol. A more detailed account

of the isolatio n of D N A is given in one of the practical schedules later

(see C hapter 8) and in B ASC Booklet 7,Recombinant D N A Technology.

O nce isolated, D N A can be broken dow n or degraded by either: (i)

treatment w ith perchloric acidat 100C , w hich breaks down the D N A

to its constituent bases; or (ii) treatment w ith enzymes(D N ase, phos-

phodiesterase, etc.) w hich break do w n the D N A to i ts const i tuent

nucleotides.

The mixture of either of these products can be separated by chroma-

tography or electrophoresis and the amount of each of the constituent

bases can be measured.

Composition

U sing the techniques outlined ab ove it w as noted by Chargaffand co-

w orkers in the late 1940s that :

(i) the base composition o f an o rganisms D N A is characteristic of t hat

organism;

(ii) dif ferent cells or tissues of the same org anism have identical b ase

composition;

(iii) closely related organisms exhibit similar b ase composition s (thisproperty is used in biology as a basis for chemical taxonomy)

(iv) the majority of D N A molecules exhibit certain chemical regularities

that are defined as C hargaff s base pairing rules (base equivalence),

namely t he amount of A equals the amount of T and t he amount of G

equals the amount o f C , as can be seen (w ithin the bo unds of experi-

mental error) from the data show n in Table 2.

I n considering t he data sho w n in Tab le 2, in terms of base eq uiv-

alence it is necessary to comb ine the values fo r cy to sine and 5-methy l

cytosine w here these apply. The only exception to base equivalence is the



19/70

D N A from the virusX 174. C an y ou t hink of an explanation? (See the

Structure section in this chapter for the solution.)

Structure

In 1947 Astbury studied D N A using the technique of X-ray diffraction,

shown schematically below.

When the beam of X -rays collides w ith an electro n-dense region in

the D N A, the beam is diff racted. From the pattern of t he diff racted

beam it is possible to determine the arrangement o f atoms in the D N A.

In this w ay, Astbury w as able to d educe that t here was a regular feature

occurring w ithin the D N A molecule every 3.34 . Such a regular feature

is referred to as a crystallographic repeator identity period.


X-raysource

Diffracted

beams

Photographic

film

DNAcrystal

Table 2.The percentage composition of bases in the DNA from avariety of organismsSource of DNA Adenine Guanine Cytosine Thymine 5-Methyl cytosine

Cattle sperm 28.7 22.2 20.7 27.2 1.3

Rat bone marrow 28.6 21.4 20.4 28.4 1.1

Sea urchin 32.8 17.7 17.3 32.1 1.1

Wheat germ 27.3 22.7 16.8 27.1 6.0

Yeast 31.3 18.7 18.1 31.9

Human sperm 30.9 19.9 19.8 29.4

Escherichia coli 26.0 24.9 23.9 25.2

X174 Phage virus 24.3 24.5 18.2 32.3


20/70

L ater w ork b y Franklin, G oslin, Wilkins and co-w orkers (1953)

demonstrated that there w ere tw o fo rms of D N A, a cry stalline form

know n as the A formand a paracrystalline form know n as the B form.

B ased o n the X-ray dif fract ion w ork and C hargaff s base eq uiv-alence rules, Watson and C rick in 1953 deduced the structure of D N A as

a double helix. This comprised two strands of sugarphosphate

backbo ne w ith the bases positioned in betw een, w ith adenine (A) on one

strand b eing hydrogen (or H -) bondedto a thy mine (T) on the ot her,

and a guanine (G ) on one strand b eing H -bond ed to a cyt osine (C ) on

the ot her. The H -bonding arrangement of these base pairs is show n

below.

A single-ringed pyrimidine base oppo site a do uble-ringed purine

base w ould ensure eq ual distance betw een the tw o poly nucleot ide

strand s but w hy AT and G C specifically ? The answ er lies in the

number of H -bonds that can be formed betw een the bases as show n (see

also B ASC Booklet 7, Recombinant D NA Technology).


N

OH

H

H

N

N

N N

CH3

N N

O

N

NH

H

H

HN

N N NH

N

O

N

O

A T

G C

Sugar

Sugar

Sugar

Sugar

H-bond


21/70

Molecular impostor that cannot form hydrogen bonds

In a recent study a synthetic chemical which resembled thymine but which had a

benzene ring instead of the pyrimidine ring and fluorine atoms in place of theoxygen and nitrogen atoms was used in an assay with DNA polymerase.Much to

the researchers surprise,a DNA helix was produced thus raising doubts on the

role of hydrogen bonds in the DNA structure. A further study showed that mol-

ecular mimics which have the wrong shape distort the helix and that this may rep-

resent the key feature of the structural stability.

New Scientist (22 February 1997)

B ecause the tw o po lynucleotide strands have direction, tw o con-

figurat ions are possible, on e in w hich bot h strand s run in the same

direction, w hich is know n as a parallel arrangement, and one in w hich

the strands run in the opposite direction, which is known as an

antiparallel arrangement. It h as been show n that th e D N A duplexes

found in nature have their chains in an antiparallel arrangement. This has

a prof ound s ignif icance w hen w e come to consider the biological

function of the molecules (see D N A replication section).

I n coiling the backbone into a helical configurat ion, tw o arran ge-

ments in space are possible, one a right-handed helix, the other a left -hand ed helix. The difference betw een th ese tw o a rrangements can b e

easily demonstrated using tw o pipe cleaners. It has been show n that t he

do uble helix of D N A fo und in nature is in the right-handed configu-

ration.


Left-handed Right-handed


22/70


23/70

Breast tissue traps carcinogens

From recent research work it would appear that the fatty tissue that constitutes

80%of womens breasts is capable of absorbing fat-soluble organic molecules,some of which are carcinogenic,causing DNA damage and mutation.It would

appear that certain foodstuffs may be the source of these carcinogens and as such

it might be impossible or difficult to avoid ingesting these.

