Upload
dangkhanh
View
217
Download
3
Embed Size (px)
Citation preview
BACTERIOCINS: UNIQUE APPROACHES FOR THE
CHARACTERIZATION OF PEPTIDE
ANTIMICROBIALS IN LACTIC ACID BACTERIA
By
SUNITA (Susan) MACWANA
Master of Science in Medical Microbiology
Kasturba Medical College
Manipal, India
1998
Submitted to the Faculty of the Graduate College of the
Oklahoma State University in partial fulfillment of
the requirements for the Degree of
DOCTOR OF PHILOSOPHY May, 2007
ii
BACTERIOCINS: UNIQUE APPROACHES FOR THE
CHARACTERIZATION OF PEPTIDE
ANTIMICROBIALS IN LACTIC ACID BACTERIA
Dissertation Approved:
Dr. Peter Muriana
Dissertation Advisor
Dr. Stanley Gilliland
Dr. William McGlynn
Dr. Christina DeWitt
Dr. A. Gordon Emslie Dean of the Graduate College
iii
ACKNOWLEDGMENT
I wish to express my sincere appreciation to my advisor, Dr. Peter Muriana for his
supervision, optimism and guidance which has enabled me to be an independent
researcher. My extended appreciation to my committee members, Dr. Gilliland, Dr.
McGlynn and Dr. DeWitt for serving on my graduate committee. Thank You for your
support, suggestion, time and encouragement.
I would also like to thank my parents, John and Victoria Macwana, for their love,
encouragement, understanding, and continued support throughout my life. The
foundation of family is what had given me solid ground to grow into the person I am
today. A million thank you’s to my sisters Selina, Susan and Susannah for their constant
support, friendship, love and prayers which have brought me thus far. I would also like to
thank my fiancé Paul Kurias, for his patience.
My gratitude extends to the most positive person, Sumit Punj who has seen me
through my research here at Oklahoma State University. In addition, I would like to
thank all the graduate students in the Department of Microbiology and Molecular
Genetics and the Food and Agricultural Product Center, Oklahoma State University for
their support and friendship.
iv
To all my friends and co-workers, I greatly appreciate all your help, advice,
support, and most importantly your friendships.
Lastly, I would like to thank all the faculty and staff in the Food and Agricultural
Product Center for their accommodating nature and friendliness. I want to thank the
department for supporting me financially throughout my study here at Oklahoma State
University.
v
TABLE OF CONTENTS
Chapter Page
I. INTRODUCTION TO LITERATURE REVIEW.............................................. 1
Historical background.................................................................................... 1
Inhibitory properties of bacteria used in food manufacture/fermentation ..... 2
Food preservation........................................................................................... 4
II. REVIEW OF LITERATURE ............................................................................. 6
Characteristics of Bacteriocins (from lactic acid bacteria) ............................ 6
General nature of bacteriocins ................................................................. 6
Inhibitory spectrum.................................................................................. 7
Bactericidal action ................................................................................... 8
Classification of bacteriocins................................................................... 8
Genetic organization and regulation of bacteriocin of lactic acid bacteria.... 9
Organization of gene clusters: genetics and biosynthesis........................ 9
Biosynthetic pathway............................................................................. 11
Post-translational modification, activation and transport ...................... 12
Regulation of biosynthesis..................................................................... 13
Producer immunity................................................................................. 14
Mode of action ............................................................................................. 15
Antimicrobial spectrum ......................................................................... 15
Primary mode of action.......................................................................... 16
Secondary mode of action...................................................................... 17
Passage across the cell wall ................................................................... 18
Importance of three dimensional structures........................................... 19
vi
Detection of bacteriocins produced by lactic acid bacteria (LAB).............. 20
Traditional methods ............................................................................... 20
Agar diffusion method....................................................................... 21
Mass spectrometry ............................................................................. 21
Hybridization method ........................................................................ 22
Flow cell cytometry ........................................................................... 22
PCR detection methods.......................................................................... 23
SYBR Green method ......................................................................... 24
TaqMan® probes ............................................................................... 25
Molecular beacons ............................................................................. 26
AmplifluorTM uniprimerTM real-time PCR......................................... 26
Bacteriocin resistance .................................................................................. 27
Food applications ......................................................................................... 29
Biopreservation of meat products .......................................................... 30
Biopreservation of dairy products.......................................................... 31
Biopreservation of seafood products ..................................................... 32
Hurdle technology to enhance food safety............................................. 33
Bacteriocins in packaging films............................................................. 34
Conclusion ................................................................................................... 36
References.................................................................................................... 38
III. SEQUENCE ANALYSIS OF THE CURVATICIN FS47 BACTERIOCIN
OPERON OF LACTOBACILLUS CURVATUS FS47................................... 52
Introduction ................................................................................................. 53
Materials and Methods ................................................................................ 55
Bacterial strains, plasmids, and media. .................................................. 55
DNA isolation and manipulation............................................................ 55
Genomic clones, sequencing and PCR walking. .................................... 55
Vectorette PCR....................................................................................... 56
Differentiation of L. sakei and L. curvatus............................................. 56
Sequence analysis. .................................................................................. 57
Results and Discussion................................................................................ 58
vii
Detection of the curvaticin FS47 bacteriocin operon. ............................ 58
Sequencing of the cloned fragments....................................................... 58
Identifying the ORF’s related to the curvaticin FS47 operon. ............... 59
Comparing the curvaticin FS47 bacteriocin operon with other bacteriocin operons................................................................................. 60
Identifying the bacteriocin producing species. ....................................... 60
Conclusion................................................................................................... 61
References ................................................................................................... 62
IV. USE OF ACQUIRED SPONTANEOUS RESISTANCE TO SCREEN
BACTERIOCINS OF LACTIC ACID BACTERIA INTO FUNCTIONAL INHIBITORY GROUPS .................................................................................. 69
Introduction ................................................................................................. 70
Materials and Methods ................................................................................ 72
Bacterial growth conditions.................................................................... 72
Bacteriocin detection and assay.............................................................. 72
Isolation of bacteriocin-producing Lactic Acid Bacteria from foods..... 73
Identification of bacteriocin-producing Lactic Acid Bacteria. ............... 74
Preparation of bacteriocin culture supernatants. .................................... 74
Derivation of spontaneous bacteriocin-resistant strains of L. monocytogenes. ...................................................................................... 75
Bacteriocin inhibitory assay in culture broth.......................................... 75
Statistical analysis .................................................................................. 76
Results and Discussion................................................................................ 77
Bacteriocin resistance and cross-resistance............................................ 77
Functional classification into ‘resistance groups’ or ‘classes’. .............. 78
Use of spontaneously-derived bacteriocin-resistant isolates as indicators for different resistance classes of bacteriocins. ..................... 79
Anti-listerial bacteriocins and ‘resistance classes’ of Lactic Acid Bacteria isolated from foods................................................................... 80
Inhibitory assay demonstrating the practical functionality of different resistance-class groupings. ..................................................................... 81
References ................................................................................................... 84
viii
V. USE OF PCR ARRAYS TO QUICKLY IDENTIFY BACTERIOCIN RELATED SEQUENCES IN BACTERIOCINOGENIC LACTIC ACID BACTERIA……………………………………………………………………91
Introduction ................................................................................................. 92
Materials and Methods ................................................................................ 94
Bacterial strains and growth conditions ................................................. 94
Isolation of bacteriocin-producing Lactic Acid Bacteria from foods..... 94
Identification of bacteriocin-producing Lactic Acid bacteria................. 95
PCR array for bacteriocin structural genes............................................. 95
Sequence analysis ................................................................................... 96
Results and Discussion................................................................................ 98
Conclusion................................................................................................. 103
References ................................................................................................. 104
ix
LIST OF TABLES
Table Page
1. Sequences of oligonucleotide primers used to differentiate L.curvatus and L. sakei. ..................................................................................................................... 64
2. Sequences of oligonucleotide primers used in the Vectorette PCR Approach..... 64
3. Sensitivity reactions of bacteriocins spotted on various indicator lawns of L. monocytogenes, including those for which spontaneous bacteriocin resistance
was acquired.......................................................................................................... 87
4. Lactic acid bacteria (LAB) and Bac+ LAB isolated from retail foods.................. 88
5. Bacterial strains used in this study...................................................................... 107
6. Primers used in this study ................................................................................... 108
x
LIST OF FIGURES
Figure Page
1. Schematic of restriction map of L.curvatus FS47 chromosomal DNA. ............... 65
2. Representation of the major open reading frames (ORFs) related to the curvaticin FS47 bacteriocin operon. ..................................................................... 66
3. Comparison of the curvaticin FS47 operon with other known bacteriocin operons. ................................................................................................................. 67
4. PCR amplification of species-specific DNA targets to help identify the bacteriocin-producing strain FS47........................................................................ 68
5. Inhibitory zones of filter-sterilized, pH-adjusted (pH 7.0) bacteriocin extracts on indicator lawns of L. monocytogenes 39-2 (wild-type) and bacteriocin- resistant derivatives………………………………………………………………89
6. Liquid inhibition assay of inidividual bacteriocins or in combination against L. monocytogenes 39-2.............................................................................................. 90
7. Primer array real-time PCR of Pediococcus acidilactici Bac3 (pediocin Bac3) 109
8. Sequence alignment of 3 different bacteriocin sequences obtained from amplification of DNA from Lb. sakei JD against the bacteriocin primer array.. 110
9. Bacteriocin PCR array amplification and sequence analysis of two Bac+ strains of Lc. lactis in comparison with the original bacteriocin gene sequence from which the primers were derived. ................................................................ 111
10. Bacteriocin array real-time PCR and sequence identify of lacticin FS92 produced by of Lc. lactis FS92. .......................................................................... 112
xi
ABBREVIATIONS AND SYMBOLS
1. LAB ………………………………………………………….Lactic Acid Bacteria
2. FDA ……………………………………………….Food and Drug Administration
3. Tm …………………………………………………………...Melting Temperature
4. SG…………………………………………………………………… SYBR Green
5. GRAS……………………………………………….. Generally recognized as safe
6. CFU………………………………………………………….Colony forming units
7. MAP……………………………………………. Modified atmospheric packaging
8. µl ………………………………………………………………………..microliters
9. µg ……………………………………………………………………….microgram
10. CHL ……………………………………………….Carbohydrate media for lactics
11. AU …………………………………………………………………Arbitrary units
12. W-T ……………………………………………………………………Wild type
1
CHAPTER I
INTRODUCTION TO LITERATURE REVIEW
Historical background
Initially, most of the significant progress in bacteriocin research stemmed from
investigations of the colicins, the prototype bacteriocins produced by various members of
the family Enterobacteriaceae, and this resulted in considerable knowledge of the genetic
basis, domain structure, mode of formation, and killing action of these molecules
(Pugsley, 1984). However, there has now been a remarkable amount of research activity
centered upon the bacteriocin-like activities of Gram-positive bacteria, particularly lactic
acid bacteria (LAB). Many of these are food-grade organisms that are already widely
used in the food industry but now offer the further prospect of food preservative
applications to inhibit bacterial pathogens and spoilage microorganisms.
It was Pasteur together with Joubert who, first systematically recorded an
observation of antagonistic interactions between bacteria. In summarizing their findings
that ‘‘common bacteria’’ (probably Escherichia coli) could interfere with the growth of
co-inoculated anthrax bacilli, either in urine (used as a culture medium) or in
experimentally infected animals. Since, in most cases the observations were of a clinical
rather than experimental nature, there is no information on the isolation and
characterization of any inhibitory chemical substance.
2
The first clear documentation of the nature of an antibiotic agent produced by E.
coli was provided by Gratia, who demonstrated in 1925 that strain V (virulent in
experimental infections), produced in liquid media, a dialyzable and heat-stable substance
(later referred to as colicin V) that inhibited the growth of E. coli even with a high
dilution. Later a series of different colicins were discovered over a period of time.
The more general term ‘‘bacteriocin’’ was coined by Jacob et al. in 1953.
Bacteriocins were specifically defined as protein inhibitors or ‘antibiotics’ of the colicin
type, i.e., molecules characterized by lethality after biosynthesis, predominant
intraspecies killing activity, and adsorption to specific receptors on the surface of
bacteriocin sensitive cells.
In 1976, a review of the bacteriocins of Gram-positive bacteria opened with the
remark that most of the definitive investigations in the field of bacteriocins had centered
on those of Gram-negative bacteria but predicted an increase in research emphasis on
bacteriocins of Gram-positive lactic acid bacteria (Tagg et al. 1976). It seems that much
of the renewed interest in these substances is a direct response to the perceived potential
practical application of these agents, either for the preservation of foods or the prevention
and treatment of bacterial infections.
Inhibitory properties of bacteria used in food manufacture/fermentation
Fermentation processes rely on natural or modified environments to select against
spoilage and pathogenic microorganisms and to promote the growth of desirable
microorganisms, either those naturally occurring or intentionally added. Most
3
fermentations progress through a sequence of microbial species, where the desirable
species usually predominates and imparts the characteristic identity attributed to the
particular food or beverage. Examples of disruptive activities that can obstruct the
fermentation process and compromise the product are phage infection of dairy starters,
growth of lactobacilli in wines and growth of staphylococci in fermented meats. The use
of bacteriocins as fermentation aids has been studied and presents a unique feature, i.e.,
the desirable microorganisms used in fermentation can also be the source of bacteriocins.
One of the first applications of bacteriocins was using nisin-producing starter
cultures in cheese making. Several observations came to light that did not encourage their
further development and application. Nisin-producing starters were effective in
controlling Clostridia spoilage; however, it was observed that cheese made with these
starters was not as high a quality as compared to cheese made with regular starters. Nisin-
producing starter cultures were also sensitive to phage attack (Hurst, 1981). A second
approach was using nisin resistant starters with good properties. The nisin resistant
starters were observed to possess some significant differences in terms of starter
performance and stability when compared to the regular parent starter cultures (Lipinska,
1977).
Foegeding et al. (1992) used a strain of Pediococcus acidilactici that produced
pediocin A1 as a lactic starter for the production of dry fermented sausage. The objective
was to evaluate the ability of this strain to inhibit intentionally introduced Listeria
monocytogenes. It was concluded that the lactic fermentation by itself was sufficient to
control L. monocytogenes if enough acid was produced. However, pediocin production
4
was shown to provide a safeguard against L. monocytogenes if acid production was
insufficient.
The use of bacteriocins and bacteriocinogenic LAB to control microbial
populations in food and beverage fermentations has been demonstrated with various
commodities. Certain problems or hurdles that may emerge are the appearance of
bacteriocin-resistant populations of spoilage LAB, increased likelihood of phage
infection because of the dependence on one or two starters instead of a heterogeneous
mixture of LAB, and inactivation of inhibitory properties by interaction with product
components.
Food preservation
Although nisin is the only bacteriocin in the United States approved as a direct
food additive, there is a great deal of interest in other bacteriocins that have similar
properties and exhibit broad spectrum inhibitory activity. Bacteriocins produced by
fermentation could be purified and added to foods as pure chemicals to inhibit food
pathogens and spoilage organisms only after obtaining approval as a direct food additive
by the FDA. Bacteriocins have several characteristics that make them ideal food
preservatives. Many bacteriocins can resist high temperature used in food processing and
can remain functional over a broad pH range. Bacteriocins can be digested by many
enzymes in the human gastrointestinal tract just like other proteins in the diet and not
become an issue for beneficial gut microflora. Bacteriocins are non-toxic, odorless,
colorless, and tasteless. Finally, bacteriocins are considered by consumers to be more
natural than chemical preservatives.
5
The efficacy of using bacteriocins as food preservatives will need to be
determined for each food system. Solubility, stability, sensory impact, heat, pH tolerance,
and types and numbers of organisms inhibited would need to be evaluated for each
bacteriocin in each food product category under a variety of storage conditions.
6
CHAPTER II
REVIEW OF LITERATURE
Characteristics of Bacteriocins (from lactic acid bacteria)
General nature of bacteriocins
Many species of LAB (Lactococcus, Lactobacillus, Pediococcus, Leuconostoc)
used for the production of fermented foods have shown to be strongly antagonistic
towards other bacteria. Bacteriocins can be small proteins, with molecular weights of a
few thousand Daltons (Da), or complex structures containing subunits in excess of 106
Da, with associated carbohydrate or lipid moieties. The heterogeneity of bacteriocins is
reflected in the differences in conditions for activity, mode of action, production, and
genetic basis (chromosomal or plasmid). Bacteriocin producing strains have evolved
mechanisms of immunity to the inhibitory action of their own bacteriocins, and immunity
genes are usually linked to production genes.
Nisin is produced by some strains of Lactococcus lactis and has been used as a
food preservative for over 30 years. Nisin is the most thoroughly characterized
bacteriocin produced by LAB. It has been used to inhibit spore-forming organisms in
cheese spreads, canned foods, bakery products and pasteurized milk. It is mainly
7
effective on Gram Positive pathogens. Nisin is a pentacyclic peptide containing three
unusual amino acids and has a molecular weight of 3,510 Da. It is inactivated by
chymotrypsin, but resistant to treatment with pronase, trypsin, and heat (100°C) under
acidic conditions.
Inhibitory spectrum
Though some bacteriocin-like substances produced by lactococci and lactobacilli
do appear to have a relatively narrow inhibitory spectra, most are much broadly active
than the colicins. They tend to be active against a wide range of Gram-positive bacteria,
and some have also been reported to inhibit Gram-negative species (Stevens et al. 1991).
The degree of activity of bacteriocin-like agents against sensitive bacteria can sometimes
be substantially increased by testing them either at particular pH values (Zajdel et al.
1985) or in the presence of chemical agents that weaken cell wall integrity
(Kalchayanand et al. 1992).
Although the specific ‘‘immunity’’ (or producer strain self-protection) of Gram-
positive bacteriocin-producing cells to their homologous bacteriocin is weak, genes
encoding membrane associated molecules that confer a degree of specific protection upon
the producer strain have been found in some Gram-positive bacteria (Klaenhammer,
1993). In the case of nisin (Nissen-Meyer et al. 1993), it has been found that the presence
of the bacteriocin structural gene as well as the immunity gene is required for expression
of immunity. Immunity to lactococcin A has been shown to function at the membrane
level via a mechanism that presumably blocks access to a putative receptor molecule,
prevents its insertion, or inactivates the bacteriocin (Van Belkum et al. 1991).
8
Bactericidal action
It appears that two major classes of killing actions are displayed by colicins: some
form ion channels in the cytoplasmic membrane, and others exhibit nuclease activity
upon gaining entry to a sensitive cell (Pugsley, 1984). However, the low-molecular-
weight bacteriocins of Gram-positive bacteria generally appear to be membrane active
(Bruno and Montville 1993; Chikindas et al. 1993). The lantibiotic subgroup of
bacteriocins tends to differ from the other groups in the voltage dependence of their
membrane insertion (Garcera et al. 1993; Schuller et al. 1989). Poration complexes
(Klaenhammer, 1993; Nissen-Meyer et al. 1992) have been proposed to be formed
between one, two, or possibly even more species of amphipathic peptides, resulting in ion
leakage, loss of proton motive force, and ultimately cell death.
Classification of bacteriocins
Most of the bacteriocins from LAB are cationic, hydrophobic, or amphiphilic
molecules composed of 20 to 60 amino acid residues (Nes and Holo 2000). These
bacteriocins are commonly classified into 3 groups that also include bacteriocins from
other Gram-positive bacteria (Klaenhammer, 1993; Nes et al. 1996).
Lantibiotics (from lanthionine-containing antibiotic) are small (<5 kDa) peptides
containing the unusual amino acids lanthionine, α-methyllanthionine, dehydroalanine,
and dehydrobutyrine. These bacteriocins are grouped into class I bacteriocins. Class I is
further subdivided into type A and type B lantibiotics according to their chemical
structures and antimicrobial activities. Type A lantibiotics are elongated peptides with a
net positive charge that exert their activity through the formation of pores in bacterial
9
membranes. Type B lantibiotics are smaller globular peptides and have a negative, or no
net charge, and antimicrobial activity is related to the inhibition of specific enzymes.
Small (<10 kDa), heat-stable, non-lanthionine containing peptides are contained
in class II, the largest group of bacteriocins in this classification system. These peptides
are divided into 3 subgroups. Class IIa includes pediocin-like peptides having an N-
terminal consensus sequence -Tyr-Gly-Asn-Gly-Val-Xaa-Cys. This subgroup has
attracted much of the attention due to their anti-Listeria activity (Ennahar et al. 2000).
Class IIb contains bacteriocins requiring two different peptides for activity, and class IIc
contains the remaining peptides of the class, including sec-dependent secreted
bacteriocins.
The class III bacteriocins are not as well characterized. This group houses large
(>30 kDa) heat-labile proteins that are of lesser interest to food scientists. A fourth class
consisting of complex bacteriocins that require carbohydrate or lipid moieties for activity
has also been suggested by Klaenhammer (1993). However, bacteriocins in this class
have not been characterized adequately at the biochemical level and has been suggested
that the definition of this class requires additional descriptive information (Jimenez-Diaz
et al. 1993; McAuliffe et al. 2001).
Genetic organization and regulation of bacteriocin of lactic acid bacteria.
Organization of gene clusters: genetics and biosynthesis
Bacteriocins are ribosomally synthesized. The genes encoding bacteriocin
production and immunity are usually organized in operon clusters (Nes et al. 1996). For
10
linear unmodified bacteriocins, which include the plantaricins, carnobacteriocins, and
sakacins, it appears that specific inducing peptides or peptide pheromones stimulate
synthesis of bacteriocins that are usually located on the same gene cluster (Quadri et al.
1997). Bacteriocin gene clusters can be located on the chromosome as in the case of
subtilin and mersacidin (Altena et al. 2000), plasmids as in the case of divergicin A and
sakacin A (Axelsson and Holck 1995), or in transposons as in the case of nisin and
lacticin 481 (Dufour et al. 2000).
The lantibiotic biosynthesis operons generally contain genes coding for the
prepeptide (LanA - the abbreviation lan refers to homologous genes of different
lantibiotic gene clusters), enzymes responsible for modification reactions
(LanB,C/LanM), processing proteases responsible for removal of the leader peptide
(LanP), the ABC (ATP-binding cassette), super family transport proteins involved in
peptide translocation (LanT), regulatory proteins (LanR, K), and proteins involved in
producer self-protection (immunity) (LanI, FEG). This information was gathered from
studies on genetic analysis of several lantibiotics, including epidermin (Schnell et al.
