Embed Size (px)
Citation preview
BACTERIAL PROFILING AND DEVELOPMENT OF
MOLECULAR DIAGNOSTIC ASSAYS FOR DETECTION OF
BACTERIAL PATHOGENS ASSOCIATED WITH BOVINE
MASTITIS
AQEELA ASHRAF
2012-VA-388
A THESIS SUBMITTED IN THE PARTIAL FULFILLMENT OF
THE REQUIREMENT FOR THE DEGREE
OF
DOCTOR OF PHILOSOPHY
IN
MOLECULAR BIOLOGY AND BIOTECHNOLOGY
UNIVERSITY OF VETERINARY AND ANIMAL SCIENCES
LAHORE
2017
To
The Controller of Examinations
University of Veterinary and Animal Sciences
Lahore.
We, the Supervisory Committee, certify that the contents and form of the thesis, submitted by
AQEELA ASHRAF, have been found satisfactory and recommend it to be processed for
evaluation by the External Examiner (s) for the award of degree.
SUPERVISOR __________________________
DR. MUHAMMAD IMRAN
MEMBER __________________________
PROF. DR. TAHIR YAQUB
MEMBER __________________________
DR. MUHAMMAD TAYYAB
i
DEDICATION
TO
MY BELOVED PARENTS
ii
ACKNOWLEDGEMENTS
All praises for Allah, the originator of heavens and earth. Limitless thanks to the
compassionate Lord who has bestowed me with all the sense of working and granted me courage
and determination not to lose hope at any cost. Choicest blessings and salutation to Hazrat
Muhammad (Peace Be upon Him), who is forever a torch of knowledge and tower of guidance
to humanity.
Millions of thanks to the Almighty creator for blessing me with the tenderness and
carefulness of my parents whose encouragement is my energy, whose inspiration is my guidance,
whose expectations are my target, whose gratification is my aim, whose advices are my weapon
and whose prayers are my treasure.
I feel great honor to express my sincere gratitude to my respected, highly learned and
reverend research supervisor Dr. Muhammad Imran, Assistant Professor, Institute of
Biochemistry and Biotechnology, UVAS, Lahore for his guidance, solicitude, skilled advice and
untiring zeal without which the accomplishment of this work would not have been possible. It is
my proud privilege and honor to express my profound gratitude to the members of supervisory
committee Prof. Dr. Tahir Yaqub, Professor, Department of Microbiology, UVAS Lahore, and
Dr. Muhammad Tayyab, Assistant Professor, Institute of Biochemistry and Biotechnology,
UVAS, Lahore, for their help and consultancy during research and thesis.
I would like to express my deepest gratitude to Dr. Wasim Shehzad, Director, Institute
of Biochemistry and Biotechnology, UVAS, Lahore. I must say that it would have been difficult
for me to accomplish my task, well in time, without cooperation of all lab workers and staff
members of the department. My acknowledgements will remain incomplete if I don’t mention
the support of my family and friends. Thank you.
Aqeela Ashraf
iii
TABLE OF CONTENTS
DEDICATION---------------------------------------------------------- (i)
ACKNOWLEDGMENTS--------------------------------------------- (ii)
LIST OF TABLES----------------------------------------------------- (iii)
LIST OF FIGURES---------------------------------------------------- (iv)
LIST OF ABBREVIATIONS---------------------------------------- (v)
SR. NO. CHAPTERS PAGE NO.
1 INTRODUCTION 1
2 REVIEW OF LITERATURE 7
3 EXPERIMENT NO 1 60
4 EXPERIMENT NO 2 84
5 SUMMARY 104
iv
LIST OF TABLES
TABLE NO. TITLE PAGE NO.
2.1 Prevalence of common mastitis pathogens Worldwide 11
2.2 Prevalence of less common mastitis pathogens Worldwide 13
3.1 Oligonucleotide primers used for multiplex PCR assay 63
3.2 Analytic sensitivity of multiplex PCR assay 70
3.3 The test results for 16S rRNA sequence analysis, bacterial culture
and multiplex PCR assay
72
3.4 Specificity and standard error of all the detected bacterial
pathogens calculated by LCA
73
3.5 Sensitivity and standard error of all the detected bacterial
pathogens estimated by LCA
73
4.1 Sequences of LAMP and PCR primers used in the current study 88
4.2 Results on M. bovis detection from known bacterial isolates and
clinical mastitic milk samples using three different sets of PCR
and LAMP primers
93
4.3 Performance of the three LAMP assays for the detection of M.
bovis as determined by estimates of sensitivity, specificity and
Cohen’s kappa statistics
95
v
LIST OF FIGURES
FIGURE NO. TITLE PAGE NO.
1.1 Overview of factors related to bovine mastitis 02
3.1 Monoplex PCR for reference strains of bacterial pathogens 68
3.2 Multiplex PCR assay for mastitic bacterial pathogens 69
3.3 Identification of bacterial pathogens from milk by multiplex PCR
assay
72
4.1 Location of LAMP primers in the target gyrB and 16S rRNA
gene sequences
87
4.2 Results of LAMP assay and conventional PCR 92
4.3 ROC curve displaying sensitivity and specificity estimates for
three different LAMP assays
94
vi
LIST OF ABBREVIATIONS
(NH4)2SO4 Ammonium Sulphate
B1C B1 Complementary
B3 Backward Primer
BIP Backward Inner Primer
cDNA Complementary DNA
CDO Citrus Derived Oil
CFS Cell Free Supernatants
CFU Colony Forming Units
CI Confidence Interval
CMT California Mastitis Test
CNS Coagulase Negative Staphylococcus
CO2 Carbon Dioxide
Cpn60 Chaperonin 60
CS Cornybacterium Species
DNA Deoxy Ribonucleic Acid
dNTPs Deoxynucleotide Triphosphates
vii
EDTA Ethylene diamine tetra-acetic Acid
ELISA Enzyme Linked Immunosorbant Assay
F1C F1 Complementary
F3 Forward Primer
FIP Forward Inner Primer
FISH Fluorescent In Situ Hybridization
gyrB Gyrase Subunit B
KCl Potassium Chloride
KS Klebseiella Species
LAMP Loop Mediated Isothermal Amplification
LCA Latent Class Analysis
LOD Limit of Detection
M Molar
MALDI-TOF MS Matrix Assisted Laser
Desorption/Ionization – Time Of Flight
Mass Spectrometry
MCMC Markov Chain Monte Carlo
viii
MgCl2 Magnesium Chloride
MgSO4 Magnesium Sulphate
MS Mycoplasma Species
ng Nano Gram
NY New York
OB Other bacteria
PCR Polymerase Chain Reaction
PD Psuedomonas Species
pg Pico Gram
PhoA Phosphatase A
PS Pasteurella Species
QMPS Quality Milk Production Services
rdr RNA-Dependent RNA
ROC Receiver Operating Characteristic
rRNA Ribosomal Ribonucleic Acid
RT-PCR Real Time PCR
SCC Somatic Cell Count
ix
scFvs Single-Chain Variable Fragment
Se Sensitivity
SE Standard Error
SFMT Surf Field Mastitis Test
Sp Specificity
Tm Melting Temperature
Tris-HCl Tris Hydrochloric Acid
U Units
USA United States of America
μL Micro Litre
1
CHAPTER 1
INTRODUCTION
Certain diseases attack a large number of livestock animals in Pakistan. Mastitis is one of
the most prominent and prevalent among all diseases that underlines the development of dairy
sector (Karahan et al. 2011; Hussain et al. 2012). The global concern is evident on this important
issue as documented information indicates that this disease is not only fatal for animals but also
causes economic losses (Kossaibati and Esslemont 1997; Hameed et al. 2012). With 70% rural
population involved in agriculture and dairy business, Pakistan’s dairy farming is high profit
generating industry for individuals and for the country. The export of dairy products and meat to
global community brings high volume of profits which contribute to the national economy.