New Scientist(7 December 1996)

RNA isolation,base composition and structure

Isolation

The isolat ion procedure is very s imilar to that for D N A isolat ionaltho ugh it is essential to include an R N ase inhibitor to prevent d egra-

dation o f the RN A. U nlike D N A, w hich exists as a more or less homo-

geneous molecule for any one cell, RN A exists as a family of molecules,

each member of w hich has a d istinctive structure and function (see later

sections in this chapter). Because of this w ide variety of RN A species it

is necessary t o separate further the initial RN A poo l into its constituent

molecules. The methods employ ed include:

density-gradient centrifugat ion; ion-exchange chromatography ;


Table 3.DNA structure and functionStructural feature Function

Strong,covalently bonded Preserves the base sequence of genetic

sugarphosphate backbone information during the lifetime of the cell

and allows shortening of the DNA during

chromosome formation in cell division

Complementary purinepyrimidine Keeps an equal distance between the two

base pairing polynucleotide strands,increasing the stability

of the double helix

Numerous but weak H-bonds Enhance stability of the helix but are easily

between complementary bases broken by enzymes to allow DNA replication

and transcription

Large,insoluble molecule Restricts DNA to the nucleus,protecting it

(molecular mass approx.100000 units) from biochemical damage,thus preserving

the genetic code


24/70

gel filtration;

electro pho resis.

Base composition

P urified RN A molecules can be degraded by chemical means (alkali) or

by enzy mes (RN ase) and the base composition determined in a manner

similar to that described fo r D N A (see section on D N A isolation in this

chapter). O ne major difference betw een D N A and RN A is that in RN A

there are a fairly large number o f mino r bases. Also, in t he majority of

cases there is no base eq uivalence, signify ing th at R N A mo lecules are

usually single-stranded.

Structure

There are three major forms of RNA: ribosomal RNA (rRNA),

transfer RNA (tRN A) and messenger RNA (mRN A) and these exist in

all the major life fo rms, together w ith ot her distinct R N A molecules

w hich are not universal. rR N A accounts for abo ut 80% of the to tal

cellular RN A and is associated w ith protein to form the cytoplasmic par-

ticles know n as ribosomes. As show n below the ribosome itself can beconsidered as tw o subunits, a large and a small , bo th o f w hich are

RN Aprot ein associations w ith ab out 65% RN A: 35% protein. The

RN A has high molecular mass and is metabolically stable.

Transfer R N A is the next mo st abund ant species and accounts for

abo ut 15% of the tot al RN A. These molecules are of much low er mol-

ecular mass than the rR N A and are also referred t o as 4S RNA. As w e

shall see later, th ese molecules functio n as adaptorsfo r amino acids in


Front view Side view

30 S subunit

50 S subunit


25/70

the course of prot ein synt hesis and many diff erent t R N As exist, each

being specificfor one amino acid. The tRN A molecule is single-stranded

but t he chain fo lds back on itself in a very d istinctive w ay (see diagram

below ) such that abo ut 5060% of the structure is base-paired.

Mo st of the remainder of the cell RN A (less than 5%) is accounted

fo r by mRN A w hich, in eukaryo tes, originates in the nucleus andmigrat es to the cy to plasm during protein sy nthesis (see C hapters 5 and

6). It is of high molecular mass and is metabolically very labile, i.e. easily

broken do w n. As w e shall see in a later section (see C hapters 5 and 6),

mRN A is centrally invo lved in the transfer and expression of the genetic

informat ion and is responsible for the sequence of amino acids in each of

th e diff erent pro teins in the cell. B ecause the siz e of the messenger is

variable, no S-value is associated w ith it.

N ote: the S-values refer to how fast a par t icular molecule sediments in an

ul t r acent r i f uge and t he S r ef er s t o Sv edber g uni t s, th e un it of mea-

sur ement in such stud ies. C learl y t hi s relates both t o themassand shape

of a molecule in that an object of greater mass w il l move faster than one

w it h l ower mass bu t the same shape, and one w it h a smal l v olume w il l

move f ast er th an one w it h a sim il ar m ass bu t lar ger v olum e (i .e. less

dense).


Loop 3

Loop 1

Loop 2Anticodon

3

5


26/70

RNAs which act as enzymes

In the late 1980s it was shown that certain RNA molecules could act as enzymes,

capable of splicing out specific sequences of RNA either on itself or other RNA

strands.The name given to such molecules wasribozymeand this work earneda Nobel Prize for one of the researchers (Tom Cech of the University of

Colorado).Two of these ribozymes are now being clinically tested as potential

treatment against HIV (see BASC Booklet 3,Enzymes and their Role in

Biotechnology,for further details).

New Scientist(7 December 1996)

A role for RNA in the treatment of debilitating disease

Specific RNA molecules are being selected from pools of randomly generated and

synthesized RNA as a means of treating the debilitating disease myasthenia gravis.

Sufferers of this disease produce auto-antibodies which block the normal signals

from nerves to muscles by blocking the acetylcholine receptor.It has been shown

that specific RNA molecules are able to bind to the antibodies,so interfering with

their binding to the receptors and hence restoring the normal nerve-to-muscle

signals (see BASC Booklets 5,Immunology,and 9,The Biochemical Basis of Disease

for further information).

New Scientist (18 January 1997)


Table 4.Differences between DNA and RNA structure and propertiesDNA RNA

Deoxyribose sugar Ribose sugar

Thymine base Uracil base

Double-stranded helix Single-stranded molecule

Very large molecular mass Much smaller molecular mass

Insoluble Soluble


27/70

3

DNA replication

Learning objectives


explain the biological significance of D N A replication;

explain the suitability of D N A structure for replication;

outline the main features of semi-conservative replication of D N A;

outline the Meselson and Stahl experiment; and

name the major enzymes involved in replication.

IntroductionIn the previous chapter i t w as show n how w e knew that t he genet ic

information o f a cell is contained in the D N A of that cell. For the cell to

divide and pro duce daughter cells in mito sis and meiosis it is essent ial

that the D N A is copied (replicated) and an identical copy is passed to the

daughter cell. D N A is replicated during interphase of bo th mito sis and

meiosis.

The basic results on w hich our present day assumptio ns of t he

mechanism of D N A replication are built are:(i) the evidence that the genetic inform ation w as cont ained w ithin the

nucleic acids;

(ii) the fact that most D N A consists of t w o strands of poly nucleotide

chains, each of w hich consists of deoxyribonucleot ide residues joined by

35 phosphodiester bonds; and

(iii) the fact that H -bonds occur betw een the bases in the tw o strand s,

adenine in one s trand is alw ay s bonded to thy mine in the other and

likew ise cy tosine with guanine.