1992), nisin (Buchmann et al. 1988), subtilin (Klein et al. 1992), lacticin 481 (Piard et al.
1992), and mersacidin (Altena et al. 2000).
The genetic regulation of the class II bacteriocins, lactococcins A, B, and M,
pediocin PA-1/AcH (pediocin PA-1 and AcH are the same molecule; the name of
pediocin PA-1 is more commonly used), plantaricin A and sakacin A have been studied.
Genes encoding the biosynthesis of class II bacteriocins share many similarities in their
genetic organizations, consisting of a structural gene coding for a precursor peptide,
followed immediately by a dedicated immunity gene and genes for an ABC-transporter
11
and an accessory protein. In some cases, regulatory genes have been found. The
accessory proteins are essential for the export of class II bacteriocins. No counterparts of
these accessory proteins in lantibiotics have been found (Nes et al. 1996; Sablon et al.
2000).
Biosynthetic pathway
Most bacteriocins are synthesized as a biologically inactive prepeptide carrying an
N-terminal leader peptide that is attached to the C-terminal propeptide. The biosynthetic
pathway of lantibiotics follows a general scheme: formation of the prepeptide,
modification reactions, proteolytic cleavage of the leader peptide, and the translocation of
the modified prepeptide or mature propeptide across the cytoplasmic membrane. A
typical series of events in bacteriocin production and transport include: (i) The formation
of prebacteriocin; (ii) Modification of the prebacteriocin by LanB and LanC that is
translocated through a dedicated ABC-transporter (LanT) and processed by LanP,
resulting in the release of a mature bacteriocin; (iii) The histidine protein kinase (HPK)
senses the presence of the bacteriocin and gets autophosphorylated; (iv) The phosphoryl
group (P) is subsequently transferred to the response regulator (RR); (v) The RR activates
transcription of the regulated genes; (vi) Lan FEG and LanI are associated with immunity
(Skaugen et al. 1997).
Class II bacteriocins are synthesized as a prepeptide containing a conserved N-
terminal leader and a characteristic double-glycine proteolytic processing site. Unlike the
lantibiotics, class II bacteriocins do not undergo extensive post-translational
modification. A typical series of events in bacteriocin production and transport include:
12
(i) The simultaneous production of an inducing factor (IF) along with the formation of the
prepeptide; (ii) The prepeptide is processed to remove the leader peptide concomitant
with export from the cell through a dedicated ABC-transporter and its accessory protein,
the same process occurs with the IF; (iii) The histidine protein kinase (HPK) senses the
presence of IF and gets autophosphorylated; (iv) The phosphoryl group (P) is
subsequently transferred to the response regulator (RR). The RR activates transcription of
the regulated genes (Nes et al. 1996).
Several functions of leader peptides have been proposed. They may serve as a
recognition site which directs the prepeptide towards maturation and transport proteins,
protecting the producer strain by keeping the lantibiotic in an inactive state while it is
inside the producer, and interacts with the propeptide domain to ensure a suitable
conformation essential for enzyme-substrate interaction (McAuliffe et al. 2001).
Post-translational modification, activation and transport
Ingram (1970) first proposed a two-step post-translational modification reaction
of a pre-lantibiotic leading to the formation of Lan/MeLan. Following the modification
reactions, the modified pre-lantibiotics undergo proteolytic processing to release the
leader peptide that leads to activation of the lantibiotic. The ABC-transporter contains
500 to 600 amino acids and is characterized by two membrane-associated domains. This
transports the bacteriocin across the membrane. Energy for the export process is provided
by ATP hydrolysis and likely occurs at the ATP-binding domains.
Substantial similarities exist between the leader peptides of class IIa, IIb and those
of lantibiotics. Both contain the characteristic double-glycine cleavage site (Nes et al.
13
1996). The conservation of the cleavage site strongly suggests that the mechanism of
processing and translocation of class IIa and IIb bacteriocins is very similar to that of the
lantibiotics. Class IIc bacteriocins are processed by a signal peptidase during
translocation across the cytoplasmic membrane.
Regulation of biosynthesis
The biosynthesis of lantibiotics and non-lantibiotics is usually regulated through a
well known two-component regulatory system. These regulatory systems consist of two
signal-producing proteins; a membrane bound histidine protein kinase (HPK), and a
cytoplasmic response regulator (RR) (Stock et al. 1989; Parkinson, 1993; Nes et al.
1996). In this signal transduction pathway, HPK autophosphorylates the conserved
histidine residue in its intracellular domain when it senses a certain concentration of
bacteriocins in the environment. The phosphoryl group is subsequently transferred to the
RR resulting in the intramolecular change and this activates the transcription of the
regulated genes. These regulated genes include the structural gene, the export genes, the
immunity genes, and in some cases, the regulatory genes themselves. For nisin and
subtilin, the bacteriocin molecule itself apparently acts as an external signal to
autoregulate its own biosynthesis via signal transduction (Kuipers et al. 1995). In
contrast, most class II bacteriocins produce a bacteriocin-like peptide with no
antimicrobial activity and use it as an inducing factor (IF) to activate the transcription of
the regulated genes. The IF is a small, heat-stable, cationic and hydrophobic peptide that
is first synthesized as a prepeptide with a double-glycine leader sequence. A dedicated
ABC-transporter specifically cleaves the leader peptide of IF concomitant with export of
14
the mature peptide from the cell. The secreted IF acts as an external signal that triggers
transcription of the genes involved in bacteriocins production (Nes et al. 1996).
Producer immunity
Two systems of lantibiotic immunity in the producing cell have been identified.
Protection can be mediated by immunity proteins, LanI, and dedicated ABC-transport
proteins, LanFEG, which can be encoded on multiple open-reading frames (Reis et al.
1994). These two immunity systems work synergistically to protect producing cells from
their own bacteriocin. LanI, which is most likely attached to the outside of the
cytoplasmic membrane, probably confers immunity to the producer cells by preventing
pore formation by the bacteriocin. LanFEG apparently acts by transporting bacteriocin
molecules that have inserted into the membrane back to the surrounding medium and thus
keeping the concentration of the bacteriocin in the membrane under a critical level.
For class II bacteriocins the immunity gene usually codes for a dedicated protein
that is loosely associated with the cytoplasmic membrane. Quadri et al. (1995) using
Western blot (immunoblot) analysis, indicated that the major part of the immunity protein
CbiB2 of carnobacteriocin B2 is found in the cytoplasm and that a smaller proportion is
associated with the membrane. Similarly, Abdel-Dayem et al. (1996) have demonstrated
that the majority of the immunity protein MesI of mesentericin Y105 is in the cytoplasm,
with only a small proportion detected in the membrane. The immunity protein, which is
cationic and ranges in size from 51 to 254 amino acids, provides total immunity against
the bacteriocin. Interaction of the immunity protein with the membrane appears to protect
the producer against its own bacteriocins.
15
Mode of action
Antimicrobial spectrum
The low molecular weight bacteriocins of Gram-positive bacteria demonstrate
bactericidal activity which is directed principally against certain other Gram-positive
bacteria (Tagg et al. 1976). For example, the lantibiotic nisin has been shown to be
effective against many strains of Gram-positive bacteria, including staphylococci,
streptococci, bacilli, clostridia, and mycobacteria (Hurst, 1981).
Similarly, among the non-lanthionine containing bacteriocins some, like pediocin
AcH, have a wide range of action against Gram-positive bacteria, while others, such as
lactococcin A, have a much narrower range and are effective against only a few strains of
Lactococcus lactis (De Vuyst and Vandamme 1994; Van Belkum et al. 1991). Several
other general observations may be made which apply to the antibacterial activities of the
low molecular weight bacteriocins: (i) within a given species, some strains may be
sensitive and others may be resistant to a particular bacteriocin (Hurst, 1981); (ii) a strain
that appears to be sensitive to a bacteriocin may also have some cells in the population
that are resistant to it (Hanlin et al. 1993); (iii) a strain can be sensitive to one bacteriocin
while being resistant to a similar type of bacteriocin (Hanlin et al. 1993; Yang et al.
1992); (iv) cells of a strain producing one bacteriocin can be sensitive to another
bacteriocin (Hanlin et al. 1993); (v) although the spores of a strain whose cells are
sensitive to a bacteriocin are resistant to that bacteriocin, the vegetative cells maybe
sensitive following germination (Hurst, 1981); and (vi) under normal conditions, Gram-
16
negative bacteria are not sensitive to bacteriocins produced by Gram-positive bacteria
(Hurst, 1981; Bhunia et al. 1988).
The details of the mechanism(s) by which Gram-negative bacteria and certain
Gram-positive bacteria manifest resistance to bacteriocins are generally not well
understood. However, this resistance does appear to differ from the specific immunity
displayed by a producer strain to its own bacteriocin product. The possible mechanism of
bacteriocin resistance of Gram-negative and some Gram-positive bacteria has been
suggested to be associated with the barrier properties of the outer membrane and the cell
wall (Stevens et al. 1991).
Primary mode of action
Several features of the mode of action of the non-lanthionine containing
bacteriocins of Gram-positive bacteria require further explanation: (i) the reason why, for
two sensitive strains, one undergoes lysis following treatment with a particular
bacteriocin while the other does not, is not known (Bhunia et al. 1991); (ii) for a
bacteriocin to come into contact with the cytoplasmic membrane of sensitive cells, the
molecules must first pass through the cell wall; the mechanism of this translocation
remains to be understood; and, finally, (iii) there is evidence that non-lanthionine
containing bacteriocin molecules may be adsorbed on the surface of most Gram-positive
bacterial cells, including sensitive, resistant, and producer strains; the influence of this is
not yet fully understood (Bhunia et al. 1991; Yang et al. 1992).The non-lanthionine
containing bacteriocins also appear to affect their bactericidal action by destabilizing the
17
cytoplasmic membrane of sensitive cells; however, the mechanism through which they
achieve this appears to differ somewhat from that described for the lantibiotics.
In general, it appears that the bactericidal action of the non-lanthionine containing
bacteriocins against sensitive cells is produced principally by destabilization of
membrane functions, such as energy transduction, rather than by disruption of the
structural integrity of the membrane. This effect results from the energy independent
dissipation of the proton motive force (PMF) and loss of the permeability barrier of the
cytoplasmic membrane and contrasts with the energy-dependent bactericidal action of the
lantibiotics. Both the lantibiotic and non-lanthionine containing bacteriocins seem to
affect the membrane permeability barrier by forming water-filled membrane channels or
pores, probably by a barrel-stave mechanism (Klaenhammer, 1993). In addition, prior to
the formation of pores, all of the non-lanthionine containing bacteriocins appear to
interact with membrane associated receptor proteins, again, in direct contrast to the
lantibiotic type bacteriocins which appear to have no such requirement (Schuller et al.
1989). Furthermore, producer strains harboring an immunity gene appear to produce
specific immunity proteins that prevent pore formation by the bacteriocin by an
unidentified mechanism(s). However, this might be accomplished either by shielding of
the receptor protein, by competitive interaction with the bacteriocin molecules, or by
closing or blocking the pores (Nissen-Meyer et al. 1993; Venema et al. 1993).
Secondary mode of action
In addition to their membrane pore-forming capabilities, both Pep5 and nisin have
been shown to induce autolysis in Staphylococcus. As seen with lanthionine bacteriocins
18
(nisin) it is suggested that following membrane depolarization by pore formation, since
the pores formed in the membrane are not sufficiently large to allow efflux of high
molecular weight components, there should be enhanced osmoinduced influx of water
through the pores. The resulting increase in osmotic pressure will encourage subsequent
cell lysis. Conflicting results have been reported concerning the ability of non-lanthionine
containing bacteriocins to induce lysis of sensitive cells.
Following treatment with lactococcin A, sensitive L. lactis cells and membrane
vesicles derived from these cells showed neither lysis nor other morphological alterations
when examined by electron microscopy. They suggested that the loss of barrier functions
of the membrane of sensitive cells occurs not as a result of lysis but as a result of pore
formation. Bhunia et al. (1991) have also suggested that the primary killing action of non-
lanthionine containing bacteriocins, such as pediocin AcH, is destabilization of
cytoplasmic membranes, but that cell death may activate autolytic systems and bring
about lysis in some strains.
Passage across the cell wall
The loss of viability of sensitive cells of Gram-positive bacteria following
treatment with a number of the non-lanthionine containing bacteriocins occurs very
rapidly, perhaps within one minute (Bhunia et al. 1991). Since cell death appears to occur
through destabilization of the cytoplasmic membrane, the bacteriocin molecules must
cross the cell wall before establishing contact with the membrane. However, the
mechanism(s) of bacteriocin passage through the cell wall has not yet been critically
19
studied. Simple diffusion models fail to entirely account for many of the observations
regarding the action of these bacteriocins.
Many bacteriocins have been reported to have greater bactericidal activity at low
pH. The peptides carry both positive and negative charges with a net positive charge
below pH 7. Both non-lanthionine containing bacteriocins and lantibiotic molecules are
adsorbed to the cell surfaces of Gram-positive bacteria, irrespective of their being
bacteriocin producer, nonproducer, resistant, or sensitive. A recent study of several of
these bacteriocins has shown that their degree of adsorption is pH dependent, with a
maximum at about pH 6.0 and a minimum at or below pH 2.0 (Yang et al. 1992). These
observations further support the suggestion that initial adsorption occurs through ionic
attraction between the bacteriocin molecules and the cell surface. The molecular
components on the cell surfaces of Gram-positive bacteria to which bacteriocin
molecules are adsorbed are thought to include teichoic and lipoteichoic acids (Bhunia et
al. 1991).
Therefore, it has been suggested that adsorption of bacteriocin molecules can
induce a change in cell wall barrier functions only in sensitive Gram-positive bacteria,
rendering the wall more permeable to the bacteriocin. No such change occurs following
adsorption to bacteriocin resistant cells (Kalchayanand et al. 1992; Ray, 1993).
Importance of three dimensional structures
Hydropathy plots of lactococcin A indicate that the carboxy terminus has a
hydrophobic region which is thought to form an amphiphilic membrane-spanning helix.
The bacteriocin appears to interact with receptor proteins in the cytoplasmic membrane of
20
the sensitive cells, form a helical transmembrane structure, and, probably in conjunction
with additional lactococcin A molecules which might form a water-filled barrel stave like
structure, increase the membrane permeability. Current models of pore formation by
lantibiotics and non-lantibiotics are based on structural data (Freund et al. 1991; Vogel et
al. 1993) and suggest that cationic lantibiotics are attracted to the membrane by ionic
interaction. When sufficient peptides come together, electrostatic repulsion between the
positive charges may be responsible for pushing open the transmembrane channel. It is
not yet clear when the peptides might aggregate (i.e., before or after they adopt a
transmembrane orientation), which terminus remains on the outside of the membrane or
whether insertion is bidirectional, and how many peptides represent the minimum
requirement for pore formation.
Detection of bacteriocins produced by lactic acid bacteria (LAB).
Traditional methods
The demonstration of antagonism from one strain of bacteria against another is
very common. Bacteriocins are only one category of substances produced by bacteria that
are inhibitory to other bacteria. In any ecological niche, one type of bacteria can be more
competitive than another regarding nutrient uptake or sensitivity to an environmental
factor, such as available oxygen. With such a wide range of possible inhibitory products
or conditions, it is no wonder that some bacteriocin-like activities may not be caused by
bacteriocins at all. When investigating bacteriocins synthesized by LAB, one must
always be aware of the presence of relatively high amounts of organic acids, and take
appropriate steps to determine or eliminate acidic effects.
21
Agar diffusion method
A common method for screening bacteriocin activity involves the use of agar
media contained in petri plates. Piddock (1990) has reviewed a number of these methods
for detection and measurement of bacteriocin activity. There are many variations, most of
them derivatives of the “spot-on-lawn” approach, which can involve an agar overlay. The
direct simultaneous tests are the simplest. In this approach, the bacteriocin from the
producer culture is spotted on the indicator cultures and these plates are incubated
concurrently before examination for zones of inhibition around the growth of producing
cultures. Deferred methods allow separation of the independent variables of time and
conditions of incubation for the bacteriocin-producing and indicator strains and are often
more sensitive than direct tests (Tagg et al. 1976). Kekessy and Piguet (1970) described a
procedure in which the producing and indicator strains were each grown on different
optimal media. The producing culture was spot-inoculated onto a spread plate, and after
growth, the agar mass was aseptically dislodged with a spatula from the petri dish bottom
and transferred to the lid of the dish. A soft agar overlay seeded with the indicator was
then poured over the inverted agar. Following re-incubation, bacteriocin-positive cultures
displayed a halo of clearing in the lawn around the original button of growth. This assay
minimizes the effects of acids and bacteriophages, since the bacteriocin-producing and
indicator strains are physically separated by an agar layer.
Mass spectrometry
Mass spectrometry has been adapted for the rapid detection of pediocin, nisin,
brochocins A and B, and enterocins A and B from culture supernatants by Rose et al.
22
(1999). The method is called matrix-assisted laser desorption/ionization time-of-flight
mass spectroscopy (MALDI-TOF MS) and was originally devised for the examination of
large molecules, such as biopolymers. In the protocol, a 30-s water wash of the
supernatant is intended to remove interfering compounds; however, this step of the
procedure requires improvement to eliminate the contaminating and interfering
substances found in foods that prevent accurate identification of the bacteriocins.
Hybridization method
Rodriguez et al. (1998) detected enterocin AS-48 from Enterococci isolated from
milk and dairy products using dot-blot and colony hybridization. Genes encoding for the
synthesis of AS-48 have been sequenced and a Polymerase Chain Reaction (PCR)
technique developed for rapid detection of these genes in isolated strains. Colony
hybridization allowed for a more rapid technique in which cultures are spotted on MRS
agar, incubated, and colony growth is transferred to membranes for lysis with subsequent
hybridization using a DNA probe.
Flow cell cytometry
In a flow cell, Mugochi et al. (2001) developed a rapid and sensitive method for
detection of bacteriocins in fermentation broth. Low concentrations of potassium ions
were measured, so that released potassium ions from a bacteriocin-sensitive indicator
strain directly correlated to concentrations of crude bacteriocin present in fermentation
broth injected into the cell. This method compared very well to a conventional agar well
diffusion assay.
23
PCR detection methods
Molecular methods used for the detection of bacteriocins have some improved
aspects over the traditional methods. The PCR technique has been used to rapidly identify
lactobacilli that may produce well-characterized bacteriocins, instead of relying on the
use of complex biochemical techniques which are usually required for the identification
and characterization of such bacteriocins. PCR methods have been used to detect genes
responsible for bacteriocin production and regulation in bacterial cultures. Rodriguez et
al. (1995) demonstrated the amplification of a 75 bp gene fragment of the lactocin S
structural gene in seven bacteriocinogenic strains of lactobacilli isolated from fermented
sausages. In another work, Garde et al. (2001) detected the genes necessary for the
synthesis of lacticin 481 and nisin using PCR techniques with specific probes on an
isolate of L. lactis subsp. lactis.
In an effort to reduce the time necessary for detection, methods to simplify or
even eliminate the need for post-amplification gel assays have been introduced. A
method for PCR quantification has been devised and is called “real-time” PCR because
use of a fluorescent label allows the user to actually view the increase in the amount of
target DNA as it is amplified. The real-time PCR system is based on detection and
quantification using one of the several types of fluorescent reporter molecules. This
signal increases in direct proportion to the amount of PCR product in the reaction (Heid
et al. 1996). A thermocycler fitted with a fluorescence detection system measures the
fluorescence in specially designed tubes that contain the reaction components. The
amplification results in a characteristic sigmoid shaped curve which represents three
phases of PCR: the lag phase (little product accumulation), the exponential phase (rapid
24
product accumulation) and the plateau phase (no further product is amplified). By
recording the amount of fluorescence emission in each cycle, it is possible to monitor the
PCR during the exponential phase where the first significant increase in the fluorescence
directly correlates with the initial amount of target template and the PCR cycle at which
this fluorescence is measured is referred to as a threshold cycle (Ct) (Higuchi et al. 1992,
Sawyer et al. 2003).
There are generally several methods of fluorescence quantification based on the
principle of fluorescent probes or DNA binding agent which includes: 1) TaqMan®
probes 2) Molecular Beacons 3) AmplifluorTM 4) SYBR Green dye. Since real-time PCR
does not require a post PCR manipulation (closed tube) and also avoids the cross
contamination of the PCR amplicons, it becomes highly suitable for food industries
where they can be used for routine applications towards rapid pathogen detection with
ease of use and high throughput (Zhang et al. 2003).
SYBR Green method
SYBR Green (SG) chemistry is an alternate method used to perform real-time
PCR analysis. SG is a dye that binds to the minor groove of double stranded DNA. When
the SG dye binds to double-stranded DNA, the intensity of the fluorescent emissions
increases. As more double-stranded amplicons are produced, the SG dye signal will
increase. This technique requires no specific probe and classic PCR protocols can be
easily adapted. One reason that SG is often used is that it is relatively inexpensive
compared to other detection chemistries. Additionally, SG allows confirmation of
amplicons by melting curve analysis, producing a characteristic melting temperature
25
(Tm) for an amplicon that is analogous to the detection of a specific sized fragment by
electrophoresis (Giglio et al. 2003).
TaqMan® probes
The TaqMan® probe is an oligonucleotide probe labeled with a fluorescent
reporter dye on the 5' end and quencher molecule on the 3' end which is hybridized to an
internal region intended to be amplified. The close proximity of the dye and quencher
results in negligible fluorescence when the probe is intact. However, during PCR
amplification, the 5'-nuclease activity of Taq DNA polymerase cleaves the probe,
separating the dye and quencher resulting in an increase in fluorescence. Accumulation of
PCR products is detected directly by monitoring the increase in fluorescence of the
reporter dye. Martin et al. (2006) reports the use of TaqMan® probes as a sensitive assay
for reliable quantitative identification of a bacteriocin produced by L. sakei in meat
products.
