KUOPION YLIOPISTON JULKAISUJA G. - A.I.VIRTANEN -INSTITUUTTI 46 KUOPIO UNIVERSITY PUBLICATIONS G.

A.I.VIRTANEN INSTITUTE FOR MOLECULAR SCIENCES 46

JANI RÄTY

Baculovirus Surface Modifications for Enhanced Gene Delivery and

Biodistribution Imaging

Doctoral dissertation

To be presented by permission of the Faculty of Natural and Environmental Sciences of the University of Kuopio for public examination in Auditorium, Kuopio University Hospital,

on Saturday 25th November 2006, at 12 noon

Department of Biotechnology and Molecular medicine A.I. Virtanen Institute for Molecular Sciences

University of Kuopio

Distributor: Kuopio University Library

P.O. Box 1627 FI-70211 KUOPIO FINLAND Tel. +358 17 163 430 Fax +358 17 163 410 http://www.uku.fi/kirjasto/julkaisutoiminta/julkmyyn.html

Series Editors: Research Director Michael Courtney, Ph.D. Department of Neurobiology A.I. Virtanen Institute Research Director Olli Gröhn, Ph.D. Department of Neurobiology A.I. Virtanen Institute

Author’s address: Department of Biotechnology and Molecular Medicine A.I. Virtanen Institute for Molecular Sciences University of Kuopio P.O. Box 1627 FI-70211 KUOPIO FINLAND Tel. +358 17 163 750 Fax + 358 17 163 751 E-mail: Jani.Raty@uku.fi

Supervisors: Professor Seppo Ylä-Herttuala, M.D., Ph.D. Department of Biotechnology and Molecular Medicine A.I. Virtanen Institute for Molecular Sciences Professor Kari Airenne, Ph.D. Department of Biotechnology and Molecular Medicine A.I. Virtanen Institute for Molecular Sciences

Reviewers: Mikko Savontaus, M.D., Ph.D. Turku Centre for Biotechnology

University of Turku Mikko Kettunen, Ph.D. Department of Biochemistry University of Cambridge

Opponent: Professor Christian Oker-Blom, Ph.D. Department of Biological and Environmental Science

University of Jyväskylä

ISBN 951-27-0605-9 ISBN 951-27-0428-5 (PDF) ISSN 1458-7335 Kopijyvä Kuopio 2006 FINLAND

Räty, Jani. Baculovirus surface modifications for enhanced gene delivery and biodistribution imaging. Kuopio University Publications G. - A.I.Virtanen Institute for Molecular Sciences 46. 2006. 86 p. ISBN 951-27-0605-9 ISBN 951-27-0428-5 (PDF) ISSN 1458-7335 Abstract As gene therapy continues to evolve to clinical use, more interested is directed towards developing new and alternative gene delivery tools to compensate for the deficiencies of major vectors. During the last decade the research interest has turned to baculoviruses, which are ubiquitous viruses with high species specificity to intervertebrates.

In this work baculoviruses were modified to extend their properties as gene delivery vectors. A versatile avidin-displaying baculovirus, Baavi, was created by inserting avidin into a baculovirus native envelope glycoprotein, gp64. Together with the strong interaction of avidin and biotin, various ligands could then be used to further modify the properties of baculovirus.

We were able to show that possibly due to the positive charge of the avidin, Baavi had increased transduction efficiency as compared to unmodified baculovirus in various cell lines. Cell biotinylation increased the transduction efficiency a further 100-150 %. As the use of avidin display enables coating of the viral surface, we then utilized magnetic microspheres to physically target cells in vitro and showed increased binding with epidermal growth factor- ligand.

The non-invasive imaging of gene delivery vector biodistribution and kinetics in vivo after administration are essential for clinical gene therapy. Traditional biodistribution imaging, based on the transduction pattern, does not always result in accurate presentation of the viral biodistribution as baculovirus may be unable to express the transgene in all penetrated cells. Magnetic resonance imaging has previously been utilized to image viral transgene expression, but by using 50 nm iron particles it was possible for the first time to image viral particle accumulation to rat choroid plexus cells with different time points. We were able to image the iron related signal loss up to two weeks and confirm the viral transgene expression to the same cells. We concluded that the payload could be transported to choroid plexus cells, together with the baculoviral gene delivery. By using biotinylated chelates with a technetium-label it was possible to use a microSPECT/CT device to image viral kinetics and biodistribution in vivo. Viral accumulation in different organs was analyzed after different administration routes using planar and 3D imaging as a function of time. We showed that intraperitoneal administration of Baavi resulted in signal accumulation in the spleen and kidneys and transgene expression at later time points.

We also studied the truncated version of the G-protein from Vesicular Stomatitis virus, VSV-GED and were able to show that by including it to the envelope with gp64, a significant increase in the transduction efficiency resulted in nearly all the studied cell lines. The mechanism was studied by inhibiting endosome maturation with ammonium chloride and monensin. Possibly the mechanism of action was by aiding gp64-potentiated membrane fusion.

In conclusion, the novel baculoviruses developed in this thesis result in increased transduction efficiency in vertebrate cells and provide more versatile tools to further develop gene therapy vectors for clinical use. National Library of Medicine Classification: QZ 52, QU 470, QU 475, QW 162 Medical Subject Headings: gene therapy; gene transfer techniques; genetic vectors; Baculoviridae; viral envelope proteins; viral fusion proteins; avidin; transduction, genetic; cell line; biotinylation; gene targeting; microspheres; magnetic resonance imaging; tomography, emission-computed, single-photon; choroid plexus; spleen; kidney; gene expression; rats

“There are two kinds of scientific progress: the methodical experimentation and categorization which gradually extends the boundaries of knowledge, and the revolutionary leap of genius which redefines and transcends those boundaries. Acknowledging our debt to the former, we yearn nonetheless for the latter.”

Academician Prokhor Zakharov Address to the Faculty

“Humanity needs practical men, who get the most out of their work, and, without forgetting the general good, safeguard their own interests. But humanity also needs dreamers, for whom the disinterested development of an enterprise is so captivating that it becomes impossible for them to devote their care to their own material profit.

Without doubt, these dreamers do not deserve wealth, because they do not desire it. Even so, a well-organized society should assure to such workers the efficient means of accomplishing their task, in a life freed from material care and freely concentrated to research.”

Nobel laureate Marie Curie

Acknowledgements

This study was carried out at the Department of Biotechnology and Molecular Medicine, A.I. Virtanen Institute, University of Kuopio 2001-2006 under the guidance of professors Seppo Ylä-Herttuala, MD, PhD. and Kari Airenne, PhD.

Professor Ylä-Herttuala is acknowledged for establishing excellent research group and providing me the opportunity to be introduced into the research world. I am also deeply grateful to my main supervisor, professor Airenne, for his endless optimism, vast professional insight and severe commitment to the baculovirus research. Without the Great Baculo, this thesis would never have been created.

I am thankful to the official reviewers of this thesis, Mikko Kettunen, PhD and Mikko Savontaus, MD, PhD for the time they spent reviewing this thesis and their valuable comments. Eileen Shaw, BSc was kind enough to revise the language of this thesis.

I am very thankful to my co-author and previous graduate student Minna Kaikkonen for the fruitful collaboration during this thesis. Additionally, she is also acknowledged for kindly providing Figure 6 for this thesis. Fellowship of the baculovirus, my roommates Anssi Mähönen and Olli Laitinen earn special thanks for providing infinite support, unique humour and hours of scientific discussion about various aspects of nonintervertebrate life. Mikko Turunen and Emilia Makkonen joined us later on, but also contributed to the relaxed atmosphere of former BV-HQ.

The good people of the SYH group, past and present, are acknowledged for the help they provided, drifting discussions, friendship and for creating the mind-boggling numbers of computer problems. Especially Pauliina Lehtolainen, Johanna Tietäväinen, Jonna Koponen, Sanna-Kaisa Häkkinen, Mervi Riekkinen, Tommi Heikura, Johanna Markkanen, Elisa Vähäkangas, Antti Kivelä, Marja Hedman, Anniina Laurema, Juha Rutanen, Tuomas Rissanen and Tiina Tuomisto are likely to find themselves in at least one of the categories.

I wish also to acknowledge those people specially participating in my thesis studies and experiments; Sanna Turpeinen, Hanna Lesch, Thomas Wirth, Jere Pikkarainen and Haritha Samaranayake.

Without the excellent technical assistance from Tarja Taskinen, Erik Peltomaa, Mervi Nieminen, Aila Seppänen, Riina Kylätie, Anneli Miettinen, Anne Martikainen, Seija Sahrio, Tiina Koponen, Jaana Pelkonen, Mari Supinen, Joonas Malinen, Riikka Eisto and Maarit Pulkkinen this study would not have been possible. Marja Poikolainen and Helena Pernu, the dynamic duo, are acknowledged for being the cornerstones for the group. People at AIV and LYT, especially Raili Rytöluoto-Kärkkäinen, Pekka Alakuijala, Riitta Keinänen and Jouko Mäkäräinen are also acknowledged for the help they provided during the years.

The people at Ark Therapeutics have influenced me greatly during the years spent with this research. Anne Kainulainen, Ville Harjulampi, Eero Paananen, Saija Paukkunen, Johanna Konttinen, Kaisa Ikonen, Outi Närvänen, Minna Karvinen, Minna Nokelainen and Maiju Jääskeläinen have been excellent collegues with lots of fun moments. The rest of the RD department with Sari Kukkonen, Miia Roschier, Diana Schenkwein, Pyry Toivanen, Tytteli Turunen, Tiina Nieminen and Hanna-Riikka Kärkkäinen have created an inspiring and supporting environment, both in and out of office.

I wish to thank my friends and business partners, Jarkko Surakka and Päivi Turunen for the moments we have shared in work and private life. The long-lasting friendship with Sami, Arto, Janne and Aki has spawned from the carefree days of past. Similarly, my friends Satu, the Korjamo family and Tuomas shan’t be forgotten. The exchange of bruises with my friends Olli, Markku, Elina, Pirkko, Mikko, Jatta, Jarimatti and Jari from UKU TKD has kept me in shape and lively during these studies.

Thanks go out to my kin, mother Riitta and aunts Tiina and Hilkka for support. Finally, my wife Piia shall be acknowledged for always being there when needed mostly.

Once again, thanks.

Kuopio, 2006

Abbreviations aa amino acids AAV Adeno associated virus AcMNPV Autographa californica multicapsid nucleopolyhedrovirus Ad Adenovirus AIDS Aqcuired immunodeficiency syndrome ATP Adenosine triphosphate BAAVI Baculovirus displaying avidin BBB Blood-brain-barrier BV Budded virus CAR Coxsackie-Adenovirus receptor CCD Charge-coupled device cDNA Complementary deoxyribonucleic acid CMV Cytomegalovirus CNS Central neural system CP Chroroid plexus CSF Cerebrospinal fluid CT Computer tomography DAB 3,3’-diaminobenzidine DNA Deoxyribonucleic acid EGF Epidermal growth factor FCS Fluorescence correlation spectroscopy FDG Fluorodeoxyglucose FGCV 18F-labeled-9[(1,3-dihydroxy-2-propoxy)methyl] guanine FHPG 18F-labeled 9-[(3-fluoro-1-hydroxy-2propoxy)methyl]guanine FHBG 18F-labeled 9-[4-fluoro-3-(hydroxymethyl)butyl]guanine FIAU 131I-labeled 2'-fluoro-2'-deoxy-1-ß-D-arabinofuranosyl-5-iodouracil FMAU 2-fluoro-5-methyl-1-beta-D-arabifuranocyluracil GV Granulosis virus GFP Green fluorescent protein HIV-1 Human Immunodeficiency Virus, strain 1 HSV-tk Herpes simplex virus thymidine kinase ICV Intracerebroventricular IF Intrafemoral IM Intramuscular IP Intraperitoneal IV Intravenous kb kilobase kbp kilobasepair Kd Dissociation constant lacZ a reporter gene coding for beta-galactosidase MLV Murine leukaemia virus moi Multiplicity of infection mRNA Messenger ribonucleic acid MRI Magnetic resonance imaging MRS Magnetic resonance spectroscopy NdFeB Neodymium-iron-borate magnetic alloy, Nd2Fe14B NMR Nuclear magnetic resonance NPV Nucleopolyhedrovirus OB Occlusion body ODV Occlusion derived virus PBS Phosphate buffered saline PCR Polymerase chain reaction PEG Polyethyleneglycol pfu Plaque forming units p.i. Post infection pI Isoelectric point PET Positron emission tomography

pKa Negative logarithm of acid dissociation constant polh Polyhedrin promoter Q-PCR Quantitative polymerase chain reaction RGD arginine-glysine-aspartate RNA Ribonucleic acid RT-PCR Reverse transcriptase polymerase chain reaction ssRNA Single stranded ribonucleic acid SCID Severe combined immunodeficiency SD Standard deviation SEM Standard error of mean SF Spodoptera frugiperda SFV Semliki Forest virus SPECT Single photon emission computer tomography SPIO Small iron oxide paramagnetic particle SV40 Simian vacuolating virus 40 TU Transduction units USPIO Ultrasmall paramagnetic iron oxide particle VEGF Vascular endothelial growth factor VSV Vesicular stomatitis virus VSV-G VSV G-protein VSV-GS VSV-G stem region VSV-GED VSV- GS with transmembrane and cytoplasmic domains WPRE Woodchuck hepatitis virus post-transcriptional element X-Gal 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside ZZ-domain IgG binding domain from protein A

List of Original Publications

This Study is based on the following articles, which are referred to in the text body by the corresponding Roman numerals (I-IV):

I Räty JK, Airenne KJ, Marttila AT, Marjomäki V, Hytönen VP, Lehtolainen P, Laitinen OH, Mähönen AJ, Kulomaa MS and Ylä-Herttuala S. Enhanced gene delivery by avidin-displaying baculovirus. Molecular Therapy. 2004 Feb;9(2):282-91.

II Räty JK, Liimatainen T, Wirth T, Airenne KJ, Ihalainen TO, Huhtala T, Hamerlynck E, Vihinen-Ranta M, Närvänen A, Ylä-Herttuala S* and Hakumäki JM*, Magnetic resonance imaging of viral particle biodistribution in vivo Gene Therapy. 2006 Oct;13(20):1440-6.

III Räty JK, Liimatainen T, Huhtala T, Kaikkonen MU, Airenne KJ, Hakumäki JM, Närvänen A, Ylä-Herttuala S, SPECT/CT imaging of baculovirus biodistribution in rat (submitted manuscript)

IV Kaikkonen MU*, Räty JK*, Airenne KJ, Wirth T, Heikura T and Ylä-Herttuala S. Truncated Vesicular Stomatitis virus G-protein improves baculovirus transduction efficiency in vitro and in vivo, Gene Therapy. 2006 Feb;13(4):304-12.

*Equal contribution

TABLE OF CONTENTS 1 INTRODUCTION................................................................................................................................................. 15 2 REVIEW OF THE LITERATURE..................................................................................................................... 16

2.1 GENE THERAPY .............................................................................................................................................. 16 2.2 GENE TRANSFER VECTORS.............................................................................................................................. 17

2.2.1 Baculoviruses............................................................................................................................................ 18 2.2.1.1 General properties of baculovirus.....................................................................................................................18 2.2.1.2 Structure of the virion.......................................................................................................................................18 2.2.1.3 Major envelope glycoprotein Gp64 ..................................................................................................................19 2.2.1.4 Baculovirus life cycle .......................................................................................................................................20 2.2.1.5 Use as a gene therapy vector.............................................................................................................................22

2.2.2 Adenoviruses............................................................................................................................................. 25 2.2.3 Adeno-associated viruses (AAVs) ............................................................................................................. 25 2.2.4 Retro- and lentiviruses.............................................................................................................................. 26 2.2.5 Other viruses............................................................................................................................................. 27 2.2.6 Non-viral vectors ...................................................................................................................................... 28

2.3 DEVELOPMENT OF TARGETED VECTORS ......................................................................................................... 29 2.3.1 Targeting gene therapy vectors ................................................................................................................ 29

2.3.1.1 Physical targeting .............................................................................................................................................29 2.3.1.2 Viral surface modifications...............................................................................................................................30 2.3.1.3 Targeting at genetic level..................................................................................................................................31

2.3.2 Vesicular stomatitis virus G-protein ......................................................................................................... 32 2.3.3 (Strept)avidin – biotin technology............................................................................................................. 33

2.3.3.1 Avidin and streptavidin.....................................................................................................................................34 2.3.3.2 Biotin................................................................................................................................................................34 2.3.3.3 (Strept)avidin-biotin technology in gene therapy..............................................................................................35

2.4 IMAGING IN GENE THERAPY........................................................................................................................... 36 2.4.1 Transduction and biodistribution imaging................................................................................................ 37

2.4.1.1 MRI ..................................................................................................................................................................38 2.4.1.2 PET / SPECT....................................................................................................................................................39 2.4.1.3 Optical imaging ................................................................................................................................................40

3 AIMS ...................................................................................................................................................................... 41 4 MATERIALS AND METHODS.......................................................................................................................... 42 5 RESULTS AND DISCUSSION............................................................................................................................ 45

5.1 ARTICLE I ....................................................................................................................................................... 45 5.1.1 Gp64-avidin fusion protein was incorporated in the baculovirus surface................................................ 45 5.1.2 Titering of baculovirus.............................................................................................................................. 47 5.1.3 Baavi resulted in enhanced transduction in vitro ..................................................................................... 47 5.1.4 Targeting the Baavi .................................................................................................................................. 48 5.1.5 Magnetically targeted transduction in vitro ............................................................................................. 49 5.1.6 Additional in vivo data.............................................................................................................................. 51

5.2 ARTICLE II...................................................................................................................................................... 53 5.2.1 Contrast agent selection ........................................................................................................................... 53 5.2.2 Atomic force microscopy........................................................................................................................... 54 5.2.3 In vitro transduction ................................................................................................................................. 54 5.2.4 Detection of viral particles by MRI........................................................................................................... 55 5.2.5 Iron detection by Prussian blue staining .................................................................................................. 56 5.2.6 Viral transgene expression ....................................................................................................................... 56 5.2.7 Choroid plexus as targets for gene therapy .............................................................................................. 57

5.3 ARTICLE III .................................................................................................................................................... 59 5.3.1 Intravenous administration....................................................................................................................... 59 5.3.2 Intraperitoneal and intramuscular administration ................................................................................... 60 5.3.3 Intracerebroventricular administration.................................................................................................... 60 5.3.4 Other administration routes and conclusions ........................................................................................... 61

5.4 ARTICLE IV .................................................................................................................................................... 62 5.4.1 VSV-GED displaying virus ....................................................................................................................... 62 5.4.2 Enhanced transduction efficiency in vitro................................................................................................. 62 5.4.3 Mechanism for transduction enhancement ............................................................................................... 63

5.4.4 Cytotoxicity ............................................................................................................................................... 64 5.4.5 Transduction in vivo ................................................................................................................................. 64

6 SUMMARY ........................................................................................................................................................... 66 REFERENCES ............................................................................................................................................................... 67 APPENDIX: ORIGINAL PUBLICATIONS I-IV

1 Introduction Gene therapy provides methods to treat the genetic reasons underlying behind the diseases with efficient methods and effect a cure instead of merely relieving the symptoms. After the initial discoveries and clinical trials, extensive research and development has been taken place to chart the full clinical and commercial possibilities of gene therapy.

As there has been success with treating some diseases, there has also been acknowledgement of the boundaries in the knowledge concerning the complex mechanisms in a living body. Some of the drawbacks have raised concern to design novel gene delivery vehicles for safer and more efficient treatments for gene therapy.

During evolution viruses have developed elaborate mechanisms to penetrate cells and take over the cellular machinery, each virus developing its preferred cell type and transduction mechanisms. For gene delivery use, the viral vectors are extensively modified for increased safety and selective transduction of target cells. Novel vectors, such as baculoviruses, provide an alternative method to treat diseases and provide new information about the processes in the path to a therapeutic result.

In this work, baculovirus surface modifications have provided ways to introduce new properties for the baculovirus and create prototypes for next generation enveloped viral vectors. The use of the avidin-biotin system has enabled flexibility and compability resulting in new data on viral behaviour and the use of modified envelope glycoproteins from other viruses has increased the efficiency of the baculovirus.

15

2 Review of the literature

2.1 Gene Therapy Gene therapy has been defined as a method to treat disease by replacing, manipulating, or supplementing genes (Boulikas, 1998). Therapeutic gene therapy has been defined as the transfer of nucleic acids to somatic cells of a patient to result in therapeutic effect (Ylä-Herttuala and Alitalo, 2003). As compared to traditional medicine, gene therapy offers unique possibilities to treat the genetic causes of diseases. Special hope has been set on treatments for the monogenic diseases.

The treatment of adenosine deaminase enzyme lacking patients with gene therapy showed positive effects (Blaese et al., 1995). This encouraged more research towards gene therapy and resulted in numerous clinical trials. Since the first clinical gene transfer was made in 1989 (Blaese et al., 1995) the number of clinical trials per year increased steadily, peaking at 116 trials during 1999, but decreased to 77 trials in 2005 (Figure 1). The death of a patient in a gene therapy trial in 1999 (Raper et al., 2003; Couzin and Kaiser, 2005) and induction of leukaemia in some patients in another trial (Hacein-Bey-Abina et al., 2003) have caused the regulatory authorities to tighten the rules for clinical research and directed research to increase the safety of the treatment.

Meanwhile, the use of gene therapy as a supportive method along with traditional treatments has gained promising results for example in the treatment of malignant glioma (Immonen et al., 2004). As gene therapy modifies a complex cellular system with a method consisting of many steps such as delivery, cellular entry, transcription and expression, the limits in the current knowledge are bound to hinder the transfer of this treatment to everyday clinical use.

Number of Gene Therapy Trial Approved Worldwide 1989-2005

67

51

68

116

94106

91 94798782

3837

148

1 20

20

40

60

80

100

120

140

19891990

19911992

19931994

19951996

19971998

19992000

20012002

20032004

2005

Year

Tria

ls

Figure 1. Number of gene therapy trials worldwide 1989-2005 (Journal of Gene Medicine, http://www.wiley.co.uk/genmed/clinical).

16

2.2 Gene transfer vectors A gene transfer vector is, by definition, a vehicle which delivers genetic material to cells. These vectors can be divided into two categories: viral and non-viral. As viruses have evolved to be efficient in gene delivery they surpass non-viral vectors in many aspects, especially in efficiency (Kootstra and Verma, 2003). Currently the most popular vectors are adeno- and retroviruses, together representing 49% of vectors used in clinical trials (Figure 2).

Ideally, a gene therapy vector would target a specific tissue with high transduction efficiency and sustain a stable, regulated gene expression without any side effects or immunogenic response. As none of the currently used vectors directly match the ideal vector profile, there is an ongoing search for new vectors and the development of vectors combining properties from different viruses and artificial virus-like-particles. Currently each vector system has its own characteristic benefits, drawbacks and preferred applications. The next chapters will briefly introduce some major viral vectors with a special focus on baculovirus.

Vectors Used in Gene Therapy Trials 1989-2005

Others; 2.4Adeno- associated virus; 3.4

Adenovirus; 26.0

Retrovirus; 24.0 Naked/plasmid DNA; 17.0

Lipofection; 8.3

Poxvirus; 6.9

Vaccinia virus; 6.5

Herpes simplex virus; 3.4

RNA transfer; 1.3

Unknown; 3.1

Figure 2. Vectors used in clinical gene therapy trials 1989- 2005 (Journal of Gene Medicine, http://www.wiley.co.uk/genmed/clinical).

17

2.2.1 Baculoviruses Baculoviruses are a virus family which probably originated 400 to 450 million years ago and are ubiquitous in the modern environment (Heimpel et al., 1973). Apart from ancient Chinese literature, the earliest evidence of baculoviruses in Western literature can be traced to the sixteenth century by Marco Vida of Cremona describing gory liquefaction of silk worms, (reviewed in Benz, 1986). Starting from the 1930’s baculoviruses were used and studied widely as biopesticides in crop fields (Miller, 1997) and a specific baculovirus from Finland was successfully introduced to Canada to abolish spruce sawfly, Gilpinia hercyniae (Balch and Bird, 1944; Arif, 2005). Since the late 80’s and 90’s they have been utilized for production of complex eukaryotic proteins in insect cell cultures (Kost and Condreay, 1999) and later on for viral display (Oker-Blom et al., 2003).

In 1985 it was discovered that a baculovirus with suitable promoter was able to transduce mammalian cells (Carbonell et al., 1985), an observation not confirmed until 1995 (Hofmann et al., 1995). Even though baculoviruses were discovered to be degraded by the classical complement pathway of blood (Hofmann and Strauss, 1998), successful ex vivo experiments soon led to successful in vivo experiments in 2000 (Airenne et al., 2000). Since then, there have been several publications using baculoviruses with various targets in vitro and in vivo (Huser and Hofmann, 2003; Kost et al., 2005).

2.2.1.1 General properties of baculovirus Baculoviridae are a family of rod-shaped viruses which can be divided into two genera: granuloviruses (GV) and nucleopolyhedroviruses (NPV). While GVs contain only one nucleocapsid per envelope, NPVs contain either single (SNPV) or multiple (MNPV) nucleocapsids per envelope in the occlusion body. The enveloped capsids of GV’s are occluded in granulin matrix and NPVs in polyhedrin. Moreover, GV have only a single virion per granulin occlusion body whilst the polyhedra of NPV contain multiple embedded virions. Baculoviruses have a circular double-stranded genome ranging from 80-180 kbp with the potential to encode about 100-200 proteins (Possee and Rohrmann, 1997; Theilmann et al., 2005).

Baculoviruses have very species-specific tropism among the intervertebrates with over 500 host species (Herniou et al., 2004) and they are not known to replicate in mammalian cells (Carbonell and Miller, 1987). However there is a report of detected early viral gene expression in human and rat cells (Kenoutis et al., 2006).

2.2.1.2 Structure of the virion The most studied baculovirus is Autographa californica multicapsid nucleopolyhedrovirus (AcMNPV). This virus was originally isolated from lepidoptheran Alfalfa looper and contains a 134 kbp genome with 154 open reading frames (Ayres et al., 1994). The major capsid protein VP39 together with some minor proteins forms a nucleocapsid (21 nm x 260 nm, (Fraser, 1986) which encloses the DNA with p6.9 protein. The virus appears in two distinctive forms depending on the stage of its lifecycle; a single budded virus (BV) and an occlusion particle containing multiple virions, called occlusion derived virus (ODV) (Figure 3). BV obtains its envelope from the cell membrane and requires glycoprotein GP64 to be able to spread systemic infection. This protein is not found on ODV whereas several other proteins are only associated to ODV. Some differencies are also seen in the lipid composition of the viral envelope (Braunagel and Summers, 1994).

18

Figure 3. Baculovirus structural protein comparison between a) budded virus (BV), b) occlusion derived virus (ODV) and c) polyhedra embedded virions (OB) (based on Blissard, 1996)

2.2.1.3 Major envelope glycoprotein Gp64 Gp64 is a homotrimeric membrane glycoprotein which is polarly present on the rod-shaped virion. It consists of 512 amino acids (aa) with five glycosylation sites at asparagine residues (Jarvis et al., 1998) and has a 20 aa long N-terminal signal sequence, oligomerization and fusion domains and a 7 aa hydrophobic transmembrane domain near the C-terminus (Oomens and Blissard, 1999; Blissard and Rohrmann, 1989). The gp64 is produced in both early and late phases of the infection cycle with a maximal rate of synthesis occurring in 24-26 h post infection (p.i.).

Trimerization with intermolecular cysteine-bonds seems to be a crucial step for protein transport, since only 25% of synthesized protein reaches the cell surface as monomeric gp64 is degraded within the cells (Oomens et al., 1995).

There is an estimation that a virion contains ~1000 gp64 peplomers (Dee and Shuler, 1996). Gp64 causes the pH-mediated envelope fusion to the endosome (van Loo et al., 2001). It is also essential for efficient budding of the virion (Oomens and Blissard, 1999), cell-to-cell transmission during the infection cycle (Keddie et al., 1989; Mangor et al., 2001; Monsma et al., 1996) as well as binding to the cell surface i.e. causing viral tropism (van Loo et al., 2001). Although gp64 has a variety of essential functions, it has been reported that gp64-null baculoviruses can be substituted with other viral glycoproteins such as ld130 or G-protein of Vesicular stomatitis virus (VSV-G) to produce a functional virus (Mangor et al., 2001; Lung et al., 2002).

During the viral evolution the baculoviral envelope glycoproteins have undergone changes. Ld130, also known as baculovirus F-protein, from Lymantria dispar is suggested to be an ancestral envelope fusion protein which has been replaced by gp64 in AcMNPV, Bombyx mori and Orgyia pseudotsugata, while they still retain the original ld130 gene (Pearson et al., 2001; Galperin

19

and Koonin, 2000). Possibly gp64 provides an advantage in the infection cycle of the virus, therefore outperforming the ancestral glycoprotein.