21


28/70

Each of these w e have already considered, and thus, if w e are given

the seq uence of bases in one strand, w e could immediately w rite dow n

the sequence of bases in the complementary strand.

Basically, there are five theoretically po ssible modes of replication.

Conservative

B y this mechanism one daughter cell receives the origina l D N A

molecule whilst the other receives a completely new copy.

Semi-conservative

H ere the original D N A molecule is split into tw o s trands and each

strand acts as a template on w hich a new strand is synthesized.

Non-conservative

H ere the original D N A is destroy ed completely during the course of

synthesis of tw o new identical D N A molecules.

Dispersive

H ere the original D N A mo lecule is dispersed o r distributed into all

nascent chains.

End-to-end

H ere the original D N A molecule is present as half of one chain and the

other half of the complementary chain for both nascent molecules.

N ote: A - l ev el st udent s are onl y expect ed t o consi der evi dence f or or

against the f ir st two possible modes of replicati on out l ined above.

The five possible modes of replicatio n are show n schemat ically in t he

figure w hich follow s.

In f act it hasbeen pro ved that D N A replicates semi-conservatively,

first in E. col i, and subsequently in all higher o rganisms as w ell: it has

been show n to be the case fo r eukaryot ic cells, including human cells, in

22 DNA replication


29/70

tissue culture. The original experiment w hich pro ved th is mechanismw as carried out by Meselson and Stahl in 1958.

The Meselson and Stahl experiment

(a) Meselson and Stahl grew E. coliin a medium containing 15N H 4C l (i.e.15N is the heavy isotope of n itrogen). The result o f this was that 15N w as

incorporated into new ly syn thesized D N A (as w ell as ot her nitrogen-

containing compounds).(b) They al low ed the cells to grow for many generat ions in the

15N H 4C l so that a l l the D N A w as heavy that is, had a greater

density than no rmal. This heavy D N A could be distinguished from the

normal D N A by centrifugation in a caesium chloride (CsCl) density

gradient. Note that 15N is not a rad ioactive isotope.

(c) They t hen transferred th e cells into a medium w ith no rmal14N H 4C l and t oo k samples at various definite time intervals as the cells

multiplied, and extracted the D N A that remained as double-stranded

helices.


Parent DNA

New DNA

Parent DNA

Conservative

Semi-conservative

Non-conservative

End-to-end

Dispersive


30/70

The various samples were then run independently on C sC l gradients

to measure the densities of D N A present. The results of this experiment

w ere as follow s:

Thus the D N A that w as extracted f rom t he culture one generation

after the transfer fro m 15N t o 14N medium (i.e. aft er 20 minutes) had a

hybridor intermediate density, exactly half-w ay betw een that of D N A

containing only 15N and that containing only 14N ; each molecule must

therefore have contained one old and one new strand.

D N A extracted fro m the culture after another generation (i.e. after

40 minutes) w as composed of equal amounts of this hybrid D N A and of l ight D N A. As t ime w ent on, more and more l ight D N A accu-

mulated.

The results of the Meselson and Stahl experiment are not consistent

w ith non-conservative (only 14N -D N A bands w ould be expected from

20 minutes onw ards) or conservative (one band of 14N -D N A and one of15N -D N A at 20 minutes w ould be expected) modes of replication.

Thus far, how ever, the dat a are consistent w ith the three remaining

modes of replication. To distinguish betw een t hese, and hence determinethe mod e of replication, Meselson an d Stahl carried out an ad ditio nal

24 DNA replication

Light

Intermediate

Heavy

0Generation 1 2 3 4 etc

0Time intervalfollowing transfer (minutes)

20 40 60 80

Density

ofmolecules

afterc

entrifugation


31/70

experiment in w hich they too k the D N A isolated at 20 minutes after

transfer t o 14N -medium, strand separated t his and ran the resultant

sample on a C sC l gradient. Fo r dispersive or end-to -end mo dels w e

w ould predict a single hy brid band, w hereas for semi-conservative repli-cation w e w ould expect tw o bands, one light, one heavy. The latt er was

found to be the case and hence D N A replication is a semi-conservative

process.

Mechanism of replication

Watson and C rick, in their 1953 paper in w hich they propo sed t he

double-helical s tructure for D N A, conclude as fol low s: I t has not

escaped our no tice that t he specific pairing w e have postulated imme-

diately suggests a possible copy ing mechanism for the genetic material .

The implication w as that, ow ing to the strict complementary nature of

the strand s, the base sequence of one strand w ould d etermine the base

seq uence of the ot her. It could be imagined therefo re that replicatio n

could follow a scheme as show n below.


53

3

3

3

3

3

3

3

5

5

5 5

5

5

5


32/70

The problem, ho w ever, w ith this scheme is that the energy required

for the first step, namely strand separation, w ould be far too high to be

plausible. This led to the suggestion that unfold ing took place a little at a

time, so forming a replication forkas show n.

H ere, as elsew here in b iochemical reactions, an enzy me is used as a

cataly st. Enzymes low er the energy needed to activate a reaction, makingit more likely t o o ccur. For E. col ithis is an enz y me called DNA poly-

merase III. The simplest scheme w ould be for poly merase molecules to

att ach themselves to the ends of the single-stranded D N A template and

to synthesize a complimentary strand of each.

The first problem encountered w ith this proposal aro se because the

polymerase enzy me was found t o operate in one direction only, that is it

synthesized the nascent D N A strand in the direction 5!3. This meant

that one of the parent strands (called the leading strand) could be copiedin a continuousfashion, w hereas the ot her (called the lagging strand)

could only be copied in a discontinuousw ay as a series of short lengths

(approx. 1000 bases long) of D N A, each o f w hich is called an Okazaki

fragment (see Figure below ). It w as also d iscovered early on t hat t he

D N A polymerase enzy me could not ac tual ly sy nthesize a D N A

molecule from individual D N A nucleot ides but instead required a short

stretch of existing D N A helix duplex on w hich to build. In this sense it is

truly a DNA-dependentD N A polymerase II I.