Advantages: Since a ratio of the specific hybridization between the probe and
target sequence must occur to generate fluorescence, non-specific products and primer-
dimers will not affect the fluorescent signal. Furthermore, by labeling multiple probes
with different dyes, multiplex reactions can be done to track different targets with a
different color flurophore. Disadvantages: The cost to run these probes has increased
because different probes need to be synthesized for different target sequences, thus
raising the running costs. However, TaqMan® is a cost effective option when the same
sequence is tested numerous times. (Nazarenko et al. 1997).
26
Molecular beacons
The molecular beacon fluorescent probe contains a short complementary
sequence of nucleotides attached to the 5’ and 3’ ends of the probe sequence so that a
stem-loop structure forms in solution (i.e., the “loop” is comprised of sequence related to
a specific target sequence). A fluorophore and a suitable quencher are attached via linkers
to the ends of the stem. In the absence of the target, the fluorophore and quencher are
held close together by the stem structure and fluorescence is quenched. However, when
the single-stranded loop hybridizes with a complementary target sequence, the stem
denatures and fluorescence appears because the flurophore and quencher molecules are in
close proximity as they are in the stem-loop conformation. Since these probes fluoresce
strongly only in the presence of their target, they can be used in solution and the removal
of the unhybridized probe is unnecessary (Tyagi and Kramer 1996).
AmplifluorTM uniprimerTM real-time PCR
The AmplifluorTM universal amplification and detection system utilizes a
molecular energy transfer system that uses an acceptor moiety to quench fluorescence
from an excited fluorophore (Nazarenko et al. 1997). The fluorophore (fluorescein) and
quencher (DABSYL) are located on the same oligonucleotide primer. The UniPrimerTM
primer has a universal format, as it will bind to any amplified DNA containing a unique
recognition sequence that can be added to existing PCR primers. The UniPrimerTM will
only emit fluorescence when incorporated into amplification products; unincorporated
UniPrimerTM does not fluoresce strongly. It is also possible to obtain custom primers with
the UniPrimerTM sequence already included.
27
These real-time PCR methods have been used to detect bacteriocin-producing
LAB by amplification of the bacteriocin structural genes or other genes involved with
bacteriocins operons. No reports have been published whereby bacteriocins have been
identified using an array of primers for all known structural genes from LAB.
Bacteriocin resistance
The presence of an antibacterial substance in a given environment will eventually
select for a variety of bacteria resistant to the antagonistic component. As found with
therapeutic antibiotics in the environment, bacteriocin-resistant mutants do occur.
Gravesen et al. (2002) examined the responses of a number of strains of L.
monocytogenes to pediocin PA-1 and nisin, and found a wide range of resistances to the
two bacteriocins occurring naturally. The influence of environmental stress (reduced pH,
low temperature, and the presence of sodium chloride) appeared bacteriocin-specific.
These stresses did not influence the frequency of resistance to pediocin PA-1, but the
frequency of nisin resistance was significantly reduced. Also of interest, the stability of
the phenotype of nisin resistance varied substantially, while resistance to the pediocin
was stable with ongoing growth of L. monocytogenes. Fitness costs as measured by
reduced growth rate in pediocin-resistant mutants were demonstrable, but nisin-resistant
mutants showed limited growth rate reductions. The bacteriocin-resistant mutants of L.
monocytogenes were not more sensitive to the applied environmental stresses than wild-
type strains and in a model sausage system their growth differences were minimal.
The genes for synthesis of pediocin PA-1 were transferred into nisin-producing L.
lactis FI5876 by Horn et al. (1998, 1999). As a result, both pediocin PA-1 and nisin A
28
were synthesized concurrently in this strain of Lactococcus. Production levels of pediocin
PA-1 were at the same levels as found in the original producer strain, P. acidilactici 347.
Since pediocin PA-1 and nisin A are unrelated bacteriocins, use of L. lactis FI5876 as a
starter culture in fermented dairy products should prevent the emergence of any
bacteriocin-resistant isolates of L. monocytogenes because the frequency for emergence
of a strain resistant to both peptides should be low.
Modi et al. (2000) evaluated resistance to nisin by L. monocytogenes to ask the
question of whether spontaneous nisin resistance leads to increased heat resistance
relative to the wild-type strains. In the absence of nisin, there was no significant
difference in heat resistance as shown by D-values. When nisin-resistant L.
monocytogenes were grown in the presence of nisin at 55ºC, the cells became more
sensitive to heat. When nisin-resistant cells were subjected to a combined treatment of
nisin and heat, there was a synergistic effect of inactivation. After exposure to heat, nisin-
resistant cells once again became sensitive to the effects of nisin. In the case of L.
monocytogenes, resistance to nisin did not appear to be particularly stable, nor impart an
undesirable effect of heightened heat resistance.
A natural concern about using bacteriocins for the preservation of food is the
selection of resistant strains. Treatment with a combination of bacteriocins, for instance
nisin and a class IIa bacteriocin would theoretically reduce the incidence of resistance
(Bouttefroy and Milliere 2000, Vignolo et al. 2000). There is currently conflicting
evidence as to whether resistance to one class of LAB bacteriocins can result in cross-
resistance to another class (Bouttefroy and Milliere 2000, Song and Richard 1997). There
29
have been no reports thus far for the selection of bacteriocin-resistant mutants towards
several bacteriocins and grouping these into different resistant classes.
Food applications
Consumers have been consistently concerned about possible adverse health
effects from the presence of chemical additives in their foods. As a result, consumers are
drawn to natural and “fresher” foods with no chemical preservatives added. This
perception, coupled with the increasing demand for minimally processed foods with long
shelf life and convenience, has stimulated research interest in finding natural but effective
preservatives. Bacteriocins produced by LAB, may be considered natural preservatives or
biopreservatives that fulfill these requirements. Biopreservation refers to the use of
antagonistic microorganisms or their metabolic products to inhibit or destroy undesired
microorganisms in foods to enhance food safety and extend shelf life (Schillinger et al.
1996).
Three approaches are commonly used in the application of bacteriocins for
biopreservation of foods (Schillinger et al. 1996):
(1) Inoculation of food with LAB that produce bacteriocin in the products. The ability of
the LAB to grow and produce bacteriocin in the products is crucial for its successful use.
(2) Addition of purified or semi-purified bacteriocins as food preservatives.
(3) Use of a product previously fermented with a bacteriocin-producing strain as an
ingredient in food processing.
30
Biopreservation of meat products
The United States government has the most rigid policy regarding L.
monocytogenes and set a zero tolerance level for L. monocytogenes in ready-to-eat foods.
It has been detected in a variety of foods and implicated in several food borne outbreaks,
such as turkey franks (Jay, 1996). Many studies have been carried out to control L.
monocytogenes in meat products since it is common within slaughterhouse and meat
packing environments and has been isolated from raw meat, cooked and ready-to-eat
meat products (Ryser and Marth 1999).
The activity of nisin alone at concentrations of 400 and 800 IU/g (International
Units/g) and in combination with 2% sodium chloride against L. monocytogenes in
minced raw buffalo meat was examined by Pawar et al. (2000). Addition of 2% sodium
chloride in combination with nisin was found to increase the efficacy of nisin. Adding
10000 IU/ml of nisin to inoculated cooked tenderloin pork inhibited the growth of L.
monocytogenes, but not Pseudomonas fragi. Nisin was found to be more effective when
used in combination with modified atmosphere packaging [MAP] (100% CO2 or 80%
CO2 + 20% air). MAP and nisin (1000 or 10000 IU/ml) inhibited growth of both
organisms, and this inhibitory effect for MAP/nisin combination system was more
pronounced at 4°C than at 20°C.
Hugas et al. (1998) found that sakacin K, a bacteriocin produced by Lactobacillus
sake CTC494, inhibited the growth of Listeria innocua in vacuum-packaged samples of
poultry breasts and cooked pork, and in MAP samples of raw minced pork. Vignolo et al.
31
(1996) showed that lactocin 705 produced by Lactobacillus casei CRL 705 inhibited the
growth of L. monocytogenes in ground beef.
Biopreservation of dairy products
L. monocytogenes has been the documented cause of a number of outbreaks
associated with dairy products, such as pasteurized milk and cheese. Nisin has been
shown effective against L. monocytogenes in dairy products (Fleming et al. 1985).
A problem in cheese production is the Clostridium-associated butyric acid
fermentation. Nisin is commonly added to pasteurized, processed cheese spreads to
prevent the outgrowth of clostridial spores, such as Clostridium tyrobutyricum
(Schillinger et al. 1996).
Lacticin 3147, a broad-spectrum, two-component bacteriocin produced by L.
lactis subsp. lactis DPC 3147, is used to control cheddar cheese quality by reducing non-
starter LAB populations during ripening (Ross et al. 1999). Cheese manufactured with
the lacticin 3147, contained 2 log10 less non-starter LAB than control cheese after 6 mo of
ripening. The lacticin 3147 producing transconjugant has also been used as a protective
culture to inhibit Listeria on the surface of a mold-ripened cheese. Presence of the
lacticin 3147 producer on the cheese surface reduced the number of L. monocytogenes by
3 log10 cycles (Ross et al. 1999).
Apart from using nisin, a bacteriocin (pediocin) produced by Pediococcus
acidilactici PAC1.0 has shown to inhibit Gram-positive spoilage organisms like
lactobacilli in salad dressings (Gonzalez 1987). Also, reports show the effectiveness of
32
pediocin AcH to reduce the population of L. monocytogenes and L. ivanovii in cottage
cheese, ice cream and reconstituted dry milk.
US patent 4,883,673 by Gonzalez describes the use of PA-1 in a salad dressing
composition to inhibit Lactobacillus bifermentans that was added at a concentration of
103 cfu/g. The experiments were conducted at 25°C for 7 days. PA-I at 200AU/g
(Arbitrary Units/g) was able to prevent spoilage of the salad dressing, which was
confirmed through organoleptic and microbiological evaluation.
Biopreservation of seafood products
The effectiveness of bacteriocins and protective cultures to control growth of L.
monocytogenes in vacuum packed cold smoked salmon has been demonstrated by several
researchers. The inhibitory effect of sakacin P against L. monocytogenes was examined in
cold-smoked salmon. When L. sake culture was added to salmon together with sakacin P,
a bactericidal effect against L. monocytogenes was observed.
The inhibitory effect of nisin, in combination with carbon dioxide and low
temperature, on the survival of L. monocytogenes in cold smoked salmon has also been
investigated (Nilsson et al. 1997). Addition of nisin to CO2-packed cold smoked salmon
resulted in a 1 to 2 log10 reduction of L. monocytogenes.
In order to improve shelf life, brined shrimp are typically produced with the
addition of sorbic and benzoic acids. Concerns about the use of these organic acids have
led researchers to explore the potential of using bacteriocins for their preservation. The
effectiveness of nisin Z, carnocin UI49, and a preparation of crude bavaricin A on shelf
33
life extension of brined shrimp was evaluated. Carnocin UI49 did not extend the shelf life
compared to the control (10 day shelf life), while bavaricin A resulted in a shelf life of 16
days. Nisin Z delivered a shelf life of 31days. The benzoate-sorbate solution was superior
as it preserved the brined shrimp for the entire storage period of 59 days.
In a study using vacuum-packed cold smoked rainbow trout, the inhibition of L.
monocytogenes and mesophilic aerobic bacteria by nisin, sodium lactate, or their
combination was examined. The combination of nisin and sodium lactate injected into
smoked fish decreased the count of L. monocytogenes from 3.3 to 1.8 log10 CFU/g over
16 days of storage at 8°C.
Hurdle technology to enhance food safety
The major functional limitations for the application of bacteriocins in foods are
their relatively narrow activity spectra and moderate antibacterial effects. Moreover, they
are generally not active against Gram-negative bacteria. To overcome these limitations,
more and more researchers use the concept of hurdle technology to improve shelf life and
enhance food safety. Nisin enhances thermal inactivation of bacteria, thus reducing the
treatment time, resulting in better food quality. Addition of nisin (500 to 2500 IU/ml) in
liquid whole egg or egg white caused a reduction of required pasteurization time of up to
35% (Boziaris et al. 1998). Nisin reduced the heat resistance of L. monocytogenes in
lobster meat and significantly reduced the treatment time compared with thermal
treatment alone. The reduced heat process resulted in significant reduction in drained
weight loss that would allow considerable cost savings. The synergistic effect between
bacteriocins and other processing technologies on the inactivation of microorganisms has
34
also been frequently reported. A synergistic effect between sodium diacetate and pediocin
against L. monocytogenes in meat slurries has been reported by Schlyter et al. (1993).
A listericidal inhibitory effect of approximately 7 log10 CFU/ml was observed in
treatments containing pediocin (5000 AU/ml) with 0.5% diacetate at 25°C and pediocin
with 0.3% diacetate at 4°C. Zapico et al. (1998) showed a synergistic effect of nisin and
the lactoperoxidase system on the inactivation of L. monocytogenes in skim milk.
Addition of nisin and the lactoperoxidase system resulted in counts of L. monocytogenes
up to 5.6 log10 cycles lower than the control milk after 24 h at 30°C. The use of
combinations of various bacteriocins has also been shown to enhance antibacterial
activity. Nisin and leucocin F10 provided greater activity against L. monocytogenes when
used in combination (Parente et al. 1998).
There has been continued interest in the food industry for using nonthermal
processing technologies, such as high hydrostatic pressure (HP) and pulsed electric field
(PEF) in food preservation. It is frequently observed that bacteriocins, in combination
with these processing techniques, enhance bacterial inactivation. Gram-negative bacteria
that are usually insensitive to LAB bacteriocins, such as E. coli O157:H7 and S.
typhimurium, become sensitive following HP/PEF treatments that induce sub lethal injury
to bacterial cells (Kalchayanand et al. 1994).
Bacteriocins in packaging films
Incorporation of bacteriocins into packaging films to control food spoilage and
pathogenic organisms has also been an area of active research. An antimicrobial
packaging film prevents microbial growth on the food surface by direct contact of the
35
package with the surface of foods, such as meats and cheese. For this method to work, the
antimicrobial packaging film must contact the surface of the food so that bacteriocins can
diffuse to the surface. The gradual release of bacteriocins from a packaging film to the
food surface may have an advantage over dipping and spraying foods with bacteriocins.
In the latter processes, antimicrobial activity may be lost or reduced due to inactivation of
the bacteriocins by food components or dilution below active concentration due to the
migration into the foods (Appendini and Hotchkiss 2002).
Two methods have been commonly used to prepare packaging films with
bacteriocins. One is to incorporate bacteriocins directly into polymers and the other is the
incorporation of nisin into biodegradable protein films. Both cast and heat-press films,
formed excellent films and inhibited the growth of Lactobacillus plantarum. Siragusa et
al. (1999) incorporated nisin into a polyethylene based plastic film that was used to
vacuum pack beef carcasses. Nisin retained activity against Lactobacillus helveticus and
Bacillus thermosphacta inoculated in carcass surface tissue sections. Coma et al. (2001)
incorporated nisin into edible cellulosic films made with hydroxypropylmethylcellulose
by adding nisin to the film forming solution. An inhibitory effect was demonstrated
against L. innocua and Staphylococcus aureus, but film additives, such as stearic acid,
used to improve the water vapor barrier properties of the film, significantly reduced
inhibitory activity.
Another method to incorporate bacteriocins into packaging films is to coat or
adsorb bacteriocins to the polymer surface. Examples include nisin/methylcellulose
coatings for polyethylene films and nisin coatings for poultry, adsorption of nisin on
polyethylene, ethylene vinyl acetate, polypropylene, polyamide, polyester, acrylics, and
36
polyvinyl chloride (Appendini and Hotchkiss 2002). The efficacy of bacteriocin coatings
on the inhibition of pathogens has also been demonstrated. Coating of pediocin onto
cellulose casings and plastic bags has been found to completely inhibit growth of
inoculated L. monocytogenes in meats and poultry through 12 wk storage at 4°C (Ming et
al. 1997). Coating of solutions containing nisin, citric acid, EDTA, and Tween 80 onto
polyvinyl chloride, low density polyethylene, and nylon films reduced the counts of
Salmonella typhimurium in fresh broiler drumstick skin by 0.4 to 2.1 log10 cycles after
incubation at 4°C for 24 h (Natrajan and Sheldon 2000).
Conclusion
Although intensive studies over the last decade have greatly advanced our
knowledge base about bacteriocins, further work is needed before we are able to fully
understand the molecular mechanisms, structure-function relationships, and mechanisms
of action of bacteriocins. In the biosynthesis of lantibiotics, the function of the enzymes
responsible for modification reactions is still not clearly understood. The mechanism of
producer immunity remains to be answered. Research in these areas is critical for the
effective applications of bacteriocins and would help develop methods to genetically
engineer bacteriocins with better activity, solubility, and stability.
Although many bacteriocins have been isolated and characterized, only a few
have demonstrated commercial potential in food application. Nisin is the only purified
bacteriocin approved for food use in the U.S. It has been used as a food preservative in
more than 50 countries, mainly in cheese, canned vegetables, various pasteurized dairy,
liquid egg products, and salad dressings. The applications of other bacteriocins in food
37
preservation have been studied intensively. The use of pediocin PA-1 for food
biopreservation has been commercially exploited and is covered by several U.S. and
European patents (Ennahar et al. 2000b). Fermentate containing pediocin PA-1 and
AltaTM, is commercially available and used as a food preservative to increase shelf life
and inhibit the growth of bacteria, especially L. monocytogenes in ready-to-eat meats.
Lacticin 3147, which is active over a wider pH range than nisin, is expected to find
applications in non-acid foods (Ross et al. 1999).
Many interacting factors influence the development of bacteriocin-resistance
during the biopreservation of food. In order to increase the efficiency of bacteriocins as
food preservatives, it may be necessary to incorporate bacteriocins from different
resistant classes. In doing so, the incidence of food spoilage organisms developing
resistance towards bacteriocins can be minimized because even if an organism develops
resistance towards one class, it may still be sensitive to the other class and hence its
growth will continue to be inhibited.
Since bacteriocins that have been used as food preservatives have relatively
narrow activity spectra and are generally not active against Gram-negative bacteria, it can
be expected that nisin and other bacteriocins will continue to be incorporated and
developed into hurdle concept technologies for food preservation. The simultaneous
application of bacteriocins and nonthermal processing technologies, such as HP and PEF,
to improve shelf life of foods is attractive since foods produced using these non-thermal
technologies usually have better sensory and nutritional qualities compared with products
produced using conventional thermal processing methods.
38
REFERENCES
1. Abdel-Dayem, M., Fleury, Y., Devilliers, G., Chaboisseau, E., Girard, R.,
Nicolas, P., and A. Delfour. 1996. The putative immunity protein of the Gram-
positive bacteria Leuconostoc mesenteroides in preferentially located in the
cytoplasm compartment. FEMS Microbiol. Lett. 138:251-9.
2. Altena, K., Guder, A., Cramer, C., and G. Bierbaum. 2000. Biosynthesis of
the lantibiotic mersacidin: organization of a type B lantibiotic gene cluster. Appl.
Environ. Microbiol. 66:2565-71.
3. Appendini, P., and J. H. Hotchkiss. 2002. Review of antimicrobial food
packaging. Innov. Food Sci. Emerg. Technol. 3:113-126.
4. Axelsson, L., and A. Holck. 1995. The genes involved in production of and
immunity to sakacin A, a bacteriocin from Lactobacillus sake Lb706. J. Bacteriol.
177:2125-37.
5. Bhunia, A.K., Johnson, M.C., and B. Ray. 1988. Purification, characterization
and antimicrobial spectrum of a bacteriocin produced by Pediococcus acidilactici
H. J. Appl. Bacteriol. 65:261–268.
6. Bhunia, A.K., Johnson, M.C., Ray, B., and N. Kalchayanand. 1991. Mode of
action of pediocin AcH from Pediococcus acidilactici H on sensitive bacterial
strains. J. Appl. Bacteriol. 70:25–30.
39
7. Bouttefroy, A., and J. Milliere. 2000. Nisin-curvaticin 13 combinations for
avoiding the regrowth of bacteriocin resistant cells of Listeria monocytogenes
ATCC 15313. Int. J. Food Microbiol. 62:65–75.
8. Boziaris, I.S., Humpheson, L., and M.R. Adam. 1998. Effect of nisin on heat
injury and inactivation of Salmonella enteritidis PT4. Int. J. Food Microbiol.
43:7-13.
9. Bruno, M.C., and T.J. Montville. 1993. Common mechanistic action of
bacteriocins from lactic acid bacteria. Appl. Environ. Microbiol. 59:3003– 3010.
10. Buchmann, G.W., Banerjee, S., and J.N. Hansen. 1988. Structure, expression,
and evolution of a gene encoding the precursor of nisin, a small protein antibiotic.
J. Biol. Chem. 263:16260-6.
11. Chikindas, M.L., Garcý´a-Garcera, M.J., Driessen, A.J.M., Ledeboer, A.M.,
Nissen-Meyer, J., Nes, I.F., Abee, T., Konings, W.N., and G. Venema. 1993.
Pediocin PA-1, a bacteriocin from Pediococcus acidilactici PAC1.0, forms
hydrophilic pores in the cytoplasmic membrane of target cells. Appl. Environ.
Microbiol. 59:3577–3584.
12. Coma, V., Sebti, I., Pardon, P., Deschamps, A., and F.H. Pichavant. 2001.
Antimicrobial edible packaging based on cellulosic ethers, fatty acids, and nisin
incorporation to inhibit Listeria innocua and Staphylococcus aureus. J. Food Prot.
64:470-5.
40
13. De Vuyst, L., and E. Vandamme (Ed). 1994. Bacteriocins of lactic acid
bacteria: microbiology, genetics and application. Chapman & Hall, Ltd., London.
14. Dufour, A., Rince, A., Uguen, P., and J.P. LePennec. 2000. IS1675, a novel
lactococcal insertion element, forms a transposon like structure including the
lacticin 481 lantibiotic operon. J. Bacteriol. 182:5600-5.
15. Ennahar, S., Sashihara, T., Sonomoto, K., and A. Ishizaki. 2000. Class IIa
bacteriocins: biosynthesis, structure and activity. FEMS Microbiol. Rev. 24:85-
106.