2.2.1.4 Baculovirus life cycle The baculovirus life-cycle involves two distinct viral forms of baculovirus. The occlusion derived virus (ODV) is derived from the occlusion matrix embedded virions and is responsible for the primary infection of the host (Figure 4). The budded virus (BV) is released from the infected cells during the secondary infection (Figure 5)(Williams and Faulkner, 1997).

Primary infection begins by the host feeding on plants contaminated with virions embedded in the polyhedra-matrix. This matrix is dissolved in the alkaline environment of the host midgut, releasing ODV to fuse with the columnar epithelial cell membrane of the host intestine (Keddie et al., 1989). Nucleocapsids are then transported to the nucleus, a step possibly mediated by actin filaments (Charlton and Volkman, 1993), via nuclear pores. Viral transcription and replication occur in the nucleus and new BV particles are budded out from the basolateral side to spread the infection systemically. During the budding BVs acquire loosely fitting host cell membrane with expressed and displayed viral glycoproteins (Monsma et al., 1996).

The baculovirus infection can be divided to three distinct phases, early (0-6 hours p.i.), late (6-24 h p.i.) and very late phase (18-24 to 72 h p.i.). While BV is produced in the late phase, the ODV form is produced in the very late phase acquiring the envelope from the host cell nucleus and embedded in the matrix of occlusion body protein. These occlusion bodies are released when cells lyse to further spread baculovirus infection to the next host. To adapt to survival in the wild, occlusion body (OB) particles are resistant to heat and light inactivation, whereas BV is more sensitive to the environment (Williams and Faulkner, 1997).

20

Figure 4. Baculovirus primary infection, from OB to BV in intervertebrate host midgut.

Figure 5. Baculovirus secondary infection, from BV to OBs in intervertebrate host cells.

21

2.2.1.5 Use as a gene therapy vector Baculoviruses have several advantages as a gene therapy vector. Viruses have a long history with extensive studies on safety and viral structure (Black et al., 1997). They can easily be produced in high titers (up to 1012 pfu/ml), easily manipulated and quickly produced without animal serum (Luckow, 1993). Baculovirus transduction is not restricted to dividing cells only, but includes also G1/S arrested cells (van Loo et al., 2001). Most importantly, since viruses are derived from an insect host, they do not replicate in vertebrate cells, however there is a contradictory report on expression of baculoviral immediate-early genes (Kenoutis et al., 2006). Still, the safety of the occluded viruses has been studied with various methods including intravenous, oral, intracerebral and intramuscular administrations in experimental animals and with feeding tests on voluntary humans without any signs of toxicity (Ignoffo and Heimpel, 1965; Heimpel and Buchanan, 1967). Even so, very limited information is available on the effects of high dose of budded viruses in vivo.

The rod-shape capsid enables high transgene capacity, without known limits (O'Reilly et al., 1994; Fipaldini et al., 1999; Cheshenko et al., 2001). However, the drawbacks include the production of the virus in insect cells which results in the display of foreign glycoproteins, thus increasing possible immunogenic responses and inactivation by the blood complement system by classical pathway (Hofmann and Strauss, 1998; Huser et al., 2001). This problem has been avoided by using complement-protecting factors (Huser et al., 2001; Hofmann et al., 1999; Pieroni et al., 2001), avoiding exposure to the complement (Sandig et al., 1996; Airenne et al., 2000) or using the virus in immunopriviledged areas such as the eye (Haeseleer et al., 2001) and the brain (Sarkis et al., 2000; Lehtolainen et al., 2002). Currently the baculovirus has produced the most promising results in vivo in the CNS gene delivery, for example inhibiting glioma cell growth in an animal model showing higher transduction rate in glioma as compared to surrounding brain tissue (Wang et al., 2006). Additionally, it has been reported baculoviruses may be able to utilize axonal transport to cell bodies (Li et al., 2004). While the later observation may be regarded as safety risk, together these studies may promote focusing the research to brain and CNS.

As compared to adenoviruses, the overall transduction efficiency of baculoviruses is somewhat lower and while baculoviruses are less cytotoxic as compared to adenoviruses (Airenne et al., 2000; Lehtolainen et al., 2002), the baculovirus envelope is still of insect origin, possibly creating immunoresponse with repeated administrations as suggested by cytokine eliciting interaction with Kupffer cells (Beck et al., 2000). Additionally, the large genome of baculovirus shows signs on instability, hindering the production of established clinical gene therapy vectors (Pijlman et al., 2004).

Some of these drawbacks related to baculovirus properties can be avoided by enhancing transduction efficiency by pseudotyping (Park et al., 2001) or by inserting enhancing elements to the viral transgene cassette or by using histone deacetylase inhibitors (Condreay et al., 1999; Sarkis et al., 2000).

It is not currently known if the baculoviruses have a specific receptor for their attachment and cell entry. However there are reports on specific requirements for their transduction (van Loo et al., 2001), involving heparin sulphate residues and electrostatic interactions. Additionally, the interaction of gp64 and cell surface phospholipids has been shown to play a role in the viral entry (Tani et al., 2001; Ernst et al., 2006). Interestingly, disruption of the cell-cell junctions with chelator EGTA has resulted in increased transduction efficiency (Bilello et al., 2001) achieved also by transient calcium depletion (Bilello et al., 2003). As it has been shown that basolateral surface is important for the baculoviral transduction, the loosening of cell-cell junctions might enable the entry from the basolateral side.

While the baculovirus receptor remains unknown, a large number of susceptible cell types (Table 1) suggests the viral tropism to result from very universal interactions. However, when examining the difference between highly permissive and less permissive cell lines, it has been reported that the difference was in the presence or absence of baculovirus DNA in the nucleus

22

(Barsoum et al., 1997). This indicates that while the attachment might be universal, the later steps with nuclear entry and viral disassembly are likely to affect the baculovirus transduction and tropism (Kukkonen et al., 2003). Interestingly, baculoviruses are one of the few viruses which carry their capsid to the nucleus (van Loo et al., 2001), enabling the transport of therapeutic proteins to the nucleus by using capsid display (Kukkonen et al., 2003).

The transgene expression of baculovirus is transient, peaking levels are 2-5 days in vitro (Liang et al., 2004) and from 3-5 days to one week in vivo (Airenne et al., 2000; Lehtolainen et al., 2002), but without complement lasting to nearly 200 days (Pieroni et al., 2001). However these results are with universal promoters and the transgene expression length and strength or tropism can be modified by using different promoters (Park et al., 2001; Wang and Wang, 2006; Wang et al., 2006).

23

Table 1. Different mammalian cell lines transduced with baculoviruses (Dai et al., 1995; Shoji et al., 1997; Airenne et al., 2000; Kost and Condreay, 2002; Ghosh et al., 2002; Song et al., 2003; Airenne et al., 2004; Cheng et al., 2004).

Human cell lines Other mamm ll lines alian ce Huh7 (Hepatoblastoma cell) Monkey HepG2 (Hepatoblastoma cell) COS-7 (Kidney cell) sk-Hep-1 (Hepatoblastoma cell) CV-1 (Kidney cell) FLC4 (Hepatocarcinoma cell) Vero (Kidney cell) primary hepatocytes 293 (Kidney) Porcine HeLa (Cervical carcinoma cell) CPK (Kidney cell) primary neural cells FS-L3 (Kidney cell) IMR32 (Neuroblastoma cell) PK-15 (Kidney cell) CHP212 (Neuroblastoma cell) SK-N-MC (Neuroblastoma cell) Rodent A 549 (Lung) RAASMC (Rabbit aortic smooth muscle WI-38 (Lung fibroblast) cell) Ramos (B-cell) RGM1 (Rat ga sal cell) stric mucoJurkat (T-cell) PC12 (Rat adrenal cell) MT-2 (T-cell) Primary rat hepatocytes W12 (Keratinocyte) BT4C (Rat glio ll) ma ceprimary foreskin fibroblasts BHK (Baby ha idney) mster kHL-60 (Promyelocyte) CHO (Hamster ovary cell) K-562 (Myelocyte) Mouse pancrea lls tic β-ceKATO-III (Gastric carcinoma cell) MKC (Mouse kidney cell) Pancreatic β-cells NIH3T3 (Mouse embryo fibroblast) Bone marrow fibroblasts C2C12 (Mouse muscle) Saos-2 (Osteosarcoma cell) N2a (Mouse neuroblastoma cell) 143TK- (Osteosarcoma cell) L929 (Mouse fibrosarcoma cell) MG63 (Osteoblast-like cell) DLD-1 (Colon carcinoma cell) Bovine SKOV3 (Ovarian carsinoma) BT (Trophoblast) MRC5 (Lung fibroblast) ECV-304 (Vascular endothelial cell) Ovine FLL-YFT (Lam g cell) b primary foetal lun

24

2.2.2 AdenoHuman adenoviruses belong to the Adenoviridae family and cause mild infections in membranes of the respiratory inary tract. Viruses contain a linear double-stranded 36 kbp DNA g non-enveloped icosahedral capsid of 70-1 iameter. Today, over 50 serotypes, divided into six subgroups (A-F), have been identified (Douglas, 2004). Gene therapy utilises repli ich are non-pathogenic and can transiently transduce a variety of both dividing and non-dividing cell iency without integration to the genom romosomal position of the v sults in loss of the viral DNA during cell divisions and explains the expression peak tim 2004).

Adenoviruses are dominating gene therapy vectors with 301 finished or ongoing clinical trials d ley.com/genmed/clinic dvantages include production to nd a packaging capac kb with so-called gutless vectors. However, as they belong to harmful viruses, pre- or acquired immune response again ay cause severe immuno oblems (Chen et al., 2000; Zoltick et al., 2001; Youil et al., 2002). Major adenoviral vector clinical trials belong to the serotype 996). These serotype rmined to be the most com exposed (Parks et al., 1999), possibly causing problems for their repeated use for the same individual (Bessis et is issue can be addressed for erotype (Parks et al., 1999) ating chimeric vectors (Hedley et al.,

The efficiency of the vector is closely related to the cellular c ovirus receptor (CAR), which is the primary adenovirus receptor. As in the tumor cells, the amount of CAR is often low, therefore creating a need to modify the interaction of cell and adenovirus fibre knob (Noureddini and Curiel, 2005). However, adenovirus also binds, to some extent, to integrins αVβ3 and αVβ5 (Wickham et al., 1993).

An interesting approach has been the development of conditionally replicating adenoviruses, which result to destructive viral replication but limit it selectively to onabend et al., 2006).

2.2.3 Adeno-associated viruses (AAVs) Adeno-associated viruses belong to the Parvoviridae family and are non-pathogenic to humans. They contain a single-stranded 4.7 kb DNA genome within a small 20 n-enveloped capsid. The number of known AAV serotypes increases constantly and is cu ever when including different hybrid capsids, the number is within hundreds (DiMattia et al., 2005). AAV transduces a wide variety of dividing and non-dividing cells in muscle r, brain and vasculature through heparin sulphate proteoglycans, integrin αVβ5 or fibroblast growth factor receptor with long-term expression (Grieger and Samulski, 2005).

Since AAV belong to the dependoviruses, it needs adeno-, herpes-, papilloma- or vaccinia virus to facilitate efficient and fully permissive infection and replication. Without a helper irus or a wild-type virus AAV causes a latent infection and integrates into a unique site in human

osome 19 (Kotin et al., 1990). The virus has a small capacity for foreign DNA (<5 kbp), but the packaging capacity has been expanded by utilizing trans-splicing and overlapping vectors resulting in intact protein in dual-transduced cells (Duan et al., 2001).

The most commonly used serotype in gene therapy is AAV-2, to which the human population has a high prevalence of antibodies (Zaiss and Muruve, 2005). To solve this problem, cross-packing AAV serotypes have been utilized (Choi et al., 2005). One of the major drawbacks in

viruses

track, the eye, intestines or the urenome with 00 nm d

cation defective adenoviruses whs with high efficirus genome re

e of 5-7 days (Muruve,e. The extra-ch

uring 1989-2006 (http://www.wihigh titers (up to 10

al). Their aity over 30 11 pfu /ml) aexisting genic prs used in

st vector or infected cells m

2 and 5 from group C (Shenk, 1mon to which adults have been

s have been dete

al., 2004). Th or creexample by changing the s

2005). oxsackie-aden

tumor cells (S

-25 nm norrently eleven, how

s, live

vchrom

25

AAV is the purification and concentration of viruses. Together with a low transgene capacity these drawbacks severely limit its use (Blouin et al., 2004). However, with the transduction peak time of

le expression for years, AAV offers long-term possibilities to treat

in a stable expression.

genes, the retroviral transgene capacity is ~8-10 kbp. The production of retrovir

f species. Viral pseudotyping is invariably used to broaden and modify

of limitations in crossing the nuclear membrane (Roe et al., 1993) MLV is capable of ansducing only dividing cells, whereas lentiviruses are also capable of transducing quiescent cells.

The integration of the viral genome is not totally random (Wu and Burgess, 2004), and it has been s are targets for retroviral integration (Schroder et

3-6 weeks and sustainabmetabolic diseases in a non-integrating manner (Wang and Herzog, 2005; Flotte, 2005; Auricchio and Rolling, 2005).

2.2.4 Retro- and lentiviruses The family of Retroviridae comprises a group of enveloped 80-100 nm viruses containing linear single stranded-RNA (ssRNA). Retroviruses have a common property of reverse transcription of the viral RNA to linear double stranded DNA and subsequent integration of this DNA to host genome resulting

Retroviruses can be further divided into simple and complex retroviruses where orthoretrovirinae Murine Leukaemia Virus (MLV) represent the former and lentivirinae Human Immunodeficiency Virus strain 1 (HIV-1) the latter. Spumaretrovirinae include several non-human viruses such as Simian Foamy virus (Mergia and Heinkelein, 2003).

Among the lentiviruses, HIV-2, FIV (Feline), SIV (Simian), EIAV (Equine Infectious Anaemia Virus), BIV (bovine) based vector systems have been designed and used for gene delivery (Romano, 2005). Being the most studied among the lentiviruses, HIV has currently advanced first clinical trial for treating AIDS (Manilla et al., 2005).

A viral genome consists of genes for viral structural proteins: gag, pol, env and in the complex retroviruses additional regulatory and accessory genes like tat, rev, vif, nef, vpr and vpu. After deletion of viral

uses requires packaging cells where removed viral proteins are expressed in trans (Coffin, 1996).

The tropism of retroviruses is highly dependable on envelope glycoprotein composition dividing viruses into ampho-, eco-, and polytrophic subsets transducing accordingly mammalian, rodent or a selection o

the retroviral tropism (Sandrin et al., 2003). Murine retroviruses were the first viral vectors used for gene therapy (Selkirk, 2004).

Becausetr

suggested that actively read genes in the genomeal., 2002) and in addition, several loci associated with leukaemia have been detected as integration sites (Calmels et al., 2005; Hematti et al., 2004; Wu et al., 2003). Possibly due to this, insertional mutagenesis in primitive multipotent progenitor cells has been detected as a result of lentiviral SCID-X1 gene therapy trial, resulting in leukaemia but also in restoration of normal enzyme levels (Schmidt et al., 2005). In gene therapy, retroviruses are widely used (Figure 2) and have a selection of applications which rely on their special properties (Barquinero et al., 2004).

26

2.2.5 Other viruses As the limitations of dominant viral vectors have became obvious, interest has risen to develop new viral vectors or transfer their properties to current vectors. There has been some interest in research

to naturally oncolytic viral vectors and to utilize the mechanisms causing the selective replication in tumor cells (Thorne et al., 2005).

e key features of some gene therapy vectors and Table 3 some

in

Table 2 summarizes thnaturally oncolytic viruses. Hybrid vectors such as chimeric vaccinia/ retrovirus (Falkner and Holzer, 2004) and retrotransposon-adenovirus (Soifer and Kasahara, 2004) combine selected features from different viruses with a rational design, perhaps resulting in a more effective outcome (Tomanin and Scarpa, 2004).

Table 2. Characteristics of some unconventional viral gene transfer vectors

Viral vectors Advantages Limitations Reference Alphaviruses/ Semliki Forest (SFV), Sindbis (SIN) and Venezuelan Equine Encephalitis (VEE)

High titer, rapid production, broad host range and extreme transgene expression levels

Low transgene capacity (<7 kb), highly cytotoxic,

(Liljestrom and Garoff, 1991; Xiong et al., 1989;

short term expression Davis et al., 1989; Yamanaka, 2004)

Spumaretroviruses / Foamy viruses (FV)

Broad tropism, high efficiency, high capacity (>9 kbp), resistant to complement

Low titer, few (Mergia and studies made Heinkelein, 2003)

Hepadnaviridae/ Hepatitis B (HBV)

High liver specificity, High titers, transduces quiescent cells

Very low transgene (Untergasser and capacity (<1,6 kb) Protzer, 2004)

Polyomaviridae/ Simian virus 40 (SV40)

Stable integration to dividing and non-dividing cells, long term expression

Low transgene capacity (< 4,7)

(Strayer et al., 2005)

Poxviridae/ Vaccinia, Western reserve strain

Replicates in tumor cells, safety with cytosolic transcription and replication, high capacity ( <25 kb). Tumor vaccination.

Pathogenic, possible previous vaccination, highly immunogenic

(Guo and Bartlett, 2004)

Alphaherpesvirinae/ Herpes Simplex 1 (HSV-1)

Broad range, high titers, large capacity

Pathogen, latent wild (Martuza et al., type-virus activation, 1991; Post et al., antigenic 2004)

Bacteriophages Non-pathogenic, easy to produce, easy manipulation

Immunogenic, large (Larocca et al., particles, very low 2002) gene delivery efficiency

27

Table 3. Some naturally oncolytic viruses (Wildner, 2003).

Oncolytic viruses Advantages Limitations Reference

Paramyxoviridae/ Measles virus (MV)

Oncolytic Pathogenic (Fielding, 2005)

Paramyxoviridae/ Newcastle disease virus (NDV)

Non-pathogenic in humans, moderate efficiency, oncolytic

Unclear mechanism, not (Lorence et al., well studied, non-recombinant viruses used

2003)

Paramyxoviridae/ Mumps virus

Oncolytic Pathogenic (Russell, 2002)

Parvoviridae/ Rat virus H1 and Minute virus of mice (MVM)

Tumor tropism, autonomous replication, low immunogenity

Low transgene capacity, (Cornelis et al., low titres, replication 2004) competent viruses

Reoviridae/ Respiratory enteric orphan virus (reovirus)

Mild pathogen, specific oncolytic activity

Previous antigens exist (Norman and Lee, 2005)

Picornaviridae/ poliovirus

Oncolytic Narrow tropism, (Gromeier et al., pathogenic, difficult 2000) manipulation

Rhabdoviridae/ Vesicular Stomatitis virus (VSV)

Relatively non-pathogenic, oncolytic

Difficult manipulation, (Barber, 2004) VSV-G inactivation

2.2.6 Non-viral vectors Non-viral vectors offer a bypass to some of the fundamental drawvectors. As compared to viral vectors, non-viral approaches have a theoretically better safety profile, cheaper and scalable production, fewer restrictions to the size of the transgene and no risk of insertional mutagenesis. However, due to the poor uptake DNA to cells their transduction efficiency is low and expression is transient (Glover et al., 2005; Kootstra and Verma, 2003). The most i ligonucleotides, naked DNA, cationic lipids or polycationic carriers and different formulations of lipids and other components, such as nanoparticles (

Systemic delivery of naked DNA suffers from rapid clearance from the blood or degradation by restriction nucleases (Brown et al., 2001). Method ectroporation (Wells, 2004), hydrodynamic injections (Al-Dosari et al., 2005) and ultrasound (Hosseinkhani et al., 2003) have been used to increase the transfection efficiency. While the increasing tissue damage may prevent the use of electroporation and hydrodynamic pressure, ultrasound may provide an alternative me gene transfer efficiency in clinical use. Naked DNA has already proven to be efficient enough in genetic vaccination (Rodriguez, 20

To shield and package DNA, several different c such as monovalent cationic lipids, polyvalent cationic lipids, cationic polymers, guanidine containing compounds, cationic peptides and cholesterol containing compounds have bee d (Rodriguez, 2004).

backs related to the use of viral

of plasmid

mportant non-viral vectors are o

Schatzlein, 2001).

s, such as el

thod to increase 04). ompounds

n develope

28

When formulated together with DNA they form lipoplexes and enhance the stability of the complex in vivo (Dass,

An interesting approach is to develop methods integrating viral proteins or artificial particles to sy an artificial gene transfer vect Wolf and Schmidt-Wolf, 2003). These virus-like-particles or nanoparticles might o ise between the benefits and drawbacks of viral and non-viral systems.

2.3 Development of targeted vectors The route and interval of repeated administrations, the dose of ve the surface moieties of the vector, length of the expression and the type of promoter contribu ficiency and immune response in a subject of gene therapy. To balance between effective dose and minimal immune response - the concept of “magic bullets”- specific homing gene therapy vectors are pursued by the gene therapy researchers.

After system nistration gene therapy vectors are diluted to the surrounding fluids, moving nd Brownian motion. The vectors attach according to their interaction wit To concentrate the vector to th e in such quantities that a therapeu , the interactions between the vector and target cells need to be modified to increase the affinity to cellular receptors. These interac be influenced either by pseudotyping a virus with other viral proteins to alter its tropism, as often used with enveloped retroviruses (Sandrin et al., 2003) or by including targeting moieties to viral surface proteins, an approach used often with non-enveloped viruses such as adenovirus (Mizuguchi and Hayakawa, 2004). The nex troduce some key concepts of vecto eting.

2.3.1 Targeting gene therapy vectors During the path of viral gene delivery, there are several possible targeting. The primary targeting consists of selection of the injection method and a method to retain the viral particles in the area of interest, by physical means. To further target the vector ecific manner, viral surface modifications provide the means to affect the attachment of the virus to the cell surface. Following the penetration of the virus to the cell, some viruses, such as baculoviruses and parvoviruses, continue to travel to the nucleus with intact capsids, possibly enabling the alteration of viral kinetics by capsid display.

After the viral genomic material is released to cells, various tissue-specific promoters can be used to restrict the expression almost exclusively to the targeted tissue. Finally, specific areas of the host genome can be targeted to specifically integrate the transgene to safe positions or to selectively replace a defective gene. Many of these techniques have been published individually; extensive integration of these methods to a single vector system still remains to be achieved.

2.3.1.1 Physical targeting With the ex vivo approach, target cells are removed from the patient, transduced with viral vectors and re-introduced to the patient (Cavazzana-Calvo et al., 2000; Harrington et al., 2002). This method increases the physical proximity and limits the target population thus increasing the vector moi (multiplicity of infection). The body’s immunogenic response can also be reduced even with high mois. However, the targeting is limited to the cells which are available either by extracting the selected population from patient’s blood by cell sorting or by growing from the stem cells in vitro.

Excluding the ex vivo approach, the viruses need to be injected to the patient by using a method suitable to the disease. The selection of the injection method enables primary targeting, as used with intracranial injections for treatment for brain tumours (Sandmair et al., 2000; Tyynela et al., 2002). As compared to multiple injections into solid tissue using a needle and a syringe, gene

2004).

stemically engineer or (Schmidt-ffer a comprom

ctor, te to the ef

ical admi with liquid flow ah cellular surfaces.tic window is reached

e target tissu

tions can

t chapters will in r targ

points for

in a tissue-sp

29

gun ejected gold particles carrying plasmid DNA penand with high velocity (Chen et al., 2002) but the transfectio

etrate directly to individual cells in a wide area n depth remains only a few millimetres

(Wells, 2004). preparation of the ammuniti can only be used for plasmid DNA. The gene gun method has been used with success to transfer plasmids to foetuses in utero (Yoshizawa et al., 2004) and in vaccination trials (Chen et al., 2002). However, to access internal organs, such as the heart, catheters provide an alternative to surgery with a limited invasion and high targetability (Rutanen et al., 2004).

In addition, viruses can be delivered and retained in the target area with silicon collars (Bhardwaj et al., 2005), or biodegrable polymer encapsulation to also reduce immunogenicity (Sailaja et al., etain the viruses, magnetic tapractice (Lubbe et al., 2001) as well as to enhance viral infectio al., 2005; Haim et al., 2005). Similar features such as synovial capsules can be used to retain the viruses (Schopf et al.,

2.3.1.2 Viral surface modifications In order to influence the interactions between the virus and the cell surface, viral surface proteins can be modified, removed or replaced, leading to targeted transduction. Targeting can be either direct or inver disables binding of the viruse rget tissue and increases the concentrat lls. This can be achieved by including a protease-cleavable blocking domain to the virus targeting protein. Specific proteases in the target tissue will remove the blocking domain and allow attachment of the virus to the target cells (Fielding et al., 1998). Retrovirus tropism has been broadened by direct targeting with other viral glycoproteins, such as Vesicular Stom rotein VSV-G (Cronin et al., 2005

While changing viral glycoproteins is feasible, non-enveloped viruses require different methods. Adenovirus type 5 transduction is dependant on the adenovirus fibre knob binding to the CAR expressed on the target tissue (Mizuguchi and Hayakawa, 2004; Noureddini and Curiel, 2005). Methods to redirect or retarget adenovirus modificatipeptides to the HI loop (Work et al., 2004), binding moieties to the capsid (Parrott et al., 2003), chemical alteration of the capsid proteins (Turunen et al., 2002) or combinations of several techniques (Kreppel et al., 2005). However, with the genetic m the major limiting factor for recovering viable adenovirus is the correct folding of modified f lar cytoplasm. Incorrect folding of modified surface protein results in a dramatic decre iral titers and therefore reduced transduction efficiency (Magnusson et al., 2002). Adenovirus chemically coupled with polyethylglycol (PEG) resulted in reduced binding of neutralizing antibodies (Chillon et al., 1998) and increased circulation time after systemic increase (Ogawara et al., 2004). PEGylated baculovirus however resulted in decreased total transduction efficiency, but increased transduction in lungs and brain (Kim et al., 2006). Adenoviruses have also ied to block binding to native targets, lower toxicity and to prepare the virus for targeting (Koizumi et al., 2006).

As a compromise between the flexible chemical surface modification and robust genetic modification, display systems utilizing various binding moieties have emerged. Baculo- and adenoviruses displaying a synthetic immunoglobulin G (IgG) binding domain (ZZ domain) of protein A have been constructed and shown to be functionall ottershead et al., 2000; Volpers et al., 2003). These vectors enable a display on antibodies on the viral surface enabling the use of a wide selection of tissue-specific antibodies. Metabo ylated vectors further widen the selection to different molecules by using avidin as g reagent (Purow and Staveley-O'Carroll, 2005; Parrott et al., 2003). Another me

reagents, such as bispecific antibodies to provide a molecular bridge between the ector and targeting ligand (Choi et al., 2005).

Due to limitations in on this method

2002). To further r

ly, anatomical2005).

rgeting has been utilized in clinical n (Kadota et

se. Inverse targetingion to target ce

s to non-ta

atitis virus G-p ).

ons include insertion of targeting

ethodsibre in celluase of the v

been modif resulting in

y active (M

lically biotina cross-linkinthod takes advantage of soluble

crosslinkingv

30

2.3.1.3 Targeting at genetic level There are several proteins associated with the transport of nucleic acids to the nucleus, several of which are of viral origin. Nuclear targeting can be used to increase the transduction efficiency for example by using SV40 T-antigen nuclear localization signal (Nakanishi et al., 2001). After the genetic material has been delivered to the nucleus, the nucleic acid sequence will determinate the transduction efficiency.

Tissue-specific promoters and enhancer elements can be used to express transgene only in selected tissues (Sadeghi and Hitt, 2005). This method is often used as such to compensate for the lack of viral vector cell specificity, allowing the vector to penetrate to various cell types and yet express the desired gene in only a few. A drawback of tissue-specific promoters is that they are often weaker than constitutive promoters, such as cytomegalovirus (CMV) immediate/early promoter. Therefore use of weaker promoters would require either the use of enhancer elements or a higher viral dose, the latter leading to stronger immuno response (Gerdes et al., 2000). However, tissue-specifi

in hybrid promoter resulted in 90 day transgene expression, by which time CMV immed

cal), the use of conditionally replicative denoviruses might offer required specificity after systemic administration. However the replication

increases the potential side-effects and cytotoxicity of the viruses (Kruyt and Curiel, 2002;

c promoters can be modified to result in stronger protein expression, for example by introducing a positive feed-back loop by using transcriptional activators (Nettelbeck et al., 1998) or by adding stabilization elements for labile mRNA, such as Woodchuck hepatitis virus posttranscriptional enhancer (WPRE) (Lee et al., 2005). Baculoviruses with tissue specific glial fibrillary acidic prote

iate/early promoter derived expression was already undetectable (Wang and Wang, 2006).

Since the majority of the gene therapy research (67%) is cancer-related (Journal of Gene Medicine, http://www.wiley.co.uk/genmed/clinia

Sonabend et al., 2006). In addition to promoters and enhancers, codon optimization and specific signal

sequences together with traditional control elements, such as Kozak sequence, 3’ and 5’ untranslated region signals, polyadenylation sequences and introns (Makrides, 1999) should be used when optimizing the vector for clinical use. However, due to the long approval process, vectors may consist of decades old technology when finally arriving to clinical use.