26 DNA replication

3

5

3

3

5

5

RNAprimer

Helix-destabilizing protein

DNA helicase

DNA gyrase

DNApolymerase III

3

5


33/70

The full details of the process of replication are beyond the scope of

the A-level syllabus but it may be of interest to know the roles of some

of th e major enz y mes/pro teins involved in t he process. The details

required for A-level are given in bold in Table 5.

E xposure to io niz ing radiat ion and carcino genic chemicals, e.g.

phenols in cigarette tar, probab ly overw helm D N A-repair enzy mes

resulting in gene mutation and cancerous cells.


Table 5. Enzymes involved in DNA replicationEnzyme Function

DNA polymerase III The replicase enzyme

DNA polymerase I A repair enzyme involved in removing errors and filling

in gaps in the sequence

DNA ligase Seals nicks in the sugar-phosphate backbone

RNA polymerase Make RNA primers to get the DNA polymerase III started

or RNA primase

RNase H Removes the RNA primers once they have completed

their function

DNA helicase and Unwind the DNA duplex

DNA gyrase

Helix-destabilizing protein Prevents the unwound DNA from immediately rewinding


34/70

4

The genetic code

Learning objectives


state that the unit of information is the codon a sequence of three

bases (on D N A and mRN A) representing one amino acid;

st a te that since there are four bases there are 64 poss ib le t r iplet

codons;

state that all codons have been assigned to amino acids or start/stop

signals;

give details of the characteristics of the genetic code; and p red ict t h e amin o acid seq u en ce o f a pro t ein f ro m an m R N A o r

D N A base sequence (w ith the aid of a copy of the genetic code).

Introduction

The middle to late 1950s w as a part icularly active and prod uctive phase

w ith respect to t he research to aid our und erstanding o f the process of

gene expression. At about this time C rick formulated thecentral dogma

w hich, in the earliest forms, was expressed as:

Thus far, w e have seen that the genetic informat ion w hich dictates a

cells phenot ype is stored in the D N A and this can be passed to pro geny

29

Replication DNA RNA Protein

TranslationTranscription


35/70

cells via the process of replication. We will now consider how this stored

information is expressed to y ield the specific phenoty pe.

A key feature in this respect is the concept of a genew hich has been

defined operationally as a region of t he genometha t segregates as asingle unit during meiosis and g ives rise to a definable phenoty pic trait

such as a red o r w hite ey e in D rosophi laor a round o r w rinkled seed in

peas .

The genome is the sum of all D N A nucleot ide/base seq uences in an

individual organism or species.

Later work demonstrated that a gene or gene regioncorresponds to

a length of D N A on the genome that contains the informat ion for t he

synthesis of a single protein. This led to the useful concept that o ne gene

corresponds to one protein.

H ow ever, as a great many biologically active proteins comprise

more than one poly peptide chain, it is more correct to consider this as

one gene one polypeptide chain.

Altho ugh serving as a useful memory aid, even this statement is not

entirely correct since some genes code fo r single structural R N A mo l-

ecules, such as mRN A and tR N A, rather than po lypeptide chains and,

also, more recent studies have revealed ad dit ional complexities in terms

of the structural organizat io n of the genet ic information. Fo r thepurposes of the present section, ho w ever, it is acceptable to t reat the gene

in terms of the one gene one polypeptide chain hypothesis.

Building a human chromosome

The first synthetic chromosome,that of yeast,was built about a decade ago.To

extend this to the synthesis of a human chromosome required detailed consid-

eration of further structural complexities.Thus,in addition to the structural genesthere is a need for telomeres,long repeating DNA sequences which protect the

ends of the chromosome and prevent them binding together,and centromeres,

which provide the scaffolding that enables duplicate chromosomes to split during

cell division.Using this approach,totally artificial chromosomes have been

produced and it is hoped that these may help in gene therapy in the future.

New Scientist(5 April 1997)

30 The genetic code


36/70

To t ransfer the genetic informat ion fro m D N A to a seq uence of

amino acids that co nstitutes a poly peptide chain involves tw o discrete

but consecutive processes:

(i) transcription, in w hich an mRN A strand of nucleot ides is syn-thesized from o ne of the strands of the D N A in the gene region; and

(ii) translation, in w hich the genetic information coded as a seq uence of

bases in mRN A is translated or converted into a sequence of amino acids

to form a discrete polypeptide chain.

The gene regions specific to protein synthesis collectively only rep-

resent a small part o f the genome for many cells. The remaining regions

are accounted for as non-coding/nonsense sequences, multiple repeat

sequences, control regionsand regions specify ing the synthesis of func-

tional RN A molecules such as tRN A and rR N A. A summary of these

features is show n below.

How many bases code for an amino acid?

In the next section w e shall consider details of the mechanism by w hich

the informat ion coded in the mRN A is used to synthesize proteins of aspecific sequence. An important concept underpinning this topic is the

nature of the code used to translate the seq uence of bases in the mRN A

mo lecule into a seq uence of amino acids in a poly peptide chain. This

code is referred to as the genetic codeand in the present section w e shall

consider the general properties of the code.

For mRN A to contro l the synthesis of specific proteins w e must ask

how a molecule made up from o nly four d if ferent kinds of base can

determine the order of about 20 different amino acids. O bviously there

cannot be a 1:1 correspond ence betw een the RN A bases and the amino


Transcription

Control region for gene A Multiple copies of gene CControl region for genes B1 and B2

Translation

gene A

Protein A Protein B (dimer)

Non-codingsequences

mRNA mRNA mRNA tRNA

gene B1 gene B2


37/70

acids. Similarly there canno t b e a 2:1 cor respon dence, since this o nly

allow s for 16 different arrangements (44). I f, ho w ever, there are three

bases cod ing fo r each amino acid, the number of possible triplets is 64

(4

4

4), w hich w ould be enough combinat ions to code for eachamino acid w ith plenty to spare. C lear-cut evidence has been produced

that th e triplet theory is correct and w e w ill now look at t he evidence

for such a view. The name given to the sequence of three nucleotides is a

codon.