16. Fleming, D.W., Cochi, S.L., MacDonald, K.L., Brondum, J., Hayes, P.S.,
Plikaytis, B.D., Holmes, M.B., Audurier, A., Broome, C.V., an A.L. Reingold.
1985. Pasteurized milk as a vehicle of infection in an outbreak of listeriosis. New
England J. Med. 312: 404-7.
17. Foegeding, P.M., Thomas, A.B., Pilkington, D.H., and T.R. Klaenhammer.
1992. Enhanced control of Listeria monocytogenes by in situ-produced pediocin
during dry fermented sausage production. Appl. Environ. Microbiol. 58: 884-890.
18. Freund, S., Jung, G., Gutbrod, O., Folkers, G., Gibbons, W.A., Allgaier, H.,
and R. Werner. 1991. The solution structure of the lantibiotic gallidermin.
Biopolymers 31:803–811.
19. Garcera, M.J.G., Elferink, M.G.L., Driessen, A.J.M., and W.N. Konings.
1993. In vitro pore-forming ability of the lantibiotic nisin, role of proton-motive
force and lipid composition. Eur. J. Biochem. 212:417–422.
41
20. Garde, S., Rodriguez, E., Gaya, P., Medina, M., and M. Nunez. 2001. PCR
detection of the structural genes of nisin Z and lacticin 481 in Lactococcus lactis
subsp. lactis INIA 415, a strain isolated from raw milk Manchego cheese.
Biotechnol. Lett. 23:85-9.
21. Giglio, S., Monis, P.T., and C.P. Saint. 2003. Demonstration of preferential
binding of SYBR Green I to specific DNA fragments in real-time multiplex PCR.
Nucleic Acids Research 31 (22): e136.
22. Gonzalez, C.F. 1987. Method for inhibiting bacterial spoilage and resulting
compositions. United States Patent 4,883,673.
23. Gravesen, A., Axelsen, A.M.J., da Silva, J.M., Hansen, T.B., and S. Knochel.
2002. Frequency of bacteriocin resistance development and associated fitness
costs in Listeria monocytogenes. Appl. Environ. Microbiol. 68:756-64.
24. Hanlin, M.B., Kalchayanand, N., Ray, P., and B. Ray. 1993. Bacteriocins of
lactic acid bacteria in combination have greater antibacterial activity. J. Food Prot.
56:252–255.
25. Heid, C. A., Stevens J., Livak K.J., and P.M. Williams. 1996. Real-time
quantitative PCR. Genome Res. 6: 986-994.
26. Higuchi, R., Dollinger G., Walsh S., and R. Griffith. 1992. Simultaneous
amplification and detection of specific DNA sequences. BioTechnology. 10: 413-
417.
42
27. Horn, N., Martinez, M.I., Martinez, J.M., Hernandez, P.E., Gasson, M.J.,
Rodriguez, J.M., and H.M. Dodd. 1998. Production of pediocin PA-1 by
Lactococcus lactis using the lactococcin A secretory apparatus. Appl. Environ.
Microbiol. 64:818-23.
28. Horn, N., Martinez, M.I., Martinez, J.M., Hernandez, P.E., Gasson, M.J.,
Rodriguez, J.M., and H.M. Dodd. 1999. Enhanced production of pediocin PA-1
and coproduction of nisin and pediocin PA-1 by Lactococcus lactis. Appl.
Environ. Microbiol. 65:4443-50.
29. Hugas, M., Pagés, F., Garriga, M., and J.M. Monfort. 1998. Application of the
bacteriocinogenic Lactobacillus sakei CTC494 to prevent growth of Listeria in
fresh and cooked meat products packed with different atmospheres. Food
Microbiol. 15:639-50.
30. Hurst, A., 1981. Nisin. Adv. Appl. Microbiol. 27:85–123.
31. Ingram, L.C., 1970. A ribosomal mechanism of synthesis for peptides related to
nisin. Biochim. Biophys. Acta. 224:263-5.
32. Jay, J.M., 1996. Modern food microbiology. 5th ed. New York: Chapman and
Hall. 635 p.
33. Jimenez-Diaz, R., Rios-Sanchez, R.M., Dezmazeaud, M., Ruiz-Barba, J.L.,
and J.C. Piard. 1993. Plantaricins S and T, two new bacteriocins produced by
Lactobacillus plantarum LPCO10 isolated from a green olive fermentation. Appl.
Environ. Microbiol. 59:1416–1424.
43
34. Kalchayanand, N., Hanilin, M.B., and B. Ray. 1992. Sub lethal injury makes
Gram negative and resistant Gram-positive bacteria sensitive to the bacteriocins,
pediocin AcH and nisin. Lett. Appl. Microbiol. 15:239–243.
35. Kalchayanand, N., Sikes, T., Dunne C.P., B. Ray. 1994. Hydrostatic pressure
and electroporation efficiency in combination with bacteriocins. Appl. Environ.
Microbiol. 60:4174-7.
36. Kekessy, D.A., and J.D. Piguet. 1970. New method for detecting bacteriocin
production. Appl. Microbiol. 20:282-3.
37. Klaenhammer, T.R. 1993. Genetics of bacteriocins produced by lactic acid
bacteria. FEMS Microbiol. Rev. 12:39-85.
38. Klein, C., Kaletta, C., Schnell, N., and K.D. Entian. 1992. Analysis of genes
involved in biosynthesis of the lantibiotic subtilin. Appl. Environ. Microbiol.
58:132-42.
39. Kuipers, O.P., Beerthuyzen, M.M., de Ruyter, P.G.G.A., Luesink, E.J., and
W.M. de Vos. 1995. Autoregulation of nisin biosynthesis in Lactococcus lactis
by signal transduction. J. Biol. Chem. 270:27299-304.
40. Lipinska, E. 1977. Nisin and its application. In “Antibiotics and antibiosis in
Agriculture” pp 103-130.
44
41. Martín, B., Jofré, A., Garriga, M., Pla, M., and T. Aymerich. 2006. Rapid
Quantitative Detection of Lactobacillus sakei in Meat and Fermented Sausages by
Real-Time PCR. Appl. Environ. Microbiol. 72(9): 6040–6048.
42. McAuliffe, O., Ross, R.P., and C. Hill. 2001. Lantibiotics: structure,
biosynthesis and mode of action. FEMS Microbial. Rev. 25:285-308.
43. Ming, X., Weber, G., Ayres, J., and W. Sandine. 1997. Bacteriocins applied to
food packaging materials to inhibit Listeria monocytogenes on meats. J. Food Sci.
62:413-5.
44. Modi, K.D., Chikindas, M.L., and T.J. Montville. 2000. Sensitivity of nisin-
resistant Listeria monocytogenes to heat and the synergistic action of heat and
nisin. Lett. Appl. Microbiol. 30:249- 53.
45. Mugochi, T., Nandakumar, M.P., Zvauya, R., and B. Mattiasson. 2001.
Bioassay for the rapid detection of bacteriocins in fermentation broth. Biotechnol.
Lett. 23:1243-7.
46. Natrajan, N., and B. Sheldon. 2000. Efficacy of nisin-coated polymer films to
inactivate Salmonella typhimurium on fresh broiler skin. J. Food Prot. 63:1189-
96.
47. Nazarenko, I. A., Bhatnagar, S.K., and R. J. Hohman. 1997. A closed tube
format for amplification and detection of DNA based on energy transfer. Nucl.
Acid. Res. 25:2516-2521.
45
48. Nes, I.F., Diep, D.B., Havarstein, L.S., Brurberg, M.B., Eijsink, V., and H.
Holo. 1996. Biosynthesis of bacteriocins in lactic acid bacteria. Antonie van
Leeuwenhoek 70:113-28.
49. Nes, I.F., and H. Holo. 2000. Class II antimicrobial peptides from lactic acid
bacteria. Biopolymers 55:50-61.
50. Nilsson, L., Huss, H.H., and L. Gram. 1997. Inhibition of Listeria
monocytogenes on cold smoked salmon by nisin and carbon dioxide atmosphere.
Int. J. Food Microbiol. 38:217-27.
51. Nissen-Meyer, J., Holo, H., Havarstein, L.V., Sletten, K., and I.F. Nes. 1992.
A novel lactococcal bacteriocin whose activity depends on the complementary
action of two peptides. J. Bacteriol. 174:5686–5692.
52. Nissen-Meyer, J., Havarstein, L.S., Holo, H., Sletten, K., and I.F. Nes. 1993.
Association of the lactococcin A immunity factor with the cell membrane:
purification and characterization of the immunity factor. J. Gen. Microbiol.
139:1503–1509.
53. Parente, E., Giglio, M.A., Ricciardi, A., and F. Clementi. 1998. The combined
effect of nisin, leucocin F10, pH, NaCl and EDTA on the survival of Listeria
monocytogenes in broth. Int. J. Food Microbiol. 40:65-75.
54. Parkinson, J.S. 1993. Signal transduction schemes of bacteria. Cell 73:857-71.
46
55. Pawar, D.D., Malik, S.V.S., Bhilegaonkar, K.N., and S.B. Barbuddhe. 2000.
Effect of nisin and its combination with sodium chloride on the survival of
Listeria monocytogenes added to raw buffalo meat mince. Meat Sci. 56:215-9.
56. Piard, J.C., Muriana, P.M., Desmazeaud, P.J., and T.R. Klaenhammer. 1992.
Purification and partial characterization of lacticin 481, a lanthionine containing
bacteriocin produced by Lactococcus lactis subsp. lactis CNRZ 481. Appl.
Environ. Microbiol. 58:279-84.
57. Piddock, L.J.V. 1990. Techniques used for the determination of antimicrobial
resistance and sensitivity in bacteria. J. Appl. Bacteriol. 68:307-18.
58. Pugsley, A.P. 1984. The ins and outs of colicins. I. Production and translocation
across membranes. Microbiol. Sci. 1:168–175.
59. Pugsley, A.P. 1984. The ins and outs of colicins. II. Lethal action, immunity and
ecological implications. Microbiol. Sci. 1:203–205.
60. Quadri, L.E., Kleerebezem, M., Kuipers, O.P., de Vos, W.M., Roy, K.L.,
Vederas, J.C., and M.E. Stiles. 1997. Characterization of a locus from
Carnobacterium piscicola LV17B involved in bacteriocin production and
immunity: evidence for global inducer-mediated transcriptional regulation. J.
Bacteriol. 179:6163-71.
61. Ray, B. 1993. Sublethal injury, bacteriocins, and food microbiology. ASM News
59:285–291.
47
62. Reis, M., Eschbach-Bludau, M., Iglesias-Wind, M.I., Kupke, T., and H.G.
Sahl. 1994. Producer immunity towards the lantibiotic Pep5: identification of the
immunity gene pepI and localization and functional analysis of its gene product.
Appl. Environ. Microbiol. 60:2876-83.
63. Rodriguez, E., Martinez, M.I., Medina, M., Hernandez, P.E., and J.M.
Rodriguez. 1998. Detection of enterocin AS-48-producing dairy Enterococci by
dot-blot and colony hybridization. J. Dairy Res. 65:143-8.
64. Rodriguez, J.M., Cintas, L.M., Casaus, P., Suarez, A., and P.E. Hernandez.
1995. PCR detection of the lactocin S structural gene in bacteriocin-producing
lactobacilli from meat. Appl. Environ. Microbiol. 61:2802-5.
65. Rose, N.L., Sporns, P., and L.M. McMullen. 1999. Detection of bacteriocins by
matrix-assisted laser desorption/ionization time-of-flight mass spectrometry.
Appl. Environ. Microbiol. 65:2238- 42.
66. Ross, R.P., Galvin, M., McAuliffe, O., Morgan, S.M., Ryan, M.P., Twomey,
D.P., Meaney, W.J., and C. Hill.1999. Developing applications for lactococcal
bacteriocins. Antonie van Leeuwenhoek 76:337-46.
67. Ryser, E.T., and E.H. Marth. 1999. Listeria, listeriosis and food Safety. 2nd ed.
New York: Marcel Dekker, Inc. 738 p.
68. Sablon, E., Contreras, B., and E. Vandamme. 2000. Antimicrobial peptides of
lactic acid bacteria: mode of action, genetics and biosynthesis. Adv. Biochem.
Engin/Biotechnol. 68:21-60.
48
69. Sawyer, J., Wood, C., Shanahan, D., Gout, S., and D. McDowell. 2003. Real-
time PCR for quantitative meat species testing. Food Control. 14: 579-583.
70. Schillinger, U., Geisen, R., and W.H. Holzapfel. 1996. Potential of antagonistic
microorganisms and bacteriocins for the biological preservation of foods. Trends
Food Sci. Technol. 7:158-64.
71. Schlyter, J.H., Glass, K.A., Loeffelholz, J., Degnan, A.J., and J.B. Luchansky.
1993. The effects of diacetate with nitrite, lactate, or pediocin on the viability of
Listeria monocytogenes in turkey slurries. Int. J. Food Microbiol. 19:271-81.
72. Schnell, N., Engelke, G., Augustin, J., Rosenstein, R., Ungermann, V., and
K.D. Götz. 1992. Analysis of genes involved in the biosynthesis of lantibiotic
epidermin. Eur. J. Biochem. 204:57-68.
73. Schuller, F., Benz, R., and H.G. Sahl. 1989. The peptide antibiotic subtilin acts
by formation of voltage-dependent multistate pores in bacterial and artificial
membranes. Eur. J. Biochem. 182:181–186.
74. Siragusa, G.R., Cutter, C.N., and J.L. Willett. 1999. Incorporation of
bacteriocin in plastic retains activity and inhibits surface growth of bacteria on
meat. Food Microbiol. 16:229-35.
75. Skaugen, M., Abildgaard, C.I.M., and I.F. Nes. 1997. Organization and
expression of a gene cluster involved in the biosynthesis of the lantibiotic lactocin
Mol. Gen. Genet. 253:674-86.
49
76. Song, H.J., and J. Richard. 1997. Antilisterial activity of three bacteriocins used
at subminimal inhibitory concentrations and cross-resistance of the survivors. Int.
J. Food Microbiol. 36:155–61.
77. Stevens, K.A., Sheldon, B.W., Klapes, N.A., and T.R. Klaenhammer. 1991.
Nisin treatment for inactivation of Salmonella species and other Gram-negative
bacteria. Appl. Environ. Microbiol. 57:3613–3615.
78. Stock, J.B., Ninfa, A.J., and A.M. Stock. 1989. Protein phosphorylation and
regulation of adaptive responses in bacteria. Microbiol. Rev. 53:450-90.
79. Tagg, J.R., Dajani, A.S., and L.W. Wannamaker. 1976. Bacteriocins of Gram-
positive bacteria. Bacteriol. Rev. 40:722–756.
80. Tyagi, S., and F.R. Kramer. 1996. Molecular beacons: probes that fluorescence
upon hybridization. Nat. Biotechnol. 14: 303-308.
81. Van Belkum, M.J., Hayema, B.J., Jeeninga, R.E., Kok, J., and G. Venema.
1991. Organization and nucleotide sequence of two lactococcal bacteriocin
operons. Appl. Environ. Microbiol. 57:492–498.
82. Van Belkum, M.J., Kok, J., Venema, G., Holo, H., Nes, I.F., Konings, W.N.,
and T. Abee. 1991. The bacteriocin lactococcin A specifically increases the
permeability of lactococcal cytoplasmic membranes in a voltage-independent
protein mediated manner. J. Bacteriol. 173:7934-7941.
50
83. Venema, K., Abee, T., Haandrikman, A.J., Leenhouts, K.J., Kok, J.,
Konings, W.N., and G. Venema. 1993. Mode of action of lactococcin B, a thiol-
activated bacteriocin from Lactococcus lactis. Appl. Environ. Microbiol.
59:1041–1048.
84. Vignolo, G., Palacios, J., Farias, M.E., Sesma, F., and U. Schillinger. 2000.
Combined effect of bacteriocins on the survival of various Listeria species in
broth and meat system. Curr. Microbiol. 41:410–16.
85. Vogel, H., Nillson, L., Rigler, R., Meder, S., Boheim, G., Beck, W., Kurth,
H.H., and G. Jung. 1993. Structural fluctuations between two conformational
states of a transmembrane helical peptide are related to its channel forming
properties in planar lipid membranes. Eur. J. Biochem. 212:305– 313.
86. Yang, R., Johnson, M.C., and B. Ray. 1992. Novel method to extract large
amounts of bacteriocins from lactic acid bacteria. Appl. Environ. Microbiol.
58:3355–3359.
87. Zajdel, J.K., Ceglowski, P., and W.T. Dobranski. 1985. Mechanism of action
of lactostrepcin 5, a bacteriocin produced by Streptococcus cremoris 202. Appl.
Environ. Microbiol. 49:969–974.
88. Zapico, P., Medina, M., Gaya, P., and M. Nuñez. 1998. Synergistic effect of
nisin and the lactoperoxidase system on Listeria monocytogenes in skim milk. Int.
J. Food Microbiol. 40:35-42.
51
89. Zhang, Y., Zhang, D., Li, W., Chen, J., Peng, Y., and W. Cao. 2003. A novel
real-time quantitative PCR method using attached universal template probe. Nucl.
Acid. Res. 31(20): 1-8.
52
CHAPTER III
SEQUENCE ANALYSIS OF THE CURVATICIN FS47 BACTERIOCIN OPERON OF
LACTOBACILLUS CURVATUS FS47.
S. Macwana1 and P.M. Muriana1,2
1Department of Animal Sciences &
2The Food & Agricultural Products Research & Technology Center,
Oklahoma State University
Stillwater, Oklahoma 74078
53
INTRODUCTION
Bacteriocins are ribosomally synthesized antimicrobial peptides produced by
many living organisms including bacteria and constitute the most abundant and diverse
group of bacterial defense systems (Nes and Holo, 2000, Eijsink et al., 2002 and Riley
and Wertz, 2002). In recent years, bacteriocins from lactic acid bacteria (LAB) have been
the focus of extensive studies due to their potential application in foods (Cleveland et al.,
2001). Many bacteriocins produced by LAB inhibit not only closely related species but
also a variety of species of Gram-positive spoilage bacteria and food-borne pathogens.
Most antimicrobial peptides from LAB are synthesized with an N-terminal leader
sequence. They are cationic, amphiphilic/hydrophobic membrane permeabilizing
peptides, usually consisting between 30 and 60 amino acids. Bacteriocins produced by
Lactobacillus curvatus and the closely related Lactobacillus sakei are classified as class
II bacteriocins; small, heat-stable, non-lantibiotics. These are further divided into three
subgroups: (IIa) listeria-active peptides, (IIb) poration complexes consisting of two
proteinaceous peptides for activity, and (IIc) thiol-activated peptides requiring reduced
cysteine residues for activity (Nes and Holo, 2000, Ennahar et al., 2000). The largest
group in Class II bacteriocins is subclass IIa. These bacteriocins share an overall amino
acid sequence identity of over 70% with the conserved sequence motif
(YYGNGVxCxKxxCxVD) in the N-terminal part of the molecule (Eijsink et al., 2002).
Curvaticin FS47 is a Listeria-active bacteriocin produced by Lactobacillus
curvatus FS47 that was isolated from retail meats (Garver and Muriana, 1993).
Lactobacillus curvatus, is a psychrotroph which can grow at temperatures as low as 5oC
and is known for the production of several different bacteriocins (curvacin, curvaticin)
54
that are inhibitory to Listeria monocytogenes and some spoilage microorganisms
(Tichaczek, et al., 1993; Vogel et al., 1993; Garver and Muriana, 1993, 1994). Curvaticin
FS47 has a molecular weight of 4.07 kDa as determined by mass spectrometry (Garver
and Muriana, 1994). Although curvaticin FS47 does not contain the consensus sequence
shared by Class IIa Listeria-active peptides, it inhibits the growth of L. monocytogenes,
suggesting that it may prevent the growth of L. monocytogenes by a different mechanism.
In this study, we completed the sequencing of the curvaticin FS47 operon (9.6-kb) and
performed sequence analysis to identify homology with other known bacteriocin
sequences.
55
MATERIALS AND METHODS
Bacterial strains, plasmids, and media.
Strains of Lactobacillus were maintained as frozen stocks held at -20oC in de
Man-Rogosa-Sharpe (MRS) broth (Difco Laboratories, Detroit, MI) with 10% glycerin
(Fisher Scientific Co., Raleigh, NC). Cultures of Lactobacillus were grown in MRS
broth or on MRS agar (1.5% agar) at 30oC. Indicator overlay agar was prepared by
adding 0.75% agar to MRS broth. Frozen stocks of strains of E. coli were maintained in
Luria-Burtani (LB) broth with 10% glycerin.
DNA isolation and manipulation.
Isolation of plasmid DNA from strains of Lactobacillus was performed by the
method of O’Sullivan and Klaenhammer (1993). Plasmid DNA from strains of E.coli
was prepared by alkaline lysis. Total DNA of strains of L. curvatus was isolated by the
procedure of Wu and Muriana (1995). Plasmid DNA required for sequencing was further
purified by CsCl-ethidium bromide density gradient ultracentrifugation.
Genomic clones, sequencing and PCR walking.
Two overlapping clones in the plasmid cloning vector, pBluescript, encompassing
the structural gene (cutA) and additional subclones obtained previously (in a related study
in our laboratory) were made available for sequencing. Sequences were obtained directly
from subclones, by PCR walking, or by using vectorette PCR (see below). PCR walking
was done for each clone initially by using the pBluescript universal primers and thereby
followed with using the gene specific primers and the universal primers. Sequencing of
56
DNA was performed at the Dept. of Biochemistry and Molecular Biology Recombinant
DNA/Protein Resource Facility (Oklahoma State University) using an automated DNA
sequencer via "BigDye™"-terminated reactions analyzed on an ABI Model 3700 DNA
Analyzer.
Vectorette PCR.
The vectorette sequences and methods are modified from a protocol at the Bostein
Lab website http://genome-www.stanford.edu/group/botlab/protocols/vectorette.html.