Transposon systems such as Sleeping Beauty (Izsvak and Ivics, 2004) provide methods to affect to the possible viral integration and long-term expression of the transgene. As integration of the retroviral transgene has been determined to be associated with leukaemia after treatment for SCID (Schmidt et al., 2005; Woods et al., 2006), episomally maintained transgenes (Kreppel and Kochanek, 2004) might offer a method to avoid the drawbacks of uncontrolled genetic targeting. Another possibility to avoid the adverse effects deriving from gene integration to harmful sites could be targeting the retroviral integration to those actively transcribed sites in the genome, which are often related to fundamental cellular processes (Bushman, 2003), but exist with a high copy number and use insulator elements (Brasset and Vaury, 2005) to restrict the viral promoter to viral transgene expression only.

31

2.3.2 Vesi

986). igure 6 illustrates 20 aa transmembrane domain, 29-amino acid cytoplasmic domain with the

ontaining two N-linked glycosylation sites. A is located on the cytoplasmic domain (Schmidt and Schlesinger, 1979;

Retroviruses

d as a platform for display in baculoviruses (Chapple and Jone

cular stomatitis virus G-protein One of the most widely used pseudotyping glycoproteins is the G-protein of vesicular stomatitis virus, VSV-G. The most studied vesicular stomatitis virus belongs to the Indiana strain. Vesicular stomatitis virus is a non-pathogenic ssRNA virus and belongs to the rhabdoviridae family. The VSV-G is a trimeric 500 aa membrane glycoprotein (Doms et al., 1987; Kreis and Lodish, 1Fremaining amino acids displayed on the surface csingle molecule of palmitate Rose et al., 1984). The VSV-G has been able to transduce all tested cell types (Coil and Miller, 2004), making it difficult to determinate what are the interactions between the cellular surface and VSV-G which make VSV-G pantropic. VSV-G has been used successfully to pseudotype various viruses, such as retroviruses (Watson et al., 2002a), herpes simplex virus (Watson et al., 2002b), baculoviruses (Tani et al., 2001) and even non-enveloped adenovirus (Yun et al., 2003).

and especially lentiviruses, routinely rely on the pantropic effect of VSV-G, that also stabilizes viral particles (Burns et al., 1993).

The membrane-proximal stem region of VSV-G protein ectodomain (GS i.e. G stem) with transmembrane and cytoplasmic domains can potentiate the membrane fusion activity when coexpressed with some heterologous viral fusion proteins (Jeetendra et al., 2002). It is also known that the membrane proximal region is non-essential for G protein oligomerization, transport to the cell surface, or incorporation into virus particles but essential for acid-induced membrane fusion activity and virus infectivity (Jeetendra et al., 2003). It has been reported that fusion activity is a response to conformational change to the pH decrease during endocytosis (Matlin et al., 1982). However the exact region responsible for the fusion activity has not been determinated (Jeetendra et al., 2003). The VSV-GS has also been utilize

s, 2002; Ojala et al., 2004).

Figure 6. Schematic presentation of the vesicular stomatitis virus glycoprotein illustrating the functional domains (modified from (Rose and Whitt, 2001)).

signalsequence

1 16 463 482

transmembranedomain

462451

buddingdomain

179 336

511

COOHNH2

118 139 449 462

fusion domains

32

2.3.3 (Strept)avidin – biotin technology Avidin was first discovered when raw egg whites, used as the sole source of protein in the diet, caused disorders in test animals (Steiniz, 1898). The reason was found to be avidin, which bound H-vitamin, (biotin) and caused deprivation of this vital vitamin. Bacterial-derived streptavidin also binds biotin with high affinity (Green, 1975). Together, the (strept)avidin-biotin bond has been found to be remarkably strong in vivo and in vitro, resulting in a great number of avidin-biotin applications in life sciences (Figure 7).

Figure 7. Rationale behind (strept)avidin-biotin technology (based on Wilchek and Bayer, 1990).

33

2.3.3.1 Avidin and streptavidin Avidin is a tetrameric protein consisting of four identical 128 aa subunits, each capable of binding biotin with an affinity comparable to covalent bond (K ~10d

ins a glycosylation site, resulting in an increase to the molecular mass of tetramer after glycosylation from 57 120 to 62 400 Da (Wilchek and Bayer, 1990). The secondary structure of a single monomer consists of eight antiparaller β-strands, forming a tertiary structure with the biotin binding region on the end of barrel (Figure 8). Four monomers form a tetrameric quaternary structure with disulfide bridges (Livnah et al., 1993; Pugliese et al., 1993) .

Interestingly, avidin is highly thermostable, the temperature for denaturation without biotin is 85 °C and with biotin a remarkable 117 °C (Gonzalez et al., 1999). Furthermore, the complex is also highly resistant to strong denaturizing conditions over a wide pH range (Green, 1975). The overall charge of avidin is basic in physiological pH (pI~10.5), therefore causing possible charge-mediated binding

-15M) (DeLange and Huang, 1971). Each subunit conta

to negatively charged surfaces (Green, 1975). The early attempts to produce recombinant avidin suffered from insolubility and

incorrect folding, but later it was showed that production was possible using a baculovirus expression system (Airenne et al., 1997), in E.coli (Nardone et al., 1998; Hytonen et al., 2004), transgenic maize (Kusnadi et al., 1998) and later on with several viral expression systems, for example SFV (Juuti-Uusitalo et al., 2000).

The bacterial streptavidin has some major differences as compared to avidin: It has slightly acidic isoelectric point (pI) (Green, 1975) and does not have any disulfide bridges between the monomers. Depending on the application, the positive charge and sugar residues of avidin may hinder the use of avidin. Due to the bacterial origin, streptavidin is therefore often preferred in biotechnological applications, since the affinity of streptavidin is comparable to avidin, Kd~ 4x10-14 M (Green, 1990; Wilchek and Bayer, 1999).

Figure 8 a) 3d-structure (http://www.ncbi.nlm.nih.gov/Structure/) and b) schematical structures of avidin tetramer, c) together with four biotinylated ligands.

2.3.3.2 Biotin Biotin (vitamin H) is a sulphur-containing chiralic organic acid with a molecular weight of 244.2 g/mol (Figure 9). Biotin is known to be part of regulation of gene expression (McMahon, 2002) as well as having a known role in metabolism.

The attachment of the biologically active D-form of biotin, known as biotinylation, regulates the activity of enzymes involved in the central metabolism of a cell. The attached biotin serves as a carrier of an activated carboxyl group in carboxylation, decarboxylation and transcarboxylation reactions (Chapman-Smith and Cronan, Jr., 1999).

There are also several enzymes involved in the biotin metabolism in cells. Biotin protein ligase (BPL) and its bacterial analogue BirA are proteins specifically binding biotin and

34

attaching biotin to other proteins (Chapman-Smith and Cronan, Jr., 1999). Biotin carboxyl carrier protein (BCCP) is part of the acetyl coenzyme A carboxylase complex carrying the biotin cofactor

995). Biotinidase is a protein, which releases and a substrate of BPL (Athappilly and Hendrickson, 1the biotin from biotinylated proteins (Hymes and Wolf, 1999). The use of these biotin processing enzymes has advanced the use of the avidin-biotin system and removed steps involving chemical attachment of biotin.

Figure 9. d-Biotin, 5-[(1R,2S,5S)-7-oxo-3-thia-6,8-diazabicyclo[3.3.0]oct-2-yl]pentanoic acid (http://pubchem.ncbi.nlm.nih.gov/)

2.3.3.3 (Strept)avidin-biotin technology in gene therapy The avidin-biotin technology provides flexibility and increased compatibility for both therapeutic and research purposes. Applications are being developed to introduce new and more efficient, targetable vectors to the field of gene therapy (Laitinen et al., 2005b). This can be achieved either by biotinylation of gene therapy vectors chemically or metabolically (Barry et al., 2003) or by genetically attaching avidin to the viral surface, introduced in this thesis. Below are some examples of avidin-biotin technology within gene therapy.

Chemically biotinylated adenovirus vector was successfully targeted to haematopoietic cells through an avidin bridge carrying biotinylated c-Kit receptor ligand and

ilarly

pos et al.,

actor GF)-avidin fusion protein showed significant enhancement in transduction efficiency in EGF

able to diminish the native infectivity but guide the opism to targeted cell types (Purow and Staveley-O'Carroll, 2005). Altogether several viral ansduction systems have so far demonstrated the beneficial properties of avidin-biotin system for

modifying viral properties for targeted delivery.

resulted in 2,440-fold increase in reporter gene expression (Smith et al., 1999). Simbiotinylated retrovirus coated with avidin-polylysin resulted in enhanced transduction and widened the ecotropic viral tropism to human cells (Zhong et al., 2001).

A photocleavable biotinylation reagent used with the adenovirus was reported to provide a way to control adenovirus infectivity by reversing a prior alkylation of the virus (Pandoriet al., 2002b). Importantly, adenoviruses with biotin acceptor peptide in fibre capsid proteins haveresulted in metabolical biotinylation and showed enhanced transduction with various targeting ligands (Parrott et al., 2003). However the use of biotin display in adenovirus capsid IX protein or hexon capsomeres together with targeting ligands reduced the transduction efficiency, possibly by preventing the disassembly of the delicate viral capsid structure. The authors conclude thatadenovirus targeting would be most efficient through the capsid fibre biotinylation (Cam2004).

Chemically biotinylated adeno-associated virus together with epidermal growth f(Ereceptor- positive cells. (Ponnazhagan et al., 2002). Further on, biotinylated vaccinia virus with avidin crosslink to murine antibodies was trtr

35

2.4 Imaging in Gene Therapy

ilability have made magnetic resonance imaging (MRI), ositron emission tomography (PET), single photon emission computer tomography (SPECT) and

In vivo imaging has emerged as a valuable tool to identify the fate of the vector in the tissue, quantify the injected dose in the organ, evaluate the toxicity, analyze the gene expression pattern and possibly evaluate the therapeutic gene expression level as well as the outcome of the treatment (Schellingerhout and Bogdanov, Jr., 2002). To improve the safety of gene therapy vectors, it would be valuable to address all these points during the development of clinical treatment. The versatility, non-invasive imaging and clinical avapbioluminescence imaging popular choices in gene therapy vector development (Bogdanov, Jr., 2003). The next chapters will briefly introduce some key concepts regarding imaging in viral gene therapy. Table 4 summarizes the key features of the imaging modalities reviewed in this chapter. Table 4. Characteristics of the major imaging modalities. Modified from (Massoud and Gambhir, 2003).

PET SPECT Bioluminescence imaging

Fluorescence imaging

MRI

Electro-magnetic radiation used

high-energy γ-rays

lower-energy γ-rays

visible light visible light or near-infrared

radio waves

Spatial resolution

1-2 mm 1-2 mm 3-5 mm 2-3 mm 25-100 µm

Depth no limit no limit 1-2 cm < 1 cm no limit Temporal resolution

10 sec to minutes

minutes seconds to minutes

seconds to minutes

seconds to hours

Molecular probes needed

~ng ~ng ~µg – mg ~µg - mg ~µg – mg

Sensivity 10-11–10-12 M 10-10–10-11 M

estimated: 10-15–10-17 M

10-9–10-12 M 10-3–10-5 M

Quantitative degree

+++ ++ + to ++ + to ++ ++

Advantages sensitive, isotopes can substitute naturally occurring atoms, quantative translational research

many molecular probes available, multiple label detection simultaneously

highest sensivity, quick, easy, low cost, relative high throughput

high sensivity, detects fluorochrome in living and dead cells

highest spatial resolution, combines morphological and functional imaging

Disadvantages cyclotron or generator needed, relatively low spatial resolution, radiation to subject

relatively low spatial resolution because of sensivity, collimation, radiation

low spatial resolution, 2D imaging only, relatively surface-weighted, limited translational research

relatively low relatively low spatial sensivity, long resolution, scan and post surface processing weighted time, mass

quantity of probe may be needed

36

2.4.1 Transduction and biodistribution imaging The current imaging methods in gene therapy can roughly be divided in two, namely transduction and biodistribution imaging. While transduction imaging visualizes the expression of transgene or resulting products from the protein expression, biodistribution imaging visualizes the actual distribution of the viral particles in the system. While studying only the transduction pattern, biodistribution results would be biased, ignoring the fact that the virus could be unable to express the transgene

marizes the major marker prote

s in all cells. Depending on the application and animal model, important data could be obtained when including the viral particle biodistribution studies to the preclinical vector development.

Various intra- and extracellular imaging agents have been developed for the pre-clinical or clinical use for molecular imaging with different methods. Table 5 sum

ins used in transductional imaging with different imaging approaches. Table 5. Marker proteins used for transductional imaging (modified from Weissleder and Mahmood, 2001).

Marker protein: Intracellular

Imaging modality

Ligand or Mechanism substrate

Thymidine kinase PET/SPECT, MRI

FIAU, FHBG, FHPG, FMAU, FGCV ganciclovir, penciclovir

Phosphorylation of prodrug, diffusion changes

Cytosine deaminase MRI Cytosine, Deamination of prodrug, fluorinated prodrug fluorine imaging

Tyrosinase PET/SPECT, MRI

Tyrosine, dopamine Oxidation of substrates into melanin or metal scavenging

Arginine kinase MRS ATP and arginine Conversion to phosphoarginine Creatine kinase MRS ATP and creatine Conversion to phosphocreatine Beta-galactosidase MRI Galactosylated Cleavage of galactose residues

chelators changes relaxivity Green fluorescent protein

Optical None Fluorescence

Luciferase Optical Luciferin Bioluminescence Proteases (cathepsin D) Optical Quenched near Fluorescence activation

infrared-fluorescent fluorochromes

Cell surface Gastrin-releasing-peptide-receptor

PET/SPECT Bombesin Affinity binding

Somatostatin receptor PET/SPECT Peptides Affinity binding Dopamine-2 receptor PET/SPECT 18F spiperone Affinity binding Iodine binding PET/SPECT Iodine Trapping Fusion proteins PET/SPECT 99mTc chelates Transchelation Engineered internalizing receptor

MRI Transferrin Internalization, relaxivity change

Ferritin receptor MRI Body’s iron Affinity binding Biotin-acceptor peptide transmembrane domain

PET/SPECT/ MRI/OPTICAL

A suitable Affinity binding avidinylated ligand

37

2.4.1.1 MRI Magnetic resonance imaging has the advantages of high spatial resolution and the ability to measure more than one physiological parameter using different pulse sequences. The underlying principle in MRI is based on the nuclear magnetic resonance phenomenon (NMR); unpaired nuclear spins (usually hydrogen atoms from water or organic compounds) align themselves when placed into a magnetic field. After a radiofrequency pulse the magnetic dipoles realign themselves with a

laxation time corresponding to their physicochemical environment (Massoud and Gambhir, 2003). ommonly used proton MRI utilizes the signal from water proton spin relaxation, augmented by

etals with high magnetic moments. The natural insensivity of plification strategies or micromolar concentrations of

ection (Schellingerhout and Bogdanov, Jr., 2002; Bogdanov, Jr., 2003). agents used in MRI can be divided into two categories according to the

st often associated with positive contrast (increasing the signal) and T2 the signal). Time constant T1 is involved in the longitudinal

mbient magnetic field and is known as “spin-lattice” relaxation. The ation is from the

e positive contrast gent separates clearly from the background, the negative contrast agent also covers the signal from ssue thus eliminating the anatomical imaging.

weighted compounds containing a

e ki

reCcontrast agents, usually transitional mMRI detection requires robust cellular amthese agents to enable det

The contrastrelaxation, T1 agents are mowith negative contrast (decreasing relaxation in the direction of aT2 time constant is perpendicular to the ambient magnetic field and the relaxinteractions of spins, known as “spin-spin” or transverse relaxation. While thati

Typical T1 contrast agents include small Lanthanide chelate as a contrast producing element (e.g. Gadolinium-DTPA). Since the relaxivity values are in the range of 5-80 (mMs)-1, the required concentration needs to be in the order of mM (Massoud and Gambhir, 2003). This limits their use or directs towards larger molecules with elevated relaxivity or multilabelled chelates like real-time detection biodistribution of gadolinium-labelled liposomes in the primate brain (Saito et al., 2005).

Cowpea chlorotic mottle virus particles, consisting of protein cages which bind multiple gadolinium ions, have been introduced as high-relaxivity MRI contrast agents to image viral particles (Allen et al., 2005). In another approach the expression of the LacZ marker gene is detected by utilizing the enzyme’s capability to cleave carbohydrate residue from modified Gadolinium chelates resulting in increase in relaxivity (Louie et al., 2000). However this approach has not been highly reproducible (Dr. M. Lythgoe, personal communication).

For T2 contrast agents, different iron oxide nanoparticles have proved to be efficient. These particles usually consist of a crystalline iron oxide core, typically Fe3O4 surrounded by a polymer coating of dextran, PEG or ionic substances like citrate. Since they consist of solid iron, their relaxivity values can be ~200 (mMs)-1. Successful imaging of stem cell migration in vivo has been achieved by feeding stem cells with iron oxide particles in vitro (Frank et al., 2004). Transferrin receptor regulation and expression can be visualized by using a transferring probe with superparamagnetic capabilities (Weissleder et al., 2000).

The high metal binding capacity of melanin in the tyrosinase-melanin system, has been utilized to result in imaging of a single enzyme activity (Weissleder et al., 1997). As thymidin nase is one of the most used therapeutic proteins in cancer treatments, a method describing the visualization of thymidine kinase induced apoptosis and diffusion changes after adenovirus gene therapy (Hakumäki et al., 1998) might be implemented in clinical use together with gene therapy.

It has been recently described that adenoviral transduction of ferritin receptor to rat brain concentrates the body’s natural iron to quantities detectable by MRI. This method could be used to image viral transduction in rat brain in a non-invasive manner, without any external ligands (Genove et al., 2005).

38

Widening the applications available for MRI-devices, magnetic resonance spectroscopy (MRS) is capable of detecting the metabolites for various genes, some of which might be used as

ylor-Robinson, 2000).

). PECT imaging requires gamma cameras, rotating around the subject, to detect γ-emitting isotopes

99m 111 123 125 131 ection,

Am any other e thym g s x type 1 virus (HSV1-tk) has proven to be very useful in nuclear imaging. It combines the therapeutic effects and enables visualization of the viral transduction pattern with a suitable isotope-probe. Adenoviral

express quan in vivo CV as bhir et al., 1999). -label iclovir has sed as an effective substrate for HSV1-tk and evaluated to

any imaging applications, for example in breast cancer (Alauddin et al., 2004). In d heart FDG, a analo been mos used fo to

glucose metabolism (Gambhir et al., 2001). Another suitable mar , sodi ne symporter gene expression, can be used

ith a s jection dete ovirus b on in on-anner (Groot-Wassink et al., 2002). B a site for ibosomal entry (IRES) o gen he genes are scribed to mRNA b ed into two separate

bicistronic vectors include D2R and HSV1-sr39tk, imaged with microPET from trans s in ng d L V-t ith

Vir tribution ging by la viral partic active compounds quases d to as et th

percentage of t s ac ined ( 8). Interestingly, no or atta 111I u ud speculate that 11 xine w in nt spac s, a indium transchelates to viral proteins and becomes stably bound. The authors demomethod preserves viral infectivity and enables the quantification of viral biodistribution (Schellingerhout et al., 2000). S oiodinated adenoviral fibre protein knob domains (Awasthi et al., 2004) or technetium-labelled adenovirus (Zinn et al., 1998) have been used to

c ing v tribuWh nd SPE alm imaging producing quantitative 3D

data, the resolution of isotope ima its e ana distri n level (Massoud 20 ovi e l data imaging, multim aging m m ography (CT) with PET/SPECT ima most replaced singl ing in clinical use (Ya ). Additionally, MR-PET im combination of nuclear data to anatomical coordinates (Seemann, 2005).

marker genes in gene therapy (Bell and Ta

2.4.1.2 PET / SPECT The Positron emission tomography (PET) probes are labelled with a positron-emitting isotope that is capable of producing two γ-rays through emission of a positron from its nucleus, which eventually annihilates with a nearby electron to produce two 51 000 eV γ-rays at ~180 ° apart. Positron emitting isotopes frequently used include 15O, 13N, 11C and 18F as a substitute for hydrogen (Massoud and Gambhir, 2003; Walker et al., 2004).

Since the calculation of the origin of decay is simple, the sensitivity and spatial resolution of PET are higher than imaging with Single photon emission tomography (SPECTSsuch as Tc, In, I, I, I (Rosenthal et al., 1995). Due to the differencies in the detSPECT is at least a log order less sensitive than PET (Massoud and Gambhir, 2003).

ong m nzymes, idine kinase trans ene from Herpe simple

HSV1-tkFHBG,

ion could be ed penc

titated been u

by using FG a probe (Gam18F

be superior in mbrain anintegrate to

disorders glucose gue, has t widely r its ability

ker gene um ioditogether winvasive m

ystemic in of 125I to rmine adeny using

iodistributiinternal r

vivo in a n

between twproteins. Such

es, t tran a single ut translat

adenovirus fected tumour mice (Lia et al., 2002), an acZ with HS k, imaged wSPECT (Tjuvajev et al., 1999).

has prodal biodis ima belling les with radio

ucedsimplex viru

ntitative data about the kineticswere injectehe virus wa method f1

and distribution of viruses. Radiolabelled Herpes with different m in the tumour

n- molecule was the tegume

gliosarcomtually retaching the as trapped

imilarly, radi

hods, showingSchellingerhout et al., 199sed in the st

e of the viru

at a very low

y. The authorsfter which the

nstrate that this Indium-o

determine the fa tors influencile PET a

and Gambhir,odality im

ging has alaging is be

iral biodisCT enable ging limits03). To pr which co

ing developed to enable better

tion. ost real-time

use to map thde more accuratbines x-ray co

e-mode imag

tomical bioanatomicaputer tom

bution to orgato the nuclear

p et al., 2004

39

the quantification is not simple and the signal is hindered by light absorption of haemoglobin

o decades. The bust expression can be imaged from live or fixed tissue/ cells and no substrate is required for the

a

reaction immun cal means ple, recombinant detected in ter intra inistration, suggesting that optical nerves

or viral (PrContrary to GFP, the optical im y

catalyze formation of products. Luciferase en atalyzing production of photons in the visible range of spectrum with an oxyge ependent manner with a short half-live in

used nescence gen d rluc are cfirefly and Renilla sp. coral. While the former en es not require

g therefore im den s2003).

gene ther pplications, xpng the lus as a marker tud

mal ex n could be i 10 weSome apparent drawbacks can also be taken advantag -live of the

e express ies with vario Xu et al., 2003). he robust nature of the enzyme, it is functional even as a fusion protein together with GFP

lay, 2002).

2.4.1.3 Optical imaging Optical imaging can be divided into two categories; firstly, fluorescent imaging, where the external light source excitates the fluorochrome and the energy is then emitted with a different wavelength when the fluorochrome returns to its ground state. Secondly, luminometric imaging, where the energy is obtained from chemical reactions and light is released enzymatically. In both cases the light emitted from the body is usually detected with charge-coupled devices (CCD detectors) which can, in suitable conditions, detect very low level signals. However, there are major fundamental drawbacks associated with optical imaging. The efficiency of the light transmission through the tissue is limited,

, limiting the imaging depth to centimetres (Massoud and Gambhir, 2003). Green fluorescent protein (GFP) from jellyfish Aequorea Victoria and its variants are

one of the most widely used marker genes in biomedical research over the last twrodetection (Spergel et al., 2001). In biodistribution studies, GFP is routinely expressed underuniversal promoter such as CMV and the results from optical imaging are confirmed withpolymerase chain AAV could be

(PCR) or brains, af

ohistochemiocular adm

. As an exam

serve as pathways f biodistribution ovost et al., 2005). aging enzymes are invzymes are capable of cn/substrate d

isible to the detectors until the

cells. The most often lumi es fluc an enzyme is ATP-dep

loned from Photinus pyralis –dent, the latter do

ATP allowin aging indepen tly of the metabolic tate of the cell (Bogdanov, Jr.,

In apy a viral transgene e ression can be detected non-invasively by usi iferase gene. In a recent s y, herpesvirus saimiri lusiferase marker gene’s episo pressio maged for up to ek (Smith et al., 2005).

e of. The short halflusiferase enzyme enables Due to t

inducibl ion stud us promoters (

(Yu and Sza

40

3 Aims This study was implemented to carry out universal strategies to improve baculoviruses as gene delivery vectors with a special focus in using avidin-biotin technology for virus modification and imaging. More specifically, the following issues were addressed:

(I) Could avidin be displayed on the baculovirus surface as an N-terminal fusion to baculovirus major env

avidin-displaying baculoviruses when imaged by SPECT w

elope glycoprotein GP64 and further be utilized by using biotinylated ligands to affect the properties of baculovirus? Could a magnetic force be used to physically target the virus in vitro? (II) Could biotinylated iron particles be used to visualize the avidin displaying viral vector biodistribution in vivo by using MRI? (III) What is the particle biodistribution of

ith biotinylated poly-lysine-DTPA? (IV) Does the VSV-GED enhance the transduction efficiency when expressed together with baculovirus gp64?

41

he methods used in Articles I-IV are summarized in Table 6 and described with more detail in the The materials used in Articles I-IV are summarized in from Table 7 to

4 Materials and methods Treferenced publications. Table 10 and described with more detail in the referenced publications. Table 6. Methods used in this study

Method Description Used in DNA Cloning Vector construction I, IV Production of viral vectors Baculovirus vector production and concentration I, II, III, IV Analysis of viral vectors Baculovirus titer determination: end-point dilution I-IV

SDS-PAGE and immunoblotting I, IV Transmission electron microscopy I Atomic force microscopy II

Characterization of virus properties

Optical biosensor analysis I Fluorescence correlation spectroscopy I Transduction efficiency by β-galactosidase staining I,II,IV Cell biotinylation I EGF targeting I Magnetic targeting I Cytotoxicity assay I,II,IV Luminescence assay for β-galactosidase expression II,IV

In vitro experiments

Syncytium formation assay IV Endocytosis blocking IV Stereotactic injections to rat brain II,III,IV Intramuscular administration III, IV Intraperitoneal administration III Systemic injection III M

In vivo procedures

agnetic resonance imaging II SPECT/CT imaging III

PCR Standard I, IV RT-PCR III Histochemical analyzes Beta-galactosidase staining II,III,IV DAB enhanced iron detection II Immunostainings III Statistical methods Mean ± SEM or SD, unpaired t-test I-IV ANOVA III

42

tudy Table 7. Plasmids used in this s

Plasmid Reference Description Used in pFastBac-1 Invitrogen, Carlsbad,

CA, USA Backbone for Baavi I

pBacSurf-1 Novagen, Madison, WI, USA

Source of gp64 gene I

pCMV-VSVG T.Friedmann, USCD, La Jolla Ca, USA

Source of VSV-G gene IV

pAIV-11 (Airenne et al., 2000) Source for LacZ gene I Table 8. Cell lines used in this study

Cell line Source Description Used in 293T/17 ATCC: CRL-11268 Human kidney carcinoma IV BT4C (Sandmair et al., 1999) Rat glioma cells I,IV EAHY-926 University of North-

Carolina, Department of Pathology, NC, USA

Hybridoma of human airway epithelium and HUVEC cells

IV

HELA ATCC: CCL-2 Human cervical epithelium IV HEPG2 ATCC: HB-8065 Human hepatocarcinoma I,II,IV RAASMC (Ylä-Herttuala et al., 1995) Rabbit aortic smooth muscle

cells I,IV

SF-9 Invitrogen, Carlsbad, CA, USA

Spodoptera frugiperda IPLB-Sf-21-AE cells

I,II,III,IV

SKOV-3 ATCC: HTB-77 Rat ovarian carcinoma I,IV Table 9. DNA oligomers used in this study

Sequence Description Used for Used in ggccactgcagctccttctgtgtgcgcagg E503; 5’ forward Colony screening I ccggcctgcaggccagaaagtgctgcgtga E507; 3’ reverse Colony screening I ccgggctgcaggctgctgcccggcggggtgct E516; 3’ reverse Colony screening I gtaagatct E718; linker cloning I cgcgcagatcttac E719; linker cloning I ctagatacgtaa E759; linker cloning I agctttacgtat E760;linker cloning I aaatagatctcctaggagatctattt G679; linker cloning IV atgcatttaaatgcattgca G680;linker cloning IV ggggtgatactgggctatccaa G681; 5’ forward amplification IV agatctttactttccaagtcggttca G682; 3’ reverse amplification IV

43

Table 10. Antibodies used in this study

Antibody Source Description Used in Anti-GP64 mAb Insight Biotechnology,

Webley, UK To detect GP64 I, IV

Anti-avidin pAb (Laitinen et al., 2002) To detect avidin I Anti-VSV-G Sigma Aldrich, St.