Buffaloes and cows contribute 95% to Pakistan milk industry (Sharif and Muhammad 2009;
Ashfaq et al. 2015) However, due to poor dairy management system, sudden climate changes,
inappropriate mechanism to market dairy products in local and international markets and
diseases like mastitis are major reasons of profit loss and hindrance in the development of dairy
sector. International statistics indicate that mastitis in early lactation is primary cause of loss to
dairy industry ((FAO 2004; Bachaya et al. 2011; De Vliegher et al. 2012). The control strategies
must be defined to avoid the use of antibiotics and greater losses in terms of culling.
Mastitis not only jeopardizes the health of the diseased animal but also reduces the milk
production. Mastitis holds the highest clinical and economic significance in dairy animals. It is
multi-factorial in nature and the involvement of a large number of different pathogens makes it
more difficult to control. In simple terms it is an inflammation of udder tissues due to some
physical damage, chemical irritation or infection caused by some pathogen (Ruegg et al. 2014).
Introduction
2
The overview of bovine mastitis showing an impact, diagnostic method, treatment strategies and
future aspects is shown in Figure No. 1.1.
Figure No. 1.1: Overview of factors related to bovine mastitis
Milk production is an intricate system where local and systemic hormones play an
important role along with other milk producing factors (Bhutto et al. 2012). Mastitis has a
negative impact on the milk production system and milk quality and quantity (Esron et al. 2005).
It causes phenomenal changes in physical, chemical and bacteriological properties of milk.
Immunological reaction triggered by the pathogen invasion results in an inflammatory response
(Abera et al. 2010).
Introduction
3
The etiology of complex diseases like mastitis is not completely known as new pathogens
are continuously detected and reported (Shaheen et al. 2016). Bovine mastitis has been known
for a long time and researchers are continuously struggling to characterize the pathogens
responsible for it. It can be caused by an attack of pathogenic microorganism and chemical
irritants that can trigger an immune response or any kind of physiological injury. However the
pathogenic microorganisms are the major cause of mastitis (Bramely et al. 1996).
Early disease detection results in better control and management strategies. The primary
diagnosis is based on the physiological symptoms that are visible to naked eye, like the swelling
and inflammation of mammary gland or the apparent changes in the milk quality and quantity.
Severe cases can lead to systemic illness and symptoms like fever, weakness, dehydration and in
appetence (Royster and Wagner 2015). But these symptoms are usually evident at the chronic or
clinical state of mastitis. The most commonly employed methods for diagnosis of mastitis in
dairy animals is the measurement of somatic cell count. It is an indicator of disease status,
severity and stage (Harmon 1994). Somatic cell counting can be done by two ways, the first by
direct enumeration under a microscope using methylene blue staining; however this direct
counting method has many limitations. The other way is indirect estimation of somatic cell
number by the California mastitis test and Surf field mastitis test. They are based on the principle
that by adding the detergent the high somatic cell count can be detected by the release of nucleic
acid and other constituents that will result in the formation of gel like substance. But this simple
method holds many discrepancies and we can get false positive and negative results (Smolenski
et al. 2007). Further, these tests do not produce numerical result but only indicate low or high
count (Viguier et al. 2009).
Introduction
4
Other indirect methods include the Coulter Milk Cell Counter which counts cells or
particles as they pass through electric field, the Fossomatic counting method based on
fluorescent dyed cells and SomaScope which involves flow cytometry (Miller et al. 1986; Moon
et al. 2007). However automated milking systems cannot use these detection methods.
None of the above mentioned assays identifies the causative agent and severity of
infection, but for better control and treatment strategies, identification of the causative pathogen
is critically important. Culturing method is still the major criterion for the detection of the
microorganism, but it is very time consuming, labor intensive and expensive (Viguier et al.
2009), and can only detect viable bacteria. Due to this reason false negative results are obtained
which leads to greater damage. Molecular detection based methods have the potential to detect
the pathogenic organism from those false negative milk samples (Taponen et al. 2009).
In order to control this devastating disease of dairy animals, a precise and economical
diagnostic tool is needed (Volling and Krömker 2008). There is remarkable progress in
molecular biology based techniques in last few years. Molecular diagnostics have the ability to
identify the organism with great specificity and can also distinguish between very closely linked
organisms (Muellner et al. 2011; Gurjar et al. 2012). These molecular diagnostics holds many
advantages over the traditional bacteriology techniques in terms of low cost and more accurate
detection (Gurjar et al. 2012). With the advancement in molecular techniques, quick and accurate
diagnosis of veterinary diseases has become possible (Biek et al. 2012).
The conventional diagnostic methods cannot broadly identify the microorganisms due to
their existence as part of a complex community (Schlaberg et al. 2012). As the microbes do not
exist in the form of pure culture, the growth of an individual strain may be suppressed by the
Introduction
5
presence of other microorganisms (Cressier and Bissonnette 2011). So, it is not possible to
comprehensively catalog all the microorganisms from milk which is a complex biological fluid
(Phuektes et al. 2001; Taponen et al. 2009). However, identification of the pathogen is necessary
for the implementation of suitable treatment and management strategies (Oliver et al. 2004).
Among the molecular biology techniques, polymerase chain reaction (PCR) holds
promise for efficient and accurate microbial identification (Meiri-Bendek et al. 2002). PCR has
become the regular diagnostic tool for various human and veterinary diseases (Schmitt and
Henderson 2005). Various features contribute to the choice of the detection technique, including
the specificity, sensitivity, time and money (Clarridge and Alerts 2004). It is quite obvious that
the earlier the diagnosis is made, the less time will be needed to cure the disease. It is essential to
identify the pathogen not only for antibiotic treatment but to monitor the rate of infection at the
farm level (Milner et al. 1997). The control of mastitis has included the use of chemical
disinfectants, antiseptic or herbal teat dips (Sharma and Maiti 2005). Antibiotic infusion is
among the most frequent and well-established practice for treatment of bovine mastitis. The
excessive of use of antibiotics without the prior identification of pathogen has resulted in the
development of multi drug resistance in various bacteria (De Vliegher et al. 2012; Wichmann et
al. 2014). Vaccination strategy is also ineffective for bovine mastitis as a very large number of
microorganism species are involved.