Briefly, genomic DNA of L. curvatus FS47 (~6µg) was digested with EcoR1. The
digested DNA was ligated with the annealed vectorette oligos (2µM each oligo) at 37oC
for 2hrs. The primers used are listed in Table 2. For the PCR, each reaction mixture
consisted of 5µl of ligation mix, 1.0µl (10pM ‘R’ gene specific primer), 0.5µl (200mM of
the universal vectorette primer 224 ‘F’), 1.5µl of 2.5mM deoxynucleotide triphosphate,
0.5U of Taq polymerase and nuclease free water to a final volume of 20µl. This reaction
allowed for the highly specific amplification of the 2-kb fragment in the 9.6-kb curvaticin
bacteriocin operon. The PCR conditions were 22 cycles of denaturation (92oC, 10sec),
annealing (60oC, 1min) and extension (72oC, 3min). The final product was separated on a
1.5% agarose gel. The 2-kb fragment obtained was purified and sequenced.
Differentiation of L. sakei and L. curvatus.
Polymerize Chain Reaction amplification: Species-specific primer combinations
have been identified to differentiate L. curvatus from the related L. sakei which involves
a primer for the common sequence of the 16S rRNA gene in both and another for a
57
species-specific spacer region (Table 1). Amplification consisted of 20 cycles (for primer
pairs 16/Lc, 16/Ls) of: denaturation for 1min at 94oC, annealing for 30 sec at 45oC and an
extension for 1min at 72oC. The first cycle was incubated for 5 min at 94oC. A 10µl
aliquot of the PCR products were electrophoresed in a 1% agarose gel and visualized by
UV illumination after ethidium bromide staining.
Sequence analysis.
Open reading frames (ORFs) and BLAST that was used to obtain protein
sequence similarity were determined using the software tools provided online at the
National Center for Biotechnology Information
(http://www.ncbi.nlm.nih.gov/gorf/orfig.cgi)
58
RESULTS AND DISCUSSION
Detection of the curvaticin FS47 bacteriocin operon.
The location of the curvaticin FS47 operon was identified from the sequence of
purified curvaticin FS47 obtained previously (Garver and Muriana, 1994) and from
partial sequencing of the curvaticin FS47 operon that provided 4.3-kb of sequence
information (P. Muriana, personal communication). In this paper, we present additional
sequence information totaling 9.6-kb and sequence analysis of the curvaticin FS47
operon.
Sequencing of the cloned fragments.
The partial 4.3-kb sequence information for curvaticin FS47 was obtained from
two overlapping clones: i) pBHX (3.6-kb, HindIII-XbaI) and pBAcE (3.9-kb, Acc651-
EcoRI) that were cloned into pBluescript encompassing the structural gene, cutA (P.
Muriana, personal communication). A restriction map of the cloned fragments was used
for subcloning smaller fragments. The restriction map as well as the clones and subclones
are shown in (Fig. 1). These smaller fragments were then purified, and submitted for
sequencing using universal primers for the common sequencing primer regions in the
multiple cloning site of pBluescript. In all, approximately 8-kb of the curvaticin FS47
operon was sequenced starting from the curvaticin FS47 proximal EcoRI site. The
remaining 2-kb of the operon, upto the distal EcoRI site was obtained by the vectorette
PCR approach. A PCR reaction was performed using a forward primer designated as ‘the
universal vectorette primer’ which has the specific EcoRI site incorporated and a reverse
primer designed from the known bacteriocin sequence designated as ‘the gene specific
59
primer’. Thus there was specific amplification of the 2-kb fragment. This approach was
employed to efficiently sequence orthologous gene regions. Thus 9.6-kb of the curvaticin
operon from one EcoRI site to the other EcoRI site was obtained.
Identifying the Open reading frames (ORF’s) related to the curvaticin FS47 operon.
The sequence of a 9.6-kb chromosomal region containing at least 26 open reading
frames (ORFs), 10 of which are predicted to play a role in curvaticin biosynthesis, is
presented. The operon shows the presence of two bacteriocins: i) a two component
bacteriocin structural gene (T-alpha and T-beta subunits), associated with its immunity
protein, these bacteriocin peptides are similar to the Sakacin T bacteriocin complex; ii) a
single component bacteriocin (curvaticin 47) structural gene associated with its immunity
protein. The inducing factor prepetide is also involved in biosynthesis. Most class II
bacteriocins produce a bacteriocin like peptide with no antimicrobial activity and use it as
an inducing factor (IF) to activate the transcription of the regulated genes. Two ORF’s
correspond to a well known two-component regulatory signal transduction system, the
histidine protein kinase (HPK) and the response regulator. The HPK when it senses a
certain concentration of bacteriocin in the environment autophosphorylates the histidine
residue and transfers the phosphate group to the response regulator which inturn activates
the transcription of the regulatory genes. A predicted protein was found homologous to
the ABC (ATP-binding cassette) transporter system of several other bacteriocin systems.
They are known to process the inducing factor prepetide and concomitantly export the
mature bacteriocin peptide to the outside of the cell. Apart from the bacteriocin
biosynthesis genes it is interesting to notice the presence of transposon related genes
(integrase and transposase like protein) at the flanking regions of the fragment. The
60
transposons maybe involved in the exchange of genetic material from other related
bacteriocin producing strains because several of these strains share the same cluster of
genes, e.g. L.curvatus and L.sakei (Fig. 2).
Comparing the curvaticin FS47 bacteriocin operon with other bacteriocin operons.
The curvaticin FS47 bacteriocin operon showed high homology (95%) to the L.
sakei IP-TX gene cluster. L. curvatus and L. sakei are known to be closely related
phylogenetically, thus high homology exists between the two. Homology of the
curvaticin FS47 gene cluster is also seen with other L.sakei bacteriocin gene clusters like
Sakacin P and Sakacin A (Fig. 3). Thus there is a probability that more than one
bacteriocin can co-exist in L. curvatus FS47.
Identifying the bacteriocin producing species.
Since the bacteriocin gene cluster between L. curvatus FS47 and L.sakei show
extremely high homology it was important to reconfirm the genomic identity of L.
curvatus FS47 (Fig. 3). A species-specific PCR DNA amplification was done to
distinguish between the bacteriocin producing FS47 strain and L.sakei. Amplification was
carried out using two sets of primers; one is the 16S rRNA-gene specific primer and the
other is the 16S/23S rDNA spacer region specific primers for L. curvatus and L. sakei
(Table 1). For the PCR amplification assay, each of the species-specific primers was
paired with the forward primer 16 from the 16S rRNA gene. The DNA from each strain
was PCR amplified in the presence of each pair of primers. For L. curvatus, amplification
was observed with the 16S/Lc primer pair only and not the 16S/Ls pair. Whereas, using
the L.sakei as the target DNA, amplification was seen only with the 16S/Ls primer pair
61
and not the 16S/Lc pair (Fig. 4). The primers developed thus allowed for the rapid
differentiation of species within two phylogenetically related groups. This proved that the
bacteriocin producing strain FS47 is different from L.sakei.
CONCLUSION
Sequence analysis of the 9.6-kb curvaticin operon revealed the presence of several genes
related to bacteriocin biosynthesis, regulation and transport. The bacteriocin related genes
are organized in several operons. There were two bacteriocins identified, i) a two
component bacteriocin (T alpha and beta subunits) and ii) a single component bacteriocin
(curvaticin FS47). There is high homology between the bacteriocin gene clusters of L.
curvatus FS47 and L. sakei. The identification of transposon-related sequences flanking
the curvaticin FS47 bacteriocin operon (and their involvement in other bacteriocin
operon) has been suggested as a possible vehicle for distribution of bacteriocin sequences
among LAB.
ACKNOWLEDGMENT
We like to thank Li Ma and M.A. Cousin for providing us with the clones and subclones
for the partial sequencing of the curvaticin FS47 operon. We would like to extend our
thanks to Dr. Desilva (OSU Animal Science Faculty) and his lab members for guiding us
with the vectorette PCR approach.
62
REFERENCES
1. Cleveland, J., T. J. Montville, I. F. Nes, and M. L. Chikindas. 2001.
Bacteriocins: safe, natural antimicrobials for food preservation. Int J Food
Microbiol 71:1-20.
2. Eijsink, V. G., L. Axelsson, D. B. Diep, L. S. Havarstein, H. Holo and I. F.
Nes. 2002. Production of class II bacteriocins by lactic acid bacteria; an example
of biological warfare and communication. Antonie Van Leeuwenhoek 81(1-
4):639-54.
3. Ennahar, S., N. Deschamps, and J. Richard. 2000. Natural variation in
susceptibility of Listeria strains to class IIa bacteriocins. Curr. Microbiol. 41:1-4.
4. Garver, K.I., and P.M. Muriana. 1993. Detection, identification, and
characterization of bacteriocin-producing lactic acid bacteria from retail food
products. Int. J. Food Microbiol. 19:241-258.
5. Garver, K.I. and P.M. Muriana. 1994. Purification and partial amino acid
sequence of curvaticin FS47, a heat-stable bacteriocin produced by Lactobacillus
curvatus FS47. Appl. Environ. Microbiol. 60(6):2191-5.
6. Nes, I.F., and H. Holo. 2000. Class II antimicrobial peptides from lactic acid
bacteria. Biopolymers 55:50-61.
63
7. O'sullivan, D. J., and T. R. Klaenhammer. 1993. Rapid Mini-Prep Isolation of
High-Quality Plasmid DNA from Lactococcus and Lactobacillus spp. Appl.
Environ. Microbiol. 59(8):2730-2733.
8. Riley, M.A. and J. E. Wertz . 2002. Bacteriocins: evolution, ecology, and
application. Annu. Rev. Microbiol. 56:117-37.
9. Tichaczek, P. S., R. F. Vogel and W. P. Hammes. 1993. Cloning and
sequencing of curA encoding curvacin A, the bacteriocin produced by
Lactobacillus curvatus LTH1174. Arch Microbiol. 160(4):279-83.
10. Vogel, R.F., M. Lohmann, M. Nguyen, A. N. Weller and W. P. Hammes.
1993. Molecular characterization of Lactobacillus curvatus and Lactobacillus
sake isolated from sauerkraut and their application in sausage fermentations. J.
Appl. Bacteriol. 74:295-300.
11. Wu, F.M., and P.M. Muriana. 1995. Genomic subtraction in combination with
PCR for enrichment of Listeria monocytogenes-specific sequences. Int. J. Food
Microbiol. 27:161-74.
64
Table 1. Sequences of oligonucleotide primers used to differentiate L.curvatus and L. sakei.
Primer Location 5’- 3’ sequence Specificity16 16S rRNA gene, 3’ end, forward GCTGGATCACCTCCTTTC 16S rRNA gene
Lc 16S/23S spacer region of L. curvatusDNA, reversed TTGGTACTATTTAATTCTTAG L. curvatus
Ls 16S/23S spacer region of L. sakei DNA,reversed ATGAAACTATTAAATTGGTAC L. sakei
Table 2. Sequences of oligonucleotide primers used in the Vectorette PCR Approach
Primer 5’- 3’ sequenceBlunt end vectorettebubble Oligo1. BPB I CAAGGAGAGGACGCTGTCTGTCGAAGGTAAGGAACGGACGAGAGAAGGGAGAG2. BPH II CTCTCCCTTCTCGAATCGTAACCGTTCGTACGAGAATCGCTGTCCTCTCCTTG
Universal vectoretteprimer 224 CGAATCGTAACCGTTCGTACGAGAATCGCT
Curvaticin Genespecific primer AACCTTAGATAGCACTGAAAGCTCA
65
Figure 1. Schematic of restriction map of L.curvatus FS47 chromosomal DNA. Only restriction enzyme sites relevant for theconstruction of the various subclones are shown. The sizes of the cloned fragments are indicated on the right. Asterisksrepresent subclones used for nucleotide sequencing.
66
Figure 2. Representation of the major open reading frames (ORFs) related to the curvaticin FS47 bacteriocin operon.The arrows represent the ORFs and their orientation indicates their direction of transcription. The vertical line in thecurvaticin T-alpha ORF represents the region where the probe hybridized.
Curvaticin FS47 Operon9673 bp
Transposase (Integrase)Transport Accessory Protein
Inducing PeptideResponse Regulator
Histidine Protein Kinase
ABC Transporter
Curvaticin T-alphaCurvaticin T-beta
Immunity ProteinCurvaticin 47 Bacteriocin
Curvaticin 47 ImmBrochocin Imm-like Protein
Transposase-like Protein
Eco RI (2) Eco RI (9669)
67
Figure 3. Comparison of the curvaticin FS47 operon with other known bacteriocin operons. Grey regions show highhomology with the Curvaticin FS47 gene cluster. The numbers indicate the base pairs.
1 2503
Lb. sakei IP-TX gene cluster
11,342 17,652
Lb. curvatus FS47 (9673 bp)
792 928 9,629 9,673
Lb. sakei Lb790 sakacin P gene cluster
1562 24891 13,181
1
Lb. sakei sakacin A gene cluster
86881482 2409
1
68
Figure 4. PCR amplification of species-specific DNA targets to help identify the bacteriocin-producing strain FS47. A combination of 16S rRNA-gene specific primers and primers for the 16S/23S rDNA spacer regions specific for either Lactobacillus curvatus (16S/Lc) or for L. sakei (16S/Ls) were used in the PCR reaction. L. curvatus FS47 PCR product (lanes 2); L. sakei 790 PCR product (lanes 6); 1--kb DNA ladder (lane 1)
1 2 3 4 5 6
Primer Combinations:16S/Lc -- 16S/Ls
DNA from: Lc Ls - Lc Ls
[ [1 2 3 4 5 61 2 3 4 5 6
Primer Combinations:16S/Lc -- 16S/Ls
DNA from: Lc Ls - Lc Ls
[ [
69
CHAPTER IV
USE OF ACQUIRED SPONTANEOUS RESISTANCE TO SCREEN BACTERIOCINS
OF LACTIC ACID BACTERIA INTO FUNCTIONAL INHIBITORY GROUPS
Sunita Macwana1 and Peter M. Muriana1,2
1Department of Animal Sciences &
2The Food & Agricultural Products Research & Technology Center,
Oklahoma State University
Stillwater, Oklahoma 74078
70
INTRODUCTION
Bacteriocins are ribosomally-synthesized peptides produced by many types of
bacteria that are inhibitory to sensitive organisms. There are so many bacteriocins
identified among members of lactic acid bacteria (LAB), that they have been classified
into 4 distinct classes (and additional subclasses) based on biochemical composition and
physical attributes (Klaenhammer, 1993). Since LAB are generally recognized as safe
(GRAS) for use in foods, bacteriocins produced by LAB have been proposed for use in
the biopreservation of food products by eliminating or controlling spoilage
microorganisms and pathogens (De Vuyst et al. 1994; Cleveland et al. 2001). Nisin is the
only bacteriocin to date approved for food preservation as a direct food additive (Thomas
et al. 2000), however pediocin-like bacteriocins are also used by virtue of GRAS
ingredients such as cultured milk or whey (Deegan et al. 2006). One concern regarding
the use of bacteriocins as food preservatives would be the possible occurrence of natural
or spontaneously-acquired bacteriocin resistance (BacR). Natural resistance to class IIa
bacteriocins has been reported in 1 to 8% of tested wild-type strains of LAB (Ennahar et
al. 2000, Larsen and Norrung, 1993, Rasch and Knochel, 1998) and variations in natural
sensitivity to nisin have also been observed in frequencies ranging from <10−9 to 10−5
(Bouttefroy and Milliere, 2000, De Martinis et al. 1997, Ming and Daeschel, 1993).
Innate, or inherent resistance, may be due to the inability of the target strain to bind
bacteriocin or due to production of proteinase(s) which may provide partial protection by
cleaving extracellular molecules of bacteriocins. Spontaneous resistant mutants have also
been observed at low frequency (10-8-10-9) upon first exposure of sensitive strains to
71
bacteriocin and in which sensitivity to bacteriocin was diminished upon subsequent
exposure (Guinane et al. 2006).
Efforts to improve bacteriocin functionality as a biopreservative have included
proposals to use mixtures of multiple bacteriocins (Muriana, 1996). The occurrence of
cross-resistance to multiple bacteriocins has also been observed which may defeat the
intention of using multiple bacteriocins (Deegan et al. 2006). However, by characterizing
bacteriocins into groups based on same-type mutational resistance may be a useful
functional approach to selecting which mixtures of bacteriocins are best suited for
application in foods without the development of resistance. Spontaneously-acquired
resistance to bacteriocins does not make the organism immune to all bacteriocins, but
only to those that are affected by the same mutational event, and therefore belong to the
same ‘resistance class’. By screening and grouping bacteriocins based on resistance class,
we should be able to classify them into different functional inhibitory groups (i.e., groups
for which spontaneous resistance would give cross-resistance) and therefore allow for the
selection of ideal mixtures of bacteriocins that would belong to different resistance
classes. In this paper, L. monocytogenes 39-2 and BacR variants derived from it, were
used as indicator strains to screen for bacteriocin-producing LAB from food samples.
These bacteriocins were then categorized into different ‘resistance classes’ based on their
inhibitory profiles against specific spontaneously-acquired bacteriocin resistance events.
The use of mixtures of bacteriocins from different ‘resistance classes’ would have greater
likelihood to overcome spontaneous resistance based on a single mutational event.
72
MATERIALS AND METHODS
Bacterial growth conditions.
Bacterial strains used in this study were either from our culture collection or were
isolated from food products. Lactic acid bacteria were grown in MRS broth (Difco
Laboratories, Detroit, Mich.) or on 1.5% (w/v) MRS agar and incubated at 30°C under
static conditions. Cultures were transferred three times in MRS broth before use. Our
LAB cultures were maintained as frozen stocks at -80°C in MRS (or in BHI for Listeria)
broth with 10% glycerin. Listeria monocytogenes 39-2, Scott A, and subsequent BacR
derivatives used as indicator strains, were propagated in Brain Heart Infusion (BHI) broth
(VWR Laboratories, Suwanee, GA) or on 1.5% (w/v) BHI agar and incubated at 30°C.
Bacteriocin detection and assay.
Bacteriocin activity was assayed by the spot-on-lawn method (Muriana and
Klaenhammer, 1991). Five ml of 0·75% (w/v) tryptic soy (TS) soft agar, inoculated with
1% (v/v) of an overnight culture of the sensitive indicator strain was overlaid onto
prepoured TS agar (1·5%, w/v) plates. Two-fold serial dilutions of each pH-adjusted (pH
7.0) and filter-sterilized bacteriocin sample were made in 0.1% buffered peptone water
(BPW) in 96-well microtiter plates (Falcon, Fischer Scientific, Pittsburgh, PA). Ten µl of
each serial dilution was spotted onto the soft seeded agar overlays; these plates were
marked in ‘pie’ sections and provided for 8 spot assays per plate. Assay plates were
incubated at 30°C for 18 h. Activity was defined as the reciprocal of the highest dilution
73
exhibiting complete inhibition of the indicator lawn, expressed in arbitrary units (AU) per
milliliter.
Isolation of bacteriocin-producing Lactic Acid Bacteria from foods.
Various foods including raw/ground meats, produce, and dairy products were
purchased from a local supermarket and sampled within 48 h. Samples (50 g) were
weighed aseptically into sterile stomacher bags, diluted 1:10 with MRS broth, stomached,
sealed, and incubated overnight at 30°C for enrichment of LAB. Dilutions of these
samples were spread plated onto MRS agar, covered with a 5-ml layer of sterile MRS
agar ‘sandwich’ layer to cover plated cells (so that the subsequent indicator overlay
would not smear exposed surface colonies), and incubated at 30°C for 14-24 h until
small-colony growth was evident. Deferred antagonism was used for the detection of
colonies producing bateriocins as previously described by Muriana and Klaenhammer
(1987). Plates with ‘sandwiched’ colonies were overlayed with 5 ml of soft MRS agar
seeded with a 1% inoculum of Lactobacillus delbrueckii subsp lactis 4797 as the
indicator strain and further incubated overnight at 30°C. Bacteriocins produced by the
underlying colonies would diffuse through the sandwich layer and appear as zones of
inhibition in the indicator layer above. Bacteriocin-producing colonies were recovered by
flipping the agar into the cover and recovering cells from the colonies through the sterile
backside agar. This colony was streaked onto MRS agar for isolation and confirmed for
bacteriocin production by patch-plating multiple colonies from the streak onto plates that
would be overlayed with the indicator strain, Lactobacillus delbrueckii subsp lactis 4797.
The confirmed bacteriocin-producing isolate would be recovered from duplicate plates
74
not overlayed with indicator. Based on the testing with proteolytic enzymes to inactivate
proteinaceous bacteriocins, these inhibitors were identified as bacteriocins.
Identification of bacteriocin-producing Lactic Acid Bacteria.
The identification and biochemical characterization of the bacteriocin producing
isolates was determined using API 50 CH panels (bioMerieux Inc., Fischer Sci.). Briefly,
bacteriocin-producing LAB cultures from overnight growth in broth were harvested by
centrifugation (4000 RPM) and the supernatant fraction was discarded. The cell pellet
was washed twice with 10 ml of Carbohydrate Lactic Acid (CHL) broth used in
conjuction with the API 50CHL test assay and the final resuspension was aliquoted into
the API 50 CH panels. The panel strips (consisting of various substrates) were incubated
aerobically at 30°C and scored at 24- and 48 hrs. The carbohydrate fermentation patterns
were scored and checked against the manufacturer’s computerized CHL database to
obtain results.
Preparation of bacteriocin culture supernatants.
Bacteriocin-producing strains (Bac+) were inoculated into MRS at a 1% inoculum
level and propagated twice overnight at 30°C before use and then harvested after 15 hrs
incubation for use in recovering bacteriocin-containing supernatant fractions. The
supernatant was adjusted to pH 7.0 with 0.5 M NaOH. A cell-free supernatant was
obtained by centrifuging (4000 RPM) the culture, followed by filtration of the
supernatant through a 0.2 µm-pore-size cellulose acetate filter. Inhibitory activity from
any hydrogen peroxide that may have been produced by the culture was eliminated by the
addition of catalase (10 IU/ml). Activity was determined as described earlier.
75
Derivation of spontaneous bacteriocin-resistant strains of L. monocytogenes.