Louis, MI, USA To detect VSV-G IV

Anti beta- galactosidase

GeneTex, San Antonio, TX, USA

To detect beta-galactosidase III

44

properties which would not e possible by means of genetic engineering.

pters will review and discuss the main findings of this study. The article as Roman numeral / referen

l data is also shown.

e vi e each modification to the viral ds to be created n order to develo ethods for

targeting gene therapy vectors platform would require a high affinity binding site on the viral surf to the ligand. vidin-biotin

is criter

5.1.1 Gp64-avidin fusion rporated in the baculovir rface We created an avidin displ m velope glycoprotein gp64. As the gp6 e (Mangor et al., 2001; Monsma et al., 1 de to an extra copy of gp64 which was

culovirus p that even short pe rtions y can decr ., 2006).

The avidin-biotin finity of biotin to a one of the strongest known in nature scussed in 2.3.3. The strong affinity between the biotinylated ligan eeping the virus coated h targeting ligand in vivo. As compared to systems (Volpers et al., 2003; Ojala et

04; Parrott et al., 2003), ld benefit the virus by introducin lyvalent e charge, which has bee increase gene transfer efficiency (Lee et al., 2000).

that urface may produce pro viral is ess loviral infection (Bliss enz,

992). The fusion protein an viral surface and an roblems in merization decrease the baculovirus titer ). The tite rming units (pfu) ratio of Baavi

nd non-modified baculovirus, produced and concentrated with similar methods, were compared nd no significant differences were seen, in accordance with others (Matilainen et al., 2006). These

data suggest that the steps of producing the fusion-protein and incorporating it into the virus envelope are not interfering with the virus propagation in the Spodoptera frugiperda ovarian cells (Sf9).

Successful avidin-gp64 fusion protein expression was confirmed by immunoblotting. It suggested that avidin-gp64 fusion protein was able to form oligomers (Article I/ figure 1). However, the actual composition of viral surface oligomers is not known. The gp64 is a trimeric protein whilst avidin is a tetramer (Oomens et al., 1995; Green, 1975). Therefore, the situation in

5 Results and discussion As gene therapy provides new methods of treatment for various diseases, the tools used in gene therapy will have to be modified to meet the needs. Viral display systems can be used to affect the interaction between the virus and the cell surface, even to introduce newb

The following cha the origresults are referenced to

additionainal article (the ce) and some

5.1 Article I Genetic engineering of thsurface nee

ral vectors is time-consuming, sincloning. Iby means of molecular c p m

, a more versatile targetingace and easily attachable counterpart ia and provides a one-step method to

Ainteraction fullfills thsurface.

attach ligands on the viral

protein was inco us suenaying baculovirus, Baavi, by fusing avidin to

g, entry and endosomal ajor

e 4 is essential for viral buddinre ma

scap996) modifications we

expressed under bato the only gp64 cop

olh promoter. It has been reported t et al

ptide inseease the virus efficiency (Erns system was selected, since the af

-15 , 1975), dividin is

(Kd~10 ) (Greend and avidin is essential for k

l display wit

other published vira avidin coual., 20

ositiv the use of g a po

p n shown to It is knownropagation, since gp64

modification of the virus s blems in and Wp ential for several steps of bacu

eting on theard

1 d gp64 are comp y pproduction or oligoMangor et al., 2001

of the gp64-fusion protein may l particle (vp) to plaque fo(

ars and vira

a

45

the viral envelope may vary from dimeric to tetrameric forms or the fusion protein may form native gp64 (Boublik et al., 1995), visualized in Figure 10. hetero-oligomeric structures with

igure 10. Possible models for assembly of trimeric membrane glycoprotein fused together with a tetrameric

of dimeric or Laitinen et al., 2001) or single/dual chain avidins nd et al., 2004; N fusion se gp64 oligo ation.

y, this kind o t in formin i roduct. It has been reported tha p64 a elope, while monomeric forms are de inutes after synthesis (Oomens et al., 1995). In the

velope, the trim zed by interm Vo an and h, 1984) and 10 e needed to r (Mar al.,

e factors fav gp h hown that slightest modification will result in a decrease in the amount and lower titers (Ernst et al.,

Optical biosensor analysis (I/ fig 4), flu spectroscopy (FCS)

fig 3) and tra n microscopy er incub with iotinylated gold particles confirmed that the avidin-gp64 fusion protein had retained the biological

to 20 biotinylated ligands. In icroscopy images, the amount of avidin molecules / virus is

around tens/ slice, which is in agreement with the (FCS) results (I/ fig 3a) of minim els/ virus. As with other baculovirus display reports (Mottershead et al., 2000; Tami et al., 2000; Toivola et al., 2002; Ojala et al., 2004; Matilainen et al., 2006; Makela et al., 2006; Ernst et al., 2006), it seem e fusion partner affect the number of gp64-fusion proteins in the viral surface, possibly by the random acquirement of the fusion protein from viral budding. Display of GFP-gp64 fusion protein resulted in an average of 3.2 fusion proteins per virus (Toivola et al., 2002). It is suggested that larger fusion partners interfere with the viral incorporation of the fusion p

As com arrott et al., 2003) the am is more than after adenovirus fibre metabolical biotinylation, shown to be sufficient for targeted viral transduction although direct comparison of different viruses is difficult. Fusion protein ability to bind biotin indicated that the protein was able to fold correctly, further con by optical

Fprotein.

The use monomeric avidins ((Nordlu ordlund et al., 2005) as partners might ea merizConsequentl f approach may assis

t only trimeric forms of ggraded within 30-45 m

g more homo-oligomerized fusre included into the viral env

on p

viral en ers are stabili olecular disulfide bonds ( lkmGoldsmit of those trimers ar esult in fusogenic activity kovic et1998). Thes or the formation of all native 64 trimers and several studies

gp64 ave s

2006).orescence correlation

assays (I/ nsmission electro imaging (I/ fig 2) aft ationbactivity and FCS suggested that one viral particle could bind to 10 addition, according to the electron m

um 10-20 lab

s that size and composition of th

rotein (Matilainen et al., 2006). pared to adenovirus biotinylation (P ount in this work

firmed

46

biosensor affinity results (I/ fig 4). Altogether these data suggested that the fusion protein is incorporated into the viral envelope in a functional form.

Modification of a viral envelope could lead to increased cytotoxicity or immuno response. The MTT-assay suggested that only low cytotoxity could be associated with the virus even with moi 1000 (I/table 1), correlating with later in vivo results (III/table 2).

5.1.2 Titering of baculoviIt is essential d which determinates the viral concentration; the titering. The standard meth tious titer and moi to determinate the gene delivery efficiency. The infectious point dilution method (O'Reilly et al., 19 ability of the baculovirus to infect Sf9-cells (production cell line). The resul titer is indicated as pl liliter (pfu/ml). Other methods are to use r of viral partic ive), determined by optical density and assay (similar to end-point dilution). Recently other methods, such as flow

ansducing titer, TU (Chan et al., 2006a), quantitative real-time PCR (Chan et al., 2006b) and cell diameter (Janakiraman et al., 2006) based methods have been published.

Regardless of the method used, the viral surface display might change the binding properties of the virus and result in altered viral efficiency in infecting the insect cells used for the titer determination. If the modification results in improved insect cell infection, while not changing the properties for gene delivery for mammalian cells, actual pfu titer would be lower than in reality, leading to decreased mammalian cell transduction efficiency. Respectively, decreased pfu would lead to increased transduction efficiency. In a recent study, infectious titers were determinated to be partly related to, but not reliably reflect, the capability to transduce mammalian cells (Chan et al., 2006a).

Although titers can be determined with different methods, the total viral particles to pfu ratio should remain constant within the same production facility and therefore reflect established methods. In addition, as baculoviruses are degraded to some extent at +4 °C storage (Jorio et al., 2006), titering should be performed at intervals to remain certain of the reproducibility of the obtained results. However, comparison of total viral particles to pfu ratio can be difficult: according to the literature the ratio of total viral particle / pfu of baculovirus has been estimated at 300 (Knudson and Tinsley, 1974), 128 (Volkman et al., 1976), 4-6 (Dee and Shuler, 1996) or an average of 3.7 (Shen et al., 2002) as compared to 7 (or generally <10) of adenovirus (Ugai et al., 2005). However, these contradicting reports may reflect improvement in the viral production between different laboratories, making it difficult to compare experiments between groups if ratio is not measured.

5.1.3 Baavi resulted in enhanced transduction in vitro It has been shown that biotin, when covalently attached to cell surface membrane proteins, enables efficient entry of avidin bioconjugates into nucleated cells (Wojda et al., 1999) providing a possible way to transduce cells without a specific receptor for a virus. This approach offers a possible method to increase local transduction efficiency without having to increase the viral dosage and create cytotoxicity problems. As regarding possible clinical use, cell biotinylation experiments in vivo have resulted in successful targeting of molecules via biotin-avidin interaction (Hoya et al., 2001; Yolcu et al., 2002; Rybak et al., 2005), without major toxicity. In addition, the surface biotinylation followed by avidin-particles has been demonstrated to be a feasible method to achieve 85% transduction efficiency in rabbit renal arteries in vivo (Hoya et al., 2001). Interestingly, it has been reported that cell surface biotinylation in vitro has been maintained for weeks (Yolcu et al., 2002), possibly widening the temporal window for avidin-biotin targeting in vivo.

rus to examine the methood is to use the infec titer is assayed by end- 94), based on the

ting virusaque forming units per milles (infective + non-infect

the total numbeplaque formationcytometry based

tr

47

In order to examine the avidin-binding of Baavi, BT4C and RaaSMC cells were avi or wild type virus. Baavi resulted in 100 to 270 % increase in

ount of avidin per virus to be adequate to achieveattachment to cells. It was also observed th ro the transduction volume of thvirus affects the transduction efficiency, larger volumes favouring the avidin-biotin interaction, possibly decreasing the effect of viral sedimentation (Dee and Shuler, 1996). In accordance, higcell confluency reduced the baculovirus transduction efficiency, possibly preventing the access tthe basolateral side, as suggested by Bilello et al., 2003.

We also found that as compared to w baculoviruses the gene transfer efficiency of Baavi per se was significantly higher in BT4C a C cell lines (I/ Fig 5). The effect was more evident at lower mois, but diminished with higher mois used. This could indicatthe saturation of the transduction pathway with hig resulting diminishment of thdifferences caused by avidin display. Similar results we detected with VSV-GED virus (IVfig 3). The enhanced transduction efficiency may be due to the high pI ratio of avidin which is reported to enhance cellular uptake (Pardridge and Boado, 1991) or possibly binding to hepari(Kett et al., 2003; Kett et al., 2005). Avidin could enable negatively charged cell surfacebecause avidin pI 10.5 presents a high positive net charge at physiological pH and baculovirus entry has been suggested to be affected by electrostatic interactions with the negative heparin sulphate proteoglycans (Duisit et al., 1999). While the hypothesi e net charge is reasonable, oncan not overrule the unspecific binding to cells by avidin ins (Marttila et al., 2000).

5.1.4 Targeting the Baavi he display of avidin on the viral surface should enable coating of the virus with targeting

molecules. We therefore examined the binding of biotin-conjugated EGF to EGF receptor overexpressing SKOV-3 cells and observed enhanced binding with both Baavi and EGF-coated Baavi as compared to the wild-type virus (I /fig 6). Similar reports of increased binding have been reported by using gp64-ZZ domain displaying baculovirus (Ojala et al., 2001) and truncated VSV-G-ZZ displaying baculoviruses (Ojala et al., 2004), both coated with cell-specific antibodies. However, no increased transduction efficiency to permissive cells could be observed either with these approaches or by ours. However, by including a RGD- motif peptides from the foot-and-mouth disease virus protein VP1 (Ernst et al., 2006) or coxsackie virus A9 or VP1 protein from human parechovirus 1 to gp64 (Matilainen et al., 2006), improved binding and transduction efficiencies are reported. The difference might be explained by the different route after the binding to the cell surface, enhanced binding with antibodies or ligands not triggering further internalization and transduction. Even though integrin specific motifs have shown promising results, the native copy of gp64 still retains its binding properties overruling weaker interactions, such as with baculovirus displaying integrin α2 specific motif (Riikonen et al., 2005).

In the future it might be essential to remove the native gp64 and provide the necessary functions for infection and endosomal escape by using other glycoproteins with reduced binding. With this method, targeting might be possible by using a pathway leading to triggered viral internalization and subsequent endosomal maturation.

Yet, with cells defined as non-permissible (for example EaHY), the restrictions in the later endocytic pathway as suggested by a previous study (Kukkonen et al., 2003), might restrict the positive effect of increased or targeted binding. If true, this would require novel methods for capsid targeting or unblocking the obstacles in nuclear traffic to take advantage of enhanced binding to cells.

biotinylated and incubated with Batransduction efficiency which suggests the am

e biotinylated at in vit

h o

ild-type nd RaaSM

e e /

her mois, re also

n s binding to

s of positiv glycoprote

e

T

48

uction in vitro he equation describing the magnetic force affecting the particles in a magnetic field is presented in

itations and applications in the magnetic targeting, since a magn

5.1.5 Magnetically targeted transdTequation 1, where B is the magnetic flux density (field strength), ∇B magnetic field gradient, χ2 is the volume magnetic susceptibility of the magnetic particle, χ1 is the volume magnetic susceptibility of the surrounding medium and μ0 is the magnetic permeability of free space (Dobson, 2006). This equation is the basis of understanding the lim

etic field gradient is always needed to cause magnetic force into the particle and large volume particles and high magnetic susceptibility result more magnetic force being affected.

)(1)(0

12 BBVxxmag ∇−=μ

Equation 1

As an approximation, it can be stated that the smaller the particle, the higher the agnetic field gradient is needed to affect the particle and compensate for the Brownian motion.

According to the literature review (Dobson, 2006) a 0,7 mT field strength requires a constant field

F

While increasing the size of the particle might be feasible in vitro, the physiology of the capillaries sets boundaries to the size of the iron particles in vivo as the smallest capillaries are 3-4 µm (Young and Heath, 2000). Larger particles are likely to cause emboli within the capillary bed of the lungs.

m

gradient of at least 100T/m to capture most magnetic particles in vivo. Permanent NdFeB magnetsprovide >1T magnetic fields, thus enabling magnetic field strengths of > 10T/m up to 3mm with in vitro use (Schopf et al., 2005).

In order to examine magnetic targeting of Baavi in vitro we used biotinylated Spherotech 1,1 µm small paramagnetic iron oxide particles (SPIO) and 1T NdFeB magnets with plated monolayer BT4C cells. When Baavi was coated with biotinylated SPIO, clear targeting was seen in the areas where the magnet was beneath the wells (I/ fig 7). Similar in vitro transduction patterns matching the magnet area have been described by others using biotinylated retro- and adenoviruses (Pandori et al., 2002a; Hughes et al., 2001). When avidin binding was blocked with excess biotin, no targeting effect was seen with the magnets, providing proof that the binding was due to the specific bond between avidin and biotin. We also analyzed the effect of the SPIO material on the targeting (Table 11) and found that while silica coated SiMAG-particles were able

clear medito um from avidin-displaying viruses efficiently (a), the same experiment with wild type virus suggested unspecific binding with SiMAG (b), which was later also recognized by the literature (Bagwe et al., 2006). The experiment also proved it was possible to concentrate Baavi from the dilute mediums (unpublished data).

49

Table 11. Constant volume of a) Baavi or b) wild-type virus was mixed with equal amount of SiMAG-biotin(Chemicell, silica based) or Spherotech-biotin magnetic particles (polystyrene-coating) in similar volumes to tethe binding efficiency. Transduction of pelleted particles was performed with NdFeB magnets in BT4C cells and presented in scale of – (no transduction) to +++ (extensive transduction).

st

a) Baavi Transduction at 24 h SiMAG +++ Spherotech ++

b) Wild-type virus SiMAG + Spherotech -

With a weaker ferrite magnet (0.1 T) the targeting effect was more subtle and

increased sporadic transduction was seen throughout the well, indicating that the increase in the magnetic field strength augments the particle sedimentation and dimishes the Brownian mo(Huth et al., 2004). In addition, an increase in the external magnetic field strength can be usedforce the magnetic particles through the cellular membrane, possibly bypassing the normal cellular uptake (Mondalek et al., 2006).

tion to

pproaches in vitro. The use of paramagnetic particles enabled the physical concentration of irus with magnetic force (Nesbeth et al., 2006; Hughes et al., 2001), resulted in increased

The use of magnetism together with non-viral or viral systems has been utilized in several avtransduction efficiencies in vitro (Chan et al., 2005) and targeting (Plank et al., 2003; Rudge et al., 2001). However, while in vitro the high magnetic field gradient of a few millimeters is sufficient to draw the magnetic particles to the monolayer cells, in vivo such depth would be inadequate. Although the idea of highly specific 3D magnetic targeting in vivo would be tempting, due to the properties of magnetic fields (Figure 11) lateral targeting (Li et al., 2005), localization to organs near the surface (Goodwin et al., 1999; Arbab et al., 2004) and retention to extremities (Alexiou et al., 2003) have been most feasible. Nevertheless, magnetic materials have proven to be promising in several clinical studies including hyperthermia and magnetic drug targeting (Lubbe et al., 2001). In some experiments the depth of magnetic field of 0.1 T has been increased to 10 cm resulting to first pass targeting and retainment for six days (Goodwin et al., 1999).

50

Figure 11. Magnetic field lines of a bar magnet, S and N denoting poles of the magnet. The magnetic field gradient is largest where the magnetic lines are sparse, while the magnetic field is linear only in a small portion of the magnet.

5.1.6 Additional in vivo data To analyze the feasibility of magnetic targeting in vivo we selected a model allowing us to study the retainm ne iron-coated Baavi by using high magnetic field gradients (unpublished). We injected 15 µl of the solution into the tailvein of BALB/c nude mice and placed a bar shaped 1 T NdFeB magnet with the gradient orthogonally to the beginning of the mouse tail for 15 minutes. Although the results are preliminary, some retainment could be seen as compared to the control without the magnet (Figure 12). The microscopical analysis showed aggregated clusters of iron particles, mainly seen on the blood vessel structures. Possibly due to the complement, no transduction could be seen in the area after beta-galactosidase staining (data not shown).

t of

51

Figure 12. Hematoxylin stained crossections from whole mount muscle tissue of nude BALB/c mice after injection of SPIO-coated Baavi a) with 1 T NdFeB magnet held for 15 min (gradient facing from right to left), b) without any magnet c) extract of a and d) extract of b. Images a and b original magnification of 100x. Arrows indicate iron clusters.

Due to the promising results of a previous studies (Lehtolainen et al., 2002; Kukkonen

et al., 2003), we speculated on the possibility of imaging the biodistribution after intracerebroventricular injection of either 1.1 µm SPIO or Gd3+-chelate coated Baavi in BDIX rats with MRI. The preliminary experiment with SPIO however resulted in very limited transduction and biodistribution (data not shown), possibly due to the hindered motion of the large sized viral complex in the ventricles. Gadolinium chelate did not reach the detection threshold and further improvements were needed (data not shown). We concluded that smaller iron particles with a nanometer scale would be required for in vivo use to maintain the viral Bas possible.

rownian motion as native

52

Based on the properties of MRI, discussed in 2.4.1.1, there are two possible classes of contrast gents to be selected from: T1 and T2. While the signal increases with the increase of T1 agents, the

opposite effect takes place with T2 agents and signal loss occurs. When considering the use in a

e quite high, a

increase occurring during viral entry, there might be some decrease in the of 10

MTT assay to analyze the toxicity of the USPIO (Ultrasmall paramagnetic iron oxide particles) particles together with viruses, without any signs of toxicity (Table 12). Since ultrasmall paramagnetic iron oxide particles had proven to be feasible for use in vivo with MRI, we biotinylated 50 nm USPIO (bUSPIO) and coated Baavi with them.

5.2 Article II In order to visualize the biodistribution of viral particles in gene therapy, a suitable non-invasive method is preferred over histology and PCR. As viral attachment and entry do not always result in viral transgene expression, marker gene expression indicates only the transduction of permissive cells and penetration of baculoviruses to non-permissive cells might be overlooked. Therefore, viral particle biodistribution studies might offer valuable information about the viral kinetics. MRI has proven to be versatile tool for imaging in clinical and pre-clinical research (Lanza et al., 2004; Muldoon et al., 2005).

5.2.1 Contrast agent selection

a

non-invasive biodistribution study, clearly the signal loss, leading to decrease in the anatomical features would not be desirable. However, while the T1 contrast agents enable better anatomical imaging, the concentrations of metal chelates required for significant increase in the contrast ar

typical dose for gadolinium being 0.1-0.3 mmol/kg total body weight (Brücher and Sherry, 2001). This would mean >30 µmol for 333 g rat and with 10 µl injection of 1*1011 viral vector with 100 biotin binding sites / virus would result in 0.166 pM solution with one Gd3+ per biotinylated chelate. When increasing the number of Gd3+ per chelate by adding chelate structures to a peptide backbone, combining metal to macromolecules (Caravan et al., 1999), or taking in consideration the concentration

8 fold difference between the calculated threshold and reality. The recently published results on Cowpea chlorotic mottle virus with 180 Gd3+ resulted in relaxivity value of 250 mM-1S-1 (Allen et al., 2005) and with nanoparticles 598 mM-1nS-1(Winter et al., 2003). It remains to be seen if these agents can be used in context with gene therapy viruses. T2 agents have already been shown to be feasible in vivo imaging of even single cells (Shapiro et al., 2006), although in practise more cells, e.g. 40 stem cells (Hoehn et al., 2002), are needed for imaging trafficking and targeting (Arbab et al., 2004). The limits of detection for T2* weighted imaging in brain have reported to be 2.4 µg Fe/ml with 120*103 cells/ ml (10 µM) (Dahnke and Schaeffter, 2005), significantly smaller than with T1 agents.

While iron ions are part of Fenton’s reaction, catalyzing hydroxyl radicals, it has been shown that ferritin is not toxic in vitro (Genove et al., 2005) and might even offer resistance to chemically induced oxidative stress. However some evidence of toxicity was seen in another study (Muldoon et al., 2005). We performed an

53

Table 12. MTT assay of the cytotoxicity of the bUSPIO particles. The control cells were calculated as 100% survival and the results are respectively compared to the control cells, presented as mean ± SEM.

Formulation Survival

Baavi 103 ± 2.1 Wild-type virus 109 ± 3.9 bUSPIO 108 ± 3.6 Baavi + bUSPIO 99 ± 4.3 Wild-type virus + 99 ± 3.9 bUSPIO

Transduction assays in HepG2 cell line showed that both transduction efficiency and expression levels of the beta-galactosidase were higher with bUSPIO-coated Baavi as compared to non-coated Baavi, (II/ fig 2). It could be possible that while the bUSPIO-Baavi complex was too small to sediment on its own, the Brownian motion was somewhat decreased, resulting in increased transduction efficiency as compared to the free virus, comparable to the mechanism seen to increase transduction efficiency of lentiviruses (Chan et al., 2005). The levels of beta-galactosidase enzyme expression were much higher with the coated viruses as compared to normal Baavi, possibly due to the fact that one USPIO contains on average of 1-2 attached virions, thus resulting in an increase in the amount of capsids transported to the nucleus as complexes entered the cell, increasing the moi per individual cell. The effect of magnetic targeting in vitro with bUSPIO was compared to the 1.1 µm SPIO particles and showed that due to the small size of the bUSPIO, the effect was less profound with similar conditions (data not shown), as could be expected based on the Equation 1. While observing the beta-galactosidase enzyme levels with both particle types with magnetic targeting, it could be seen that the overall transgene levels were lower with SPIO and also with USPIO, due to concentration of the viruses to a smaller area with less permissive cells (data not shown). This could indicate that while the increase of capsids in cellular entry with a relatively unlimited number of

5.2.2 Atomic force microscopy The ratio of viruses to the iron particle is crucial when considering the similar size of the viruses and biotinylated USPIO. With previously used SPIO with a mean diameter of 1.1 µm, the particle is five fold larger, therefpre likely to result in a particle coated with viruses. With smaller USPIO with a mean diameter of 50 nm, the ratio and resulting composition was analyzed by using atomic force microscopy. Atomic force microscopy has the ability to yield images under ambient conditions or in a solution, which provides an ideal tool for the physical study of biological specimens under physiological conditions (Horber and Miles, 2003).

It was observed that keeping the viral particles highly saturated (100:1) with multibiotinylated USPIO during the overnight coating, caused limited formation of crosslinked aggregates, resulting in small-sized iron-virus complexes with 1-2 virus per bUSPIO (II/ fig 1). Together with the 50 nm size of the USPIO as compared to the 25x200 nm virus these factors increased bUSPIO-Baavi diffusion in liquid in vivo, probably resulting in more natural biodistribution and kinetics of the virus.

5.2.3 In vitro transduction

54

cells increases the transgene expression levels, the limits will be reached with magnetic sgene expression levels.

V) injection of bUSPIO-coated Baavi a specific loss of MRI n ventricle (II/ fig 3). The signal loss remained

fig 4). Since baculoviruses are known to exhibit choroid plexus (CP) (Lehtolainen et al., 2002)

ight explain the MRI contrast changes in the corresponding choroid plexus cells are known to have extensive

al., 2005), the contrast changes could not be explained by passive MRI signal changes was detected in animals

diffused to the rat ventricular system (~300 µl) to a . In contrast to other studies, the amount of administered iron

en considering the fate of the Baavi-bUSPIO particles not entered, the cerebrospinal uid (CSF) clearance is reportedly rapid (Nagaraja et al., 2005) with one hour turnover in rats avson and Segal, 1996), and after two hours unbound bUSPIO or non-endocytosed bUSPIO-

ped from the CSF (Muldoon et al., 2004).

on of the iron amount in rat brain using MRI (Kroll et al., 1996). It is therefore impossible to estimate the amount of transduced cells based on the iron related signal loss. In this respect, methods based on SPECT or PET are more quantitative (Schellingerhout and Bogdanov, Jr., 2002). However as MRI methods have been reported to reach a spatial resolution of 30 µm (Lee et al., 2001), this accuracy might enable detection of individual cells and provide more vital information after intracerebral viral administration in the future. However, the blooming effect with iron would harden the separation of individual cells from clusters of labelled cells.

concentration, resulting in lower tran

5.2.4 Detection of viral particles by MRI After the intracerebroventricular (ICsignal was found on the injected side of the rat braidetectable for at least two weeks (14 days) (II / strong tropism towards cuboid epithelial cells in the the accumulation of iron to these cells marea of the rat brain. Even though the secretiveendocytotic traffic (Emerich et endocytosis of the bUSPIO-particles, since no receiving only bUSPIO suspension.

The administrated iron (500 ng)maximal concentration of 1,7 ng/µlwas small, as there have been studies with intracerebral administration of 25µg of iron (Muldoon et al., 2005). As compared to the reported detection limits of 10 µM, the concentration factor would be 1000-fold. Whfl(DBaavi particles are likely to have esca

The dimishment of the MRI signal loss during time might be explained by CP epithelial cell turnover (Netsky and Shuangshoti, 1970; Chauhan and Lewis, 1979) or even cell proliferation as response to injury from the injection pressure (Li et al., 2002). After intracerebral administration the USPIO particles have been observed to accumulate in cervical lymph nodes via CSF efflux (Kida et al., 1993; Muldoon et al., 2004) which agreed with previous findings of baculovirus systemic escape to ectopic tissues (Lehtolainen et al., 2002) and data from later SPECT experiments (III / fig 3). These observations could explain the fate of free bUSPIO and bUSPIO-Baavi complexes.

The nonlinearity of the iron signal hinders the evaluati

55

Iron detection by Prussian blue staining The relationship of the iron originated signal loss to the biodistribution

ed by Prussian blue staining for iron. As the amount inobenzidine (DAB) signal enhancement for the detection (Moos a

thod resulted in staining of the cuboid epithelial cells of CP on the side of the injection, while the contralateral CP cells remained without any stain, similar to controls without any injected iron.

As the CSF flow originates from the lateral ventricles and passesourth ventricle to the to superior sagittal sinus via the subarachnoid spac

liquid dynamics (Figure 13) are likely to prevent the diffusion of bUSPIO-virus paed ipsilateral ventricle to the contralateral ventricle. This would explain the lim

of the coated virus.

5.2.5of the baculovirus was

confirm of iron was low, we used diam nd Mollgard, 1993). This me

through the third and f e (Knopf et al., 1995), the

rticles from the inject ited diffusion

Figure 13. The flow of cerebrospinal fluid (CSF) in human brain, (a) coronal plane and (b) midsagittal plane. The CSF is produced in ependymal cells of choroid plexus cells in lateral ventricles (1.) and it flows through the third ventricle (2.) to the fourth ventricle where it can continue to the spinal subarachnoidal space or (3.) continue through the lateral aperture of the fourth ventricle to the subarachnoidal space (4.) of the brain. The CSF in the subarachnoidal space moves to the superior sagittal sinus (5.) where it is reabsorbed via the arachnoidal villi into the venous system.