PCR is based on the detection of pathogen by amplifying part of its DNA and then
visualizing it on agarose gel (Lee et al. 1998; Baird et al. 1999). Loop-mediated isothermal
amplification (LAMP) is rapid and simple method that can be used for diagnosis of various
diseases (Notomi et al. 2000). Progress in diagnostic methods will improve the well-being of
animals by rapid diagnosis and treatment. As large number of pathogens are involved in mastitis,
Introduction
6
(Phuektes et al. 2003; Bottero et al. 2004) it is very difficult, time consuming and expensive to
perform individual tests for each one of them. Based on this rationale, research is focused on the
development of multiplex PCR that can detect several pathogens in a single reaction
The current study was designed to develop a multiplex PCR assay for the detection of
nine critically important bacterial pathogens associated with bovine mastitis and compare the
LCA sensitivity and specificity estimates of the developed assay with those of bacterial culture
and 16S rRNA sequence analysis. A LAMP assay was developed for detection of M. bovis from
mastitic milk on the basis of three sets of primers from uvrC, 16S rRNA and gyrB gene regions.
7
CHAPTER 2
REVIEW OF LITERATURE
Mastitis is an infection of udder tissue which causes damage by affecting the milk
production and by inducing pathological changes like swelling, pain, edema, inflammation and
fibrosis of the udder (Shaheen et al. 2016). The teat orifice is made up of smooth-muscled
sphincter, and its role is to keep the teat canal closed and stops milk from flowing. On the other
hand it prevents any pathogen from invading the teat canal. Keratin is produced by the cell lining
which have bacteriostatic action and serves as a barrier against bacteria. Physical injury to the
teat makes it more vulnerable to bacterial invasion, colonization, and infection because of
damage to keratin or mucous membranes lining the teat sinus. Mastitis causes inflammation and
the toxins produced by bacteria initiate the series of immunological reactions. The degree of the
inflammatory response depends on the invading pathogen, stage of lactation, age, immune status
of the cow, genetics, and nutritional status (Harmon 1994).
Milk production is an intricate system where local and systemic hormones play an
important role along with other milk producing factors (Bhutto et al. 2012). Mastitis negatively
impacts the milk production system as well as quality and quantity of milk (Esron et al. 2005). It
causes phenomenal changes in physical, chemical and bacteriological properties of milk.
Immunological reaction triggered by the pathogen invasion results in intramammary infection
(Abera et al. 2010).
2.1. FINANCIAL LOSSES
Dairy farmers believe that bovine mastitis is one of the major reasons for their personal
economic fluctuation that ultimately risks the national economy as well (Pol and Ruegg 2007a).
High concerns of the global dairy industry towards mastitis in the context of dairy animals are
Review of Literature
8
due to its widespread scale and constant increasing costs to counter such diseases (Seegers and
Fourichon 2003). It is regarded as the most important disease of dairy sector worldwide
(Hogeveen et al. 2011). Control and management schemes are focused on the prevention and
cure of mastitis (Gilbert et al. 2013).
Mastitis has a devastating effect on animal health and causes huge financial losses, 38%
of the total expenditures of the common production diseases is credited to mastitis. It is also
reported as the most common cause of death of dairy animals (Kossaibati and Esslemont 1997).
The financial losses associated with mastitis cannot be accurately measured. However financial
losses are attributed to treatment cost, labor, veterinary services including diagnostics, early cow
replacement, reduced milk production and discarded milk (Halasa et al. 2007). The other indirect
cost burden which is ignored is due to the risk and transmission of disease to other dairy animals
(Down et al. 2013).
2.2. TYPES OF MASTITIS
Bovine mastitis is an intricate disease and can be broadly classified into two types,
clinical mastitis and subclinical mastitis. Clinical mastitis can be further categorized as peracute,
acute and subacute mastitis depending on severity of symptoms. Various factors which
contribute to the level of infection include the disease-causing agent, age of the animal, its
immunological health and lactation stage (Hurley and Theil 2011) Clinical mastitis is a severe
condition in which local and systemic symptoms including redness and inflammation of affected
area, pain, loss of appetite, increased body temperature, reduction in milk yield and changes in
milk composition are evident (De Vliegher et al. 2012). In severe cases abnormal teat secretions
including milk and blood clots are observed (Lehtolainen et al. 2004).
Review of Literature
9
Subclinical mastitis results in normal appearance of mammary gland as well as milk.
However the somatic cell count is increased and this is one of the primary indications of
subclinical mastitis. The other indicators of subclinical mastitis include increased bacterial
population in milk, decreased milk production and change in composition and quality of milk
(Bian et al. 2014). Detection of subclinical mastitis is of very crucial for executing mastitis
control and management strategies (Hoque et al. 2015). It is difficult to diagnose subclinical
mastitis due to lack of visible symptoms. However in both cases laboratory diagnosis is required
for isolation and identification of pathogen involved. Mastitis results in great loss by affecting
the overall health of animal and milk production (Madouasse et al. 2010).
2.3. ETIOLOGY AND EPIDEMIOLOGY
The etiology of complex diseases like mastitis is not completely known as new pathogens
are continuously detected and reported (Shaheen et al. 2016). Bovine mastitis has been known
for a long time and researchers are continuously struggling to characterize the pathogens
responsible for it. It can be caused by an attack of pathogenic microorganism and chemical
irritants that can trigger an immune response or any kind of physiological injury. However the
pathogenic microorganisms are the major cause of mastitis (Bramely et al. 1996). Almost 200
microorganisms have been identified which cause bovine mastitis, including bacteria, yeast,
fungi and viruses (Wellenberg et al. 2002).
Bacterial mastitis is the most common and significant form of mastitis from physiological
and economic perspectives (Blowey and Edmondson 2010). Mastitis is caused by a group of
infective and potentially pathogenic bacteria. More than 150 bacterial species are identified as
mastitis pathogens (Kuang et al. 2009). Both gram positive and gram negative bacteria can cause
mastitis. Gram positive bacteria include various species of Staphylococci, Streptococci, and the
Review of Literature
10
most common gram negative bacteria are Escherichia coli (E. coli) and Klebsiella pneumoniae
(Contreras and Rodríguez 2011).
There are three major categories of bacteria that can infect bovine mammary gland
contagious, environmental and opportunist microbes (Hawari and Hassawi 2008). The
contagious pathogens live on the udder and are transmitted from infected to uninfected teats
during the milking process. They mainly include Streptococcus agalactiae, Staphylococcus
aureus and Mycoplasma bovis. They usually have very strong adhesive properties that help them
invade the inner lining of the gland. They can cause periodic episodes of clinical mastitis (Fox
and Gay 1993).
Environmental pathogens usually reside in the housing and bedding and tend to enter the
teat canal during the milking process. E. coli are the major cause of environmental mastitis
(Günther et al. 2011). S. agalactiae, S. dysgalactiae and S. uberis are most common
streptococcal species causing mastitis (Dmitriev et al. 2006). Other environmental coliforms
include Klebsiella spp., Citrobacter spp., Enterobacter spp., including E. faecalis and E.
faecium., and other gram negative bacteria such as Serratia, Pseudomonas and Proteus
(Radostitis et al. 2000).