Cell-free filter-sterilized bacteriocin fractions produced by various bacterial
genera of LAB were spotted onto indicator overlays containing L. monocytogenes 39-2 or
Scott A-2. After 3-5 days of extended incubation, colonies of L. monocytogenes 39-2 and
Scott A-2 appeared in the inhibition zones. These colonies were additionally streaked
onto TS agar plates upon which 1-ml of the respective bacteriocin extract (105-106
AU/ml) was spread prior to streaking. The indicator isolate recovered from the
bacteriocin inhibition zone and bacteriocin streak plate was then compared to the wild-
type indicator in comparative spot tests with serial dilutions of bacteriocin extracts (to
confirm bacteriocin resistance) and checked on both MOX agar and antibiotic-containing
TS agar to antibiotics (100 µg Streptomycin/ml and 10 µg Rifamycin/ml) against which
the original indicator strain was resistant (to confirm identity as the original indicator
strain). Resistance in BacR L. monocytogenes 39-2 was compounded to include resistance
to additional bacteriocins against which the BacR derivative was still sensitive by
repeating this process.
Bacteriocin inhibitory assay in culture broth.
Bacteriocin inhibitory assays were tested against the wild-type L. monocytogenes
39-2 strain in liquid culture. Listeria monocytogenes 39-2 was inoculated into BHI broth
at ~106 CFU/ml and assays included the addition of pH-adjusted filter-sterilized spent
media from a non-bacteriocin producing lactic (i.e., control), pH-adjusted and filter-
sterilized filtrates for each of 3 different ‘resistance-class’ groupings of bacteriocins we
identified (individually), as well as a combination of the 3 bacteriocins belonging to 3
76
different resistance classes. The combination was obtained by addition of an equal
amount of each bacteriocin and then using 1 ml for inoculation (the same amount of each
of the individual bacteriocins). Addition of 1 ml of bacteriocin-free media or bacteriocin
preparation was then added to 9 ml broth of each of the solutions mentioned above.
Samples of each were retrieved at 0, 1, 2, 6, 12, 24, 48, 72, and 96 hrs for plate counts of
L. monocytogenes 39-2. Trials were performed in duplicate.
Statistical analysis.
All trials were performed in duplicate and the data were subjected to one-way
repeated measures analysis of variance (RM ANOVA) to determine the differences
between the different treatments using Sigma Stat 3.1 (Systat Software, Inc., Richmond,
USA). All pair-wise, multiple comparisons were by the Holm-Sidak method.
77
RESULTS AND DISCUSSION
Bacteriocin resistance and cross-resistance.
During routine ‘spot-on-lawn’ assays, we noticed that for some indicator
organisms, including L. monocytogenes, bacteriocin-resistant (BacR) colonies would
often appear within inhibition zones upon extended incubation. We compared the
sensitivity of wild-type and spontaneous BacR derivatives obtained individually against 4
bacteriocins (nisin produced by L. lactis ATTC 11454, curvaticin FS47 produced by
Lactobacillus curvatus FS47, pediocin PA-1 produced by Pediococcus acidilactici
PAC1.0, and lacticin FS56 produced by Lactococcus lactis FS56) with L. monocytogenes
39-2 and Scott A-2 against five bacteriocin preparations: nisin, curvaticin FS47, pediocin
PA-1, lacticin FS56, and lacticin FS92. The wild-type strains of L. monocytogenes, Scott
A-2 and 39-2, were sensitive to all 5 bacteriocins tested (Table 3). We were not able to
isolate a derivative that was completely insensitive to nisin, but only one which had a
reduced MIC. However, with both L. monocytogenes Scott A-2 and 39-2, we were able to
isolate BacR derivatives that were completely resistant in spot-on-lawn tests using the
highest concentration of bacteriocins that we obtained from culture supernatant fractions
(Table 3). The BacR variants not only had resistance to the bacteriocin against which they
were obtained against, but several demonstrated cross-resistance reactions to other
bacteriocins (Table 3). This trend was obtained with both L. monocytogenes Scott A-2
and 39-2.
78
Functional classification into ‘resistance groups’ or ‘classes’.
The practical implications of this are that a resistance event against one of this
group of bacteriocins would provide resistance against all three since cross-resistance
was obtained for 2 bacteriocins without the strain having had exposure to them. An
important consideration to make is that if one, or several, of these bacteriocins were
intended for use as biopreservatives in foods, how readily such an event would occur. We
determined that the frequency of spontaneous resistance was in the range of 10-6-10-7, and
is consistent with the range observed by Graveen et al. (2002). The independent
mutational event that occurred upon selection against each of the individual bacteriocins
must be a common mechanism for all three bacteriocins, since the change that affected
inhibition was previously demonstrated by all three of them. We choose to refer to this
situation as having identified three bacteriocins of the same ‘resistance class’ because we
used resistant variants to identify the occurrence. The cross-resistance observed between
pediocin PA-1-, lacticin FS56-, and curvaticin FS47-resistant isolates of L.
monocytogenes and these three bacteriocins did not extend to nisin or lacticin FS92,
indicating that either the mode of inhibition by these bacteriocins and/or their mechanism
of resistance/immunity, is not the same. Lacticin FS92 did not blot with a nisin gene
probe and both bacteriocins inhibit the respective producer organism demonstrating that
they are not the same bacteriocin or share the same immunity (data not shown). This
suggests that nisin, lacticin FS92, and the group comprising lacticin FS56, curvaticin
FS47, and pediocin PA-1 belong to three different ‘resistance’ groups. We felt that it was
possible to use the spontaneous-resistant isolates as a ‘screen’ for bacteriocins that were
of a different ‘resistance class’ (i.e., those that would demonstrate inhibitory activity
79
against the resistant isolate) and therefore, cross-resistance would only be observed by
different bacteriocins of the same resistance class.
Use of spontaneously-derived bacteriocin-resistant isolates as indicators for
different resistance classes of bacteriocins.
When all five bacteriocins that inhibited L. monocytogenes 39-2 (Fig. 5A) were
spotted on the lacticin FS56R variant, activity from three bacteriocins that belonged to the
same ‘resistance class’ was eliminated (Fig. 5B). We consider the bacteriocins that were
still inhibitory to the FS56R strain of L. monocytogenes 39-2 as belonging to a different
‘resistance class’. Furthermore, we were able to generate variants that were resistant to
multiple resistance classes by re-selection of resistant variants against bacteriocins of a
different resistance class. The new resistant variants were able to compile multiple
resistances to additional bacteriocins (Fig. 5C). Using the L. monocytogenes strain that
was resistant to two resistance classes of bacteriocins (FS56R and Bac3R), we screened
for bacteriocins in our collection that were still inhibitory to this variant (lacticin FS97,
Fig. 5C). When we again selected for resistance to lacticin FS97 using the strain of L.
monocytogenes 39-2 that was resistant to two bacteriocins (comprising two different
resistance classes, lacticin FS56R and pediocin Bac3R), we were able to further eliminate
inhibitory activity from lacticin FS97, and consider this bacteriocin as belonging to a 3rd
resistance class (Fig. 5D). The compounding of multiple resistances in aggregate is
presumably due to different mutational events specific to the particular ‘resistance class’
addressed. This bacteriocin resistant strain was resistant to all 5 bacteriocins comprising 3
‘resistance classes’ and yet was still sensitive to nisin (i.e., a 4th resistance class; data not
shown). However, we were not able to isolate a variant that demonstrated complete
80
resistance against nisin. We propose the use of these BacR strains with aggregate
accumulation of multiple resistances, may be useful in screening for bacteriocins that
would still inhibit them and to assist in the identification of bacteriocins of different
resistance classes (i.e., of different mechanisms of inhibition against which different
mutations may afford protection). The identification of what resistance class an unknown
bacteriocin belongs to would only be accommodated by a series of resistance isolates,
each derived against a different resistance-class bacteriocin (as in Table 3), or, unless
tested against the entire series of indicators we have derived, each having resistance
against an additional class (as in Fig. 5).
Anti-listerial bacteriocins and ‘resistance classes’ of Lactic Acid Bacteria isolated
from foods.
Using this approach of resistance-class indicators, we examined Bac+ LAB
isolated from retail foods for presence of multiple resistance class bacteriocins that we
previously identified. Thirty-eight Bac+ LAB were isolated from seventy-five samples of
retail foods via deferred antagonism using Lb. delbrueckii 4797, one of the most sensitive
indicators of bacteriocins from LAB that we have tested (Table 4). The Bac+ LAB were
then tested for inhibition of L. monocytogenes 39-2 and the various bacteriocin-resistant
mutant strains we isolated to screen and group the bacteriocins into resistance classes. Of
the 38 Bac+ LAB detected with our sensitive lactic indicator, only 16 were inhibitory to
L. monocytogenes 39-2 (Table 4). Of these 16 bacteriocins, activity against 14 was
eliminated using the lacticin FS56R variant (also the same as the pediocin PA-1 and
curvaticin FS47-resistant variants). When tested against the double resistance class L.
monocytogenes 39-2 indicator strain (FS56R Bac3R), activity was only demonstrated by 2
81
of the 4 that inhibited the single resistance class indicator strain, and no activity was
observed against the triple resistance class isolate (Table 4). The data indicate that
bacteriocins produced by LAB that are generally present on food products, can be
grouped according to mutational resistance events as presented in our typing scheme. The
practical significance is that this information may provide a method by which one can
design a mixture of bacteriocins that may be used to reduce, or eliminate, the possibility
of spontaneous resistance occurring against bacteriocins when used as preservatives in
foods.
Inhibitory assay demonstrating the practical functionality of different resistance-
class groupings.
The concept of combining different bacteriocins is not new. Genetically modified
L. lactis FI5876, containing both pediocin PA-1 and nisin A which are unrelated
bacteriocins was developed by Horn et al. (1998, 1999). When used as a starter culture in
fermented dairy products, this modified strain prevented the emergence of any
bacteriocin-resistant isolates of L. monocytogenes because the frequency for emergence
of a strain resistant to both peptides was low. Treatment with a combination of
bacteriocins, for instance, nisin and a class IIa bacteriocin, would theoretically reduce the
incidence of resistance (Bouttefroy and Milliere 2000, Vignolo et al. 2000). There is
currently conflicting evidence as to whether resistance to one class of LAB bacteriocins
can result in cross-resistance to another class (Bouttefroy et al. 2000, Song and Richard,
1997). To our knowledge, there have been no reports on grouping of bacteriocins into
different resistance classes. The novelty of using mixtures of bacteriocins of different
resistance classes would be that they would require a separate mutational event to render
82
the strain resistant against the mixture. A single spontaneous resistance event may occur
at a frequency of 10-6-10-7 (our estimates with the resistances we obtained) when faced
with a population of Listeria. When the Listeria would come up against a mixture of 3
bacteriocins of the same ‘resistance class’, a spontaneous mutant would render that
mutant resistant to all 3 bacteriocins. However, if the 3 bacteriocins were of different
resistance classes and used in combination, it would require that event to occur
simultaneously for 3 different mutational targets in the same target cell, a less-likely
event. We examined this by performing liquid inhibition assays using individual and a
combination assay of bacteriocins belonging to 3 resistance classes against wild-type
(sensitive) strain, L. monocytogenes 39-2 (Fig. 6). Our data shows that the strain grew
unimpeded in the inoculated medium (as expected), however cultures to which each of
the individual resistance-class bacteriocins were added were inhibited followed by quick
recovery and regrowth. However, a mixture of all 3 bacteriocins containing only 1/3 the
amount of any one of the bacteriocins used in the individual assays, provided a
significant difference in treatment that was sufficient to prevent regrowth of Listeria for
an extended period of time (Fig. 6). Although we may have used too high an inoculum of
Listeria for which there may not have been enough bacteriocin to accommodate all of the
cells, the difference in the outgrowth of the population of L. monocytogenes in the
individual and combination treatments gives a good demonstration of the utility of
selecting mixtures of bacteriocins that belong to different resistance classes. This may
also demonstrate that there is some synergy involved with the mixture, as it contained
only 1/3 the amount of each bacteriocin in the individual assays.
83
Although there are reports of the development of resistance towards single
bacteriocins, this study suggests that a combination of different resistance-class
bacteriocins, used as ‘biopreservatives’, could minimize or eliminate the appearance of
BacR variants in food applications, thus providing the broadest immunity and protection
from pathogens or spoilage microorganisms. Selection for bacteriocin-resistant (BacR)
variants of L. monocytogenes resulted in strains that were resistant to one or more
bacteriocins and demonstrated that resistance to one bacteriocin can provide cross-
resistance to others (Fig. 5). Cross-resistance is well known in the medical community
with regards to antibiotic treatment of bacterial infections, whereby different antibiotic
classes are often required to effectively combat stubborn microorganisms. We have
demonstrated that cross-resistance also occurs for various groups of bacteriocins and the
same approach of different ‘resistance classes’ can best inhibit strains that may otherwise
develop resistance to a single bacteriocin.
ACKNOWLEDGEMENTS
This work was supported in part by the VPR Homeland Security Fellowship program, the
FAPC Research Assistantship program, and the Oklahoma Agricultural Experiment
Station, Oklahoma State University (HATCH project no. 2335), Stillwater, OK. We
thank Ms. Janet Rogers (OSU Core Facility) in assistance with DNA sequencing
reactions and obtaining sequence information.
84
REFERENCES
1. Bouttefroy, A., and J. B. Milliere. 2000. Nisin-curvaticin 13 combinations for
avoiding the regrowth of bacteriocin resistant cells of Listeria monocytogenes
ATCC 15313. Int J Food Microbiol 62:65-75.
2. Cleveland, J., T. J. Montville, I. F. Nes, and M. L. Chikindas. 2001.
Bacteriocins: safe, natural antimicrobials for food preservation. Int J Food
Microbiol 71:1-20.
3. Deegan, L.H., P.D. Cotter, C. Hill, and P. Ross. 2006. Bacteriocins: Biological
tools for bio-preservation and shelf-life extension. Intl. Dairy J. 16:1058-1071.
4. De Martinis, E. C. P., A. D. Crandall, A. S. Mazzotta, and T. J. Montville.
1997. Influence of pH, salt, and temperature on nisin resistance in Listeria
monocytogenes. J. Food Prot. 60:420-423.
5. De Vuyst, L., and E. J. Vandamme. 1994. Bacteriocins of lactic acid bacteria:
microbiology, genetics and applications. Blackie Academic & Professional,
London, United Kingdom.
6. Ennahar, S., N. Deschamps, and J. Richard. 2000. Natural variation in
susceptibility of Listeria strains to class IIa bacteriocins. Curr Microbiol 41:1-4.
7. Gravesen, A., A. M. Jydegaard Axelsen, J. Mendes da Silva, T. B. Hansen,
and S. Knochel. 2002. Frequency of bacteriocin resistance development and
85
associated fitness costs in Listeria monocytogenes. Appl Environ Microbiol
68:756-64.
8. Guinane, C.M., P.D. Cotter, C. Hill, and R.P. Ross. 2006. Spontaneous
resistance in Lactococcus lactis IL1403 to the lantibiotic lacticin 3147. FEMS
Microbiol. Lett. 260:77-83.
9. Horn, N., Martinez, M.I., Martinez, J.M., Hernandez, P.E., Gasson, M.J.,
Rodriguez, J.M., and H.M. Dodd. 1998. Production of pediocin PA-1 by
Lactococcus lactis using the lactococcin A secretory apparatus. Appl. Environ.
Microbiol. 64:818-23.
10. Horn, N., Martinez, M.I., Martinez, J.M., Hernandez, P.E., Gasson, M.J.,
Rodriguez, J.M., and H.M. Dodd. 1999. Enhanced production of pediocin PA-1
and coproduction of nisin and pediocin PA-1 by Lactococcus lactis. Appl.
Environ. Microbiol. 65:4443-50.
11. Klaenhammer, T. R. 1993. Genetics of bacteriocins produced by lactic acid
bacteria. FEMS Microbiol Rev 12:39-85.
12. Larsen, A. G., and B. Nørrung. 1993. Inhibition of Listeria monocytogenes by
bavaricin A, a bacteriocin produced by Lactobacillus bavaricus MI401. Lett.
Appl. Microbiol. 17:132-134.
13. Ming, X., and M. A. Daeschel 1993. Nisin resistance of foodborne bacteria and
the specific resistance responses of Listeria monocytogenes Scott A. J. Food Prot.
56:944-948.
86
14. Muriana, P.M. 1996. Bacteriocins for control of Listeria. J. Food Prot.
59(suppl.):54-63.
15. Muriana, P.M., and T.R. Klaenhammer. 1987. Conjugal transfer of plasmid-
encoded determinants for bacteriocin production and immunity in Lactobacillus
acidophilus 88. Appl. Environ. Microbiol. 53:553-560.
16. Muriana, P.M., and T.R. Klaenhammer. 1991. Purification and partial
characterization of lactacin F, a bacteriocin produced by Lactobacillus acidophilus
11088. Appl. Environ. Microbiol. 57:114-121.
17. Rasch, M., and S. Knochel. 1998. Variations in tolerance of Listeria
monocytogenes to nisin, pediocin PA-1 and bavaricin A. Lett Appl Microbiol
27:275-8.
18. Song, H.J., and J. Richard. 1997. Antilisterial activity of three bacteriocins used
at subminimal inhibitory concentrations and cross-resistance of the survivors. Int.
J. Food Microbiol. 36:155–61.
19. Thomas, L., M. R. Clarkson, and J. Delves-Broughton. 2000. Nisin, In A. S.
Naidu (ed.). Natural food antimicrobial systems CRC Press, Boca Raton, Fla.
463-524.
20. Vignolo, G., Palacios, J., Farias, M.E., Sesma, F., and U. Schillinger. 2000.
Combined effect of bacteriocins on the survival of various Listeria species in
broth and meat system. Curr. Microbiol. 41:410–16.
87
Table 3. Sensitivity reactions of bacteriocins spotted on various indicator lawns of L. monocytogenes, including those for which spontaneous bacteriocin resistance was acquired.
Cell-free Bacteriocins Extracts (spotted on indicator lawn) Indicator Lawn Bacteria1
Nisin Curvaticin FS47
Pediocin PAC1.0
Lacticin FS56
Lacticin FS92
L. monocytogenes Scott A S S S S S L. monocytogenes Scott A (NisinR) S2 S S S S
L. monocytogenes Scott A (curvaticin FS47R) S R R R S
L. monocytogenes Scott A (pediocin PACR) S R R R S
L. monocytogenes Scott A (lacticin FS56R) S R R R S
L. monocytogenes 39-2 S S S S S L. monocytogenes 39-2 (NisinR) S* S S S S
L. monocytogenes 39-2 (curvaticin FS47R) S R R R S
L. monocytogenes 39-2 (pediocin PACR) S R R R S
L. monocytogenes 39-2 (lacticin FS56R) S R R R S1 Resistance to specific bacteriocin is denoted with a superscript “R” (NisinR). 2Note: Reduced MIC was observed to nisin, but not complete resistance. Reactions: S = sensitive (zone of inhibition obtained); R = resistant (no inhibition detected).
88
Table 4. Lactic acid bacteria (LAB) and Bac+ LAB isolated from retail foods. Sensitivity to L.monocytogenes
(indicator strain) Food
Sample No. Food Samples
No. of Bac+
Isolatesa 39-2 W-T
39-2 FS56R
39-2 FS56R
Bac3R
39-2 FS56R
Bac3R
FS97R
Raw Meat:
Ground Beef 8 3 3 - - -Ground Pork 26 12 5 1 - -
Ground Turkey 18 9 5 1 - - Ground Chicken 5 2 - - - -
Raw Beef 2 - - - -Raw Pork 2 1 1 1 1 -Raw Chicken 1 1 - - - -
Diary: Cheese 6 3 - - - -
Produce: Vegetables 4 4 1 1 1 -Mushrooms 1 1 1 - - -Fruits 2 2 - - - -
Total 75 38 16 4 2 0 a Lb. delbrueckii 4797 used as the indicator strain
89
Figure 5. Inhibitory zones of select filter-sterilized, pH-adjusted (pH 7.0) bacteriocin extracts on indicator lawns of L.monocytogenes 39-2 (wild-type) and bacteriocin-resistant derivatives (as listed above the plates). Panel A, inhibition zonesagainst L. monocytogenes 39-2 using 5 bacteriocins: curvaticin FS47 (Lactobacillus curvatus FS47), pediocin PAC1.0(Pediococcus acidilactici PAC1.0), lacticin FS56 (Lactococcus lactis FS56), lacticin FS97 (L. lactis FS97), and pediocin Bac3(P. acidilactici Bac3). Panel B, activity of the same 5 bacteriocins against L. monocytogenes 39-2 resistant to lacticin FS56(FS56R). Panel C, activity of the same bacteriocins against L. monocytogenes 39-2 resistant to lacticin FS56 and pediocinBac3 (FS56RBac3R). Panel D, activity of the same bacteriocins against L. monocytogenes 39-2 resistant to lacticin FS56,pediocin Bac3, and lacticin FS97 (FS56R Bac3R FS97R).
A B C D
Wild-Type Class 1 Resistance Class 2 Resistance Class 3 ResistanceL.mono 39-2 L. mono 39-2 L. mono 39-2 L. mono 39-2(wild type) (FS56R) (FS56R Bac3R) (FS56R Bac3R FS97R)
90
Figure 6. Liquid inhibition assay of inidividual bacteriocins or in combination against L. monocytogenes 39-2. Panel A,cultures of L. monocytogenes 39-2 alone (control), or to which each of 3 resistance class bacteriocins or mixture of the 3resistance classes were added (lacticin FS56, pediocin Bac3, or lacticin FS97). Panel B, similar to panel A but comparing twocombination assays: one combination contains 3 of the same resistance class bacteriocins (lacticin FS56, curvaticin FS47,pediocin PA-1) whereas the other has 3 different resistance class bacteriocins (lacticin FS56, pediocin Bac3, and lacticinFS97). Treatments with different lowercase letters are significantly different (P < 0.05).