Evidence for a triplet code

The evidence for a t riplet code comes from genetic studies by C rick and

co-w orkers using mutations caused by acridine orange or pro flavine in

fruit fl ies. The mode of action of these compounds is not fully

understo od but t he net effect is to cause the insertion of an add itional

base into a D N A strand or to delete one of t he bases in a D N A strand,

possibly during D N A replication.

I t is easier t o explain th e results of t hese stud ies by considering a

simple model and study ing its behaviour. If w e assume a D N A sequence

to be a series of t riplet codes of bases, or codons, for five amino acids:

CAT CAT CAT CAT CAT

The insertio n of a base, T:

CAT TCA TCA TCA TCA

O r deletion o f a base, C , from the original sequence:

CAT ATC ATC ATC ATC

The result o f a single muta tio n (either insertio n o r d eletio n) is tocause the genetic message/amino acid seq uence every w here to the right

of the mutation to be misread.

The result w ould a lmost certainly be a defective protein or enzyme,

especially if t he amino acid sequence is in or n ear the active site of an

enzyme.

Also in these studies it w as show n th at if w e insert a n extra b ase,

then delete another base a litt le further on in the sequence, the net result

is an almost identical product (demon strat e this for y ourself). The

important point here is that the insertion and deletion are relatively close

32 The genetic code


38/70

to gether (w hy ?). There are all sorts of o ther w ay s of comb ining

mutat ion, but the net results provide very strong evidence in favo ur of a

triplet cod e. These results also pro vide add itional dat a concerning t he

mode of t ranslating the code.

Deciphering the code

The prob lem o f deciphering t he code, that is assigning amino acids to

each of the codo ns, has been approached using a variety of techniques,

the most pro ductive being the ribosome-binding techniquedevised by

Leder and N irenberg. This metho d, like many of the ot hers, makes use

o f synthetic mRNA, w hich in t his case is only three bases long, i.e. a

s ingle codon. C lear ly the advantage of using an mRN A of know n

seq uence is that it makes data interpretat ion a relatively straight forw ard

process.

The ribosome-binding techniq ue involved mixing a sample of pure

synt hetic codo n w ith ribosomes and then, in turn, each of the different

amino acids (w hich had been radioact ively labelled), each linked to their

corresponding tR N A. Each mixture w as filtered th rough a M illipore

fi l ter w hich caused the ribosome and any bound components to be

retained on the filter. The filter could then be tested for radioactivity. I fw e consider as an example the triplet U U G , then it w as found that the

sample w hich contained rad ioactive serine did not b ind to the filter, and

likew ise for the amino acids try ptophan, gly cine, methionine, ty rosine,

etc. In fact, the only sample w hich retained radioactivity on t he filter

occurred w hen leucine w as used (see diagram below ) and therefore it can

be concluded that the codon U U G codes for leucine (Leu).


U UG U UGAA CA AC

Leu*Leu*

RibosomeSyntheticmRNA codon

Anti-codon

Amino acidtRNA molecule


39/70

This process is then repeated exactly as abo ve for a d ifferent tr iplet

code. U sing this simple y et highly efficient technique (w ith some minor

mod ifications) it w as possible to assign 61 of the 64 possible triplets

unamb iguously t o specific amino acids, and t he accepted cod e is asshow n here.

Nonsense codons

As has just b een seen, 61 of th e 64 triplets have b een a ssigned t o par-

ticular amino acids w hat then is the function o f the remaining three,

UAA, UAG and UGA? These w ere initia lly labelled as the nonsense

codonsbut it has since been show n that they have an important function

in prot ein biosynt hesis as chain-terminating signals. I t is these codons

w hich info rm t he protein-sy nthesizing system that the nascent poly-

peptide chain has been completely synthesized and to thus allow it to be

released from the ribosome.

34 The genetic code

U

U C A G

C

A

G

U

C

A

G

UUU

UUC

UUA

UUG

UCU

UCC

UCA

UCG

UAU

UAC

UAA

UAG

UGU

UGC

UGA

UGG

CUU

CUC

CUA

CUG

CCU

CCC

CCA

CCG

CAU

CAC

CAA

CAG

CGU

CGC

CGA

CGG

AUU

AUC

AUA

AUG

ACU

ACC

ACA

ACG

AAU

AAC

AAA

AAG

AGU

AGC

AGA

AGG

GUU

GUC

GUA

GUG

GCU

GCC

GCA

GCG

GAU

GAC

GAA

GAG

GGU

GGC

GGA

GGG

U

C

A

G

U

C

A

G

U

C

A

G

} } }

} }

}}}

}}

} }}

}}

}

}}

}

}

}

Phe

Ser

Pro

Thr

Ala GlyVal

Met

Ile

Leu

Leu

His

Gln

Asn

Lys

Ser

Arg

CysTyr

OCHRE

AMBER

?

Trp

Arg

Asp

Glu

SECOND LETTER

FIRSTLETTER

THIRDLETTER


40/70

Fro m the experiments just described, plus other related studies, the

general features of the code that are important are as follow s:

the code is sequential (i.e. it is read in strict seq uence from one end

to the other); and the code is degenerate.

A mo st important feature is that many amino acids are coded by

more than one triplet (all except methionine and t ry ptophan). Indeed it

seems that fo r most amino acids only the first t w o b ases of the codo n

need b e specified. A code of this ty pe is termed d egenerate. It fo llow s

from t his that more than one kind of t RN A may code for the same

amino acid. This is in fact know n to be the case.

The code is universalor ubiquitous.

At present, as a result o f experimenta l dat a, it is generally accepted

that the code is universal, e.g. L ipmann and others demonstra ted using

yeast, M icrococcalor E. colitR N A, rabbit reticulocy te ribosomes and

mR N A for haemoglobin that a perfect ly no rmal protein, indist in-

guishable from w ild-ty pe, could b e formed. M ore recently, how ever,

some exception s to t his generalizatio n have been identified in mito -

chondria, leukaemic cells and in some ciliates, and these observat ions are

presently posing a challenge for evolutionary theorists.