5.2.6 Viral transgene expression In order to compare and examine the viral transgene expression, we performed β-galactosidase staining for the viral LacZ-transgene expression. As previously (Lehtolainen et al., 2002; Laitinen et al., 2005a), the β-galactosidase staining resulted in staining of cuboid epithelial cells of CP. Only a few blue cells were seen in the contralateral side, in agreement with the Prussian blue staining for iron. As compared to wild-type virus or uncoated Baavi, the results in ipsilateral side were similar or transduction efficiency was slightly increased, determined by the amount of blue cells. Since the USPIO coating increases the size of the virus, it is possible that larger sized complexes are more

56

easily endocytosed into the cells (Muro et al., 2004), as also suggested in a study which compared the uptake of different sized iron oxide particles (Raynal et al., 2004).

trast to the wild-type virus, some blue cells were detected sporadically in the

ination of the bUSPIO particles from CP, it would be interesting to determine if the similarity is caused by cellular regeneration.

inly in young children with 0.3 cases per a 1 million population. While surgical treatment is the primary option in the majority of the cases, the poor prognosis even with radio- and chemotherapy suggests that gene therapy could be used along with the traditional methods (Gupta, 2003; Wolff et al., 2002). There is also evidence that weight regulation via leptin interaction could be affected by numerous leptin receptors in CP (Strazielle and Ghersi-Egea, 2000), creating commercial potential for weight regulation by gene therapy.

In this light, the further research of the baculovirus mediated transduction of CP seems reasonable. The described MRI-based imaging has several benefits as compared to the traditional

In conbrain parenchyma with Baavi and USPIO-coated Baavi. It may be possible that the positive charge of the avidin on Baavi might enhance attachment and result in improved transduction of known permissible cell types, such as endothelial cells of microvessels (Lehtolainen et al., 2002), glial cells or astrocytes (Sarkis et al., 2000).

It is known that the expression of baculovirus transgene is reduced from 80 % at day 5 to almost zero at day 14 (Lehtolainen et al., 2002). Interestingly, the iron-related signal loss was also reduced to background in two weeks. Although short-time expression of baculovirus may be entirely separate from the elim

5.2.7 Choroid plexus as targets for gene therapy This study showed that detection of viral particle biodistribution by MRI is possible. The data confirmed the co-localization of bUSPIO with Baavi and moreover indicated that Baavi could deliver cargo to CP cells. Magnetic nanoparticles have been utilized as drug carriers (Alexiou et al., 2006), with therapeutic results and decreased side effects (Alexiou et al., 2003). The combination of gene delivery and drug delivery together might be beneficial when considering the versatile role of CP in physiology.

CP are best known best for their role in producing CSF, but they also play a role in the immune system, maintaining the blood-brain barrier (BBB), detoxification, secretion of various molecules and neurogenesis (Emerich et al., 2005). Human CP cells produce 500 ml of CSF per day and are reported to be involved in various medical conditions, such as Alzheimer’s disease (Emerich et al., 2005), and in brain regeneration, containing neuronal precursor cells (Li et al., 2002). Therefore the possibility of affecting the central nervous system via the CSF by gene therapy would be intriguing. Interestingly, it has been suggested that 30% of CSF is produced at other sites than CP, such as the epithelial lining of the ventricles and the endothelium of the brain capillaries (Davson, 1972; Hammock and Milhorat, 1973). Together with the CP cells, all those sites have been found to be transduced with baculovirus (Lehtolainen et al., 2002; Kaikkonen et al., 2006). Although this behaviour might be due to common extracellular properties deriving from embryonal properties (Sarnat, 1998), further research on this matter might also shed some light on to the baculoviral tropism and cell entry in the central nervous system (CNS).

According to literature, viruses such as Sendai-, mumps- and human T-cell leukaemia virus-1 and possibly HIV-1 have tropism for CP (Levine, 1987; Strazielle and Ghersi-Egea, 2000). This might be explained by the role of CP in the neuroimmune system (Engelhardt et al., 2001), relaying information between the brain and the immune system (Lacroix et al., 1998b). Recently, CP transplants have been studied for neuroprotective potential and spinal neuron regeneration (Lacroix et al., 1998a). Ex vivo transduction of neuroprotective genes, such as VEGFs (Zachary, 2005) could be combined with such transplants to further enhance the neuroprotection.

CP tumours have a rare prevalence of 0.5 % of all brain tumours occurring ma

57

histochemical mechanisms. Especially when including a MRI-visible transgene system with ifferent relaxivity (Table 5) to the virus, both particle biodistribution and transgene imaging could

erfusion and metabolic and ctions (Yang and Atalar, 200 , this MRI-based baculovirus imaging system to further characterize novel t or CP related conditions.

dbe performed with the same device, although iron effects to detection of other contrast agents as well. Additionally, MRI is also capable of imaging physiological changes in organ p

mechanical fun could be used

6). In timereatments f

58

5.3 Article III As discussed in the previous chapter, the transduction of choroid plexus in brain has so far showed promising results and set goals for further studies. As intracerebroventricular (ICV) administration is mostly suited to the treatment of brain disorders, there is still little knowledge of the baculoviral systemic kinetics in the body after ICV injection and traffic routes after other administration routes. Since the baculovirus is hindered by the blood complement (Hofmann and Strauss, 1998), biodistribution studies based on the transduction pattern of the virus would not provide accurate

formation about the viral kinetics after administration, but tracking viral particles could provide dditional information about baculovirus systemic kinetics.

with biotinylated USPIO could create ution, the poor temporal resolution favour the

idney and a minor

99m

resulted b

virus with the labelled chelate did not show any activity. Despite the SPECT revealed activity in the spleen, no beta-galactosidase expression was detected with Baavi or wild-type virus.

ina

While the MRI- imaging of Baavi coated accurate information about brain particle biodistribuse of other imaging method when acquiring data of rapid systemic changes in baculovirus administration kinetics. As discussed in 2.4.1.2, SPECT imaging has these advantages over MRI imaging, also enabling quantitation of the signal.

In this study, we compared different routes of administration of avidin-displaying baculovirus, Baavi, coated with polylysine-serine-DTPA chelate (III/ fig 1) with 99mTechnetium. By using a combined microSPECT/CT device the particle biodistribution could be monitored real-time in the SPECT with the ability to include anatomical references by CT imaging.

5.3.1 Intravenous administration Systemic injection is the preferred method to use, when acquiring a wide access to organs by gene delivery vectors. The complement inhibition hinders the systemic use of baculovirus; however the inhibition is not always complete. Previously it has been shown that systemic administration of non-modified baculovirus through a tail vein injection in BALB/c mice resulted in GFP expression in liver, spleen, lung, heart, kidney and brains (Kim et al., 2006). Similarly, after systemic injection of A/J mice a significant lusiferase expression was seen in the spleen, liver and kexpression in the lungs (Kircheis et al., 2001). However, no GFP or luciferase expression was seen after intravenous administration of VSV-G displaying baculovirus into BALB/c mice (Tani et al., 2003b). While the results may be due to pseudotyping of virus, a variation in dose, rodent strain, individual properties of experimental animals or virus preparation between laboratories, there might also be other factors influencing to the expression pattern.

The SPECT planar imaging of Baavi coated with technetium-labelled chelate showed increasing activity after systemic injection via v. femoralis, (IF), (III/ fig 2) in the lungs, liver, spleen and kidneys while the imaging of the radiolabelled chelate or Tc alone (data not shown)

in rightening of kidneys, ureters and bladder as the urinary export of water-soluble substances progressed. It has been shown that the reticulo-endothelial system of the liver plays an important role in the active disposal of administered viral particles (Tao et al., 2001), together with the spleen and kidneys, being therefore expected to gather virions. The signal seen in the lungs was decreased in time, likely representing viruses circulating in blood (Schellingerhout and Bogdanov, Jr., 2002).

Baavi resulted in moderate beta-galactosidase expression in kidneys and liver (III, table 1), while IF injections of the wild-type

59

5.3.2 traperitoneal and intramuscular administration traperitoneal administration (IP) has been used for the treatment of ovarian cancer, in an attempt

proved access to the peritoneal cavity has a direct access to the thoracic and

transduce various mammalian kidney cell lines in vitro (Liang et al., 2004; Condreay et al., 1999). The reports of kidney transduction after systemic tail-vein administration do

l, although not clinically preferred method. Previously it has been reported that the intracranial administration of baculoviral vector has resulted in GFP expression in mouse and rat brain striatum, corpus callosum and ependymal layer neuronal cells

GFP expression in the mouse brain (Tani et al., 2003b),

InInto overcome the limitations of intratumoral injections for im(Evans and Keith, 2004). However, the peritoneal cavity pleural cavities via the lymphatic channels (bu-Hijleh et al., 1995a). The peritoneal fluid enters from the peritoneum to the lymphatic lacunae and continues onwards via the parasternal lymphatics to the superior mediastinal nodes (bu-Hijleh et al., 1995b; bu-Hijleh et al., 1995a). This access enables both ovarian tumour metastases and injected virus spread systemically through the lymphatic system, the latter being important for viral safety.

IP injection of the labelled Baavi resulted in significantly increased radioactivity in spleen and kidney (III/ table 1). Beta-galactosidase stainings of the spleen resulted in moderate expression of the LacZ transgene and in the kidney resulted in strong and extensive beta-galactosidase expression (III/ Figure 4). According to a study, baculoviruses have previously been shown to efficiently

not show extensive transduction in one study (Kim et al., 2006), while the other shows kidneys quite positive (Kircheis et al., 2001). It might be possible that avidin display has enhanced the baculovirus transduction mechanism as compared to the wild-type virus, as suggested by our previous study (I), to result in the successful transduction of the kidney after both IP and IF administrations.

After IP administration some beta-galactosidase expression could also be seen in the lungs and the brain and radioactivity was occasionally detected in mediastinal nodes during the SPECT imaging (data not shown). Interestingly, the brain was also seen unexpectedly positive after systemic administration in a previous study, increasing with the PEGylation of the baculovirus (Kim et al., 2006). This indicates that under suitable conditions the baculovirus is possibly able to transport across the BBB and transduce brain parenchymal cells with better capability than previously thought. Our results suggest that after IP injection the baculovirus enters the lymphatic circulation from the peritoneal lymphatic drainage. Similarly after intramuscular injection with Baavi, we could detect the femoral lymphatic nodes being imaged, indicating viral traffic via the lymphatic system. Some transgene expression could also be seen in the kidney cells (data not shown), indicating that Baavi is also likely to escape to the systemic circulation after intramuscular administration. Previously it has been shown that intramuscular administration of baculovirus results in successful transduction of mouse skeletal muscle (Pieroni et al., 2001).

5.3.3 Intracerebroventricular administration In order to bypass the BBB and to provide access for drug or gene delivery vector administration by ICV injection has provided a usefu

(Sarkis et al., 2000), ICV administration tochoroid plexus epithelial cells and endothelial brain microvessels (Lehtolainen et al., 2002), corpus callosum (Kukkonen et al., 2003), choroid plexus cells (Laitinen et al., 2005a) and with neuronal promoter, astrocytes (Wang and Wang, 2006). Biodistribution studies after ICV administration showed RT-PCR positivity in the spleen, heart and lungs indicating escape from the cranium, with the conclusion of baculovirus escape through the arachnoid villi (Lehtolainen et al., 2002). There has also been report on baculoviral traffic via axons of neurons (Li et al., 2004), thus contributing to viral biodistribution in a previously unexpected manner.

60

In our study, after ICV injection of Baavi the remaining radioactivity was lower as compared to the chelate control, further supporting the theory of systemic escape of the baculovirus (Lehtolainen

th technetium. In comparison to the MRI, the poor anatomical resolution of

5.3.4 Other administration routes and conclusions et cellular receptors,

a hypothesis of binding with charge

to the presented administration methods described, some other routes have also been used wi

sical complement pathway and degradin

ainen et al., 2002) and av

et al., 2002). We could detect a signal in the kidneys 65 minutes after the injection (III/ fig 3), indicating escape of the virus from the CSF circulation, possibly by the arachnoid villi and the lymphatic system (Kida et al., 1993). However, due to the small injected volume and consequent low radioactivity (5-8 MBq), the limit for direct detection of lymphatic circulation or neuronal transport was too high wi

SPECT prevents further pinpointing of the viral biodistribution in the brain. However, the use of another high-energy isotope such as 111Indium might provide more accurate results in the future.

While the specific interactions between baculovirus surface proteins and targleading to baculovirus tropism, are not exactly known, there is related manner via heparan sulphate residues instead of specific receptor (van Loo et al., 2001), supported by a large number of susceptible cell-lines in vitro (Song et al., 2003). If true, baculoviral transduction pattern should be wide also in vivo, if not hindered by other factors. Previously it has been reported that baculovirus transduction in vivo is inhibited by the blood complement system (Hofmann and Strauss, 1998), forcing researchers to discover elaborate methods to circumvent this problem. In addition

th baculoviruses. Rabbit carotid arteries have been transduced with baculovirus by using silicon collars

as artificial virus reservoirs (Airenne et al., 2000), a method enabling the protection of the baculovirus. Subretinal and intravitreal injections of baculoviruses to mouse eye demonstrated that transduction in immuno-privileged areas other than the brain are possible (Haeseleer et al., 2001). Similarly, the immunopriviledged testis (Ferguson and Griffith, 1997) has been shown to be accessible to baculovirus transduction (Tani et al., 2003b). In a vaccination study, intranasal and subcutaneous administration were utilized to produce immunoresponse towards displayed antigens (Facciabene et al., 2004). Finally, lumbar puncture, routinely used for spinal anaesthesia, has been shown to be an effective method to reach dorsal root ganglion neurons and induce neuronal regeneration of peripheral nerves (Tani et al., 2003a).

To conclude, as compared to the IV injection the IP injection might result in gene delivery to the organs in the abdomen without severely activating the clas

g the virus. Recently, it has been shown clinically that an IP administration in the treatment of ovarian cancer can be used to reduce the side effects while reaching the therapeutic window with a smaller dose as compared to IV administration (Armstrong et al., 2006). The results of this study suggest that IP injection of baculoviral might offer a new method to target kidney and treat nephronal diseases (Osada et al., 1999).

Additionally the data from this study indicates that the baculovirus is able to spread systemically via the lymphatics, as suggested by earlier studies with baculovirus (Lehtol

idin/biotin liposomes (Medina et al., 2006). Yet more studies are needed to clarify the possible baculovirus traffic via the lymphatic system and the effects on gene therapy treatment and safety.

61

5.4 Article IV While baculovirus has several benefits as compared to other major gene delivery vectors, one of the downfalls is the mediocre or poor overall transduction efficiency. This problem can be circumvented by concentrating the virus to target cells, using various targeting methods as discussed in chapter 2.3.1 or by including transduction enhancing elements, such as histone

eacetylase inhibitors (e.g. sodium butyrate) or genetic elements increasing transduction efficiency (e.g. transcriptional regulatory elements). Baculoviral cell entry requires endosomal maturation, after which the capsids are released and transported to the nucleus. It has been reported that half of the capsids reach the nucleus, while the rest are degraded in lysosomes (Dee and Shuler, 1997). Therefore improvements in this step are likely to also improve the transduction efficiency. In this study we analyzed the effects of displaying a truncated 21 aa version of VSV-G together with native gp64 to baculoviral transduction.

5.4.1 VSV-GED displaying virus VSV-G pseudotyping has been used to widen the retroviral tropism, however the VSV-G has recently been shown to offer increased resistance towards complement inactivation of baculoviruses (Tani et al., 2003b) and restore the productive infection, replication and propagation of gp64-null baculoviruses (Mangor et al., 2001). The VSV-G membrane proximal stem region (IV/ Figure 1), in addition to the transmembrane and cytoplasmic domains (VSV-GED) has been utilized also as a display platform, to create a non-polarly distributed fusion protein with GFP (Chapple and Jones, 2002) and ZZ-domain on baculovirus (Ojala et al., 2004). Since there have been reports of VSV-GED improving membrane fusion capabilities (Jeetendra et al., 2002), VSV-GED was included in the baculovirus together with native gp64 glycoprotein.

VSV-GED display was confirmed from the concentrated viruses by immunoblotting with VSV-G antibody (IV / fig 2), which recognizes the 15 carboxy-terminal aminoacids of the VSV-GED. In agreement with a previous study (Robison and Whitt, 2000), trimer of VSV-GED was also detected on the immunoblot. To examine the ratio of total viral particles vs. infective virus particles between VSV-GED and control baculovirus, immunoblotting with anti-vp39 and anti-gp64 was performed. The result showed that the ratio remained comparable between the viruses. This indicated that the quality of the VSV-GED pseudotyped virus was comparable to that of the control virus. In addition, the titer of the concentrated virus was constantly high (with 300x concentration 2,5*10E10) which suggests that VSV-GED pseudotyping does not disturb virus infectivity.

5.4.2 Enhanced transduction efficiency in vitro The performance of the VSV-GED virus was studied in transduction assays using different cell lines; HeLa, SK-OV-3, BT4C, HepG2, EAHY and 293T (IV/ fig 3). The increase in the transduction efficiency was remarkable in all studied cell lines excluding EAHY, showing no β-galactosidase expression after VSV-GED virus transduction. EAHY cells have previously been shown to be non-permissive to baculovirus transduction (Kukkonen et al., 2003). This could support the hypothesis that the block in the transduction to non-permissive cells is not related to viral endosomal escape but rather to nuclear transport of the nucleocapsids.

The difference in the marker gene expression level was somewhat cell line dependent, possibly reflecting variation in mechanisms associated with viral transduction. In accordance with the previous results that HepG2 cells are very permissive for baculovirus-mediated gene delivery

d

62

(Hofmann et al., 1998; Park et al., 2001), they showed the smallest difference in marker gene expression level between VSV-GED and the control virus. In general, the increase in the

cy was greatest at low mois (<200) and saturated at higher mois, which is in

ight vary between cell lines, EAHY and HepG2 representing the opposite ends of that property.

adict the transduction enhancement of

the pH of 6.

fusion properties of the VSV-G, the pH for formation of syncytia should then be higher. However, with both VSV-GED and the control virus the pH threshold for syncytia formation remained at 5.5

transduction efficienagreement with previous results with other surface modifications (Matilainen et al., 2006). Almost 50-fold higher transduction rate, as compared to the control virus, was detected in BT4C glioma cells using VSV-GED pseudotyped virus (IV/ fig 4), confirming the suitability of baculoviruses for transduction of CNS cells.

HeLa cells are generally found to be poorly permissive for wild type baculovirus transduction (Hofmann et al., 1995; Tani et al., 2001; Barsoum et al., 1997). However some reports show effective transduction (Sarkis et al., 2000). The conflicting results regarding permissivity of HeLa for baculovirus transduction may reflect heterogeneity and differentiation of the original cell line in different laboratories.

While the increase in the transduction efficiency, seen as number of positive cells, is important, the amount of expressed transgene provides information about the changes in the viral entry. The increase in the enzyme levels was 40-fold in BT4C cells at moi 10 (IV/ fig 3), with decreased difference at higher mois. In 293T cells, the difference was six-fold at moi 1. Interestingly, with HepG2 cells the difference in beta-galactosidase expression levels was not decreased with increasing mois, but continued to remain ~10 fold. This could indicate that highly permissive HepG2 cells do not posses restrictions in the viral pathway leading to gene expression, with the mois used in this study. With higher mois the pathway would most likely be saturated at some point. If true, it might be possible that the obstacle in the nuclear entry m

5.4.3 Mechanism for transduction enhancement As compared to the Baavi and the positive charge-related binding, the VSV-GED enhanced transduction mechanism might be more specific and occur later in the transductional pathway, as suggested by previous studies (Jeetendra et al., 2003). According to a mathematical model based on the literature and experimental data on tritium-labelled baculoviruses (Dee and Shuler, 1996; Dee and Shuler, 1997), baculovirus binding is slow and according to predictions, less than 500 particles are at the cell surface at any given time. This amount would not be enough to saturate the endocytic pathway. According to the results of Dee and Shuler, half of the internalized baculoviruses are degraded despite the moi used, indicating extremely low efficiency in endosomal fusion and escape. In this respect, any increase in the fusion efficiency would be likely to increase the transduction efficiency. In addition, this observation would not contrBaavi, since increased binding with the positive charge of avidin might also increase the number of viruses entering the pathway. However, the models discussed are constructed on data based on infection of insect cells and may not fully apply to mammalian cell transduction.

To elucidate the exact mechanism of the transduction enhancement, a syncytium formation assay was performed. According to the literature, a pH ≤ 5.5 is required to induce gp64-mediated membrane fusion (Blissard and Wenz, 1992; Oomens and Blissard, 1999; Leikina et al., 1992) which was confirmed by using the LacZ control virus. VSV-G induced membrane fusion occurs at higher pH, 5.8- 6.2 (Whitt et al., 1991; Fredericksen and Whitt, 1995; Carneiro et al., 2003b). Insect cells transduced with VSV-GED baculovirus resulted in large syncytia formation in

2. Since VSV-GED still retained the other putative fusion domains, determined by mutational assays (Carneiro et al., 2003a; Shokralla et al., 1998) it could be possible that the endosomal fusion would occur at higher pH, therefore having the time to release more capsids at the 40-60 min maturation time (Dee and Shuler, 1996). If the VSV-GED would have retained the

63

(IV / fig 5), indicating that the membrane fusion was still dependent on the gp64 properties. This

As there hav

at brain and rabbit muscle as targets to study the in vivo properties of the VSV-GED pseudotyped baculovirus. Some enhancement in gene delivery was observed in rabbit M. semimembranosus after intramuscular

uscle is a more changes were far more subtle (data not

in these areas and was exceeded only with

observation was in agreement with the initial findings of Jeetendra (Jeetendra et al., 2002). Next, in order to study if the VSV-GED augments gp64-mediated endosomal escape,

a study with monensin was performed. Carboxylic ionophores such as monensin allow protons to equilibrate the pH between the endosomal and cytoplasmic compartments thus preventing the acidification needed for the baculovirus envelope fusion and endosomal escape mediated by gp64. No β-galactosidase activity was detected with the control LacZ virus, whereas VSV-GED transduced cells showed only partial reduction in transduction efficiency. To further determinate the reduction of transduction efficiency as related to the inhibition of lysosomal acidification, we studied the transduction efficiency in various concentrations of ammonium chloride (IV, fig 6). Ammonium-cation has pKa of 9.24, thus readily accepting protons in pH 7 and hindering the endosomal acidification.

Altogether, the results demonstrated that whilst the pH threshold had remained unchanged the transduction efficiency was not reduced as severely with VSV-GED as with the control virus. As suggested previously (Jeetendra et al., 2002), the VSV-GED fragment appeared to aid the gp64 in membrane fusion, restoring the endosomal escape despite ammonium chloride and resulting in an increased number of released nucleocapsids with improved transduction efficiency.

5.4.4 Cytotoxicity e been reports that the VSV-G included in the viral envelope increases the toxicity of

the vector (Watson et al., 2002a; Facciabene et al., 2004) in addition to the well-known toxicity of VSV-G in cell lines which produce the virus (Burns et al., 1993), it would be essential to diminish the cytotoxicity of VSV-G while retaining the transduction enhancement. We therefore used an MTT-assay to analyze the effects of VSV-GED baculovirus transduction as compared to VSV-G (IV / table 1). While the VSV-G virus showed some signs of cytotoxicity, the VSV-GED virus was comparable to the unmodified control virus. In addition, the production of VSV-G pseudotyped virus in insect cells resulted in the formation of cell fusions, which was not the case with VSV-GED virus.

5.4.5 Transduction in vivo Since the VSV-GED increased transduction efficiency in in vitro, we selected r

injection of VSV-GED pseudotyped baculovirus; however since the rabbit mchallenging environment to baculoviral transduction, theshown).

ICV injection into rat brain was previously used to study the tropism of wild type baculovirus (Lehtolainen et al., 2002) and the results of VSV-GED pseudotyped virus were compared to this study. As the unmodified baculovirus efficiently transduces cuboidal epithelium cells of CP and, to some extent, epithelial cells in brain microvessels, VSV-GED resulted in repeated transgene expression in the subarachnoid space and epithelial lining of the brain (IV/ fig 7). Interestingly, VSV-G pseudotyped lentiviral vector resulted in a similar transduction pattern (Watson et al., 2005). However, transductions in these areas have previously been observed with unmodified virus as random incidents, possibly after special circumstances during the injection (data not shown). Altogether it might be possible that although being a truncated version of the VSV-G, the VSV-GED has either some characteristics which influence viral binding or the threshold for the detection of LacZ expression was high

64

VSV-GED improved transduction. Further studies would be required to determine the change in the viral behaviour.

In conclusion, VSV-GED pseudotyping is able to significantly enhance the baculovirus-mediated gene transfer and has several advantages as compared to the VSV-G pseudotyping.

65

th high efficiency. 2. We d

ribution of the radiolabelled Baavi was studied with SPECT/CT by using different methods of administration. We were able to show that intraperitoneal and intravenous

uction of the kidney, suggesting a new method e results also suggested that Baavi utilized the lymphatic

al vector by modifying its envelope and emonstrated

SPECT by using biotinylated ligands. A baculovirus containing a truncated version of VSV-G gl

6 Summary

1. We have developed and characterized a novel and universal targeting system for enhanced and targeted gene delivery based on avidin-biotin technique. Avidin-displaying baculovirus, Baavi, showed enhanced transduction efficiency in several cell lines. Biotinylated cells were used to further increase the transduction efficiency and magnetic particles were utilized to physically target viruses in vitro wi

emonstrated non-invasive MRI- imaging of viral particle biodistribution in vivo using Baavi with biotinylated ultrasmall paramagnetic particles. The viral particles could be detected in choroid plexus cells two hours after injection and for up to 14 days. No adverse effects could be associated with the imaging. The study also provided proof that the delivery of cargo was possible with Baavi.

3. Biodist

administrations resulted in extensive transdfor treating nephronal diseases. Thsystem to distribute after administration.

4. We constructed VSV-GED displaying baculovirus and showed markedly enhanced transduction in vitro and in vivo. The possible mechanism of the action was suggested by demonstrating improved escape from the endosome.

In this study, we widened the properties of the baculovird several novel methods for baculoviral vector targeting and imaging. Avidin-displaying baculovirus was used in vitro with enhanced transduction efficiency and imaged in vivo with MRI and

ycoprotein was constructed resulting in an enhanced transduction both in vitro and in vivo. Both viruses provide new data for the use of avidin-biotin technology in gene therapy and vector imaging for safety studies, with combatability to other enveloped viruses.

66

References Airenne,K.J., Hiltunen,M.O., Turunen,M.P., Turunen,A.M., Laitinen,O.H., Kulomaa,M.S., and Yla-Herttuala,S. (2000).

Baculovirus-mediated periadventitial gene transfer to rabbit carotid artery. Gene Ther. 7, 1499-1504.

Airenne,K.J., Mahonen,A.J., Laitinen,O.H., and Yla-Herttuala,S. (2004). Baculovirus-mediated gene transfer: An evolving new concept. In Gene and Cell Therapy, N.S.Templeton, ed. (New York, NY: Marcel Dekker, Inc.), pp. 181-197.

Airenne,K.J., Oker-Blom,C., Marjomaki,V.S., Bayer,E.A., Wilchek,M., and Kulomaa,M.S. (1997). Production of biologically active recombinant avidin in baculovirus-infected insect cells. Protein Expr. Purif. 9, 100-108.

Al-Dosari,M.S., Knapp,J.E., and Liu,D. (2005). Hydrodynamic delivery. Adv. Genet. 54, 65-82.

2005). Paramagnetic viral nan articles as potential high-relaxivity magnetic resonance contrast agents. Magn Reson. Med. 54, 807-

dioiodinated

Alauddin,M.M., Shahinian,A., Gordon,E.M., and Conti,P.S. (2004). Direct comparison of radiolabeled probes FMAU, FHBG, and FHPG as PET imaging agents for HSV1-tk expression in a human breast cancer model. Mol. Imaging 3, 76-84.

Alexiou,C., Jurgons,R., Schmid,R.J., Bergemann,C., Henke,J., Erhardt,W., Huenges,E., and Parak,F. (2003). Magnetic drug targeting--biodistribution of the magnetic carrier and the chemotherapeutic agent mitoxantrone after locoregional cancer treatment. J. Drug Target 11, 139-149.

Alexiou,C., Schmid,R.J., Jurgons,R., Kremer,M., Wanner,G., Bergemann,C., Huenges,E., Nawroth,T., Arnold,W., and Parak,F.G. (2006). Targeting cancer cells: magnetic nanoparticles as drug carriers. Eur. Biophys. J. 35, 446-450.

Allen,M., Bulte,J.W., Liepold,L., Basu,G., Zywicke,H.A., Frank,J.A., Young,M., and Douglas,T. (op

812.

Arbab,A.S., Jordan,E.K., Wilson,L.B., Yocum,G.T., Lewis,B.K., and Frank,J.A. (2004). In vivo trafficking and targeted delivery of magnetically labeled stem cells. Hum. Gene Ther. 15, 351-360.

Arif,B.M. (2005). A brief journey with insect viruses with emphasis on baculoviruses. J. Invertebr. Pathol. 89, 39-45.