Time (hrs)0 12 24 36 48 60 72 84 96
Log
CFU
/ml
0
1
2
3
4
5
6
7
8
9
10
ControlClass 1 BacClass 2 BacClass 3 BacCombo (1+2+3)
Time (hrs)0 12 24 36 48 60 72 84 96 108 120 132 144
Log
CFU
/ml
0
1
2
3
4
5
6
7
8
9
10
Control3x Class-1 ComboClass 1+2+3 Combo
A B
a a
b
bb
c
b
c
Time (hrs)0 12 24 36 48 60 72 84 96
Log
CFU
/ml
0
1
2
3
4
5
6
7
8
9
10
ControlClass 1 BacClass 2 BacClass 3 BacCombo (1+2+3)
Time (hrs)0 12 24 36 48 60 72 84 96 108 120 132 144
Log
CFU
/ml
0
1
2
3
4
5
6
7
8
9
10
Control3x Class-1 ComboClass 1+2+3 Combo
A B
Time (hrs)0 12 24 36 48 60 72 84 96
Log
CFU
/ml
0
1
2
3
4
5
6
7
8
9
10
ControlClass 1 BacClass 2 BacClass 3 BacCombo (1+2+3)
Time (hrs)0 12 24 36 48 60 72 84 96 108 120 132 144
Log
CFU
/ml
0
1
2
3
4
5
6
7
8
9
10
Control3x Class-1 ComboClass 1+2+3 Combo
Time (hrs)0 12 24 36 48 60 72 84 96
Log
CFU
/ml
0
1
2
3
4
5
6
7
8
9
10
ControlClass 1 BacClass 2 BacClass 3 BacCombo (1+2+3)
Time (hrs)0 12 24 36 48 60 72 84 96 108 120 132 144
Log
CFU
/ml
0
1
2
3
4
5
6
7
8
9
10
Control3x Class-1 ComboClass 1+2+3 Combo
A B
a a
b
bb
c
b
c
91
CHAPTER V
USE OF PCR ARRAYS TO QUICKLY IDENTIFY BACTERIOCIN-RELATED
SEQUENCES IN BACTERIOCINOGENIC LACTIC ACID BACTERIA.
Sunita Macwana1 and Peter M. Muriana1,2
1Department of Animal Sciences &
2The Food & Agricultural Products Research & Technology Center,
Oklahoma State University
Stillwater, Oklahoma 74078
92
INTRODUCTION
Bacteriocins are ribosomally-synthesized peptides produced by many types of
bacteria that are inhibitory to sensitive organisms. Since lactic acid bacteria (LAB) are
generally recognized as safe (GRAS) for use in foods, those produced by LAB have been
proposed for use in the biopreservation of food products by eliminating or controlling
spoilage microorganisms and pathogens (De Vuyst and Vandamme, 1994). Due to
potential food-related applications, many bacteriocins of LAB have been identified and
characterized, both biochemically and genetically (Cleveland et al. 2001). Since 1984
through 2006, more than 1000 papers have been published characterizing bacteriocins
from LAB. Each newly identified Bacteriocin-positive (Bac+) strain that shows promising
phenotypic traits presents a challenge in determining whether it has already been studied
and characterized.
Bacteriocins of LAB have been classified into four distinct classes based on
biochemical and functional characteristics (Klaenhammer, 1993). Class I (or lantibiotics)
are bacteriocins characterized by the presence of unusual amino acids such as
lanthionine. Nisin is a well characterized and broadly used bacteriocin in this class. Class
II bacteriocins are small, heat-stable, non-lanthionine peptides (Nes et al. 1996), which
are divided into three subgroups: class IIa or pediocin-like bacteriocins with strong
antilisterial activity, class IIb bacteriocins whose activity depends on the complementary
action of two peptides which form poration complexes and class IIc are Thiol-activated
peptides in which reduced cysteine residues are required for activity and are sec-
dependent secreted bacteriocins. Class III bacteriocins are large, heat-labile bacteriocins
93
(M.W.>30 kDa). Class IV bacteriocins are complex compounds claimed to consist of an
undefined mixture of chemical moieties such as proteins, carbohydrates, and lipids that
are required for activity. Most of the bacteriocins that have been defined belong to class I
or II.
Class II bacteriocins of LAB have emerged in recent years as the most promising
bacteriocin candidates for food preservation as they display overall better performance in
biological activity and physicochemical properties than most bacteriocins from other
classes (Klaenhammer, 1993; Nes et al. 1996; Ennahar et al. 1999, 2000; Nes and Holo,
2000; Garneau et al. 2002). Class II bacteriocin gene clusters are typically built up of
three gene modules: (1) a module that encompasses the structural and immunity genes,
(2) a transport gene module and (3) a regulatory gene module. The latter module encodes
a three-component regulatory system, responsible for the control of bacteriocin
production and consisting of a secreted bacteriocin-like, cationic peptide pheromone, a
histidine protein kinase (HPK), and a response regulator (RR) (Nes and Eijsink, 1999).
The genes that code for the LAB bacteriocins vary in size from 100- 250 bp in length.
In this paper, the DNA from Bac+ strains and new food isolates were subjected to
a bacteriocin-specific PCR array in individual reactions with primers for forty-two known
structural genes of bacteriocins from LAB. Sequencing of the amplimers followed by
sequence analysis helped determine if the identify of the sequences were pre-existent
with others currently available in GenBank or were new sequences. This study uses a
bacteriocin structural gene PCR array to amplify and obtain sequence information to
allow for quick and facile discovery of new bacteriocins among LAB.
94
MATERIALS AND METHODS
Bacterial strains and growth conditions
Bacterial strains used in this study are described in Table 5. LAB were grown in
MRS broth (Difco Laboratories, Detroit, Mich.) or on MRS agar and incubated at 30°C
under static conditions. Cultures (0.1%) were transferred three times in MRS broth
incubated at 30°C for 24 h before use. LAB cultures were maintained as frozen stocks at -
80°C in MRS broth with 10% glycerin.
Isolation of bacteriocin-producing Lactic Acid Bacteria from foods
Various foods including raw/ground meats, produce, and dairy products were
purchased from a local supermarket and sampled within 48 h. Samples (50 g) were
weighed aseptically into sterile stomacher bags, diluted 1:10 with MRS broth, stomached,
sealed, and incubated overnight at 30°C for enrichment of LAB. Dilutions made in 0.1%
peptone water were plated onto MRS agar, covered with a 5-ml layer of sterile MRS agar
‘sandwich’ layer to cover plated cells, and incubated at 30°C for 14-24 h until small-
colony growth was evident. Plates with the sandwiched colonies were then overlayed
with 5 ml of soft MRS agar seeded with a 1% inoculum of Lactobacillus delbrueckii
subsp lactis 4797 as the indicator strain and further incubated overnight at 30°C.
Bacteriocins produced by the underlying colonies would diffuse through the sandwich
layer and appear as zones of inhibition in the indicator layer above. Bacteriocin-
producing colonies (Bac+) were recovered by flipping the agar into the cover and
95
recovering cells from the colony through the sterile backside agar. This colony was
streaked onto MRS agar for isolation and confirmed for bacteriocin production.
Identification of bacteriocin-producing Lactic Acid Bacteria
The identification and biochemical characterization of the bacteriocin-producing
isolates was determined using API 50 CH panels (bioMerieux Inc., Fischer Sci.). The
manufacturer’s directions were modified by using overnight growth in broth instead of
cells recovered from agar plates. The broth cultures were harvested by centrifugation and
the supernatant fraction was discarded. The cell pellet was washed twice with 10 ml of
Carbohydrate Lactic Acid (CHL) broth and the final resuspension was aliquoted into the
API 50 CH panels. The panel strips (consisting of various substrates) were incubated
anaerobically (GasPak) at 30°C for 48 h. If a carbohydrate was fermented, the acids
generated produced a yellow color, indicating a positive reaction. Negative reactions did
not show a color change. These carbohydrate-fermented positives were scored and
subjected to the manufacturer’s computerized database to obtain results.
PCR array for bacteriocin structural genes
The coding strand sequences for forty-two known LAB bacteriocin structural
genes were retrieved from GenBank (Table 6). Primers were designed using the Primer
Express Software (Applied Biosystems, Foster City, CA). The criteria for the primer
design included optimum length of 25 bp and melting temperature (Tm) of 58°C - 60°C.
A total of 42 pairs of primers were designed from the coding strands for all known
bacteriocin structural genes targeting Lactobacillus spp., Pediococcus spp., Lactococcus
spp., and Leuconostoc spp. Prior to PCR, the DNA from the bacteriocin-producing strains
96
isolated by our Bac+ screening process was extracted by the BAXTm procedure (Qualicon,
Wilmington, Delaware): 5 µl of overnight culture was mixed with 200 µl of BAXTm lysis
reagent containing protease, and cell lysis was performed by incubating this mixture at
55°C for 60 min and then 95°C for 10 min. The PCR reaction mix consisted of 5 µl of
lysate (i.e., DNA template), 12.5 µl of Absolute SYBR Green PCR mix (ABgene,
Rochester, NY; contains the buffer, MgCl2, dNTPs and DNA polymerase), and the
individual array of primers designed for use in this bacteriocin PCR array. The final
concentration of primers used was 50 nM and the final reaction volume was 25 µl. The
reaction mix was placed in PCR reaction tubes [MJ white low profile tubes (MJ
Research, Hercules, CA)] and then subjected to real time PCR detection using the
Opticon-2 DNA engine (MJ Research) with the following cycling profiles: initial
denaturation at 95°C for 15 min (genome denaturation), followed by 40 cycles of 95°C
for 15 sec (denaturation), 62°C for 60sec (annealing), 72°C for 60 sec (extension),
followed by a final hold at 4°C. All PCR runs included a blank control consisting of
PCR-grade water and a non-template control (no DNA) which was run in parallel to
determine amplification efficiency within each experiment. At the end of each run a
melting curve analysis was performed from 58°C to 90°C at 0.2°C/s to confirm the
specificity of amplification and demonstrate the lack of primer dimer formation.
Sequence analysis
Bacteriocin sequence information was analyzed by using the BLAST algorithm
through the National Center for Biotechnology Information
(www.ncbi.nlm.nih.gov/blast). Nucleotide multiple sequence alignment (MSA) was
performed using the BCM Search Launcher online utility from the Baylor College of
97
Medicine (Smith et al. 1996). DNA sequencing of amplified DNA was performed at the
Dept. of Biochemistry and Molecular Biology Recombinant DNA/Protein Resource
Facility (Oklahoma State University) using an automated DNA sequencer via
"BigDye™"-terminated reactions analyzed on an ABI Model 3700 DNA Analyzer.
98
RESULTS AND DISCUSSION
The LAB are widely used in the manufacture of fermented or cultured foods, they
are considered GRAS, and are also present as a prevalent indigenous contaminating flora
on most non-sterile foods, including cheese, luncheon meats, fruits, and vegetables
(Garver and Muriana, 1993). The production of lactic acid has already afforded their
recognition as bacteria contributing to food preservation, but in recent decades the
identification of numerous bacteriocin-producing strains that can inhibit foodborne
pathogens has enhanced their roles in applications of food preservation and safety
(Cleveland et al. 2001). Due to the ubiquitous nature of these organisms, it is possible
that the same strains/bacteriocins are being investigated in different locations, and their
common identity may go unnoticed until much effort has been spent towards their
molecular characterization.
The identity of bacteriocin gene sequence information is usually obtained after
tedious work to purify and obtain amino acid sequence information of bacteriocin
peptides for further molecular characterization and comparison with database sequences.
We opted for the use of an inexpensive PCR array over the more costly approach of
micro-/macro-arrays for examining a bacterial strain against a bank of target bacteriocin
genes. Reminger et al. (1996), identified and characterized bacteriocins from thirteen
Bac+ LAB strains by designing primers based on the sequences of four well known
bacteriocins; curvacin A, sakacin P, plantaricin A, and plantaricin S. Our initial intention
was to establish an array of primers specific to every bacteriocin coding sequence of LAB
that has been identified. However, this would be difficult due to the high degree of
homology and short coding sequences (100-175 bp) for these bacteriocin genes and the
99
fact that a new bacteriocin sequence may show up as only a negative PCR reaction. We
therefore contemplated the possibility that the homology between the sequences may
assist by way of non-specific priming of bacteriocin genes using stretches of homologous
primer sequences to initiate priming of heterologous bacteriocin sequences in which the
intra-primer sequence information would be specific to the bacteriocin gene of the target
strain. Using this approach, we designed primer sets for 42 structural genes of known
bacteriocin from LAB utilizing most of the full length of the coding sequence as possible
given their small size (Table 6). Although real-time PCR is primarily used for
quantification of target DNA being amplified, we used it as a means of providing visual
(PCR profiles) and diagnostic discrimination (melting curves) to our analyses and is very
efficient when examining large numbers of samples. We examined a Bac+ isolate from
ground turkey, “Bac3” identified as Pediococcus acidilactici, known to produce pediocin
that was recently shown to belong to a different ‘resistance class’ than pediocin PA-1,
lactocin FS56, and curvaticin FS47 in which cross-resistance to all of these were
demonstrated by several strains of Listeria monocytogenes that were made resistant to
one of these bacteriocins, yet was still inhibited by P. acidilactici Bac3 (Macwana and
Muriana, 2007). When this strain was subjected to our bacteriocin PCR array, we
obtained real-time amplification with 4 sets of primers designed from 4 bacteriocin
structural genes (Fig. 7): papA (Pediococcus pentosaceous), pedB (Pediococcus
acidilactici), plnA (Lactobacillus plantarum), and sakX (Lactobacillus sakei). When
amplimers generated by these different primer-pairs were sequenced and analyzed by
multiple sequence alignment, the intra-primer regions generated with P. acidilactici Bac3
as template were identical (Fig. 7). However, when these sequences were compared to the
100
bacteriocin structural genes from which the primers were derived, there were obvious
differences in among the intra-primer regions and those pertaining to P. acidilactici Bac3
(Fig. 7). These data were exciting in that they allowed the identification of specific
bacteriocin sequence information from an, as yet, unknown lactic strain (i.e., we had not
yet done API Identification on the strain, except for isolation as a Bac+ lactic acid
bacteria).
Another Bac+ isolate from ground pork (sausage) was identified as Lactobacillus
sakei (strain JD) by API identification. When DNA from Lb. sakei JD was subjected to
the bacteriocin PCR array, we again obtained successful amplification by primers to
bacteriocins from other Lb. sakei bacteriocin genes as well as from closely related Lb.
curvatus (Fig. 8). When we compared the sequences obtained from our amplifications to
each other after amplifying strain JD with the various primers, we were confused at the
differences observed when comparing intra-primer sequences by multiple sequence
alignment (data not shown). Previously, amplimers obtained from the same strain, but
with different primers, showed the same intra-primer sequence. Upon further examination
of the intra-primer sequences with a Blast search of GenBank, we found that three
different intra-primer amplimer sequences obtained with different bacteriocin array
primers each showed close homology to a different bacteriocin structural gene, all three
of which have been previously shown to exist within a single strain (Fig. 8). Two of these
bacteriocins (Sakacin T and Sakacin X) showed high homology to bacteriocins found in
Lb. sakei while the third bacteriocin showed homology to one produced by Lb. curvatus
(Curvacin A). Further analysis showed that the three sequences were homologous to 3
bacteriocins that already co-exist in the same strain of Lb. sakei (Vaughan et al. 2004).
101
The data suggests that this isolate may be a different (or related) strain of Lb. sakei
because sequence comparison of all 3 sequences to those in GenBank were not
completely identical (Fig. 8).
The prospects for multiple bacteriocin genes within individual strains confirmed
the need to sequence all successful amplimers obtained with different primers sets. We
also did this with 2 Bac+ strains of Lactococcus lactis isolated from raw pork (RP1) and
vegetables (FS97). In both cases, we again identified three bacteriocin genes in each
strain identified with primers that correlated to a two-component ltnA/ltnB bacteriocin
and additional lcnB bacteriocin that has previously been identified in Lc. Lactis (Kojic et
al. 2006) (Fig. 9). Lc. Lactis FS97 was of interest because it was unique in being able to
inhibit L. monocytogenes strains that had acquired bacteriocin resistance to 2 different
bacteriocin resistance mechanisms and was categorized as a bacteriocin belonging to a
3rd resistance class (Macwana and Muriana, 2007).
In an effort to further demonstrate the utility of the method we tested Lc. lactis
FS92, a bacteriocinogenic strain for which we had spent numerous attempts trying to
obtain amino acid sequence information with purified bacteriocin but without success,
presumably due to an N-blocked amino terminus that prevented amino acid sequencing
by Edman Degradation analysis, and further attempts to recover internal peptides for
sequencing were also unsuccessful (Mao et al. 2001). Amplification of the lacticin FS92
bacteriocin with primers from the lacA gene of Lc. lactis resulted in the identity of a
structural gene sequence sharing homology with that in FS92 (Fig. 10).
102
The data demonstrate that not only can the ‘bacteriocin PCR array’ quickly
amplify and allow sequence identify and analysis of bacteriocin structural genes from
Bac+ LAB, but it can also help to identify multiple bacteriocin-related genes occurring in
the same strain. By more traditional methods, this could have taken months to identify,
yet with the PCR array we have been able to identify the existence and sequence identity
of 3 bacteriocin genes within 3 different strains or sequences of bacteriocin genes that
were impervious to protein sequence analysis within 2 days (1 day to run PCR, 1 day to
sequence and run sequence analyses). The utility of such an array can be enlarged by
automated methods to include immunity or other processing genes that would further
help identify and characterize bacteriocin operons and/or whether they have previously
been studied. We have already tested a preliminary version of this as well, using a
‘bacteriocin immunity gene PCR array’ that was effective in eliciting PCR amplification
of bacteriocin immunity gene sequence information for P. acidilactici Bac3 (data not
shown). The use of these approaches to identifying newfound bacteriocinogenic strains
would be helpful to those laboratories interested in non-repetitive research in new and
novel bacteriocins.
103
CONCLUSION
This study demonstrates the rapidity with which novel bacteriocin sequences can be
identified using a PCR array to quickly amplify and provide definitive DNA sequence
information for unknown bacteriocins. This process may minimize duplicative efforts to
study bacteriocins that are already well-characterized and for which sequence information
exists in GenBank. Every bacteriocin-producing strain of LAB that was subjected to the
PCR array provided amplification with more than one pair of primers and sequence data
quickly demonstrated whether the bacteriocin was previously characterized.
ACKNOWLEDGEMENTS
This work was supported in part by the VPR Homeland Security Fellowship program, the
FAPC Research Assistantship program, and the Oklahoma Agricultural Experiment
Station, Oklahoma State University (HATCH project no. 2335), Stillwater, OK. We
thank Ms. Janet Rogers (OSU Core Facility) in assistance with DNA sequencing
reactions and obtaining sequence information.
104
REFERENCES
12. Cleveland, J., T. J. Montville, I. F. Nes, and M. L. Chikindas. 2001.
Bacteriocins: safe, natural antimicrobials for food preservation. Int. J. Food
Microbiol. 71:1-20.
13. De Vuyst, L., and E. J. Vandamme. 1994. Bacteriocins of lactic acid bacteria:
microbiology, genetics and applications. Blackie Academic & Professional,
London, United Kingdom.
14. Ennahar, S., N. Deschamps, and J. Richard. 2000. Natural variation in
susceptibility of Listeria strains to class IIa bacteriocins. Curr. Microbiol. 41:1-4.
15. Ennahar, S., K. Sonomoto, and A. Ishizaki. 1999. Class IIa bacteriocins from
lactic acid bacteria: antibacterial activity and food preservation. J. Biosci. Bioeng.
87:705-16.
16. Garneau, S., N. I. Martin, and J. C. Vederas. 2002. Two-peptide bacteriocins
produced by lactic acid bacteria. Biochimie 84:577-92.
17. Garver, K.I., and P.M. Muriana. 1993. Detection, identification, and
characterization of bacteriocin-producing lactic acid bacteria from retail food
products. Int. J. Food Microbiol. 19:241-258.
18. Kojic M., Strahinic I., Fira D., Jovcic B., Topisirovic L. 2006. Plasmid content
and bacteriocin production by five strains of Lactococcus lactis isolated from
semi-hard homemade cheese. Can. J. Microbiol. 52(11):1110-20.
105
19. Klaenhammer, T. R. 1993. Genetics of bacteriocins produced by lactic acid
bacteria. FEMS Microbiol. Rev. 12:39-85.
20. Macwana, S., and P.M. Muriana. 2007. Use of acquired spontaneous resistance
to screen bacteriocins of LAB into functional inhibitory groups. Appl. Environ.
Microbiol. (Dissertation, Chapter IV).
21. Mao, Y., Muriana, P.M., and M.A. Cousin. 2001. Molecular characterization
and transpositional inactivation of lacticin FS92, a broad spectrum bacteriocin
produced by Lactococcus lactis. Food Microbiol. 18:165-175.
22. Nes, I. F., D. B. Diep, L. S. Havarstein, M. B. Brurberg, V. Eijsink, and H.
Holo. 1996. Biosynthesis of bacteriocins in lactic acid bacteria. Antonie Van
Leeuwenhoek 70:113-28.
23. Nes, I. F., and H. Holo. 2000. Class II antimicrobial peptides from lactic acid
bacteria. Biopolymers 55:50-61.
24. Nes, I. F., V.G.H. Eijsink. 1999. Regulation of group II peptide bacteriocin
synthesis by quorum-sensing mechanisms. In: Cell-Cell Signalling in Bacteria
(Dunny, G. M., Winans, S.C., Eds.), pp. 175-192 American Society for
Microbiology, Washington DC.
25. Reminger, A., Ehrmann, M. A., Vogel, R. F. 1996. Identification of
bacteriocin-encoding genes in Lactobacilli by polymerase chain reaction (PCR).
Syst. Appl. Microbiol. 19:28-34.
106
26. Smith, R.F., Wiese, B.A., Wojzynski, M.K., Davison, D.B., Worley, K.C.
1996. BCM Search Launcher--An integrated interface to molecular biology data
base search and analysis services available on the world wide web. Genome Res.
6:454-62.
27. Vaughan, A., O’ Mahony, J., V. G. Eijsink, O’ Connell-Motherway, M., and
D. van Sinderen. 2004. Transcriptional analysis of bacteriocin production by
malt isolate Lactobacillus sakei 5. FEMS Microbiol. Lett. 235:377-84.
107
Table 5. Bacterial strains used in this study.