41/70

5

Transcription

Learning objectives


explain the meaning of the term transcription;

explain the ro le o f mR N A;

explain the relationship of mRN A to the D N A template;

outline the necessity of moving the genetic information required to

synthesize proteins from the nucleus to the cyto plasm;

state that the genetic information is carried to the cytoplasm by an

mRN A s t rand w hich is complementary to the D N A templatestrand;

st a te t h at o n ly a r ela tiv ely sh o rt seg men t o f D N A co d in g fo r a

specific polypeptide is transcribed as a unit from the template strand

of D N A;

sta te that mRN A is synthesized by RN A polymerase using r ibo-

nucleoside triphosphates as substrates and D N A as a template; and

outline w ith the aid of simple labelled diagrams the process of trans-

cription.

Introduction

Tran scription invo lves th e syn thesis of an mR N A mo lecule comple-

mentary to a gene region/specific nucleot ide sequence of D N A. This

being the case, w e req uire the basic building blo cks fo r R N A, namely

free RN A nucleotides and ATP molecules for energy to gether w ith a

D N A molecule, part o f w hich w ill be copied, the latter being called a

DNA template.

37


42/70

Fo r such a process to be undertaken at an appro priate and suffi-

ciently fast rate for the cell req uires the help of an enzy me, which in this

case is called D N A-dependent R N A poly merase or just RNA poly-

merase. This enz y me cannot synthesiz e an mRN A strand fr om f reeRN A nucleot ides unless a D N A molecule is present.

I t is worth remembering that enzy mes have three key advantages.

(i) They act as biological catalyststo speed up biochemical reactions by

low ering the energy needed to activate a reaction. This means a reaction

is far mo re likely to proceed und er the conditio ns fo und in cells, e.g.

moderate temperature and low pressures.

(ii) They usually have high specificity in that one very specific reaction

(or a few related reactio ns) is cata ly sed b ecause of t he specific th ree-

dimensional shape of the active site.

(iii) Their activity can be controlled, e.g. by their prod ucts and o ther

compounds.

Mechanism of transcription

The enz y me RN A poly merase, like D N A poly merase, operates in the

direction 5!3, that b eing the direction in w hich the mRN A is syn-

thesized. U nlike D N A poly merase it only transcribes one strand o fD N A, i.e. genes are located on a single D N A template strand .

To und erstand the mechanism of this process it is clearly of interest

to know the w ay in w hich the start o f each gene is correctly recognized.

The picture w hich emerged from a study of the D N A sequences near the

start of specific gene region s w as that of AT-rich sequences of bases.

These seq uences w ere situat ed a few bases upstreamfro m the starting

point of the mRN A transcript, as show n here.

38 Transcription

pecific gene Base sequence near the start of specific gene region

fd

T7 A2

Lac-UV-5

SV40

E. coliTyr tRNA

CTGACTATAATAGACAGGGTAAAGACCTG

TGCAGTAAGATACAAATCCGTAGGTAACA

GCTCGTATAATGGTTACAAATAAAGCAAT

CAGCTTATAATGGTTACAAATAAAGCAAT

TTTGATATGATGCGCCCCGCTTCCCGATA


43/70

The AT base pair has tw o H -bonds compared w ith three for the G C

ba se pair (see C hapt er 2); and co nseq uently a region rich in AT pairs

tends to melt or strand separate more readily, so f orming a bubble. The

advant ages of for ming this bubble are that (i) it helps the RN A poly -merase to identify the start of the gene region and (ii) it allow s the RN A

poly merase to select mo re easily the template or cod ing strand and so

allow asy mmetr ic sy nt hesis to ta ke place. I n fa ct it is the non-TATA

stran d (i.e. th e 3!5 strand) that acts as the template stran d in t ran-

scription.

O nce correct initiationhas been achieved t he RN A poly merase

moves along the template strand sy nthesizing an mRN A fro m RN A

nucleot ides. The base on each successive RN A nucleot ide is com ple-

mentary to the D N A template strand.

The mechanisms for termination of t ranscription vary from gene to

gene. Fo r some genes an ad ditional pro tein called rho() ident ifies the

termination site and causes the RN A poly merase to stop sy nthesis .

O ther mechanisms, as show n schemat ically below , include (i) an AT-rich

region f lanked on either side by a G C -rich region or (ii) a palindromic

region. In bo th t hese cases a bubble structure is fo rmed w hich can be

considered to act as a phy sical barrier, so causing the RN A poly merase

to terminate synthesis as show n.

Ea ch mRN A strand t hen exits the nucleus through po res in the

nuclear membrane and att aches to ribosomes in the cell cytoplasm.


CGrich CGrichAATATTA

TTATAAT

CGATAATCG

GCTATTAGC

AATATTA

TTATAA

T

AATATTA

TTATAA

T

growing mRNA

RNA polymerase

growing mRNA

mRNA

mRNA

TAGC

ATCG

A

GCTA

CGAT

A

TT

TAGC

ATCG

GCTA

CGAT

(i)

(ii)


44/70

The mechanism of transcription is summarized schematically below.

40 Transcription

TATA

TATA

TATA

TATA

TATA

Sense strandRNA polymerase

Gene

Initiation site

DNA unzipped byRNA polymerase

Termination sequence


Growing mRNA transcript

mRNA


5


45/70

6

Translation

Learning objectives


state that ribosomes are responsible for the translation of the genetic

inform ation encoded as a seq uence of bases in the mR N A strand

into a specific sequence of amino acids in a polypeptide chain;

outline the functions of ribosomes, mRN A, tRN A and amino acids

in translation; and

outline the processes involved in translation using the terms: codon,

anticod on, peptide-bond formation and termination , using simplediagrams.

Introduction

I t can b e show n that no specific affinity /binding occurs betw een amino

acids and the mRN A, to neither the sugarphosphate backbone nor the

bases (see the Figure below ). This being the case, we cannot have a direct

read-off in translation as w e did in replication and transcription.

The solutio n to this prob lem is to h ave an indirect associatio n

achieved by coupling the specific amino acid to t he mRN A via an

adaptor molecule, w hich turned out to be tRN A.

41

mRNA

Amino acid

No reaction Binds to mRNA

Binds to amino acid

mRNA

tRNA


46/70

The tRN A molecules must be activated befo re they can at tach to a

specific amino acid and perfo rm their ro le in translation o f th e genetic

code.