Armstrong,D.K., Bundy,B., Wenzel,L., Huang,H.Q., Baergen,R., Lele,S., Copeland,L.J., Walker,J.L., and Burger,R.A. (2006). Intraperitoneal cisplatin and paclitaxel in ovarian cancer. N. Engl. J. Med. 354, 34-43.

Athappilly,F.K. and Hendrickson,W.A. (1995). Structure of the biotinyl domain of acetyl-coenzyme A carboxylase determined by MAD phasing. Structure. 3, 1407-1419.

Auricchio,A. and Rolling,F. (2005). Adeno-associated viral vectors for retinal gene transfer and treatment of retinal diseases. Curr. Gene Ther. 5, 339-348.

Awasthi,V., Meinken,G., Springer,K., Srivastava,S.C., and Freimuth,P. (2004). Biodistribution of raadenovirus fiber protein knob domain after intravenous injection in mice. J. Virol. 78, 6431-6438.

Ayres,M.D., Howard,S.C., Kuzio,J., Lopez-Ferber,M., and Possee,R.D. (1994). The complete DNA sequence of Autographa californica nuclear polyhedrosis virus. Virology 202, 586-605.

Bagwe,R.P., Hilliard,L.R., and Tan,W. (2006). Surface modification of silica nanoparticles to reduce aggregation and nonspecific binding. Langmuir 22, 4357-4362.

Balch, R. E. and Bird, F. T. A disease of the European Sawfly, Gilpinia hercyniae (HTG.), and its place in natural control. Sci.Agric. 65, 65-80. 1-1-1944.

Barber,G.N. (2004). Vesicular stomatitis virus as an oncolytic vector. Viral Immunol. 17, 516-527.

Barquinero,J., Eixarch,H., and Perez-Melgosa,M. (2004). Retroviral vectors: new applications for an old tool. Gene Ther. 11 Suppl 1, S3-S9.

67

Barry,M.A., Campos,S.K., Ghosh,D., Adams,K.E., Mok,H., Mercier,G.T., and Parrott,M.B. (2003). Biotinylated gene therapy vectors. Expert. Opin. Biol. Ther. 3, 925-940.

Barsoum,J., Brown,R., McKee,M., and Boyce,F.M. (1997). Efficient transduction of mammalian cells by a recombinant baculovirus having the vesicular stomatitis virus G glycoprotein. Hum. Gene Ther. 8, 2011-2018.

Beck,N.B., Sidhu,J.S., and Omiecinski,C.J. (2000). Baculovirus vectors repress phenobarbital-mediated gene induction and stimulate cytokine expression in primary cultures of rat hepatocytes. Gene Ther. 7, 1274-1283.

Bell,J.D. and Taylor-Robinson,S.D. (2000). Assessing gene expression in vivo: magnetic resonance imaging and spectroscopy. Gene Ther. 7, 1259-1264.

Benz,G.A. (1986). The Biology of Baculoviruses. CRC Press, Boca Raton, FL).

Bessis,N., GarciaCozar,F.J., and Boissier,M.C. (2004). Immune responses to gene therapy vectors: influence on vector function and effector mechanisms. Gene Ther. 11 Suppl 1, S10-S17.

Bhardwaj,S., Roy,H., Karpanen,T., Hi,Y., Jauhiainen,S., Hedman,M., Alitalo,K., and Yla-Herttuala,S. (2005). Periadventitial angiopoietin-1 gene transfer induces angiogenesis in rabbit carotid arteries. Gene Ther. 12, 388-394.

Bilello,J.P., Cable,E.E., Myers,R.L., and Isom,H.C. (2003). Role of paracellular junction complexes in baculovirus-to nondividing rat hepatocytes. Gene Ther. 10, 733-749.

lissard,G.W. (1996). Baculovirus--insect cell interactions. Cytotechnology 20, 73-93.

Location, sequence, transcriptional mapping, and temporal expression of the

cati

576.

mediated gene transfer

Bilello,J.P., Delaney,W.E., Boyce,F.M., and Isom,H.C. (2001). Transient disruption of intercellular junctions enables baculovirus entry into nondividing hepatocytes. J. Virol. 75, 9857-9871.

Black,B.C., Brennan,L.A., Dierks,P.M., and Gard,I.E. (1997). Commercialization of Baculoviral Insecticides. In The Baculoviruses, L.K.Miller, ed. (New York: Plenum Press), pp. 341-388.

Blaese,R.M., Culver,K.W., Miller,A.D., Carter,C.S., Fleisher,T., Clerici,M., Shearer,G., Chang,L., Chiang,Y., Tolstoshev,P., Greenblatt,J.J., Rosenberg,S.A., Klein,H., Berger,M., Mullen,C.A., Ramsey,W.J., Muul,L., Morgan,R.A., and Anderson,W.F. (1995). T lymphocyte-directed gene therapy for ADA- SCID: initial trial results after 4 years. Science 270, 475-480.

B

Blissard,G.W. and Rohrmann,G.F. (1989).gp64 envelope glycoprotein gene of the Orgyia pseudotsugata multicapsid nuclear polyhedrosis virus. Virology 170, 537-555.

Blissard,G.W. and Wenz,J.R. (1992). Baculovirus gp64 envelope glycoprotein is sufficient to mediate pH-dependent membrane fusion. J. Virol. 66, 6829-6835.

Blouin,V., Brument,N., Toublanc,E., Raimbaud,I., Moullier,P., and Salvetti,A. (2004). Improving rAAV production and purifi on: towards the definition of a scaleable process. J. Gene Med. 6 Suppl 1, S223-S228.

Bogdanov,A., Jr. (2003). In vivo imaging in the development of gene therapy vectors. Curr. Opin. Mol. Ther. 5, 594-602.

Boublik,Y., Di Bonito,P., and Jones,I.M. (1995). Eukaryotic virus display: engineering the major surface glycoprotein of the Autographa californica nuclear polyhedrosis virus (AcNPV) for the presentation of foreign proteins on the virus surface [see comments] [published erratum appears in Biotechnology 1995 Dec;13(13):1503]. Biotechnology (N. Y. ) 13, 1079-1084.

Boulikas,T. (1998). An overview on gene therapy. In Gene Therapy and Molecular Biology, T.Boulikas, ed. (Palo Alto, CA: Gene Therapy Press), pp. 1-171.

Brasset,E. and Vaury,C. (2005). Insulators are fundamental components of the eukaryotic genomes. Heredity 94, 571-

68

Braunagel,S.C. and Summers,M.D. (1994). Autographa californica nuclear polyhedrosis virus, PDV, and ECV viral envelopes and nucleocapsids: structural proteins, antigens, lipid and fatty acid profiles. Virology 202, 315-328.

Brown,M.D., Schatzlein,A.G., and Uchegbu,I.F. (2001). Gene delivery with synthetic (non viral) carriers. Int. J. Pharm. 229, 1-21.

Brücher,E. and Sherry,A.D. (2001). Stability and Toxicity of Contrast Agents. In The Chemistry of Contrast Agents in Medical Magnetic Resonance Imaging, A.E.Merbach and È.Tóth, eds. (Oxford: John Wiley & Sons, Ltd), pp. 244-279.

bu-Hijleh,M.F., Habbal,O.A., and Moqattash,S.T. (1995a). The role of the diaphragm in lymphatic absorption from the peritoneal cavity. J Anat 186 ( Pt 3), 453-467.

bu-Hijleh,M.F., Habbal,O.A., and Moqattash,S.T. (1995b). The role of the diaphragm in lymphatic absorption from the peritoneal cavity. J Anat 186 ( Pt 3), 453-467.

Burns,J.C., Friedmann,T., Driever,W., Burrascano,M., and Yee,J.K. (1993). Vesicular stomatitis virus G glycoprotein pseudotyped retroviral vectors: concentration to very high titer and efficient gene transfer into mammalian and nonmammalian cells. Proc. Natl. Acad. Sci. U. S. A. 90, 8033-8037.

Bushman,F.D. (2003). Targeting survival: integration site selection by retroviruses and LTR-retrotransposons. Cell 115, 135-138.

Calmels,B., Ferguson,C., Laukkanen,M.O., Adler,R., Faulhaber,M., Kim,H.J., Sellers,S., Hematti,P., Schmidt,M., Von,K.C., Akagi,K., Donahue,R.E., and Dunbar,C.E. (2005). Recurrent retroviral vector integration at the MDS1-EVI1 locus in non-human primate hematopoietic cells. Blood.

Campos,S.K., Parrott,M.B., and Barry,M.A. (2004). Avidin-based targeting and purification of a protein IX-modified, metabolically biotinylated adenoviral vector. Mol. Ther. 9, 942-954.

Caravan, P., Ellison, J. J., McMurry, T. J., and Lauffer, R. B. Gadolinium (III) chelates as MRI contrast agents: Structure, dynamics and applications. Chem Rev 99, 2293-2352. 1-1-1999.

Carbonell,L.F., Klowden,M.J., and Miller,L.K. (1985). Baculovirus-mediated expression of bacterial genes in dipteran and mammalian cells. J. Virol. 56, 153-160.

Carbonell,L.F. and Miller,L.K. (1987). Baculovirus interaction with nontarget organisms: a virus-borne reporter gene is not expressed in two mammalian cell lines. Appl. Environ. Microbiol. 53, 1412-1417.

Carneiro,F.A., Stauffer,F., Lima,C.S., Juliano,M.A., Juliano,L., and Da Poian,A.T. (2003a). Membrane fusion induced by vesicular stomatitis virus depends on histidine protonation. Journal of Biological Chemistry 278, 13789-13794.

Carneiro,F.A., Stauffer,F., Lima,C.S., Juliano,M.A., Juliano,L., and Da Poian,A.T. (2003b). Membrane fusion induced by vesicular stomatitis virus depends on histidine protonation. J. Biol. Chem. 278, 13789-13794.

Cavazzana-Calvo,M., Hacein-Bey,S., de Saint,B., Gross,F., Yvon,E., Nusbaum,P., Selz,F., Hue,C., Certain,S., Casanova,J.L., Bousso,P., Deist,F.L., and Fischer,A. (2000). Gene therapy of human severe combined immunodeficiency (SCID)-X1 disease. Science 288, 669-672.

Chan,L., Nesbeth,D., Mackey,T., Galea-Lauri,J., Gaken,J., Martin,F., Collins,M., Mufti,G., Farzaneh,F., and Darling,D. (2005). Conjugation of lentivirus to paramagnetic particles via nonviral proteins allows efficient concentration and infection of primary acute myeloid leukemia cells. J. Virol. 79, 13190-13194.

Chan,Z.R., Lai,C.W., Lee,H.P., Chen,H.C., and Hu,Y.C. (2006b). Determination of the baculovirus transducing titer in mammalian cells. Biotechnol. Bioeng. 93, 564-571.

Chan,Z.R., Lai,C.W., Lee,H.P., Chen,H.C., and Hu,Y.C. (2006a). Determination of the baculovirus transducing titer in mammalian cells. Biotechnol. Bioeng. 93, 564-571.

69

Chapman-Smith . and Cronan,J.E., Jr. (1999). The enzymatic biotinylation of proteins: a post-translational modificat on of exceptional specificity. Trends Biochem. Sci. 24, 359-363.

. (2002). Non-polar distribution of green fluorescent protein on the surface of Autographa californica nucleopolyhedrovirus using a heterologous membrane anchor. J. Biotechnol. 95, 269-275.

Chanu

Chauhanpo

Chen .26

Chen,P.,G

Cheng,Tex

Cheshende er adenovirus. Gene Ther 8, 846-854.

Chillon,ca

Cho .W., McCarty,D.M., and Samulski,R.J. (2005). AAV hybrid serotypes: improved vectors for gene delivery. Curr. Gene Ther. 5, 299-310.

pression in U. S. A. 96, 127-132.

or ., Lang,S.I., Stroh-Dege,A.Y., Balboni,G., Dinsart,C., and Rommelaere,J. (2004). Cancer gene therapy through autonomous parvovirus--mediated gene transfer. Curr. Gene Ther. 4, 249-261.

Couzin,J. and Kaiser,J. (2005). Gene therapy. As Gelsinger case ends, gene therapy suffers another blow. Science 307, 1028.

Cronin,J., Zhang,X.Y., and Reiser,J. (2005). Altering the tropism of lentiviral vectors through pseudotyping. Curr. Gene Ther. 5, 387-398.

Dahnke,H. and Schaeffter,T. (2005). Limits of detection of SPIO at 3.0 T using T2 relaxometry. Magn Reson. Med. 53, 1202-1206.

Dai,Y., Schwarz,E.M., Gu,D., Zhang,W.W., Sarvetnick,N., and Verma,I.M. (1995). Cellular and humoral immune responses to adenoviral vectors containing factor IX gene: tolerization of factor IX and vector antigens allows for long-term expression. Proc Natl Acad Sci U. S. A. 92, 1401-1405.

Dass,C.R. (2004). Lipoplex-mediated delivery of nucleic acids: factors affecting in vivo transfection. J. Mol. Med. 82, 579-591.

Davis,N.L., Willis,L.V., Smith,J.F., and Johnston,R.E. (1989). In vitro synthesis of infectious venezuelan equine encephalitis virus RNA from a cDNA clone: analysis of a viable deletion mutant. Virology 171, 189-204.

,Ai

Chapple,S.D. and Jones,I.M

rlton,C.A. and Volkman,L.E. (1993). Penetration of Autographa californica nuclear polyhedrosis virus cleocapsids into IPLB Sf 21 cells induces actin cable formation. Virology 197, 245-254.

,A.N. and Lewis,P.D. (1979). A quantitative study of cell proliferation in ependyma and choroid plexus in the stnatal rat brain. Neuropathol. Appl. Neurobiol. 5, 303-309.

,D , Maa,Y.F., and Haynes,J.R. (2002). Needle-free epidermal powder immunization. Expert. Rev. Vaccines. 1, 5-276.

Kovesdi,I., and Bruder,J.T. (2000). Effective repeat administration with adenovirus vectors to the muscle. ene Ther 7, 587-595.

., Xu,C.Y., Wang,Y.B., Chen,M., Wu,T., Zhang,J., and Xia,N.S. (2004). A rapid and efficient method to press target genes in mammalian cells by baculovirus. World J. Gastroenterol. 10, 1612-1618.

ko,N., Krougliak,N., Eisensmith,R.C., and Krougliak,V.A. (2001). A novel system for the production of fully leted adenovirus vectors that does not require help

M., Lee,J.H., Fasbender,A., and Welsh,M.J. (1998). Adenovirus complexed with polyethylene glycol and tionic lipid is shielded from neutralizing antibodies in vitro. Gene Ther 5, 995-1002.

i,V

Coffin,J.M. (1996). Retroviridae: The viruses and their replication. In Virology, B.N.Fields and D.M.Knipe, eds. (New York: Raven press), pp. 1767-1848.

Coil,D.A. and Miller,A.D. (2004). Phosphatidylserine is not the cell surface receptor for vesicular stomatitis virus. J. Virol. 78, 10920-10926.

Condreay,J.P., Witherspoon,S.M., Clay,W.C., and Kost,T.A. (1999). Transient and stable gene exinant baculovirus vector. Proc. Natl. Acad. Sci. mammalian cells transduced with a recomb

C nelis,J.J

70

Davson,H (1972) Dynamic Aspects of Cerebrospinal Fluid. Dev Med Child Neurol 14(27):1-16

.B. (1996). Physiology of the CSF and Blood-Brain Barriers. (Boca Ration, FL: CRC Press).

Dee, K es: Application to the Binding, Uptake, and Nuclear Accumulation of Baculovirus. Biotechnology and

Dee,K uler,M.L. (1997). Optimization of an assay for baculovirus titer and design of regimens for the synchronous infection of insect cells. Biotechnol. Prog. 13, 14-24.

DeLanpeptide. Complete amino acid sequence of the protein subunit. J. Biol. Chem. 246, 698-709.

DiMattia,M., Govindasamy,L., Levy,H.C., Gurda-Whitaker,B., Kalina,A., Kohlbrenner,E., Chiorini,J.A., McKenna,R.,

uct. un. 61, 917-921.

Doms,R.W., Keller,D.S., Helenius,A., and Balch,W.E. (1987). Role for adenosine triphosphate in regulating the

Douglas,J.T. (2004). Adenovirus-mediated gene delivery: an overview. Methods Mol. Biol. 246, 3-14.

Duan,rs: a quantitative comparison. Mol. Ther. 4, 383-391.

in mammalian cells. J. Gene Med. 1, 93-102.

Emerich,D.F., Skinner,S.J., Borlongan,C.V., Vasconcellos,A.V., and Thanos,C.G. (2005). The choroid plexus in the

Engelhardt,B., Wolburg-Buchholz,K., and Wolburg,H. (2001). Involvement of the choroid plexus in central nervous

Ernst,W., Schinko,T., Spenger,A., Oker-Blom,C., and Grabherr,R. (2006). Improving baculovirus transduction of

Evans,T.R. and Keith,W.N. (2004). Intra-peritoneal administration of genetic therapies: promises and pitfalls. Minerva

Facciabene,A., Aurisicchio,L., and La,M.N. (2004). Baculovirus vectors elicit antigen-specific immune responses in

Falkner,F.G. and Holzer,G.W. (2004). Vaccinia viral/retroviral chimeric vectors. Curr. Gene Ther. 4, 417-426.

Fergus l death: insights into immune privilege. Immunol. Rev 156, 167-184.

Fieldi olytic virus. Rev. Med. Virol. 15, 135-142.

troviral vectors: selective gene transfer in a mixed population of hematopoietic and nonhematopoietic cells. Blood 91, 1802-1809.

Davson,H. and Segal,M

. U. and Shuler, M. L. A Mathematical Model of the Trafficking of Acid-Dependent Enveloped Virus

Bioengineering 54[5], 468-489. 24-10-1996.

.U. and Sh

ge,R.J. and Huang,T.S. (1971). Egg white avidin. 3. Sequence of the 78-residue middle cyanogen bromide

Muzyczka,N., Zolotukhin,S., and gbandje-McKenna,M. (2005). Production, purification, crystallization and preliminary X-ray structural studies of adeno-associated virus serotype 5. Acta Crystallograph. Sect. F. StrBiol. Cryst. Comm

Dobson,J. (2006). Gene therapy progress and prospects: magnetic nanoparticle-based gene delivery. Gene Ther. 13, 283-287.

assembly and transport of vesicular stomatitis virus G protein trimers. J. Cell Biol. 105, 1957-1969.

D., Yue,Y., and Engelhardt,J.F. (2001). Expanding AAV packaging capacity with trans-splicing or overlapping vecto

Duisit,G., Saleun,S., Douthe,S., Barsoum,J., Chadeuf,G., and Moullier,P. (1999). Baculovirus vector requires electrostatic interactions including heparan sulfate for efficient gene transfer

rise, fall and repair of the brain. Bioessays 27, 262-274.

system inflammation. Microsc. Res. Tech. 52, 112-129.

mammalian cells by surface display of a RGD-motif. J. Biotechnol.

Ginecol. 56, 529-538.

mice. J. Virol. 78, 8663-8672.

on,T.A. and Griffith,T.S. (1997). A vision of cel

ng,A.K. (2005). Measles as a potential onc

Fielding,A.K., Maurice,M., Morling,F.J., Cosset,F.L., and Russell,S.J. (1998). Inverse targeting of re

71

Fipaldini,C., Bellei,B., and La Monica,N. (1999). Expression of Hepatitis C Virus cDNA in Human Hepatoma Cell Line Mediated by a Hybrid Baculovirus-HCV Vector. Virology 255, 302-311.

otherapy. 6, 621-625.

Fraser of virion maturation in autographa californica nuclear polyhedrosis virus infected spodoptera frugiperda cell cultures. J. Ultrastruct. Mol. Struct. Res. 95, 189-195.

Fredericksen,B.L. and Whitt,M.A. (1995). Vesicular stomatitis virus glycoprotein mutations that affect membrane

Galperin,M.Y. and Koonin,E.V. (2000). Who's your neighbor? New computational approaches for functional genomics.

Gamb , Barrio,J.R., Phelps,M.E., Iyer,M., Namavari,M., Satyamurthy,N., Wu,L., Green,L.A., Bauer,E., MacLaren,D.C., Nguyen,K., Berk,A.J., Cherry,S.R., and Herschman,H.R. (1999). Imaging adenoviral-directed

2,

Ghosh,S., Parvez,M.K., Banerjee,K., Sarin,S.K., and Hasnain,S.E. (2002). Baculovirus as mammalian cell expression

Gonzalez,M., Argarana,C.E., and Fidelio,G.D. (1999). Extremely high thermal stability of streptavidin and avidin upon

Goodwin,S., Peterson,C., Hoh,C., and Bittner,C. (1999). Targeting and retention of magnetic targeted carriers (MTCs)

Green,N. (1990). Avidin and Streptavidin. Methods in Enzymology 184, 51-67.

Green 1975). Avidin. Adv. Prot. Chem. 29, 85-133.

Grome utin,P.H., and Wimmer,E. (2000). Intergeneric poliovirus recombinants for the treatment of malignant glioma. Proc. Natl. Acad. Sci. U. S. A 97, 6803-6808.

Groot- Lemoine,N.R., and Vassaux,G. (2002). Adenovirus biodistribution and noninvasive imaging of gene expression in vivo by positron emission tomography using human sodium/iodide

Flotte,T.R. (2005). Recent developments in recombinant AAV-mediated gene therapy for lung diseases. Curr. Gene Ther. 5, 361-366.

Frank,J.A., Anderson,S.A., Kalsih,H., Jordan,E.K., Lewis,B.K., Yocum,G.T., and Arbab,A.S. (2004). Methods for magnetically labeling stem and other cells for detection by in vivo magnetic resonance imaging. Cyt

,M.J. (1986). Ultrastructural observations

fusion activity and abolish virus infectivity. J. Virol. 69, 1435-1443.

Nat. Biotechnol. 18, 609-613.

hir,S.S.

reporter gene expression in living animals with positron emission tomography. Proc Natl Acad Sci U S A 96, 2333-2338.

Gambhir,S.S., Czernin,J., Schwimmer,J., Silverman,D.H., Coleman,R.E., and Phelps,M.E. (2001). A tabulated summary of the FDG PET literature. J. Nucl. Med. 42, 1S-93S.

Genove,G., Demarco,U., Xu,H., Goins,W.F., and Ahrens,E.T. (2005). A new transgene reporter for in vivo magnetic resonance imaging. Nat. Med. 11, 450-454.

Gerdes,C.A., Castro,M.G., and Lowenstein,P.R. (2000). Strong promoters are the key to highly efficient, noninflammatory and noncytotoxic adenoviral-mediated transgene delivery into the brain in vivo. Mol. Ther. 330-338.

vector for gene therapy: an emerging strategy. Mol. Ther. 6, 5-11.

Glover,D.J., Lipps,H.J., and Jans,D.A. (2005). Towards safe, non-viral therapeutic gene expression in humans. Nat. Rev. Genet. 6, 299-310.

biotin binding. Biomol Eng 16, 67-72.

enhancing intra-arterial chemotherapy. Journal of Magnetism and Magnetic Materials 194, 132-139.

,R.M. (

Grieger,J.C. and Samulski,R.J. (2005). Adeno-associated virus as a gene therapy vector: vector development, production and clinical applications. Adv. Biochem. Eng Biotechnol. 99, 119-145.

ier,M., Lachmann,S., Rosenfeld,M.R., G

Wassink,T., Aboagye,E.O., Glaser,M.,

symporter as reporter gene. Hum. Gene Ther. 13, 1723-1735.

72

Guo,Z.S. and Bartlett,D.L. (2004). Vaccinia as a vector for gene delivery. Expert. Opin. Biol. Ther. 4, 901-917.

Gupta,N. (2003). Choroid plexus tumors in children. Neurosurg. Clin. N. Am. 14, 621-631.

Hacein-Bey-Abina,S., Von,K.C., Schmidt,M., McCormack,M.P., Wulffraat,N., Leboulch,P., Lim,A., Osborne,C.S., Pawliuk,R., Morillon,E., Sorensen,R., Forster,A., Fraser,P., Cohen,J.I., de Saint,B.G., Alexander,I.,

, and Cavazzana-Calvo,M. (2003). LMO2-associated clonal T cell proliferation in two patients after gene therapy for SCID-X1. Science 302, 415-419.

Haese wski,K. (2001). Gene transfer mediated by recombinant baculovirus into mouse eye. Invest Ophthalmol. Vis. Sci. 42, 3294-3300.

Haim, d infection of cell cultures by magnetically controlled virus. J. Virol. 79, 622-625.

Hakumscopy of BT4C rat glioma during

thymidine kinase-mediated gene therapy in vivo: identification of apoptotic response. Cancer Res 58, 3791-3799.

Hamm d Milhorat,TH (1973) Recent Studies on the formation of CSF. Dev Med Child Neurol 15(29), 27-34

le,R.

ilized single chain antibody achieves targeted gene delivery. Gene Ther.

Heimp lyhedrosis virus of Heliothis zea. Journal of Invertebrate Pathology 9, 55-57.

Heimp mith, L. J. (1973) The presence of nuclear polyhedrosis virus of Trichoplusia ni on cabbage from the market shelf. Environmental Entomology 2, 72-75..

Hema , Sharma,Y., Schmidt,M., Von,K.C., Persons,D.A., Billings,E.M., Verfaillie,C.M., Nienhuis,A.W., Wolfsberg,T.G., Dunbar,C.E., and

Herniou,E.A., Olszewski,J.A., O'Reilly,D.R., and Cory,J.S. (2004). Ancient coevolution of baculoviruses and their

Hoehn,M., Kustermann,E., Blunk,J., Wiedermann,D., Trapp,T., Wecker,S., Focking,M., Arnold,H., Hescheler,J., vo: a

atl. Acad.

Hofmann,C., Lehnert,W., and Strauss,M. (1998). The baculovirus vector system for gene delivery into hepatocytes.

Hofmann,C., Sandig,V., Jennings,G., Rudolph,M., Schlag,P., and Strauss,M. (1995). Efficient gene transfer into human

Wintergerst,U., Frebourg,T., Aurias,A., Stoppa-Lyonnet,D., Romana,S., Radford-Weiss,I., Gross,F., Valensi,F., Delabesse,E., Macintyre,E., Sigaux,F., Soulier,J., Leiva,L.E., Wissler,M., Prinz,C., Rabbitts,T.H., Le,D.F., Fischer,A.

leer,F., Imanishi,Y., Saperstein,D.A., and Palcze

H., Steiner,I., and Panet,A. (2005). Synchronize

äki,J.M., Poptani,H., Puumalainen,A.M., Loimas,S., Paljärvi,L.A., Ylä-Herttuala,S., and Kauppinen,R.A. (1998). Quantitative 1H nuclear magnetic resonance diffusion spectro

ock,MK an

Harrington,K., varez-Vallina,L., Crittenden,M., Gough,M., Chong,H., Diaz,R.M., Vassaux,G., Lemoine,N., and Vi(2002). Cells as vehicles for cancer gene therapy: the missing link between targeted vectors and systemic delivery? Hum. Gene Ther. 13, 1263-1280.

Hedley,S.J., uf der,M.A., Hohn,S., Escher,D., Barberis,A., Glasgow,J.N., Douglas,J.T., Korokhov,N., and Curiel,D.T. (2005). An adenovirus vector with a chimeric fiber incorporating stab

el, A. M. and Buchanan, L. K. (1967). Human feeding tests usinf a nuclear po

el, A. M., Thomas, E. D, Adams, J. R., and S

tti,P., Hong,B.K., Ferguson,C., Adler,R., Hanawa,H., Sellers,S., Holt,I.E., Eckfeldt,C.E.

Calmels,B. (2004). Distinct genomic integration of MLV and SIV vectors in primate hematopoietic stem and progenitor cells. PLoS. Biol. 2, e423.

insect hosts. J. Virol. 78, 3244-3251.

Fleischmann,B.K., Schwindt,W., and Buhrle,C. (2002). Monitoring of implanted stem cell migration in vihighly resolved in vivo magnetic resonance imaging investigation of experimental stroke in rat. Proc. NSci. U. S. A 99, 16267-16272.

Hofmann,C., Huser,A., Lehnert,W., and Strauss,M. (1999). Protection of baculovirus-vectors against complement-mediated inactivation by recombinant soluble complement receptor type 1. Biol. Chem. 380, 393-395.

Gene Ther. Mol. Biol. 1, 231-239.

hepatocytes by baculovirus vectors. Proc. Natl. Acad. Sci. U. S. A. 92, 10099-10103.