Bacterial Strains Source Reference Lactic Acid Bacteria
Lactobacillus delbrueckii subsp, lactis 4797 T. R. Klaenhammer Garver and Muriana, 1993
Lactobacillus curvatus FS47 Ground beef Garver and Muriana, 1993
Pediococcus acidilactici PAC1.0 J. B. Luchansky Marugg et al., 1992
Lactococcus lactis FS56 Mushrooms Garver and Muriana, 1993
Lactococcus lactis FS97 Vegetables Garver and Muriana, 1993
Lactococcus lactis FS92 Raw Pork Garver and Muriana, 1993
Pediococcus acidilactici Bac3 Ground Turkey This study
Lactobacillus sakei JD1 Ground Pork This study
Lactococcus lactis RP1 Raw Pork This study
108
Table 6. Primers used in this study ID Organism Gene For Primer (5’ – 3’) Rev Primer (5’ – 3’) Size
(-kb) S 1 Lactococcus lactis subsp lactis lclA aaaccaagtctctcgtattggc ggcacgttgtgtatccttacct 200
S 2 Lactococcus lactis Ltn A ccagttacatggttggaagaag tttacaccaagccatacattca 150
S 3 Lactococcus lactis subsp. lactis lcnB agttaatggaggaagcttgcag tagtggaatgtttttccccatc 156
S 4 Lactococcus lactis LtnB caattgggaaaataccttgaaga caagcacgtgtacattttgttgt 152
S 5 Lactococcus lactis subsp. lactis LacA agtgctattcaaaattctggcg taatccaacctccggaataaga 217
S 6 Lactococcus lactis subsp. cremoris IcpJ tggaccttattttaggtgcaaaa gagcagcaagtaaatacaaagttcc 100
S 7 Leuconostoc mesenteroides mesY agtctgtggaagcatatcagca taccaaaatccatttccaccat 172
S 8 Leuconostoc mesenteroides mesB aaacaaatttcaaaatcctttcaga atttgtggttcttgatctttgc 150
S 9 Leuconostoc mesenteroides lccK tgaactgactgcaatcactggt aagagtgcatatgtcccttggt 100
S 10 Leuconostoc carnosum B-Talla gtaacggagttcattgcacaaa taccagaaaccatttccaccat 103
S 11 Leuconostoc mesenteroides lcnS ctttggatgcctttcgatactc gctacatgaggtcgacttttcc 144
S 12 Leuconostoc gelidum lcnA gaacatgaaacctacggaaagc ccaccatttgctaaacgatgta 165
S 13 Pediococcus pentosaceus papA ttacttgtggcaaacattcctg tgattaccttgatgtccaccag 106
S 16 Pediococcus acidilactici ped A ctgccgaagaaaacaaagttct ctattggctaggccacgtattg 110
S 17 Lactobacillus plantarum plnc8A ctagaaaagatctctggcggtg catatgggtgctttaaattcca 100
S 18 Lactobacillus plantarum plnc8B ggcaagagtagcttgtctcaaa caatcgttttgcgatgcttat 106
S 19 Lactobacillus acidophilus TK8912 acd T aaagaattagcattaatttctgggg cgtcagtataacgaaggctttccc 100
S 20 Lactobacillus casei α-peptide aacaattggtggtggcatgt tatccaagacgtccctttttgt 111
S 21 Lactobacillus casei β-peptide gaaaaatttgccaatatctcgaa accattaattggtgaatggtga 150
S 22 Lactobacillus curvatus cur A acagaattacaaacaattaccggc cattccagctaaaccactagcc 150
S 23 Lactobacillus gasseri bac aatgtaatgggtggaaacaagtg tcttatatcccagatatcctccaa 154
S 24 Lactobacillus gasseri LA39 gaa A cggacgtaatttaggtttgaaca aagcccatgcaggtaatgtc 224
S 25 Lactobacillus plantarum plaA aaaaattaactgaaaaagaaatggc actttccatgaccgaagttagc 150
S 26 Lactobacillus amylovorus amy L cggtggaaatagatggactaatg tagcctttacgaacataacccg 159
S 27 Lactobacillus sakei Skg A1 aagaatacacgtagcttaacgatcc accgccattagctagatgattt 150
S 28 Lactobacillus sakei SkgA2 aaaaacgcaaaaagcctaacaa aactccatgaccgccattag 159
S 29 Lactobacillus sakei SppA aacagcaattacaggtggaaaa tatttattccagccagcgtttc 150
S 32 Lactobacillus sakei sakT- α tcggtggctatactgctaaaca tgtcctaaaaatccaccaatgc 160
S 33 Lactobacillus sakei sakT-β aagaaatgatagaaatttttggagg tgtgaaatccaatcttgtcctg 151
S 34 Lactobacillus sakei sakX agctatgaaaggtattgtcggg taagatttccagccagcagc 156
S 35 Lactobacillus salivarius abp118 α agttagcaaaggttgatggtgg aacaagtaagtgctccgcctac 156
S 36 Lactobacillus salivarius Abp118 β aatggtggtaaaaatggttatgg ttaacggcaacttgtaaaacca 150
S 38 Lactobacillus acidophilus acdA gaattagcattaatttctggggg aatgaaatgtcttgccaaaagc 199
S 40 Lactobacillus plantarum C11 pln A agcaacttagtaataaggaaatgcaaa acagtttctttacctgtttaattgcag 102
S 41 Lactobacillus sp laf agtcgttgttggtggaagaaat tcttatcttgccaaaaccacct 184
S 42 Lactobacillus plantarum TMW1.25 pln B tagcattgattgatggaggaaa gcatgccgtgtaagttgttaga 176
109
Figure 7. Primer array real-time PCR of Pediococcus acidilactici Bac3 (pediocin Bac3) isolated from ground turkey in individual PCR reactions with 42 pairs of primers. Primers that resulted in amplification were designed from bacteriocin structural genes from P. pentosaceous (S-13), P. acidilactici (S-16), Lb. plantarum (S-25), and Lb. sakei (S-34). Inset 1, melting curve of amplified products obtained from individual PCR reactions with primer pairs S-13, S-16, and S-34. Inset 2, agarose gel analysis of amplification products with S-13 (lane 3), S-16 (lane 4), S-34 (lane 5). Sequence different from strain Bac3 are highlighted in black.
L.sakei (orig_SakX) 1 AGCTATGAAAGGTATTGTCGGGGGAAAATACTACGGTAATGGATTGTCTTGTAACAAAAGP.acidi Bac3(S-34) 1 AGCTATGAAAGGTATTGTCGGGGGTAAATACTACGGTAAGGCTCTTACTTGTGGCAAACAP.acidi Bac3(S-13) 1 --------------------------------------------TTACTTGTGGCAAACAP.acidi (orig_PapA) 1 --------------------------------------------TTACTTGTGGCAAACA
L.sakei (orig_SakX) 61 TGGTTGTTCAGTTGACTGGAGTAAAGCTATTAGTATTATCGGGAATAATGCTGTAGCAAAP.acidi Bac3(S-34) 61 TTCCTGTTGTTCTGACTGGAGTGGAGCTATGGCATGGGCTATTACGCATGGAGTTGTGCCP.acidi Bac3(S-13) 17 TTCCTGTTGTTCTGACTGGAGTGGAGCTATGGCATGGGCTATTACGCATGGAGTTGTGCCP.acidi (orig_PapA) 17 TTCCTGCTCTGTTGACTGGGGTAAGGCTACCACTTGCATAATCAATAATGGAGCTATGGC
L.sakei (orig_SakX)121 TTTGACTACCGGTGGAGCTGCTGGCTGGAAATCTTAA P.acidi Bac3(S-34) 121 AACGGCCACTGGTGGAGCTGCTGGCTGGAAATCTTAA P.acidi Bac3(S-13) 77 AACGGCCACTGGTGGACATCAAGGTAATCA------- P.acidi (orig_PapA) 77 ATGGGCTACTGGTGGACATCAAGGTAATCA-------
PCR Cycle
0 5 10 15 20 25 30 35 40
RFU
0.0
0.2
0.4
0.6
0.8
1.0
S_13 papA S_16 pedB S_25_plnA S_34 SakX Other primers
DNA(kb)
1000750
500
300
15050
1 2 3 4 5
DNA(kb)
1000750
500
300
15050
1 2 3 4 5
110
Figure 8. Sequence alignment of 3 different bacteriocin sequences obtained from amplification of DNA from Lb. sakei JD against the bacteriocin primer array with sequence of the original bacteriocin gene from which the primers were derived. Panel A, sequence alignment of Lb. sakei JD DNA amplified with S-22 with original sequence for curA (Lb. curvatus). Panel B, sequence alignment of Lb. sakei JD DNA amplified with S-32 with original sequence for sakTα (Lb. sakei). Panel C, sequence alignment of Lb. sakei JD DNA amplified with S-34 with original sequence for sakX (Lb. sakei). Sequence different from strain JD is highlighted in black.
PCR Cycle
0 5 10 15 20 25 30 35 40
RFU
0.0
0.2
0.4
0.6
0.8
1.0
1.2
S_22_cuvA S_32_SakT S_33_SakT S_34_SakX Other primers
DNA(kb)
1000750
500
300150
50
1 2 3 4 5 6
DNA(kb)
1000750
500
300150
50
1 2 3 4 5 6
Lb.sakei JD(S-22) 1 ACAGAATTACAAACAATTACCGGCGGTTGCAGATCATATGGCAATGGTGTTTACTGTAACLb.curvatus(curA) 1 ACAGAATTACAAACAATTACCGGCGGTGCTAGATCATATGGCAACGGTGTTTACTGTAA-
Lb.sakei JD(S-22) 61 TAATAAAAAATGTTGGGTAAATCGGGGTGAAGGTTCGCAAAGTATTATTGGTGGTATGATLb.curvatus(curA) 60 TAATAAAAAATGTTGGGTAAATCGGGGTGAAGCAACGCAAAGTATTATTGGTGGTATGAT
Lb.sakei JD(S-22) 121 TAGCGGCTGGGCTAGTGGTTTAGCTGGAATG Lb.curvatus(curA) 120 TAGCGGCTGGGCTAGTGGTTTAGCTGGAATG _________________________________________________________________________________ Lb.sakei JD(S-32) 1 TCGGTGGCTATACTGCTAAACA--GCTTGCA-GCAATTGGCAGTTGGGGTATTGCTGGTALb.sakei SakT 1 TCGGTGGCTATACTGCTAAACAATGCTTGCAAGCAATTGGCAGTTGGGGTATTGCTGGTA
Lb.sakei JD(S-32) 58 CAGGAGCAGGAGCCAAAGCAGGAGGTCCTGCTGGAGCTTTCGTAGGCGCACACGCATCGGLb.sakei SakT 61 CAGGAGCAGGAGC---AGCAGGAGGTCCTGCTGGAGCTTTCGTAGGCGCACACG--TCGG
Lb.sakei JD(S-32)118 GGTCATTGCTGGGTCAGCGGGTATGCATTGGTGGATTTTTAGGACA Lb.sakei SakT 116 GGTCATTGCTGGGTCAGCGG-TATGCATTGGTGGATTTTTAGGACA _________________________________________________________________________________ Lb.sakeiJD(S-34) 1 AGCTATGAAAGGTATTGTCGGGGGAAA-TACTACAGGTAATGGCATTGTCCTATTGTAACLb.sakei SakX 1 AGCTATGAAAGGTATTGTCGGGGGAAAATACTAC-GGTAATGG-ATTGTC---TTGTAAC
Lb.sakei JD(S-34) 60 AAAAGTGGTTGTTCAGTTGACTGGAGTAAAGCTATTAGTATTATCGGTCGAATAATGCTGLb.sakei SakX 56 AAAAGTGGTTGTTCAGTTGACTGGAGTAAAGCTATTAGTATTATCGG--GAATAATGCTG
Lb.sakei JD(S-34)120 TAGCATATT-GACTACCGGTGGAGCTGCTGGCTGGAAATCTTAA Lb.sakei SakX 114 TAGCAAATTTGACTACCGGTGGAGCTGCTGGCTGGAAATCTTAA
111
L.lactis LtnA 1 CCAGTTACATGGTTGGAAGAAGTATCTGATCAAAATTTTGATGAAGATGTATTTGGTGCGL.lactis RP1(S-2) 1 CCAGTTACATGGTTGGAAGAAGTATCTGAAGTAAATTTAGAAGTAGATGTATTGGAATAA
L.lactis LtnA 61 TGTAGTACTAACACATTCTCGCTCAGTGATTACTGGGGAAATAACGGGGCTTGGTGTACAL.lactis RP1(S-2) 61 TGCTGTACTAACACATTCTCGCGCAGTGATTACTGGAAAAATAACGGGGCAAGGTGTACA
L.lactis LtnA 121 CTCACTCA-TGAATGTATGGCTTGGTGTAAA L.lactis RP1(S-2)121 GTGACTCAATGAATGTATGGCTTGGTGTAAA
L.lactis LtnB 1 CAATTGGGAAAATACCTTGAAGATG-ATATGATTGAATTAGCTG-AAGGGGATGAGTCTCL.lactis RP1(S-4) 1 CAATTGGGAAAATACCTTGAAGATGTATTTGACTGGATTAGCTGTAAAGGTATTAGTCTC
L.lactis LtnB 59 ATGGAGGAACAACACCAGCAACTCCTGCAATCTCTATTCTCAGTGCATATATTAGTACCAL.lactis RP1(S-4) 61 TAGGAGGAATAACACCAGCAATTGTAGCAAATTTGATTCTCAGTGGATATAGCCTTACCA
L.lactis LtnB 119 ATACTTGTCCAACAACAAAATGTACACGTGCTTG L.lactis RP1(S-4)121 GAACTTGTCCAACAACAAAATGTACACGTGCTTG
L.lactis LcnB 1 AGTTAATGGAGGAAGCTTGCAGTATGTTATGAGTGCTGGACCATATACTTGGTATAAAGAL.lactis RP1(S-3) 1 AGTTAATGGAGGAAGCTTGCAGTAC---ATG---GTTGGAAGAAGTATCTGAAGTAAATT
L.lactis LcnB 61 TACTAGAACAGGAAAAACAATA----TGTAAACAGACAAT-TGACACAGCAAGTTAT--AL.lactis RP1(S-3) 55 TAGAAGTAGATGTATTGGAATAATGCTGTACTAACACATTCTCGCGCAGTGATTACTGGA
L.lactis LcnB 114 CATTT----------GGTGTAA--TGGCAGAAGGATGGGGAAAAACATTCCACTAA L.lactis RP1(S-3)115 AAAATAACGGGGCAAGGTGTACAGTGACTCAA-GATGGGGAAAAACATTCCACTAA
A
B
C
L.lactis LtnA 1 CCAGTTACATGGTTGGAAGAAGTATCTGA-TCAAAATTTTGATGAAGATGTATTTGGTGCL.lactis FS97(S-2) 1 CCAGTTACATGGTTGGAAGAAGTATGTGAATCAATATTC-GTTGAAGCCGAATTCGCTGC
L.lactis LtnA 60 GTGTAGTACTAACACATTCTCGCTCAGTGATTACTGGGGAAATAACGGGGCTTGGTGTACL.lactis FS97(S-2) 60 GTGAAGTATTAACACAGTCGCGCTCTCTGTTAACGGGGGATATACGCGGGCATGCTGTAC
L.lactis LtnA 120 ACTCACTCATGAATGTATGGCTTGGTGTAAA L.lactis FS97(S-2)120 ACGGACATTTGAATGTATGGCTTGGTGTAAA
L.lactis LtnB 1 CAATTGGGAAAATACCTTGAAGATGATATGATTGAATTAGCTGAAGGGGA-TGAGTCTCAL.lactis FS97(S-4) 1 CAATTGGGAAAATACCTTGAAGATGATTTGATTGAATTGGCTGAAGTAGAATCGGACACT
L.lactis LtnB 60 TGGAGGAACAACACCAGCAACTCCTGCAATCTCTATTCTCAGTGCATATATTAGTACCAAL.lactis FS97(S-4) 61 TGCAGGATCAACACCTCGAACTCATGCAATCTATACTATCCGTGCACATAGTTGAACCAC
L.lactis LtnB 120 TACTTGTCCAACAACAAAATGTACACGTGCTTG L.lactis FS97(S-4)121 TACTTAGCCTACAACAAAATGTACACGTGCTTG
L.lactis lcnB 1 AGTTAATGGAGGAAGCTTGCAGTATGTTATGAGTGCTGGACCATATACTTGGTATAAAGAL.lactis FS97(S-3) 1 AGTTAATGGAGGAAGCTTGCAGTATGTTATGAGTGCTGGACCATATACTTGGTATAAAGA
L.lactis lcnB 61 TACTAGAACAGGAAAAACAATATGTAAACAGACAATTGACACAGCAAGTTATACATTTGGL.lactis FS97(S-3) 61 TACTAGAACAGGAAAAACAATATGTAAACAGACAATTGACACAGCAAGTTATACATTTGG
L.lactis lcnB 121 TGTAATGGCAGAAGGATGGGGAAAAACATTCCACTAA L.lactis FS97(S-3)121 TGTAATGGCAGAAGGATGGGGAAAAACATTCCACTAA
D
E
F
Figure 9. Bacteriocin PCR array amplification and sequence analysis of two Bac+ strains of Lc. lactis in comparison with the original bacteriocin gene sequence from which the primers were derived. Panels A-C, Lc. lactis RP1 bacteriocin PCR array sequence analysis derived from amplification with S-2 (LtnA), S-4 (LtnB), and S-3 (LcnB) primers. Panels D-F, Lc. lactis FS97 bacteriocin PCR array analysis after amplification with primers for the same bacteriocin genes.
112
Figure 4. Bacteriocin array real-time PCR and sequence identify of lacticin FS92 produced by of Lc. lactis FS92.
Figure 10. Bacteriocin array real-time PCR and sequence identify of lacticin FS92 produced by of Lc. lactis FS92.
L.lactisLacA 1 AGTGCTATTCAAAATTCTGGCGCGATATTTCCTCTCAATATGTCTCAAAAAGGAATTAGAFS92 (S-5) 1 AGTGCTATTCAAAATTCTGGCGCGATATTTCCTCTCAATATGTCTCAAACT---ATTAGA
L.lactisLacA 61 AAAACTCAAAGTAGCTCTTCTATGCAAACCTATGTAGGAACCTATACTGGTAGTGGTGGAFS92 (S-5) 58 AAAACTCAAAGTAGCTCTTCTATGCAAACCTATGTAGGAAGCGGTTTAAAGAGTGGTGGA
L.lactisLacA 121 ATTCCAACACCTTGGGGTAACGCGAATCTTATTTCACAAACACGAAGTTTGAGAACTATAFS92 (S-5) 118 ATTCCAACACCTTGGGGTAACGCGAATAATATTTCACAAACACGAAGTTTGAGAACTATA
L.lactisLacA 181 ATACATGGTAACGGTTCTTATTCCGGAGGTTGGATTA FS92 (S-5) 178 ATATCTGGTAACGGTTCTTATTCCGGAGGTTGGATTA
PCR Cycle0 5 10 15 20 25 30 35 40
RFU
0.0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8S-5 (LacA) Other primers
VITA
SUNITA J. MACWANA
Candidate for the Degree of
Doctor of Philosophy
Dissertation: BACTERIOCINS: UNIQUE APPROACHES FOR THE CHARACTERIZATION OF PEPTIDE ANTIMICROBIALS IN LACTIC ACID BACTERIA.
Major Field: Food Science/Food Microbiology
Biographical:
Personal Data: Born in Bangalore, India, February 18, 1974, the daughter of John and Victoria Macwana. Education: Graduated from Baldwin Girls High School, Bangalore, India in May of 1989. Received my Bachelor of Science Degree in Microbiology from Saint Josephs College of Arts and Science, Bangalore, India in May of 1994. Received my Masters of Science in Medical Microbiology from Kasturba Medical College, Manipal, India in 1998. Completed the requirements for the Doctorate of Philosophy in Food Science/Food Microbiology at Oklahoma State University in May of 2007. Experience: Employed by Oklahoma State University: Oklahoma Food and Agricultural Products Research and Technology Center as a graduate research assistant under Dr. Peter Muriana. Organizations: Institute of Food Technologist and Gamma Sigma Delta Honors Society.
Name: Sunita Macwana Date of Degree: May, 2007
Institution: Oklahoma State University Location: Stillwater, Oklahoma
Title of Study: BACTERIOCINS: UNIQUE APPROACHES FOR THE CHARACTERIZATION OF PEPTIDE ANTIMICROBIALS IN LACTIC ACID BACTERIA.
Pages in Study: 125 Candidate for the Doctor of Philosophy
Major Field: Food Science
Study and Conclusions: Curvaticin FS47 is a listeria-active peptide produced by L. curvatus that was isolated from retail meats. The nucleotide sequence spanning the 9.6kb operon of curvaticin FS47 was determined from the original clones, shortened subclones and the vectorette PCR method. Sequence analysis of the 9.6-kb curvaticin operon revealed the presence of several genes related to bacteriocin biosynthesis. Two types of bacteriocins were identified, i) a two component bacteriocin (T alpha and beta subunits) and ii) a single component bacteriocin (curvaticin FS47). There is high homology between the bacteriocin gene clusters of L. curvatus FS47 and L. sakei.
A major concern in using bacteriocins as food preservatives is the occurrence of natural or spontaneous resistance. Here, L. monocytogenes 39-2 and BacR variants derived from it, were used as indicator strains to screen for bacteriocin-producing LAB from food samples and these bacteriocins were then categorized into different ‘resistance classes’ based on their ability to inhibit these spontaneously-acquired bacteriocin resistant mutants. The use of a mixture of bacteriocins from different ‘resistance classes’ would have greater likelihood to overcome spontaneous resistance.
Bacteriocin producing LAB belonging to different resistance classes were subjected to a bacteriocin-specific PCR array with primers for forty-two known structural genes of bacteriocins from LAB. Amplimers obtained were sequenced and the sequence analysis determined if the bacteriocin was novel or already existed in the GenBank database. This approach allowed for the quick and facile discovery of functionally new bacteriocins among LAB.
A combination of bacteriocins belonging to the 3 different ‘resistance classes’ were used to perform an inhibitory assay against L. monocytogenes 39-2. The results show a significant difference in treatment that was sufficient to prevent regrowth of Listeria for an extended period of time.
ADVISOR’S APPROVAL: Dr. Peter Muriana