Activation of tRNA

To b ind the amino acid to t he tRN A molecule requires ATP energy and

a specific enzy me called an amino acyl-tRNA synthetase. The reactio n

occurs in tw o stages: in the first the amino acid is activated and in the

second the activated a mino acid is transferred t o its specific tRN A as

show n schematically below.

42 Translation

A

A

Amino acid Enzyme (amino acyl-

tRNA synthetase)

ATP

PyrophosphatePhosphate

A

A

CCA

tRNA

CCA

AMP

CCA

Amino acyl-tRNA(an activatedamino acid)


47/70

The amino acy l-tRN A synthetase enzy me, apart from catalysing the

reaction , also displays high specificity in that it w ill only bind a par-

ticular amino acid to its correct, specific tRN A mo lecule thus ensuring

high accuracy /fid elity in the tran slation event. The amino acids arelinked to the 3 end of the tRN A (all end w ith the seq uence C C A-O H )

via their carboxyl group (C O O H ).

Initiation

Translation of the mRN A strand starts from the 5 endat a specific ini-

tiation siteor triplet codon, AU G , w hich normally codes for the amino

acid methionine. This initiation site AU G codo n is distinguished from

all other AU G seq uences as it is preceded in the mRN A seq uence by an

AG G A base seq uence, know n as the ShineDalgarno consensus

sequence, named after the discoverers.

This seq uence is recogniz ed by a U C C U complementary seq uence

in the tRN A of the small ribosomal subunit and so causes the ribosome

to bind to the correct starting point on the mRN A as seen below.

It w as also show n that t his uniq ue AU G binds a special amino acid

(linked to its correspond ing tRN A as described previously). This special

amino acid is a methio nine residue in w hich the amino g ro up has a

formyl group (C H O ) bound to it and is called N-formylmethionine

(fM et) in prokary ot es. The advantage of this added complexity is that

this effectively b locks the amino group and inhibit s it reacting, thereby

directing the polypeptide chain to be synthesized in the N -terminal!C -terminal direction. Eukary otes do not use the formy l group.


AGGA AUG AUG AUG AUG

AGGAUCCU

AUG AUG AUG AUG

5

5

3

3


48/70

B y such means an initiation complex is fo rmed in w hich the

ribosome is bound to the correct site on the mRN A and t he first amino

acid (linked to its corresponding tR N A) is in position.

Elongation

Aft er this the next amino acid specified by the codo n follow ing the

AU G seq uence (again an amino acy l-tR N A) is bought into posit ion

alongside the first residue in order that these can be linked together via a

peptide bond, an example of a stro ng co valent bo nd. The energy

req uired f or t he format ion of a pept ide bond comes from the high-

energy b ond betw een the tRN A mo lecule and its specific amino acid

produced by the breakdow n of ATP molecules.

The condensation of (or peptide bond betw een) the tw o amino acids

is cataly sed b y an enzy me called peptidyl transferase, one of the con-

stituent pro teins of the RN Aprotein complex that makes up the large

ribosomal subunit. In this w ay, the fM et is transferred on t o th e ot her

amino acyl-tRN A and i ts tR N A (called a spent tRNA) leaves th ecomplex. The ribo some mo ves alon g t hree bases by a pro cess called

translocationand this allow s the next amino acyl-tR N A to b ind to its

codo n on the mRN A. The individual amino acyl-tRN A molecules bind

to the correct codo n seq uences by virtue of each tR N A having a three

base sequence, know n as the anticodon, w hich is complementary to the

codon seq uence and so H -bonds to it . B ecause only a specific tRN A

molecule attaches to t he mRN A codon t he correct amino acid is placed

in the gro w ing poly peptide seq uence. The gro w ing chain is transferredto t he incoming amino acyl-tR N A via a second peptide bo nd and , as

44 Translation

fMetOH

SpenttRNA

tRNAmolecules

Amino acids

Peptidebond

aa2 aa2 fMet


49/70

before, the spent tR N A leaves the complex because of the relat ive

w eakness of the H -bonds between the codon and ant icodo n bases.

Termination

The abo ve process cont inues exactly as described unt il the ribo some

encounters one of t he codons referred to earlier as the nonsense codo ns

(see C hapter 4). As those cod ons do not code fo r specific amino acids

th is serves as the signal to terminat e the process and consequently the

ribo some dissociates fro m the mRN A and th e poly peptide chain is

hydroly sed from the tRN A to w hich it is currently bo und.

O nce prot ein synt hesis is under w ay, the formy l group is cleaved

fro m the methionine by an enzy me called deformylaseand, for many

proteins, a number of amino acids are also removed fro m the N -terminal

end by peptidaseenzy mes. This type of processing is referred to as post-

translational modification. The poly peptide chain w ill now fo ld up

into t he seconda ry and tert iary structure of t he function al protein/

enzyme and is transported to its req uired location in the cell through the

rough endoplasmic reticulum membrane system.


Ribosome

Start

mRNA

3end

5end

Complete polypeptidereleased

Ribosomesubunits released

Stop

Growing polypeptide


50/70

Therefo re, by the processes of t ranscriptio n and tr anslatio n the

large, permanent, insoluble D N A mo lecule, w hich is restricted to the

nucleus, can con tro l the expression o f it s genetic code by prod ucing a

prot ein/enzy me molecule w hich can now aff ect a b iochemical processthroughout the cell.

Polysomes

In the living cell, each strand of mRN A usually carries several ribosomes

at any one time, each at a diff erent stage in the formation o f the protein

w hich is being sy nthesized. Such gro ups of ribo somes strung o ut o n a

thread of mR N A are know n as polyribosomesor polysomes, as show n

here in the electro n micrograph.

The poly some mechanism protects the mRN A mo lecule, delay ing

its breakdow n, and greatly increases the eff iciency of t ranslation , i.e.

many prot ein molecules can be prod uced from a single mR N A strand,

thus saving the cell energy.

P oly somes are fo und bo th fr ee in the cy to plasm and closely asso-

ciated w ith the outer face of the rough endoplasmic reticulum membrane

system.

Recreating an extinct bird

Groups of researchers in Japan and New Zealand are studying the genetic

makeup of the giant moa,a flightless bird which became extinct about 300 years

ago.These workers have isolated DNA from the femur of a giant moa and plan to

introduce these into chicken embryos.The area of particular interest is the

homeobox,which controls embryonic development by switching specific genes

on or off.It is hoped in this way to switch on common ancestor genes and to see

if they can reproduce some of the features of the extinct moa.