Coagulase negative Staphylococci (S. epidermidis, S. simulans, S. saprophyticus, and S.
chromogenes) (dos Santos Nascimento et al. 2005) are opportunist pathogens and the stay on the
lining of the teat or udder skin. Staphylococcal mastitis is the most frequent cause of huge
economic losses in terms of low milk production in South Asia, and is the leading cause of
mastitis in Europe (Wilson et al. 1997; Shaheen et al. 2016). The most prevailing pathogens of
bovine mastitis throughout the World are S. aureus and Coagulase negative Staphylococci
species (Graber et al. 2007).
Review of Literature
11
Table No. 2.1: Prevalence of common mastitis pathogens Worldwide
Countries CNS S.
aureus
S.
agalactiae
S.
dysagalatiae
S.
uberis
E. coli References
Pakistan -
11.46
-
-
-
-
21.5
48.08
45
26.9
33.9
43
17.54
21.15
23
7.1
-
22
-
-
-
4.9
-
-
-
-
-
-
-
-
17.54
1.9
18
15.4
27
19
(Sadaf et al.)
(Ashfaq and
Muhammad 2008)
(Khan and
Muhammad 2005)
(Ali et al. 2011)
(Ahmad 2001)
(Akhtar and
Tanweer 2016)
India 12.6
16
28.1
47.7
16.3
27.4
24
34.7
-
27.9
5.8
-
6.7
9.1
6.9
-
-
22.7
25
-
-
-
2.7
2.3
-
8.9
20
-
-
17.4
(Ranjan et al. 2011)
(Sumathi et al.
2008)
(Sharma et al. 2012)
(Pankaj et al. 2013)
(Das and Joseph
2005)
China 34.5
25
9.9
17.4
41
30.4
22.4
27
11.2
8.8
29
3.1
6.4
53
6.2
1.8
-
19.3
(Fang et al. 1993)
(Cheng et al. 2010)
(Yang et al. 2011)
Saudi
Arabia
3.5
-
9.8
9.1
3.8
12.6
10.8
6.3
28.9
5.1
18.6
36.6
(Fadlelmula et al.
2009)
(Bashir 2015)
Brazil 18.7
-
21.5
46.4
0.4
3.9
0.4
-
0.4
-
0.4
-
(Martins et al. 2010)
(Parada et al. 2011)
Argentina
52.1
69.1
21.3
12.7
4.4
-
4.4
-
0.4
4.4
2.1
-
(Dieser et al. 2014)
(Calvinho et al.
Review of Literature
12
-
50
5.5
12.7
31.8
-
2007)
(Neder 2015)
United
states
11.3
2.8
13.6
-
9.1
0.7
2.9
9.7
10.1
0.7
0.8
4.2
-
7
-
-
-
-
-
-
0.4
9.8
1.9
4
(Wilson et al. 1997)
(Ruegg 2011)
(Pol and Ruegg
2007b)
(Makovec and
Ruegg 2003)
Canada 10.7
21.5
21.7
9.9
0.3
0.1
8.4
2.6
13.3
0.6
17.6
9
(Olde Riekerink et
al. 2008)
(Levison et al. 2016)
Australia -
0.8
9
17.5
0.1
0.1
5.4
3.3
33
13.1
7.1
0.9
(Charman et al.
2012)
New
Zealand
7.2
5.5
23.5
16.5
-
-
6.2
6.1
23.6
32
3..7
-
(Petrovski et al.
2011)
(McDougall 1999)
United
Kingdom
8.1
-
3.3
2.2
-
-
1.5
2
23.5
5.3
19.8
14.4
(Bradley et al. 2007)
(Bradley and Green
1997)
Germany 9.1 5.7 0.7 0.5 1.0 0.3 (Tenhagen et al.
2006)
Sweden 4.2
6.2
21.6
21.3
0.5
0.6
13.5
11.1
15.3
15.6
16
15.9
(Nilsson et al. 1997)
(Ericsson Unnerstad
et al. 2009)
South
Africa
61.7
60.9
17.2
16.9
1.2
5.9
2.5
2.2
1.2
2.2
-
-
(Petzer et al. 2009)
Ethiopia 3.9
30.1
38.5
21.2
43.3
47
21.1
14.7
12.2
-
-
11.6
7.2
-
-
6.4
2.8
-
-
3.3
-
4.6
3.8
7.5
(Ararsa et al. 2014)
(Abunna et al. 2013)
(Tekle and Berihe
2016)
(Mekonnen and
Tesfaye 2010)
Review of Literature
13
Table No. 2.2: Prevalence of less common mastitis pathogens Worldwide
Countries MS PD PS KS CA *OB References
Pakistan -
-
-
-
-
-
14.3
-
-
12.6
1.9
-
-
-
-
-
-
-
-
-
-
4.9
-
-
-
3.9
-
6.3
1.5
-
-
3.8
14
11.8
-
16
(Sadaf et al. 2016)
(Ashfaq and Muhammad
2008)
(Khan and Muhammad
2005)
(Ali et al. 2011)
(Ahmad 2001)
((Akhtar and Tanweer
2016)
India -
-
-
-
-
7.9
-
-
-
3.5
-
-
-
-
-
1.6
10.7
-
-
5.8
-
-
-
-
4.6
0.5
13.3
-
-
4.6
(Ranjan et al. 2011)
(Sumathi et al. 2008)
(Sharma et al. 2012)
(Pankaj et al. 2013)
(Das and Joseph 2005)
China -
-
-
0.2
-
-
-
-
-
0.2
-
-
-
-
13.7
0.4
-
-
(Fang et al. 1993)
(Cheng et al. 2010)
(Yang et al. 2011)
Saudi
Arabia
-
-
1.5
-
-
-
2.0
1.7
2.8
-
-
-
(Fadlelmula et al. 2009)
(Bashir 2015)
Brazil -
-
-
-
-
-
-
-
27.6
-
1.1
32.7
(Martins et al. 2010)
(Parada et al. 2011)
Argentina
-
-
-
0.4
-
-
-
-
-
-
-
-
5.2
-
-
-
-
-
(Dieser et al. 2014)
(Calvinho et al. 2007)
(Neder 2015)
United
states
0.1
-
-
-
0.1
-
-
-
<0.1
-
-
-
0.2
7.7
-
1.2
7.3
-
-
2.7
0.8
2.1
10
-
(Wilson et al. 1997)
(Ruegg 2011)
(Pol and Ruegg 2007b)
(Makovec and Ruegg
2003)
Canada - 1.6 0.1 9.1 0.4 4.8 (Olde Riekerink et al.