73

Hofmann,C. and Strauss,M. (1998). Baculovirus-mediated gene transfer in the presence of human serum or blfacilitated by inhibition of the complement system. Gene Ther. 5, 531-536.

ood

Hosseinkhani,H., Aoyama,T., Ogawa,O., and Tabata,Y. (2003). Ultrasound enhances the transfection of plasmid DNA

Hoya,K., Guterman,L.R., Miskolczi,L., and Hopkins,L.N. (2001). A novel intravascular drug delivery method using

Hughes,C., Galea-Lauri,J., Farzaneh,F., and Darling,D. (2001). Streptavidin paramagnetic particles provide a choice of

Huser,A. and Hofmann,C. (2003). Baculovirus vectors: novel mammalian cell gene-delivery vehicles and their

Huser,A., Rudolph,M., and Hofmann,C. (2001). Incorporation of decay-accelerating factor into the baculovirus

Huth,S., Lausier,J., Gersting,S.W., Rudolph,C., Plank,C., Welsch,U., and Rosenecker,J. (2004). Insights into the

Hymes,J. and Wolf,B. (1999). Human biotinidase isn't just for recycling biotin. J Nutr. 129, 485S-489S.

Hyton danius,T., Maatta,J.A., Nordlund,H.R., Johnson,M.S., Salminen,T.A., Airenne,K.J., Yla-Herttuala,S., and Kulomaa,M.S. (2004).

y of virus to white mice and guinea pigs. Journal of Invertebrate Pathology 7, 329-340. 1965.

Immo nela,K., Hurskainen,H., Sandmair,A., Vanninen,R., Langford,G., Murray,N., and Yla-Herttuala,S. (2004). AdvHSV-tk gene therapy with intravenous ganciclovir improves survival in human

Izsvak,Z. and Ivics,Z. (2004). Sleeping beauty transposition: biology and applications for molecular therapy. Mol. Ther.

Janakiraman,V., Forrest,W.F., Chow,B., and Seshagiri,S. (2006). A rapid method for estimation of baculovirus titer

Jarvis,D.L., Kawar,Z.S., and Hollister,J.R. (1998). Engineering N-glycosylation pathways in the baculovirus-insect cell

Jeetendra,E., Ghosh,K., Odell,D., Li,J., Ghosh,H.P., and Whitt,M.A. (2003). The membrane-proximal region of

. Biotechnol. Prog. 22, 319-325.

Horber,J.K. and Miles,M.J. (2003). Scanning probe evolution in biology. Science 302, 1002-1005.

by non-viral vectors. Curr. Pharm. Biotechnol. 4, 109-122.

endothelial biotinylation and avidin-biotin binding. Drug Deliv. 8, 215-222.

three affinity-based capture and magnetic concentration strategies for retroviral vectors. Mol. Ther. 3, 623-630.

applications. Am. J. Pharmacogenomics. 3, 53-63.

envelope generates complement-resistant gene transfer vectors. Nat. Biotechnol. 19, 451-455.

mechanism of magnetofection using PEI-based magnetofectins for gene transfer. J. Gene Med. 6, 923-936.

en,V.P., Laitinen,O.H., Airenne,T.T., Kidron,H., Meltola,N.J., Porkka,E.J., Horha,J., Pal

Efficient production of active chicken avidin using a bacterial signal peptide in Escherichia coli. Biochem. J. 384, 385-390.

Ignoffo, C. M. and Heimpel, A. M. The nuclear-polyhedrosis virus of Heliothis zea (Boddie) and Heliothis virescens (Fabricius). V. Toxicity-pathogenicit

nen,A., Vapalahti,M., Tyy

malignant glioma: a randomised, controlled study. Mol. Ther. 10, 967-972.

9, 147-156.

based on viable cell size. J. Virol. Methods 132, 48-58.

system. Curr. Opin. Biotechnol. 9, 528-533.

vesicular stomatitis virus glycoprotein G ectodomain is critical for fusion and virus infectivity. J. Virol. 77, 12807-12818.

Jeetendra,E., Robison,C.S., Albritton,L.M., and Whitt,M.A. (2002). The membrane-proximal domain of vesicular stomatitis virus G protein functions as a membrane fusion potentiator and can induce hemifusion. J. Virol. 76, 12300-12311.

Jorio,H., Tran,R., and Kamen,A. (2006). Stability of serum-free and purified baculovirus stocks under various storage conditions

74

Juuti-Uusitalo,K., Airenne,K.J., Laukkanen,A., Punnonen,E.L., Olkkonen,V.M., Gruenberg,J., Kulomaa,M., and Marjomaki,V. (2000). Selective targeting of avidin/mannose 6-phosphate receptor chimeras to early or late

n by

Keddie,B.A., Aponte,G.W., and Volkman,L.E. (1989). The pathway of infection of Autographa californica nuclear

Kenoutis,C., Efrose,R.C., Swevers,L., Lavdas,A.A., Gaitanou,M., Matsas,R., and Iatrou,K. (2006). Baculovirus-l but

Kett,W oe,L., and Coombe,D.R. (2005). Direct detection of the binding of avidin and lactoferrin fluorescent probes to heparinized surfaces. Anal. Biochem. 339, 206-215.

Kida,S , and Weller,R.O. (1993). CSF drains directly from the subarachnoid space into nasal lymphatics in the rat. Anatomy, histology and immunological significance. Neuropathol. Appl. Neurobiol. 19, 480-488.

Kim,Y gulation of transduction efficiency by pegylation of baculovirus vector in vitro and in vivo. J. Biotechnol.

Kircheis,R., Wightman,L., Schreiber,A., Robitza,B., Rossler,V., Kursa,M., and Wagner,E. (2001).

ymphatic

Knudson,D.L. and Tinsley,T.W. (1974). Replication of a nuclear polyhedrosis virus in a continuous cell culture of 4-

lphav integrin, and heparan sulfate binding reduce in vivo tissue transduction and toxicity. Hum. Gene Ther. 17, 264-279.

Kootst . Rev. Pharmacol. Toxicol. 43, 413-439.

n to the residual genetic fluctuation in gene-modified DHMO in North-Kirgisian rural area. J Sem Quant Res. 25,(10)1977-2006.

Kost,T ecombinant baculoviruses as expression vectors for insect and mammalian cells. Curr. Opin. Biotechnol. 10, 428-433.

Kost,T.A. and Condreay,J.P. (2002). Recombinant baculoviruses as mammalian cell gene-delivery vectors. Trends

Kost,T.A., Condreay,J.P., and Jarvis,D.L. (2005). Baculovirus as versatile vectors for protein expression in insect and

S. A 87, 2211-2215.

endosomes. Eur J Cell Biol 79, 458-68.

Kadota,S.I., Kanayama,T., Miyajima,N., Takeuchi,K., and Nagata,K. (2005). Enhancing of measles virus infectiomagnetofection. J. Virol. Methods.

polyhedrosis virus in an insect host. Science 243, 1728-1730.

mediated gene delivery into Mammalian cells does not alter their transcriptional and differentiating potentiais accompanied by early viral gene expression. J. Virol. 80, 4135-4146.

Kett,W.C., Osmond,R.I., Moe,L., Skett,S.E., Kinnear,B.F., and Coombe,D.R. (2003). Avidin is a heparin-binding protein. Affinity, specificity and structural analysis. Biochim. Biophys. Acta 1620, 225-234.

.C., Osmond,R.I., Stevenson,S.M., M

., Pantazis,A.

.K., Park,I.K., Jiang,H.L., Choi,J.Y., Je,Y.H., Jin,H., Kim,H.W., Cho,M.H., and Cho,C.S. (2006). Re

Polyethylenimine/DNA complexes shielded by transferrin target gene expression to tumors after systemic application. Gene Ther. 8, 28-40.

Knopf,P.M., Cserr,H.F., Nolan,S.C., Wu,T.Y., and Harling-Berg,C.J. (1995). Physiology and immunology of ldrainage of interstitial and cerebrospinal fluid from the brain. Neuropathol. Appl. Neurobiol. 21, 175-180.

Spodoptera frugiperda: purification, assay of infectivity, and growth characteristics of the virus. J. Virol. 14, 93944.

Koizumi,N., Kawabata,K., Sakurai,F., Watanabe,Y., Hayakawa,T., and Mizuguchi,H. (2006). Modified adenoviral vectors ablated for coxsackievirus-adenovirus receptor, a

ra,N.A. and Verma,I.M. (2003). Gene therapy with viral vectors. Annu

Korjamo,T.J., Radenthal,J-P., Lehesranta S.J., Mäntylä,T., Heikkinen,J., Kallio,A., Tervonen,T. (2001). The effects of amorphic surface tensio

.A. and Condreay,J.P. (1999). R

Biotechnol. 20, 173-180.

mammalian cells. Nat. Biotechnol. 23, 567-575.

Kotin,R.M., Siniscalco,M., Samulski,R.J., Zhu,X.D., Hunter,L., Laughlin,C.A., McLaughlin,S., Muzyczka,N., Rocchi,M., and Berns,K.I. (1990). Site-specific integration by adeno-associated virus. Proc. Natl. Acad. Sci. U.

75

Kreis,T.E. and Lodish,H.F. (1986). Oligomerization is essential for transport of vesicular stomatitis viral glycoproteithe cell surface. Cell 46, 929-937.

n to

s efficient de- and retargeting of adenovirus vectors. Mol. Ther. 12, 107-117.

Kroll,R.A., Pagel,M.A., Muldoon,L.L., Roman-Goldstein,S., and Neuwelt,E.A. (1996). Increasing volume of

or

Kulomaa,M.S., and Yla-Herttuala,S. (2003). Baculovirus capsid display: a novel tool for transduction imaging. Mol. Ther. 8, 853-862.

Kusna

Lacroix,S., Feinstein,D., and Rivest,S. (1998a). The bacterial endotoxin lipopolysaccharide has the ability to target the 25-640.

Lacroix,S., Feinstein,D., and Rivest,S. (1998b). The bacterial endotoxin lipopolysaccharide has the ability to target the .

Laitinen,O.H., Airenne,K.J., Hytonen,V.P., Peltomaa,E., Mahonen,A.J., Wirth,T., Lind,M.M., Makela,K.A., 05a). A

cleic Acids Res. 33, e42.

very 2[2], 124-132. 1-3-2005b.

son,M.S., Airenne,K.J., and Kulomaa,M.S. (2002). Chicken avidin-related proteins

show altered biotin-binding and physico-chemical properties as compared with avidin. Biochem. J. 363, 609-617.

Laitin lik,T., Livnah,O., Bayer,E.A., Wilchek,M., and Kulomaa,M.S. (2001). Biotin induces tetramerization of a recombinant monomeric avidin. A model for protein-protein interactions. J

Lanza,G.M., Winter,P.M., Caruthers,S.D., Morawski,A.M., Schmieder,A.H., Crowder,K.C., and Wickline,S.A. (2004). l. 11, 733-743.

onzalez,A.M., and Baird,A. (2002). Evolving phage vectors for cell targeted gene delivery. Curr. Pharm. Biotechnol. 3, 45-57.

Lee,S. Kim,N.K. (2000). Enhancement of adenoviral transduction with polycationic liposomes in vivo. Cancer Gene Ther. 7, 1329-1335.

Lee,S. ne Micrometer Resolution NMR Microscopy. Journal of Magnetic Resonance 150, 207-213.

Lee,Y

Kreppel,F., Gackowski,J., Schmidt,E., and Kochanek,S. (2005). Combined genetic and chemical capsid modificationenable flexible and

Kreppel,F. and Kochanek,S. (2004). Long-term transgene expression in proliferating cells mediated by episomally maintained high-capacity adenovirus vectors. J. Virol. 78, 9-22.

distribution to the brain with interstitial infusion: dose, rather than convection, might be the most important factor. Neurosurgery 38, 746-752.

Kruyt,F.A. and Curiel,D.T. (2002). Toward a new generation of conditionally replicating adenoviruses: pairing tumselectivity with maximal oncolysis. Hum. Gene Ther. 13, 485-495.

Kukkonen,S.P., Airenne,K.J., Marjomaki,V., Laitinen,O.H., Lehtolainen,P., Kankaanpaa,P., Mahonen,A.J., Raty,J.K., Nordlund,H.R., Oker-Blom,C.,

di,A.R., Hood,E.E., Witcher,D.R., Howard,J.A., and Nikolov,Z.L. (1998). Production and purification of two recombinant proteins from transgenic corn. Biotechnol Prog 14, 149-55.

brain in upregulating its membrane CD14 receptor within specific cellular populations. Brain Pathol. 8, 6

brain in upregulating its membrane CD14 receptor within specific cellular populations. Brain Pathol. 8, 625-640

Toivanen,P.I., Schenkwein,D., Heikura,T., Nordlund,H.R., Kulomaa,M.S., and Yla-Herttuala,S. (20multipurpose vector system for the screening of libraries in bacteria, insect and mammalian cells and expression in vivo. Nu

Laitinen, O. H., Airenne, K. J., Raty, J. K., Wirth, T., and Yla-Herttuala, S. Avidin Fusion Protein Strategies in Targeted Drug and Gene Delivery. Letters in Drug Design & Disco

Laitinen,O.H., Hytonen,V.P., Ahlroth,M.K., Pentikainen,O.T., Gallagher,C., Nordlund,H.R., Ovod,V., Marttila,A.T.,Porkka,E., Heino,S., John

en,O.H., Marttila,A.T., Airenne,K.J., Ku

Biol Chem 276, 8219-24.

Magnetic resonance molecular imaging with nanoparticles. J. Nucl. Cardio

Larocca,D., Burg,M.A., Jensen-Pergakes,K., Ravey,E.P., G

G., Yoon,S.J., Kim,C.D., Kim,K., Lim,D.S., Yeom,Y.I., Sung,M.W., Heo,D.S., and

C., Kim,K., Kim,J., Lee,S., Han Yi,J., Woo Kim,S., Ha,K.S., and Cheong,C. (2001). O

.B., Glover,C.P., Cosgrave,A.S., Bienemann,A., and Uney,J.B. (2005). Optimizing regulatable gene expression using adenoviral vectors. Exp. Physiol 90, 33-37.

76

Lehtolainen,P., Tyynela,K., Kannasto,J., Airenne,K.J., and Yla-Herttuala,S. (2002). Baculoviruses exhibit restricted cell type specificity in rat brain: a comparison of baculovirus- and adenovirus-mediated intracerebral gene transfer in

Levine

Li,A.M n,R.M., and Yi,L.H. (2005). Localization and distribution of magnetic chemotherapeutic drugs with magnetic targeting in rat brain. Chin Med. J. (Engl. ) 118, 824-827.

Li,Y., mal, subependymal and choroid plexus cells in response to stroke in rats. J. Neurol. Sci. 193, 137-146.

Li,Y., d Wang,S. (2004). Axonal transport of recombinant baculovirus vectors. Mol. Ther. 10, 1121-1129.

Liang an

repetitive, quantitative measurement of gene expression from a bicistronic message by positron emission

Liljest on of animal cell expression vectors based on the Semliki Forest virus replicon. Biotechnology (N. Y. ) 9, 1356-1361.

Livna in-ci. U. S. A. 90, 5076-5080.

ministration of PV701, an oncolytic virus. Curr. Opin. Mol. Ther. 5, 618-624.

Louie eade,T.J. (2000). In vivo visualization of gene expression using magnetic resonance imaging. Nat. Biotechnol. 2000. Mar. ;18. (3.

Lubbe ,

4-

Magnusson,M.K., Hong,S.S., Henning,P., Boulanger,P., and Lindholm,L. (2002). Genetic retargeting of adenovirus

Makela,A.R., Matilainen,H., White,D.J., Ruoslahti,E., and Oker-Blom,C. (2006). Enhanced baculovirus-mediated

Makrides,S.C. (1999). Components of vectors for gene transfer and expression in mammalian cells. Protein Expr. Purif.

Mangor,J.T., Monsma,S.A., Johnson,M.C., and Blissard,G.W. (2001). A GP64-null baculovirus pseudotyped with vesicular stomatitis virus G protein. J. Virol. 75, 2544-2556.

vivo. Gene Ther. 9, 1693-1699.

Leikina,E., Onaran,H.O., and Zimmerberg,J. (1992). Acidic pH induces fusion of cells infected with baculovirus to form syncytia. FEBS Lett. 304, 221-224.

,S. (1987). Choroid plexus: target for systemic disease and pathway to the brain. Lab Invest 56, 231-233.

., Zhang,C.X., Fu,X.P., Zhang,Z.W., Xue,Q.H., Ya

Chen,J., and Chopp,M. (2002). Cell proliferation and differentiation from ependy

Wang,X., Guo,H., an

,C.Y., Wang,H.Z., Li,T.X., Hu,Z.H., and Chen,X.W. (2004). High efficiency gene transfer into mammalikidney cells using baculovirus vectors. Arch. Virol. 149, 51-60.

Liang,Q., Gotts,J., Satyamurthy,N., Barrio,J., Phelps,M.E., Gambhir,S.S., and Herschman,H.R. (2002). Noninvasive,

tomography, following gene transfer with adenovirus. Mol. Ther. 6, 73-82.

rom,P. and Garoff,H. (1991). A new generati

h,O., Bayer,E.A., Wilchek,M., and Sussman,J.L. (1993). Three-dimensional structures of avidin and the avidbiotin complex. Proc. Natl. Acad. S

Lorence,R.M., Pecora,A.L., Major,P.P., Hotte,S.J., Laurie,S.A., Roberts,M.S., Groene,W.S., and Bamat,M.K. (2003). Overview of phase I studies of intravenous ad

,A.Y., Huber,M.M., Ahrens,E.T., Rothbacher,U., Moats,R., Jacobs,R.E., Fraser,S.E., and M

):321. -325. 18, 321-325.

,A.S., Alexiou,C., and Bergemann,C. (2001). Clinical applications of magnetic drug targeting. J. Surg. Res. 95200-206.

Luckow,V.A. (1993). Baculovirus systems for the expression of human gene products. Curr. Opin. Biotechnol. 4, 56572.

Lung,O., Westenberg,M., Vlak,J.M., Zuidema,D., and Blissard,G.W. (2002). Pseudotyping Autographa californicamulticapsid nucleopolyhedrovirus (AcMNPV): F proteins from group II NPVs are functionally analogous to AcMNPV GP64. J. Virol. 76, 5729-5736.

vectors: functionality of targeting ligands and their influence on virus viability. J. Gene Med. 4, 356-370.

transduction of human cancer cells by tumor-homing peptides. J. Virol. 80, 6603-6611.

17, 183-202.

77

Manilla,P., Rebello,T., Afable,C., Lu,X., Slepushkin,V., Humeau,L.M., Schonely,K., Ni,Y., Binder,G.K., Levine,BMacGregor,R.R., June,C.H., and Dropulic,B. (2005). Regulatory considerati

.L., ons for novel gene therapy products:

a review of the process leading to the first clinical lentiviral vector. Hum. Gene Ther. 16, 17-25.

Markovic,I., Pulyaeva,H., Sokoloff,A., and Chernomordik,L.V. (1998). Membrane fusion mediated by baculovirus

Marttila,A.T., Laitinen,O.H., Airenne,K.J., Kulik,T., Bayer,E.A., Wilchek,M., and Kulomaa,M.S. (2000). Recombinant

cesses

r- carcinoma cells.

J. Biotechnol.

Matlin tion. J Mol Biol 156[3], 609-631. 1-1-1982.

McMahon,R.J. (2002). Biotin in metabolism and molecular biology. Annu. Rev. Nutr. 22, 221-239.

Medin matic

Mergia,A. and Heinkelein,M. (2003). Foamy virus vectors. Curr. Top. Microbiol. Immunol. 277, 131-159.

Miller

Mizuguchi,H. and Hayakawa,T. (2004). Targeted adenovirus vectors. Hum. Gene Ther. 15, 1034-1044.

Mond bility of netic field. J. Nanobiotechnology. 4,

4.

Monsm ens,A.G., and Blissard,G.W. (1996). The GP64 envelope fusion protein is an essential baculovirus protein required for cell-to-cell transmission of infection. J. Virol. 70, 4607-4616.

Moos, cement technique for demonstration of iron in the central nervous system. Histochemistry 99, 471-475.

Motte ., and Oker-Blom,C. (2000). Baculoviral display of functional scFv and synthetic IgG-binding domains. Biochem. Biophys. Res. Commun. 275, 84-90.

Muldoetic iron oxide magnetic resonance nanoparticles in the rat brain and intracerebral tumor.

Neurosurgery 57, 785-796.

Muldo erparamagnetic iron oxide particles (Combidex) from brain to lymph nodes in the rat.

Neuropathol. Appl. Neurobiol. 30, 70-79.

Muro, dothelial endocytic pathways: gates for vascular drug delivery. Curr. Vasc. Pharmacol. 2, 281-299.

Muruve,D.A. (2004). The innate immune response to adenovirus vectors. Hum. Gene Ther. 15, 1157-1166.

gp64 involves assembly of stable gp64 trimers into multiprotein aggregates. J. Cell Biol. 143, 1155-1166.

NeutraLite avidin: a non-glycosylated, acidic mutant of chicken avidin that exhibits high affinity for biotin andlow non-specific binding properties. FEBS Lett 467, 31-6.

Martuza,R.L., Malick,A., Markert,J.M., Ruffner,K.L., and Coen,D.M. (1991). Experimental therapy of human glioma by means of a genetically engineered virus mutant. Science 252, 854-856.

Massoud,T.F. and Gambhir,S.S. (2003). Molecular imaging in living subjects: seeing fundamental biological proin a new light. Genes Dev. 17, 545-580.

Matilainen,H., Makela,A.R., Riikonen,R., Saloniemi,T., Korhonen,E., Hyypia,T., Heino,J., Grabherr,R., and OkeBlom,C. (2006). RGD motifs on the surface of baculovirus enhance transduction of human lung

, K. S., Reggio, H., Helenius, A., and Simons, K. Pathway of vesicular stomatitis virus entry leading to infec

a,L.A., Calixto,S.M., Klipper,R., Li,Y., Phillips,W.T., and Goins,B. (2006). Mediastinal node and diaphragtargeting after intracavitary injection of avidin/99mTc-blue-biotin-liposome system. J. Pharm. Sci. 95, 207-224.

,L.K. (1997). The Baculoviruses. (Plenum Press, New York).

alek,F.G., Zhang,Y.Y., Kropp,B., Kopke,R.D., Ge,X., Jackson,R.L., and Dormer,K.J. (2006). The permeaSPION over an artificial three-layer membrane is enhanced by external mag

a,S.A., Oom

T. and Mollgard,K. (1993). A sensitive post-DAB enhan

rshead,D.G., Alfthan,K., Ojala,K., Takkinen,K

on,L.L., Sandor,M., Pinkston,K.E., and Neuwelt,E.A. (2005). Imaging, distribution, and toxicity of superparamagn

on,L.L., Varallyay,P., Kraemer,D.F., Kiwic,G., Pinkston,K., Walker-Rosenfeld,S.L., and Neuwelt,E.A. (2004).Trafficking of sup

S., Koval,M., and Muzykantov,V. (2004). En

78

Nagaraja,T.N., Patel,P., Gorski,M., Gorevic,P.D., Patlak,C.S., and Fenstermacher,J.D. (2005). In normal rat, intraventricularly administered insulin-like growth factor-1 is rapidly cleared from CSF with limited distribuinto brain. Cerebrospinal. Fluid Res. 2, 5

tion .

chemical characterization and crystal structure of a recombinant hen avidin and its acidic mutant expressed in Escherichia coli. Eur J Biochem 256, 453-60.

Nesbent manipulation. Mol. Ther. 13, 814-

822.

Netsk 173.

uted avidins. Biochem. J. 392, 485-491.

Nordl truction of a dual-chain pseudo-tetrameric chicken avidin by combining two circularly permuted avidins. J. Biol. Chem. 279,

Norma ll viruses are bad guys: the case for reovirus in cancer therapy. Drug Discov. Today 10, 847-855.

Noure

ork,

Ogawara,K., Rots,M.G., Kok,R.J., Moorlag,H.E., Van Loenen,A.M., Meijer,D.K., Haisma,H.J., and Molema,G. (2004). ial

Ojala,K., Koski,J., Ernst,W., Grabherr,R., Jones,I., and Oker-Blom,C. (2004). Improved display of synthetic IgG-

Oker-Blom,C., Airenne,K.J., and Grabherr,R. (2003). Technique reviews: Baculovirus display strategies: Emerging

Oomens,A.G. and Blissard,G.W. (1999). Requirement for GP64 to drive efficient budding of Autographa californica

Oomens,A.G., Monsma,S.A., and Blissard,G.W. (1995). The baculovirus GP64 envelope fusion protein: synthesis,

Osada,S., Ebihara,I., Setoguchi,Y., Takahashi,H., Tomino,Y., and Koide,H. (1999). Gene therapy for renal anemia in Int. 55,

Nakanishi,M., Akuta,T., Nagoshi,E., Eguchi,A., Mizuguchi,H., and Senda,T. (2001). Nuclear targeting of DNA. Eur. J.Pharm. Sci. 13, 17-24.

Nardone,E., Rosano,C., Santambrogio,P., Curnis,F., Corti,A., Magni,F., Siccardi,A.G., Paganelli,G., Losso,R., Apreda,B., Bolognesi,M., Sidoli,A., and Arosio,P. (1998). Bio

th,D., Williams,S.L., Chan,L., Brain,T., Slater,N.K., Farzaneh,F., and Darling,D. (2006). Metabolic biotinylation of lentiviral pseudotypes for scalable paramagnetic microparticle-depende

y,M.G. and Shuangshoti,S. (1970). Studies on the choroid plexus. Neurosci. Res. (N. Y. ) 3, 131-

Nettelbeck,D.M., Jerome,V., and Muller,R. (1998). A strategy for enhancing the transcriptional activity of weak cell type-specific promoters. Gene Ther. 5, 1656-1664.

Nordlund,H.R., Hytonen,V.P., Horha,J., Maatta,J.A., White,D.J., Halling,K., Porkka,E.J., Slotte,J.P., Laitinen,O.H., and Kulomaa,M.S. (2005). Tetravalent single-chain avidin: from subunits to protein domains via circularly perm

und,H.R., Laitinen,O.H., Hytonen,V.P., Uotila,S.T., Porkka,E., and Kulomaa,M.S. (2004). Cons

36715-36719.

n,K.L. and Lee,P.W. (2005). Not a

ddini,S.C. and Curiel,D.T. (2005). Genetic Targeting Strategies for Adenovirus. Mol. Pharm. 2, 341-347.

O'Reilly,D.R., Miller,L.K., and Luckov,V.A. (1994). Baculovirus expression vectors. A laboratory manual. (New YNY: Oxford University Press).

A novel strategy to modify adenovirus tropism and enhance transgene delivery to activated vascular endothelcells in vitro and in vivo. Hum. Gene Ther. 15, 433-443.

binding domains on the baculovirus surface. Technol. Cancer Res. Treat. 3, 77-84.

Ojala,K., Mottershead,D.G., Suokko,A., and Oker-Blom,C. (2001). Specific binding of baculoviruses displaying gp64 fusion proteins to mammalian cells. Biochem. Biophys. Res. Commun. 284, 777-784.

tools for eukaryotic libraries and gene delivery. Briefings in Functional Genomics and Proteomics 2, 244-253.

multicapsid nucleopolyhedrovirus. Virology 254, 297-314.

oligomerization, and processing. Virology 209, 592-603.

mice with polycystic kidney using an adenovirus vector encoding the human erythropoietin gene. Kidney1234-1240.

79

Pandori,M., Hobson,D., and Sano,T. (2002a). Adenovirus-microbead conjugates possess enhanced infectivity: a new strategy for localized gene delivery. Virology 299, 204-212.

otocleavable biotinylation reagent. Chem. Biol. 9, 567-573.

Pardri inylated antisense oligonucleotide or peptide mediated by avidin, a cationic protein. FEBS Lett. 288, 30-32.

Park,S irus irus envelope glycoprotein. Biochem. Biophys. Res. Commun. 289, 444-

450.

Parks, oviral vectors of alternative serotypes permits repeat vector administration. Gene Ther 6, 1565-1573.

Parrottor purification. Mol. Ther. 8, 688-700.

1, 22-31.

geting

Ponna hompson,J.A., and Castillas,M., Jr. (2002). Conjugate-based targeting of recombinant adeno-associated virus type 2 vectors by using avidin-linked ligands. J. Virol. 76, 12900-12907.

Possee iruses, L.K.Miller, ed. (New York: Plenum Press), pp. 109-140.

Post,D

.,

f vector DNA in the optic nerve and in the brain. Mol. Ther. 11, 275-283.

iol. 231, 698-710.

atal

gene transfer. Mol. Genet. Metab 80, 148-158.

Rayna 004). Macrophage endocytosis of superparamagnetic iron oxide nanoparticles: mechanisms and comparison of ferumoxides and ferumoxtran-10.

Pandori,M.W., Hobson,D.A., Olejnik,J., Krzymanska-Olejnik,E., Rothschild,K.J., Palmer,A.A., Phillips,T.J., and Sano,T. (2002b). Photochemical control of the infectivity of adenoviral vectors using a novel ph

dge,W.M. and Boado,R.J. (1991). Enhanced cellular uptake of biot

.W., Lee,H.K., Kim,T.G., Yoon,S.K., and Paik,S.Y. (2001). Hepatocyte-specific gene expression by baculovpseudotyped with vesicular stomatitis v

R., Evelegh,C., and Graham,F. (1999). Use of helper-dependent aden

t,M.B., Adams,K.E., Mercier,G.T., Mok,H., Campos,S.K., and Barry,M.A. (2003). Metabolically biotinylated adenovirus for cell targeting, ligand screening, and vec

Pearson,M.N., Russell,R.L., and Rohrmann,G.F. (2001). Characterization of a baculovirus-encoded protein that is associated with infected-cell membranes and budded virions. Virology 29

Pieroni,L., Maione,D., and La Monica,N. (2001). In vivo gene transfer in mouse skeletal muscle mediated by baculovirus vectors. Hum. Gene Ther. 12, 871-881.