New Scientist (4 January 1997)

46 Translation

260000


51/70

7

Assessment:past examination questionsand outline solutions

As stated earlier, i t is hoped t hat the inclusion o f d etailed learning

objectives w ithin each section o f these guidance notes w ill not o nly help

students to identify key to pics in the syllabus but also help them to

gauge the level of expected outcome, and hence be of value in the formal

assessment of the material.

Many of the Examination B oards publish detailed analy ses of the

exam-question performance and it may be w ort hw hile to read thesecarefully and modify the guidance notes w here appropriate to reflect the

vary ing emphasis placed on the different themes within this broad to pic.

The follow ing q uestions are actual A-level B iology examination

q uestions together w ith their solutions provided by the authors. O ther

solutions and approaches may also be valid. P resented in this w ay they

might serve as useful source material in the review of each of the sections

at t he end o f f ormal lessons. O nce again, w e are grateful to t he various

Examinat ion Boards , especial ly the Northern Examinat ions and

Assessment B oard , fo r allow ing past examination q uestions to be used.Answ er all the questions in the spaces provided.

Question 1

The diagram show s the seq uence of bases on one strand o f a short length

of D N A. This sequence should be read from left to right.

CGACCCCAG

47


52/70

(a) G ive:

(i) the base sequence tha t w ill be pro duced as a result o f t rans-

cription of the complete length of D N A show n in the diagram;

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (2)(i i) the three bases of t he tRN A that w ill correspond to the

sequence of bases show n by the underlined bases on the diagram.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (1)

As a result of a mutation, the first base in the length o f D N A show n in

the diagram is lost (deleted).

(b) (i) U se Table 6 to ident ify the f irst tw o amino ac ids for w hich

the mutated D N A codes;

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (1)

(ii) explain w hy mutat ions involving the deletion of a base mayhave greater effects than those involving substitution of onebase for ano ther.. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (2)

Question 2

In an invest igat ion of D N A replicat ion, a species of bacterium w as

grow n fo r many generations in a medium containing the 15N isoto pe of

nitrogen, rather than its more common form, 14N .

D N A w as isolated fro m the bacterial cells and separated into single

strands by mild chemical treatment. The density of this single-strandedD N A w as measured using density -gradient centrifugat ion. I n this

48 Past examination questions

Table 6.DNA base sequences and the amino acids for which theycodeDNA base sequence Amino acid

ACC Tryptophan

CAG Valine

CCA Glycine

CCC Glycine

CGA Alanine

GAC Leucine


53/70

techniq ue, samples of dif ferent densities settle at d iff erent levels in the

tube. Some of the results obtained by using this technique are show n in

the Figure. All samples w ere treated in the same manner.

(a) D ensity-gradient centrifugation enables different types of D N A

to be dist inguished. Explain how the use of the 15N isoto pe in

this experiment makes this possible.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (2)

(b) Account for t he results obt ained in Tube C , explaining w hy no

D N A of intermediate density w as observed at this stage.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (3)

(c) B acter ia like those that gave the resul t show n in Tube C of t he

Figure w ere grow n fo r a further generat ion o n a medium con-

taining 14N . D N A w as isolated from these bacteria and treated

as in the first investigation.

Show, o n the follow ing Figure, the result expected w ith density -

grad ient centrifugat ion. Also, indicate the relat ive amo unt ofeach type of D N A you w ould expect to be present.


Tube CTube BTube A

DNA X

DNA frombacteriagrown on 14N

DNA frombacteriagrown on 15N

DNA from bacteriagrown originally on 15N,but then transferred forone generation to a mediumcontaining 14N

Sugarsolution


54/70

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (2)

Studies w ere carried out to determine the nitrogenous base composition

of D N A in this bacterium. This involved f inding values for d ouble-

stranded D N A as w ell as for each individual ( and ) D N A strand.

The Table below gives some of the results obt ained.

(d) Enter the seven missing values in the table. (4)

(e) Wh at ra tio o f (AG ) to (CT) w ould y ou expect in the band of

D N A marked as X in Tube C in the first Figure? Explain y ouranswer.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (2)

Question 3

Albino m ice are completely w hite because they cannot prod uce coat

pigment. They cannot produce this pigment because of a gene mutation

that aff ects the formation o f an enzy me in the metabolic pathw ay that

50 Past examination questions

DNA from bacteriagrown originally on 15N,but then transferred fortwo generations to amedium containing 14N

Table 7. Base composition of DNAPercentage of base

present in DNA sample Ratio of (AG) Ratio of (AT)

DNA sample A G C T to (CT) to (CG)

Double-stranded 30 20 20 1.00 1.5

Strand 28 26 32 1.17

Strand 32 0.85


55/70

prod uces the pigment. The enz y me produced by the mutant gene do es

not function effectively.

(a) (i) Explain w hat is meant by gene mutation;. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (1)

(ii) explain how a gene mutation could result in a change in the

amino acid sequence in the enzyme produced by the coat-

pigment gene.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (4)

(b) Expla in w hy mice that are heteroz y gous for th is mutant gene

are never albinos.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (2)

Question 4

The diagram show s part of a D N A molecule.

(a) H ow are the tw o strands of the D N A molecule held together?

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (1)

(b) What do each of the follow ing letters on the diagram represent?

W. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

X . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Y. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Z . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (4)


Yguanine

W

Z

X

thymine


56/70

Question 5

O ne techniq ue used to produce human insulin by genetic engineering

involves inserting a gene for human insulin into the D N A of a bacterium.

(a) N ame the enzyme that w ould be used to:

(i) cut the bacterial D N A;

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (1)

(ii) insert the D N A for human insulin into the cut bacterial D N A.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (1)

(b) There are 51 amino acids in insulin, made up of 16 amino acids

out o f the 20 that are coded fo r by D N A. What is the minimum

number of dif ferent ty pes of tR N A molecule necessary fo r thesynthesis of insulin? Explain y our answer.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . (2)

(c) The base seq uence below is par t o f the D N A seq uence that

Documents

Basc02 Full Dna