Review of Literature
14
-
1.3
-
1.9
3.4
16.2
2008)
(Levison et al. 2016)
Australia -
-
0.1
0.6
0.5
-
0.7
-
1.6
3.2
0.3
0.6
(Charman et al. 2012)
(Charman et al. 2012)
New
Zealand
-
-
-
-
-
-
-
-
-
-
4
3.6
(Petrovski et al. 2011)
(McDougall 1999)
United
Kingdom
-
-
-
-
0.2
-
0.2
-
3.5
-
0.2
-
(Bradley et al. 2007)
(Bradley and Green
1997)
Germany - - - - - 0.6 (Tenhagen et al. 2006)
Sweden -
-
-
-
-
-
2.2
4.2
-
-
9.6
6.1
(Nilsson et al. 1997)
(Ericsson Unnerstad et
al. 2009)
South
Africa
-
-
-
-
-
-
-
-
-
-
0.06
0.1
(Petzer et al. 2009)
(Petzer et al. 2009)
Ethiopia -
-
-
-
-
-
-
-
-
-
-
-
-
3.26
13.5
-
3.3
2.0
-
-
20.5
4.6
19.1
21.4
(Ararsa et al. 2014)
(Abunna et al. 2013)
(Tekle and Berihe 2016)
(Mekonnen and Tesfaye
2010)
(Mycoplasma spp. (MS), Psuedomonas spp. (PD), Pasteurella spp (PS), Klebseiella spp. (KS),
Cornybacterium spp. (CS), *Other bacteria (OB) included Bacilli, Micrococcus and Pypogenes)
This complex etiology of mastitis makes it vulnerable and difficult to control.
Epidemiological data of common and less common bacterial pathogens involved in mastitis
worldwide is given in Table No. 1.1 and 1.2.Arcanobacterium pyogenes and Peptostreptococcus
indolicus mostly affect non-lactating cows and flies are the source of spreading disease in the
herd (Sol 1984). Pseudomonas aeruginosa is associated with sporadic clinical mastitis, resulting
in acute cases, and the source of this is contaminated water (Kirk and Bartlett 1984). Bovine
Review of Literature
15
mastitis is also induced by Nocardia spp., and has an environmental origin and usually caused by
soil contamination. The clinical examination of the udder shows enlargement, edema and fibrosis
and damage to tissues is permanent. Occasionally bovine mastitis is caused by Bacillus cereus,
Streptococcus pyogenes and S. pneumonia (Quinn et al. 1999).
Mycotic mastitis is mainly due to yeast from Candida genus and algae from Prototheca
genus (mostly P. zopfii). Bovine mastitis due to fungal infections is continuously increasing
(Spanamberg et al. 2008; Tarfarosh and Purohit 2008). Infection caused by Aspergillus fumigatus
and Candida spp. is of acute nature and can cause death of an animal and the severity of
infection depends on the number of pathogenic organism (Pengov 2002).
2.4. TREATMENT
Disease management involves the diagnosis and treatment of mastitis, and control of the
spread of infection (Ali et al. 2014). In dairy animals, antibiotics are are the most common form
of treatment for mastitis (Pol and Ruegg 2007a). The mastitis cases are usually treated with
antibiotics during lactation; however antibiotic dry cow therapy is also very effective in mastitis
treatment (Halasa et al. 2009). Bovine mastitis is a major disease of dairy animals and 80% of
antibiotics used in dairy animals are administered for control and treatment of mastitis (Saini et
al. 2012; Ganda et al. 2016a). Different groups of pathogens respond differently to antibiotic
treatment. Some coliform infections have a high cure rate when an antibiotic is not administered.
Detection of pathogen before starting antibiotic treatment is crucial. A drug sensitivity test
should be performed while choosing an appropriate antibiotic (Koskinen et al. 2010).
The decision and choice of antibiotic treatment is a debatable issue due to risks associated
with it. The trend towards use of non-antibiotic treatment is increasing due to its negative impact
on development of antibiotic resistance, adverse effects on soil and water environment and
Review of Literature
16
requirement to with-hold milk during or immediately after treatment (Wichmann et al. 2014).
Detection of the pathogen is important before antibiotic treatment is initiated and culturing
results showed that 10-40% of cases do not show any bacterial growth so in those cases
antibiotics are of no use. This is because mastitis has a very complex etiology and different
pathogens respond differently to certain drugs due to presence of virulence factors. In some very
severe cases, segregation and culling is the better, and may in fact be the only choice. In short, all
these factors should be considered before treating mastitis with antibiotics (Bartlett et al. 1992).
In the last couple of decades many studies are focused on alternative treatment plans for
mastitis, but still lack decisive peer reviewed scientific evidence. Polymer based external and
internal sealant is a prophylactic approach and offered promising results as an alternative to
antibiotic dry cow therapy (Timms 2004). Research by (Woolford et al. 1998) and (Huxley et al.
2002) has reported the effectiveness of this product for mastitis prevention in uninfected teats at
drying off. An alternative approach such as use of Bacteriocin has many advantages over
conventional antibiotic treatment (Twomey et al. 2000).
In the last decade, research is focused on finding alternative approaches for treatment of
mastitis, one with less drawbacks and side effects. One such simple study was conducted which
involved an administration of an subcutaneous injection containing different concentrations of
zinc, manganese, selenium and copper (Machado et al. 2013). Results showed that these
injections have a positive impact on udder health and reduced the cases of subclinical mastitis as
compared to the control group. No effect was observed on milk production and composition.
However further studies are required to confirm these findings (Machado et al. 2013). Another
supporting study reported that no effect was observed on quantity and quality of milk produced
when these trace mineral supplement was administered (Ganda et al. 2016b).
Review of Literature
17
Antimicrobial activity of 13 lactic acid bacteria isolated from the crop of honey bees was
investigated in vitro against mastitis causing pathogens and promising results were obtained
(Piccart et al. 2016). Platelets can actively regenerate glandular tissue; in a recent study platelet
concentrate was administered together with an antibiotic or alone. Significantly better results
were obtained in mastitis cases treated with platelet concentrate and antibiotic (Lange-Consiglio
et al. 2014). A study was conducted to analyze the effect of silver ions on the mastitic pathogens
E. coli and S. aureus using proteomic analysis. Silver ions killed these pathogens by bactericidal
activity and this can be a potential candidate for an alternate treatment of mastitis (Kang et al.
2016). Copper is also known for its inhibitory action against various pathogens. Various
concentrations of copper was tested against pathogens isolated from bovine mastitis, results
found were satisfactory but further studies on pathogen response to copper in vivo are required
for practical implementation (Reyes-Jara et al. 2016).
Bacteriophage cocktails have also been used for preventing coliform mastitis in dairy
farms. In vitro studies in raw milk and mammary gland tissue culture showed that the growth of
E. coli isolates from mastitis was inhibited by these bacteriophages. Inhibition results from this
novel cocktail were comparable to some of the commonly used antibiotics. This method has the
potential to be introduced as a treatment method for E. coli induced mastitis. However in vivo
trials must be carried out to check the specific dose and other risk factors involved (Porter et al.