Pijlman,G.P., de,V.J., van den End,F.J., Vlak,J.M., and Martens,D.E. (2004). Evaluation of baculovirus expression vectors with enhanced stability in continuous cascaded insect-cell bioreactors. Biotechnol. Bioeng. 87, 743-753.

Plank,C., Scherer,F., Schillinger,U., Bergemann,C., and Anton,M. (2003). Magnetofection: enhancing and targene delivery with superparamagnetic nanoparticles and magnetic fields. J. Liposome Res. 13, 29-32.

zhagan,S., Mahendra,G., Kumar,S., T

,R.D. and Rohrmann,G.F. (1997). Baculovirus Genome Organisation and Evolution. In The Baculov

.E., Fulci,G., Chiocca,E.A., and Van Meir,E.G. (2004). Replicative oncolytic herpes simplex viruses in combination cancer therapies. Curr. Gene Ther. 4, 41-51.

Provost,N., Le,M.G., Weber,M., Mendes-Madeira,A., Podevin,G., Cherel,Y., Colle,M.A., Deschamps,J.Y., Moullier,Pand Rolling,F. (2005). Biodistribution of rAAV vectors following intraocular administration: evidence for the presence and persistence o

Pugliese,L., Coda,A., Malcovati,M., and Bolognesi,M. (1993). Three-dimensional structure of the tetragonal crystal form of egg-white avidin in its functional complex with biotin at 2.7 A resolution. J. Mol. B

Purow,B. and Staveley-O'Carroll,K. (2005). Targeting of vaccinia virus using biotin-avidin viral coating and biotinylated antibodies. J. Surg. Res. 123, 49-54.

Raper,S.E., Chirmule,N., Lee,F.S., Wivel,N.A., Bagg,A., Gao,G.P., Wilson,J.M., and Batshaw,M.L. (2003). Fsystemic inflammatory response syndrome in a ornithine transcarbamylase deficient patient following adenoviral

l,I., Prigent,P., Peyramaure,S., Najid,A., Rebuzzi,C., and Corot,C. (2

Invest Radiol. 39, 56-63.

80

Riikonen,R., Matilainen,H., Rajala,N., Pentikainen,O., Johnson,M., Heino,J., and Oker-Blom,C. (2005). Functional display of an alpha2 integrin-specific motif (RKK) on the surface of baculovirus particles. Technol. Cancer Res. Treat. 4, 437-445.

Robison,C.S. and Whitt,M.A. (2000). The membrane-proximal stem region of vesicular stomatitis virus G protein confers efficient virus assembly. J. Virol. 74, 2239-2246.

tion. J. Mol. Med. 82, 500-509.

Roe,T. sis. EMBO J 12, 2099-2108.

Roma Drug News Perspect. 18, 128-134.

Lippincott Williams & Wilkins), pp. 1221-1244.

of proteins which are N alpha-blocked. Biochem. J. 217, 253-257.

Rosen ing: a lear Medicine Computer and

Instrumentation Council. J. Nucl. Med. 36, 1489-1513.

Rudge atterall,L. (2001). Adsorption and desorption of chemotherapeutic drugs from a magnetically targeted carrier (MTC). J. Control Release 74, 335-340.

Russe her. 9, 961-966.

iated intramyocardial gene transfer using the mature form of vascular endothelial growth factor-D induces transmural angiogenesis in porcine heart. Circulation 109, 1029-1035.

Rybakc antigens accessible from the vasculature. Nat. Methods 2, 291-298.

Sailaja,G., HogenEsch,H., North,A., Hays,J., and Mittal,S.K. (2002). Encapsulation of recombinant adenovirus into

Saito,R., Krauze,M.T., Bringas,J.R., Noble,C., McKnight,T.R., Jackson,P., Wendland,M.F., Mamot,C.,

d

intra-tumoural transduction with thymidine kinase retrovirus packaging cell injections and ganciclovir treatment. Acta

Sandmair,A.M., Loimas,S., Puranen,P., Immonen,A., Kossila,M., Puranen,M., Hurskainen,H., Tyynela,K., Turunen,M., e

Rodriguez,E.G. (2004). Nonviral DNA vectors for immunization and therapy: design and methods for their obten

, Reynolds,T.C., Yu,G., and Brown,P.O. (1993). Integration of murine leukemia virus DNA depends on mito

no,G. (2005). Current development of lentiviral-mediated gene transfer.

Rose,J.K. and Whitt,M.A. (2001). Rhabdoviridae: The viruses and their replication. In Virology, B.N.Fields, ed. (Philadelphia:

Rose,K., Kocher,H.P., Blumberg,B.M., and Kolakofsky,D. (1984). An improved procedure, involving mass spectrometry, for N-terminal amino acid sequence determination

thal,M.S., Cullom,J., Hawkins,W., Moore,S.C., Tsui,B.M., and Yester,M. (1995). Quantitative SPECT imagreview and recommendations by the Focus Committee of the Society of Nuc

,S., Peterson,C., Vessely,C., Koda,J., Stevens,S., and C

ll,S.J. (2002). RNA viruses as virotherapy agents. Cancer Gene T

Rutanen,J., Rissanen,T.T., Markkanen,J.E., Gruchala,M., Silvennoinen,P., Kivela,A., Hedman,A., Hedman,M., Heikura,T., Orden,M.R., Stacker,S.A., Achen,M.G., Hartikainen,J., and Yla-Herttuala,S. (2004). Adenoviral catheter-med

,J.N., Ettorre,A., Kaissling,B., Giavazzi,R., Neri,D., and Elia,G. (2005). In vivo protein biotinylation for identification of organ-specifi

Sadeghi,H. and Hitt,M.M. (2005). Transcriptionally targeted adenovirus vectors. Curr. Gene Ther. 5, 411-427.

alginate microspheres circumvents vector-specific immune response. Gene Ther. 9, 1722-1729.

Drummond,D.C., Kirpotin,D.B., Hong,K., Berger,M.S., Park,J.W., and Bankiewicz,K.S. (2005). Gadolinium-loaded liposomes allow for real-time magnetic resonance imaging of convection-enhanced delivery in the primate brain. Exp. Neurol.

Sandig,V., Hofmann,C., Steinert,S., Jennings,G., Schlag,P., and Strauss,M. (1996). Gene transfer into hepatocytes anhuman liver tissue by baculovirus vectors. Hum. Gene Ther. 7, 1937-1945.

Sandmair,A.M., Loimas,S., Poptani,H., Vainio,P., Vanninen,R., Turunen,M., Tyynelä,K., Vapalahti,M., and Ylä-Herttuala,S. (1999). Low efficacy of gene therapy for rat BT4C malignant glioma using

Neurochir. (Wien. ) 141, 867-872.

Vanninen,R., Lehtolainen,P., Paljarvi,L., Johansson,R., Vapalahti,M., and Yla-Herttuala,S. (2000). Thymidin

81

kinase gene therapy for human malignant glioma, using replication-deficient retroviruses or adenoviruses. Hum Gene Ther 11, 2197-2205.

Sandrin,V., Russell,S.J., and Cosset,F.L. (2003). Targeting retroviral and lentiviral vectors. Curr. Top. Microbiol.

Sarkis,C., Serguera,C., Petres,S., Buchet,D., Ridet,J.L., Edelman,L., and Mallet,J. (2000). Efficient transduction of

Sarnat the developing ependyma and choroid plexus. Microsc. Res. Tech. 41, 14-28.

Schatz s. Anticancer Drugs 12, 275-304.

Schell E., Spear,M., Breakefield,X., and Weissleder,R. (1998). Mapping the in vivo distribution of herpes simplex virions. Hum. Gene Ther. 9, 1543-1549.

Schellpression. Neuroimaging Clin. N. Am. 12, 571-vii.

7, 1648-1655.

Garrigue,A., Le,D.F., Lagresle,C., Fischer,A., Cavazzana-Calvo,M., and Von,K.C. (2005). Clonal evidence for

ew type of post-translational modification of the viral glycoprotein. Cell 17, 813-819.

Schmidt-Wolf,G.D. and Schmidt-Wolf,I.G. (2003). Non-viral and hybrid vectors in human gene therapy: an update.

articles (SPION) in synovial cells of sheep. Journal of Magnetism and Magnetic Materials 293, 411-418.

Shapiro,E.M., Sharer,K., Skrtic,S., and Koretsky,A.P. (2006). In vivo detection of single cells by MRI. Magn Reson.

Shen,C n,A. (2002). Quantitation of baculovirus particles by flow cytometry. J. Virol. Methods 105, 321-330.

Shenk e, eds.

including non- hepatic cells, by baculovirus vectors. J. Gen. Virol. 78, 2657-2664.

Immunol. 281, 137-178.

neural cells in vitro and in vivo by a baculovirus-derived vector. Proc. Natl. Acad. Sci. U. S. A 97, 14638-14643.

,H.B. (1998). Histochemistry and immunocytochemistry of

lein,A.G. (2001). Non-viral vectors in cancer gene therapy: principles and progres

ingerhout,D., Bogdanov,A., Jr., Marecos,

ingerhout,D. and Bogdanov,A.A., Jr. (2002). Viral imaging in gene therapy noninvasive demonstration of gene delivery and ex

Schellingerhout,D., Rainov,N.G., Breakefield,X.O., and Weissleder,R. (2000). Quantitation of HSV mass distribution in a rodent brain tumor model. Gene Ther.

Schmidt,M., Hacein-Bey-Abina,S., Wissler,M., Carlier,F., Lim,A., Prinz,C., Glimm,H., ndre-Schmutz,I., Hue,C.,

the transduction of CD34+ cells with lymphomyeloid differentiation potential and self-renewal capacity in the SCID-X1 gene therapy trial. Blood 105, 2699-2706.

Schmidt,M.F. and Schlesinger,M.J. (1979). Fatty acid binding to vesicular stomatitis virus glycoprotein: a n

Trends Mol. Med. 9, 67-72.

Schopf,B., Neuberger,T., Schulze,K., Petri,A., Chastellain,M., Hofmann,M., Hofmann,H., and von Rechenberg,B. (2005). Methodology description for detection of cellular uptake of PVA coated superparamagnetic iron oxide nanop

Schroder,A.R., Shinn,P., Chen,H., Berry,C., Ecker,J.R., and Bushman,F. (2002). HIV-1 integration in the human genome favors active genes and local hotspots. Cell 110, 521-529.

Seemann,M.D. (2005). Whole-body PET/MRI: The Future in Oncological Imaging. Technol. Cancer Res. Treat. 4, 577-582.

Selkirk,S.M. (2004). Gene therapy in clinical medicine. Postgrad. Med. J. 80, 560-570.

Med. 55, 242-249.

.F., Meghrous,J., and Kame

,T. (1996). Adenoviridae: The viruses and their replication. In Fields Virology, B.N.Fields and D.M.Knip(New York: Raven Press), pp. 2111-2148.

Shoji,I., Aizaki,H., Tani,H., Ishii,K., Chiba,T., Saito,I., Miyamura,T., and Matsuura,Y. (1997). Efficient gene transfer into various mammalian cells,

82

Shokralla,S., He,Y., Wanas,E., and Ghosh,H.P. (1998). Mutations in a carboxy-terminal region of vesicular stvirus glycoprotein G that affect membrane fusion activity. Virology 242, 39-50.

omatitis

Smith,J.S., Keller,J.R., Lohrey,N.C., McCauslin,C.S., Ortiz,M., Cowan,K., and Spence,S.E. (1999). Redirected

. S. A. 96, 8855-8860.

iri-

Soifer,H.S. and Kasahara,N. (2004). Retrotransposon-adenovirus hybrid vectors: efficient delivery and stable

Sonab .M., Ulasov,I.V., and Lesniak,M.S. (2006). Conditionally replicative adenoviral vectors for malignant glioma. Rev. Med. Virol. 16, 99-115.

Song,S.U., Shin,S.H., Kim,S.K., Choi,G.S., Kim,W.C., Lee,M.H., Kim,S.J., Kim,I.H., Choi,M.S., Hong,Y.J., and

Strayer,D.S., Cordelier,P., Kondo,R., Liu,B., Matskevich,A.A., McKee,H.J., Nichols,C.N., Mitchell,C.B., Geverd,D.A., f

erapy vectors and what they have to offer. Curr. Gene Ther. 5, 151-165.

ogy. J. Neuropathol. Exp. Neurol. 59, 561-574.

Tami, aboga,O. (2000). Presentation of antigenic sites from foot-and-mouth disease virus on the surface of baculovirus and in the membrane of infected cells. Arch. Virol. 145, 1815-1828.

Tani,Hitro and in vivo gene delivery by recombinant

baculoviruses. J. Virol. 77, 9799-9808.

Tani,H wa,Y., Watanabe,R., Mochizuki,R., Moriishi,K., and Matsuura,Y. (2003b). In vitro and in vivo gene delivery by recombinant

Tani,H., Nishijima,M., Ushijima,H., Miyamura,T., and Matsuura,Y. (2001). Characterization of cell-surface

Tao,N., Gao,G.P., Parr,M., Johnston,J., Baradet,T., Wilson,J.M., Barsoum,J., and Fawell,S.E. (2001). Sequestration of

05). of the International Committee on Taxonomy of

Viruses, C.M.Fauquet, M.A.Mayo, J.Maniloff, U.Desselberger, and L.A.Ball, eds. (London: Elsevier), pp. 177-

Thorn ton,T., and Kirn,D. (2005). Oncolytic virotherapy: approaches to tumor targeting and enhancing antitumor effects. Semin. Oncol. 32, 537-548.

infection of directly biotinylated recombinant adenovirus vectors through cell surface receptors and antigens. Proc. Natl. Acad. Sci. U

Smith,P.G., Oakley,F., Fernandez,M., Mann,D.A., Lemoine,N.R., and Whitehouse,A. (2005). Herpesvirus saimbased vector biodistribution using noninvasive optical imaging. Gene Ther. 12, 1465-1476.

integration of transgenes via a two-stage mechanism. Curr. Gene Ther. 4, 373-384.

end,A

Lee,K.H. (2003). Effective transduction of osteogenic sarcoma cells by a baculovirus vector. J. Gen. Virol. 84, 697-703.

Spergel,D.J., Kruth,U., Shimshek,D.R., Sprengel,R., and Seeburg,P.H. (2001). Using reporter genes to label selected neuronal populations in transgenic mice for gene promoter, anatomical, and physiological studies. Prog. Neurobiol. 63, 673-686.

Steiniz,F. (1898). Ueber das Verhalten phosphorhaltiger Eiweiss-körper im Stoffwechsel. Arch. Ger. Physiol. 72, 75-104.

White,M.K., and Strayer,M.S. (2005). What they are, how they work and why they do what they do? The story oSV40-derived gene th

Strazielle,N. and Ghersi-Egea,J.F. (2000). Choroid plexus in the central nervous system: biology and physiopathol

C., Farber,M., Palma,E.L., and T

., Limn,C.K., Yap,C.C., Onishi,M., Nozaki,M., Nishimune,Y., Okahashi,N., Kitagawa,Y., Watanabe,R., Mochizuki,R., Moriishi,K., and Matsuura,Y. (2003a). In v

., Limn,C.K., Yap,C.C., Onishi,M., Nozaki,M., Nishimune,Y., Okahashi,N., Kitaga

baculoviruses. J. Virol. 77, 9799-9808.

determinants important for baculovirus infection. Virology 279, 343-353.

adenoviral vector by Kupffer cells leads to a nonlinear dose response of transduction in liver. Mol. Ther. 3, 28-35.

Theilmann,D.A., Blissard,G.W., Bonning,B., Jehle,J., O'Reilly,D.R., Rohrman,G.F., Thiem,S.M., and Vlak,J.M. (20Family Baculoviridae. In Virus Taxonomy: Eighth Report

185.

e,S.H., Hermis

83

Tjuvajev,J.G., Chen,S.H., Joshi,A., Joshi,R., Guo,Z.S., Balatoni,J., Ballon,D., Koutcher,J., Finn,R., Woo,S.L., and Blasberg,R.G. (1999). Imaging adenoviral-mediated herpes virus thymidine kinase gene transfer and expression in vivo. Cancer Res. 59, 5186-5193.

Toivo g roscopy. Biol. Chem. 383, 1941-1946.

r. 4, 357-372.

talloproteinase-1 decreases restenosis after intravascular gene transfer. Mol. Ther. 6, 306-312.

Yla-hymidine kinase gene therapy in BT4C rat

glioma model. Cancer Gene Ther. 9, 917-924.

Ugai,H rata,T., Kimura,M., Pan,J., Obata,Y., Hamada,H., and Yokoyama,K.K. (2005). Purification of infectious adenovirus in

her. 15, 203-210.

20-832.

Volpe unant,P., von der,M.H., Herrmann,A., Kochanek,S., and Lochmuller,H. (2003). Antibody-mediated targeting of an adenovirus vector modified to contain a synthetic

Walker,R.C., Purnell,G.L., Jones-Jackson,L.B., Thomas,K.L., Brito,J.A., and Ferris,E.J. (2004). Introduction to PET

Wang he diphtheria toxin a gene for malignant glioma therapy. Cancer Res. 66, 5798-5806.

Wangcontaining an astrocyte-specific promoter. Gene Ther.

Wang transfer for treatment of hemophilia. Curr. Gene Ther. 5, 349-360.

Watsoith VSV, Ebola, Mokola, LCMV, or MuLV envelope proteins.

Mol. Ther. 5, 528-537.

Watso ectors pseudotyped with VSV, Ebola, Mokola, LCMV, or MuLV envelope proteins.

Mol. Ther. 5, 528-537.

la,J., Ojala,K., Michel,P.O., Vuento,M., and Oker-Blom,C. (2002). Properties of baculovirus particles displayinGFP analyzed by fluorescence correlation spect

Tomanin,R. and Scarpa,M. (2004). Why do we need new gene therapy viral vectors? Characteristics, limitations and future perspectives of viral vector transduction. Curr. Gene The

Turunen,M.P., Puhakka,H.L., Koponen,J.K., Hiltunen,M.O., Rutanen,J., Leppanen,O., Turunen,A.M., Narvanen,A., Newby,A.C., Baker,A.H., and Yla-Herttuala,S. (2002). Peptide-retargeted adenovirus encoding a tissue inhibitor of me

Tyynela,K., Sandmair,A.M., Turunen,M., Vanninen,R., Vainio,P., Kauppinen,R., Johansson,R., Vapalahti,M., and Herttuala,S. (2002). Adenovirus-mediated herpes simplex virus t

., Yamasaki,T., Hirose,M., Inabe,K., Kujime,Y., Terashima,M., Liu,B., Tang,H., Zhao,M., Mu

two hours by ultracentrifugation and tangential flow filtration. Biochem. Biophys. Res. Commun. 331, 1053-1060.

Untergasser,A. and Protzer,U. (2004). Hepatitis B virus-based vectors allow the elimination of viral gene expressionand the insertion of foreign promoters. Hum. Gene T

van Loo,N.D., Fortunati,E., Ehlert,E., Rabelink,M., Grosveld,F., and Scholte,B.J. (2001). Baculovirus infection of nondividing mammalian cells: mechanisms of entry and nuclear transport of capsids. J. Virol. 75, 961-970.

Volkman,L.E. and Goldsmith,P.A. (1984). Budded Autographa californica NPV 64K protein: Further biochemical analysis and effects of postimmunoprecipitation sample preparation conditions. Virology 139, 295.

Volkman,L.E., Summers,M.D., and Hsieh,C.H. (1976). Occluded and nonoccluded nuclear polyhedrosis virus grown in Trichoplusia ni: comparative neutralization comparative infectivity, and in vitro growth studies. J. Virol. 19, 8

rs,C., Thirion,C., Biermann,V., Hussmann,S., Kewes,H., D

immunoglobulin g-binding domain in the capsid. J. Virol. 77, 2093-2104.

imaging with emphasis on biomedical research. Neurotoxicology 25, 533-542.

,C.Y., Li,F., Yang,Y., Guo,H.Y., Wu,C.X., and Wang,S. (2006). Recombinant baculovirus containing t

,C.Y. and Wang,S. (2006). Astrocytic expression of transgene in the rat brain mediated by baculovirus vectors

,L. and Herzog,R.W. (2005). AAV-mediated gene

n,D.J., Kobinger,G.P., Passini,M.A., Wilson,J.M., and Wolfe,J.H. (2002a). Targeted transduction patterns in the mouse brain by lentivirus vectors pseudotyped w

n,D.J., Kobinger,G.P., Passini,M.A., Wilson,J.M., and Wolfe,J.H. (2002b). Targeted transduction patterns in themouse brain by lentivirus v

84

Watson,D.J., Passini,M.A., and Wolfe,J.H. (2005). Transduction of the choroid plexus and ependyma in neonatal mobrain by vesicular stomatitis virus glycoprotein-pseudotyped lentivirus and adeno-associated virus type 5 vectors.Hum. Gene Ther. 1

use

6, 49-56.

Weissleder,R., Moore,A., Mahmood,U., Bhorade,R., Benveniste,H., Chiocca,E.A., and Basilion,J.P. (2000). In vivo

Weissleder,R., Simonova,M., Bogdanova,A., Bredow,S., Enochs,W.S., and Bogdanov,A., Jr. (1997). MR imaging and

Wells,D.J. (2004). Gene therapy progress and prospects: electroporation and other physical methods. Gene Ther. 11,

embly

ta 5

Wilchek,M. and Bayer,E.A. (1990). Introduction to avidin-biotin technology. Methods Enzymol. 184:5-13, 5-13.

Wilch ng

urr.

uring Baculovirus infection. In The Baculoviruses, L.K.Miller, ed. (New York: Plenum Press), pp. 61-107.

Winte

8, 2270-2274.

tosis of

7, 1086-1091.

Wood using lymphoma. Nature 440, 1123.

Work,

Wu,X. and Burgess,S.M. (2004). Integration target site selection for retroviruses and transposable elements. Cell Mol.

Wu,X., Li,Y., Crise,B., and Burgess,S.M. (2003). Transcription start regions in the human genome are favored targets

Xiong host animal cells. Science 243, 1188-1191.

Weissleder,R. and Mahmood,U. (2001). Molecular imaging. Radiology 219, 316-333.

magnetic resonance imaging of transgene expression. Nat. Med 6, 351-355.

scintigraphy of gene expression through melanin induction. Radiology 204, 425-429.

1363-1369.

Whitt,M.A., Buonocore,L., Prehaud,C., and Rose,J.K. (1991). Membrane fusion activity, oligomerization, and assof the rabies virus glycoprotein. Virology 185, 681-688.

Wickham,T.J., Mathias,P., Cheresh,D.A., and Nemerow,G.R. (1993). Integrins alpha v beta 3 and alpha v bepromote adenovirus internalization but not virus attachment. Cell 73, 309-319.

ek,M. and Bayer,E.A. (1999). Foreword and introduction to the book (strept)avidin-biotin system. Biomol E16, 1-4.

Wildner,O. (2003). Comparison of replication-selective, oncolytic viruses for the treatment of human cancers. COpin. Mol. Ther. 5, 351-361.

Williams,G.V. and Faulkner,P. (1997). Cytological Changes and Viral Morphogenesis d

r,P.M., Morawski,A.M., Caruthers,S.D., Fuhrhop,R.W., Zhang,H., Williams,T.A., Allen,J.S., Lacy,E.K., Robertson,J.D., Lanza,G.M., and Wickline,S.A. (2003). Molecular imaging of angiogenesis in early-stage atherosclerosis with alpha(v)beta3-integrin-targeted nanoparticles. Circulation 10

Wojda,U., Goldsmith,P., and Miller,J.L. (1999). Surface membrane biotinylation efficiently mediates the endocyavidin bioconjugates into nucleated cells. Bioconjug. Chem. 10, 1044-1050.

Wolff,J.E., Sajedi,M., Brant,R., Coppes,M.J., and Egeler,R.M. (2002). Choroid plexus tumours. Br. J. Cancer 8

s,N.B., Bottero,V., Schmidt,M., Von,K.C., and Verma,I.M. (2006). Gene therapy: therapeutic gene ca

L.M., Nicklin,S.A., Brain,N.J., Dishart,K.L., Von Seggern,D.J., Hallek,M., Buning,H., and Baker,A.H. (2004).Development of efficient viral vectors selective for vascular smooth muscle cells. Mol. Ther. 9, 198-208.

Life Sci. 61, 2588-2596.

for MLV integration. Science 300, 1749-1751.

,C., Levis,R., Shen,P., Schlesinger,S., Rice,C.M., and Huang,H.V. (1989). Sindbis virus: an efficient, broadrange vector for gene expression in

Xu,Z.L., Mizuguchi,H., Mayumi,T., and Hayakawa,T. (2003). Regulated gene expression from adenovirus vectors: a systematic comparison of various inducible systems. Gene 309, 145-151.

85

Yama

Yang,X. and Atalar,E. (2006). MRI-guided gene therapy. FEBS Lett. 580, 2958-2961.

Yap,J. , and Townsend,D.W. (2004). Image-guided cancer therapy using PET/CT. Cancer J. 10, 221-233.

Ylä-H701.

Ylä-H iltunen,T., Sisto,T., and Nikkari,T. (1995). Transfer of 15-lipoxygenase gene into rabbit iliac arteries results in the appearance of oxidation-specific lipid-protein adducts characteristic of

Yolcu,E.S., Askenasy,N., Singh,N.P., Cherradi,S.E., and Shirwan,H. (2002). Cell membrane modification for rapid

., gene gun in midgestational mouse fetuses. J.

Pediatr. Surg. 39, 81-84.

Youil, Casimiro,D. (2002). Hexon gene switch strategy for the generation of chimeric recombinant adenovirus. Hum. Gene Ther. 13, 311-320.

Young

Yu,Y. orea GFP (ruc-gfp) fusion gene construct permits real-time detection of promoter activation by exogenously administered mifepristone in vivo. Mol. Genet. Genomics 268,

Yun,C.O., Cho,E.A., Song,J.J., Kang,D.B., Kim,E., Sohn,J.H., and Kim,J.H. (2003). dl-VSVG-LacZ, a vesicular

14, 1643-1652.

Zaiss,A.K. and Muruve,D.A. (2005). Immune responses to adeno-associated virus vectors. Curr. Gene Ther. 5, 323-331.

Zhong ar conjugates. A novel, high transduction efficiency, potentially safety-improved, gene transfer system. J. Biol. Chem. 276, 24601-24607.

Zinn,K ouglas,J.T., Smyth,C.A., Liu,H.G., Wu,Q., Krasnykh,V.N., Mountz,J.D., Curiel,D.T., and Mountz,J.M. (1998). Imaging and tissue biodistribution of 99mTc-labeled adenovirus knob (serotype 5). Gene Ther. 5, 798-

n nonhuman primate muscle. J Virol. 75, 5222-5229.

naka,R. (2004). Alphavirus vectors for cancer gene therapy (review). Int. J. Oncol. 24, 919-923.

T., Carney,J.P., Hall,N.C.

erttuala,S. and Alitalo,K. (2003). Gene transfer as a tool to induce therapeutic vascular growth. Nat. Med. 9, 694-

erttuala,S., Luoma,J., Viita,H., H

oxidized low density lipoprotein. J. Clin. Invest. 95, 2692-2698.

display of proteins as a novel means of immunomodulation: FasL-decorated cells prevent islet graft rejection. Immunity. 17, 795-808.

Yoshizawa,J., Li,X.K., Fujino,M., Kimura,H., Mizuno,R., Hara,A., Ashizuka,S., Kanai,M., Kuwashima,N., Kurobe,Mand Yamazaki,Y. (2004). Successful in utero gene transfer using a

R., Toner,T.J., Su,Q., Chen,M., Tang,A., Bett,A.J., and

,B. and Heath,J.W. (2000). Wheater's Functional Histology. (Oxford: Harcourt Publishers).

A. and Szalay,A.A. (2002). A Renilla luciferase-Aequ

169-178.

stomatitis virus glycoprotein epitope-incorporated adenovirus, exhibits marked enhancement in gene transductionefficiency. Hum. Gene Ther.

Zachary,I. (2005). Neuroprotective role of vascular endothelial growth factor: signalling mechanisms, biological function, and therapeutic potential. Neurosignals. 14, 207-221.

,Q., Kolls,J.K., and Schwarzenberger,P. (2001). Retrovirus molecul

.R., D

808.

Zoltick,P.W., Chirmule,N., Schnell,M.A., Gao,G.P., Hughes,J.V., and Wilson,J.M. (2001). Biology of e1-deleted adenovirus vectors i

86