2016). Citrus derived oil (CDO) was tested against growth of S. aureus and invasion of bovine
mammary cells. CDO efficiently killed S. aureus cells and its invasion into bovine mammary
cells treated with CDO was also inhibited. It can be considered as a therapeutic agent against
bovine mastitis. This study was performed in vitro and confined only to S. aureus so a
comprehensive research evaluation is now required (Federman et al. 2016). Among the natural
Review of Literature
18
products, cinnamon cassia oil was tested against a few of the mastitic pathogens. It has
bactericidal activity and inhibits the growth of major bacterial species most common in bovine
mastitis. It is safe and resistance is not developed even after prolonged use. With these
advantages it has the potential to replace some of the antibiotics particularly in organic dairies
(Zhu et al. 2016).
Cell free supernatants (CFS) of Lactococcus lactis (L. lactis) strains were tested against
various mastitis pathogens. Among various strains L. lactis, LL11 and SL153 inhibited the
growth of major pathogens. It was found that they produced nisin A, a class I bacteriocin.
Immune response of bovine mammary epithelial cell line against bacteriocin producing CFS was
tested. It stimulated lysosomal activity so it can be considered as a candidate to treat and control
bovine mastitis (Malvisi et al. 2016). In a recent study, bovine single chain variable region
fragment (scFv) was obtained from cDNAs of lymphocytes suffering from S. aureus induced
mastitis. scFvs with a high affinity for S. aureus antigen were screened and tested in culture
medium where they inhibited S. aureus growth. Its role as a preventive agent was also tested
against S. aureus induced mastitis in a mouse model. These novel scFvs may be used as a
preventive agent for S. aureus induced mastitis but further study of risk factors is required (Wang
et al. 2016).
The success of gene therapy in human trials is encouraging for its application in
veterinary diseases like mastitis. It involves insertion of certain genes coding for lysozyme and
lysostaphin that can cure different types of mastitis. This is an alternative approach to induce the
production of an antibacterial agent by mammary glands and kill the pathogen (Fan et al. 2002).
Antimicrobial peptides which exist naturally in living organisms can be used as a tool of gene
therapy (Zasloff 2002).
Review of Literature
19
Recent advancement in culture independent techniques included the progress in -omics
technology. It has a lot of potential and can lead to a broader horizon of biotechnological
applications. Milk microbiota contains complex microbial population and changing patterns of
milk peptides can serve as potential biomarkers for detection studies (Mansor et al. 2013). Meta-
transcriptomics, meta-proteomics, and meta-metabolomics are contributing largely in building
new concepts. Milk microbiota has a role to play in physiology and health of the udder and
animal as well as the quality and quantity of milk (Addis et al. 2016).
2.5. EFFECTS OF MASTITIS ON HUMAN HEALTH
Clinical and subclinical mastitis not only cause severe damage to udder tissues and milk
production and causes financial damage by affecting animal health but also poses serious threat
to human health by affecting adversely the nutritional quality of milk (Gröhn et al. 2004;
Schukken et al. 2009; Gurjar et al. 2012). Mastitis alters physical, chemical, bacteriological and
organoleptic properties of milk. High somatic cell count due to mastitis is associated with
reduction in lactose and nonfat solids in milk, however the level of change is dependent on the
causative agent (dos Reis et al. 2013). Similarly proteins and calcium levels are also lowered in
mastitic milk, damaged epithelial cells in milk promote the release of certain enzymes
(Oliszewski et al. 2002).
Antibiotic residues in milk can cause allergic reactions when consumed but this can be
avoided by discarding milk during antibiotic treatment. Resistant strains of bacteria are
continuously developing due to antibiotic use and its transfer to humans cannot be ignored
(Virdis et al. 2010). Multi-drug resistant microorganisms are posing a serious threat to human
and animal health. Spread of antimicrobial resistance cannot be controlled easily due to its
various routes of transmission (Köck et al. 2016). Scrutiny of antimicrobial resistant clones at an
Review of Literature
20
early stage can help to control its transmission from livestock to humans (Spoor et al. 2013).
Mastitic milk obtained from antibiotic-treated dairy animals can be the source of antimicrobial
resistance in humans. To ensure safety and quality of milk, the excessive of use of antibiotics
must be controlled (Shamila-Syuhada et al. 2016).
2.6. CONTROL MEASURES AND FUTURE ASPECTS
The control strategies must be developed to avoid the use of antibiotics and greater losses
in terms of culling. Control measures mainly rely on detailed screening and inspection of dairy
farms, evaluation of welfare plans and the use of prognostic diagnostic tests. These monitoring
actions can identify animals at risk and spread of disease can also be controlled. Similarly
comprehensive record keeping and the choice of effective treatment can be improved. For
example, the use of immuno-modulators can improve immuno-competence and disease
resistance in animals (Trevisi et al. 2014).
In some of the recent studies, ghost bacteria are used as a vaccine for inducing immunity
against infection. In one such approach ultraviolet-killed E. coli bacterin were injected for
intramammary immunization at dry off. It resulted in partial prevention against E. coli induced
mastitis. It was compared with J-5 bacterin vaccine evaluated by (Gurjar et al. 2013) and gave
better protection and increased milk production. Further progress in immunization strategies and
related challenges in the field can lead to improved results (Pomeroy et al. 2016).
Another major target for vaccine development is S. aureus and for this purpose virulence
factors are studied. The relationship between virulence factors of pathogen and host response has
been explored to study immune response (Scali et al. 2015). Expression of antigen in non-
conventional hosts such as plants is of interest. Development of new vaccines can help minimize
the antibiotic use and control S. aureus mastitis (Festa et al. 2013). S. uberis is another pathogen
Review of Literature
21
causing mastitis worldwide. Vaccine antigens from the protein of S. uberis were evaluated as a
potential target and tested in murine models (Collado et al. 2016)
Comparative studies of conventional and organic dairy farms can be very useful to
identify the factors involved in control of mastitis. This could lead to development of better
management strategies and promote organic farming or otherwise avoiding contributing factors
on conventional dairy farms (Levison et al. 2016). Major mastitic pathogens have an ability to
form biofilms which make them more resistance and difficult to control by causing recurrent
infections. In-depth knowledge of biofilm formation and control mechanism could lead to better
control (Gomes et al. 2016).
This is an old belief and is still true, that “prevention is better than cure”. Similarly
various management and control strategies were adopted for prevention of mastitis. In the last
few decades studies are directed towards farm management. It includes genetic selection for
better milk production & disease prevention, health care facilities mainly better hygiene & early
diagnosis and understanding of the host response to lead to improved treatment of mastitis
(Shook 2006; Arif et al. 2015).
Biosensors can be used as a monitoring tool for animal health management. Various such
tools are used practically for human health status and disease diagnosis. With some
modifications these can be used for animals. Such advanced techniques including microfluidics,
sound analyzers, sweat and saliva sensing and nano-biosensors are gaining attention due to
various advantages. Together with these techniques a comprehensive online system can
contribute for better farm management (Neethirajan 2017). Understanding of the host response to
various mastitis pathogens by meta-analysis of available literature discloses various vital themes
Review of Literature
22
including genes responsible for biological functions and pathways. It can be very useful for
better control (Genini et al. 2011).
2.7. DIAGNOSTIC METHODS
Accurate diagnosis of disease is the major step between the cause and cure of disease. An
economical, reliable and rapid diagnostic tool is fundamental for the management of udder health
(Yasser 2014). The earlier the disease is identified the less will be the damage, keeping this in
prospect, many efforts are being made to develop the reliable diagnostic tools.
In simple terms there are two stages of disease diagnosis, first is an indicative of disease
status if it is present or not and in the second stage causative agent is detected. Disease status is
indicated by appearance of udder and milk in case of clinical mastitis and on farm screening tests
used traditionally for detection of sub-clinical mastitis like somatic cell count, california mastitis
test and surf field mastitis tests. None of the above mentioned methods indicate causative agent
or quantitative results for level of severity (Viguier et al. 2009). Somatic cell count is considered
as a universal indicator for mastitis detection and is widely used for determining milk quality in
individual quarters and bulk tanks. It has few disadvantages like cost of the test and requirement
of trained staff (Rasmussen 2001).
Inflammation in mammary gland results in decreased milk production, veterinary care
costs and culling losses. Despite considerable knowledge about mastitis and its etiology, this
disease is still prevalent in many dairy herds; it remains most difficult to eradicate or control, and
it has a great negative financial impact on the dairy industry worldwide. These losses are caused
by several factors such as a decrease in the total milk output with marked compositional changes
in the milk (a reduction in the quality and industrial usability), cost of treatments, labor costs,
and increasing the chance of premature culling of cows (Halasa et al. 2007). Decreased milk
Review of Literature
23
production is often due to the direct effect of pathogen or damage caused by host immune
response. Mastitis is very complicated in terms of etiology, degree of losses and treatment
strategy (Detilleux et al. 2015).
Mastitis not only affects the health of animal and results in reduced milk production but it
also has a negative impact on quality of milk. Sub-clinical mastitic milk samples have decreased
milk fat, protein, lactose, potassium, calcium, magnesium, phosphorous, iron and zinc and
increased pH, electrical conductivity, malondialdehyde, leukocytes and neutrophil count
(Qayyum et al. 2016).
Bovine mastitis is the most significant and costly disease of dairy herds. One key
component of better control of this disease is identification of the causative bacterial agent
during udder infections in cows. Mastitis is complex, given the diversity of pathogens that must
be identified. Development of a rapid and efficient bacterial species identification tool is thus
necessary. Early detection of mastitis and identification of causative agent is crucial for control
and treatment. The initial methods used for detection are estimation of somatic cell counts, an
indication of inflammation, measurement of biomarkers associated with the onset of the disease
(e.g. the enzymes N-acetyl-β-D-glucosaminidase and lactate dehydrogenase) and identification
of the causative microorganisms, which often involves culturing methods. These methods have
their limitations and there is a need for new rapid, sensitive and reliable assays. Recently,
significant advances in the identification of nucleic acid markers and other novel biomarkers and
the development of sensor-based platforms have taken place (Viguier et al. 2009).
2.7.1. Traditional Methods
Mastitis diagnosis begins with the observation of any apparent change in the mammary
gland or milk followed by other clinical signs like fever, weakness or loss of appetite. Staff at a
Review of Literature
24
dairy herd has an important role to play in this initial screening and visual observation of
symptoms (Lam et al. 1993). Well trained and vigilant staff can help in better control and
management of mastitis by not ignoring even the minor change in the udder tissue or a smallest
clot in milk. As the above mentioned symptoms are an indication of intra mammary infections
and if taken in account can help initiate early treatment and control the spread of disease (Hulsen
et al. 2008).
The above mentioned physiological symptoms appear at the clinical stage of mastitis. It is
a complex disease not only in terms of etiology but it shows many symptoms which vary
depending on the nutritional status of animal, pathogenic strain involved or other factors.
Somatic cell count (SCC) is often considered as the most widely used biomarker for detection of
bovine mastitis and is linked with infection status in terms of severity and stage (Harmon 1994).
SCC levels can also increase slightly by other stress factors which are not related with mastitis.
Currently the threshold of 200,000 cells/mL is supposed to give the status of disease if it is
present or not (Schukken et al. 2003).
Various methods are used for determination of the somatic cell count which include
direct microscopic counting using methylene blue staining, coulter counting and flouro-optic
electronic cell counting by disk or flow cytometry. Direct microscopic counting is the reference
method but have many limitations. It is time consuming and skilled labor is required and it is
difficult to differentiate between cells and cytoplasmic particles (Moon et al. 2007). Electronic
particle counting is performed with a coulter counter. It involves the addition of formaldehyde
prior to performing the test to fix the somatic cells and cell lysis treatment to remove fat cells
(Miller et al. 1986). The indirect methods for SCC determination are Fossomatic, Somacount,
Somascope based on disk or flow cytometry. These methods are equally good for fresh as well as
Review of Literature
25
preserved milk and no pre-treatment is required. Flow cytometry combined with fluorescence
staining gave a better option as a rapid reliable and affordable test (Gunasekera et al. 2003).
California mastitis test (CMT) and Surf field mastitis test (SFMT) are very simple and
can be performed on farm for SCC estimation (Schalm and Noorlander 1957). The reagent used
in CMT is sodium alkyl aryl sulfonate. SFMT requires commonly used the detergent named as
Surf so it is cheaper and conveniently available in poor countries. However results obtained are
comparable to each other. It is based on the principle that nucleic acids and other cell
constituents are released in the presence of high SCC and gel is formed which can be easily
detected (Sargeant et al. 2001; Muhammad et al. 2010). The few drawbacks linked with these
tests include false positive and false negative tests and none of these give any numerical values.
These tests do not identify the pathogen involved and severity of infection, but only give mastitis
positive or negative results (Viguier et al. 2009). Among cow side indicators firmness of udder
can also serve as an indicator of bovine mastitis. Firmness of infected and normal udder before
and after milking is checked and considerable increase in udder firmness of infected udder after
milking can be observed. Further studies on udder firmness and its relationship with disease may
to lead to its application as a predictive indicator of mastitis (Rees et al. 2017).
All of the above mentioned methods are indicative of disease and some of them identify
the stage or severity of mastitis. However none of them can tell the causative agent. Many
advantages are related with early and accurate detection of the pathogen involved. These include
the choice of treatment method and antibiotic selection and better management strategies to
control the spread of disease, especially in the case of a contagious organism. Researchers from
different areas of expertise including dairy researchers, microbiologists, molecular biologists,
Review of Literature
26
biochemists, nano-technologist are struggling to find suitable, simple, accurate and cheap tests
for detection of mastitic pathogens.
2.7.2. Microbial Culturing Method
Pathogens involved in various veterinary diseases are usually identified by microbial
culturing or antibody based detection methods (Schmitt and Henderson 2005). Detection of
causative organisms of mastitis has many advantages in terms of selective use of antibiotics,
reduced risk of spread of infection in case of contagious pathogen and culling decision. Bacterial
culturing based detection of pathogen is still considered as a gold standard despite many
discrepancies and its inconvenience (Hogan et al. 1999). The major discrepancies associated with
the culturing method are false negative results, time consuming and labor intensive. In samples
containing more than one pathogen, one bacterial species may suppress the growth of others and
many bacterial species require long period of time for growth like mycoplasma spp. Results
mainly rely on interpretation of phenotypic properties of bacterial culture, so considerable
variability is seen. It has been reported already that microbial culturing of mastitis milk samples
gave 27-50% false negative results (Makovec and Ruegg 2003; Barrett et al. 2005; Bradley et al.
2007; Koivula et al. 2007; Olde Riekerink et al. 2008).
Despite the above mentioned facts, efforts were still made to come up with a better
diagnostic assay on the basis of microbial culturing. Various microbial culturing based kits
(VetoRapid and Vétoquinol) were designed to serve the purpose. The specificity and sensitivity
of these on farm culturing kits were compared with routine culturing method. These kits offered
economic benefits by rapid detection of gram positive clinical mastitis pathogens. These reported
results also showed misidentification of certain pathogens in some cases (Viora et al. 2014). On-
farm culture systems were devised for an early treatment decision. They are based on the use of
Review of Literature
27
selective media for differentiation between various groups of mastitis pathogens. Minnesota Easy
Culture System II Bi-Plate and Tri-Plate were evaluated as on-farm culture systems. Results
indicated higher specificity but lower sensitivity. These methods were more reliable for broad
classification of infections but not very promising for closely related species identification
(Royster et al. 2014). These on-farm culture systems did not serve as the replacement of
laboratory microbial culturing; however, acceptable results were obtained to make quick
treatment decision for mastitis cases.
2.7.3. Probes Based Assay
Nanotechnology based diagnosis of infectious diseases is gaining a lot of attention in the
last couple of decades. Nanotechnology based biosensors provide the concept of lab on chip and
can lead to rapid and accurate detection of pathogens (Driskell and Tripp 2009). Nanoparticles
together with proteomics can be a future candidate for rapid diagnosis of bovine mastitis
pathogen. The study was conducted in which specific protein corona was formed when novel
magnetic nanoparticles were added to biological fluid. This can further help in minimizing
proteome complexity by analyzing protein corona on nanoparticles (Miotto et al. 2016).
Microarray diagnostics in 3-D nitrocellulose membranes was used for diagnosis of mastitis, A
bio-chip used in this study has a inkjet printer and a set tag specific antibodies immobilized on
nitrocellulose membrane coated slides. Conjugate for secondary signal was prepared using black
carbon nanoparticles and a fusion protein. The blackness of the spots can be determined by
flatbed scanning; however, it can be easily read by naked eye. This bio-chip based assay has the
ability to detect four mastitic pathogens in less than 3 hours (Mujawar et al. 2013).
2.7.3. PCR Based Methods
Use of molecular techniques in veterinary diagnostics is no longer a new strategy. These
methods have the potential to detect the pathogen with higher sensitivity and specificity. The
Review of Literature
28
advent of PCR technology along with its various versions like multiplex PCR, real time PCR and
LAMP PCR has improved the rapidity and sensitivity of diagnosis. These DNA-based diagnostic
methods have greatly aided in better management of dairy farms. Nucleic acid based detection
relies on the genomic sequences of various pathogens (Deb et al. 2013).
Certain mastitis pathogens yield no growth in bacterial culture or difficult to detect due to
slow growth rate. PCR assays are quite popular in dealing with such issues by rapidly detecting
the pathogen with high specificity. One such study was conducted by Boonyayatra et al. (2012)
to detect three species of mycoplasma by real time PCR assay.
PCR electrospray ionization mass spectrometry was analyzed as a diagnostic tool for
bovine mastitis pathogens from milk samples. It can detect not only bacterial species but yeasts,
molds, parasites and viruses in a mixed culture. It has high specificity and sensitivity, but is quite
costly to be used as a routine diagnostic tool (Perreten et al. 2013). DNA sequencing is usually
preferred for identification of bacteria. 16S rRNA sequencing is used largely for identification of
closely related bacterial species (Lange et al. 2015).
Various techniques are combined in different studies to obtain the best results. One such
example is combining real-time PCR with high resolution melt analysis for detection of mastitis
pathogens. This method can also serve as an alternative to traditional diagnostic methods and
offers a series of benefits including low cost and rapid results (Ajitkumar et al. 2012). The less
common, non-viable, slow growing and phenotypically unique pathogens are always difficult to
detect by routing diagnostic methods. PCR and DNA sequencing provided more favorable
results that could lead to early treatment and better control strategies for infectious diseases. 16S
rRNA sequencing can identify novel bacterial species in various diseases. (Woo et al. 2008).
Review of Literature
29
Various attempts were made for rapid identification of a mastitis pathogen by PCR using
samples collected on filter paper disks. There are many benefits associated with such kind of
methods but not all the pathogens can be recovered from filter paper by this technique. S.
agalactiae was detected by this method and the samples can be stored at room temperature for
four weeks (Jiusheng et al. 2008). PCR is more sensitive, rapid and reliable as compared to
bacterial culturing method for detection of various mastitis pathogens (Cantekin et al. 2015).
Multiplex PCR assay was designed for the detection of four common mastitis pathogens in a
single test. Multiplex PCR assay has many advantages over the traditional techniques in terms of
ease, sensitivity and specificity (Charaya et al. 2015). Fluorescent in situ hybridization (FISH) is
another culture independent method tested for detection of mastitis pathogens. It is less time
consuming and reliable but is not commonly used due to certain limitations such as a
pretreatment step is required to obtain the results and high detection limit (Gey et al. 2013).
Various studies are focused on development of multiplex PCR assays for detection of
various common mastitis pathogens (Pradham et al. 2011) (Riffon et al. 2001). Genus and
species specific multiplex PCR for detection of Enterococci was developed by Jackson et al.
(2004). It showed a high percentage of agreement when compared to other available methods for
identification of the target species. There is a need for a perfect gold standard test for detection of
bovine mastitis pathogens, which is rapid and accurate, specific and sensitive and can be easily
performed. Various studies focused on development of multiplex real-time PCR assay for
detection of major mastitis pathogens have shown great potential and future prospects due to a
high sensitivity and specificity (Gillespie and Oliver 2005; Paradis et al. 2012).
PCR has the power to identify and discriminate between closely linked microorganisms
(Koskinen et al. 2009). 16S ribosomal RNA (rRNA) gene sequencing is a popular alternative to
Review of Literature
30
traditional methods and provides several advantages (Petti et al. 2005). Reliable identification of
the etiological agent is crucial in mastitis diagnostics. Real-time PCR is a fast, automated tool for
detecting the most common udder pathogens directly from milk (Hiitiö et al. 2015).
Multiplex PCR assay has an ability to detect more than one pathogen at a time. Various efforts
have been made to detect multiple pathogens involved in mastitis. One such assay was developed
for the detection of three common mastitis pathogens namely S. aureus, E. coli and S.
agalactiae, the reported multiplex PCR assay was rapid, sensitive and specific, when compared
with conventional microbial culturing and monoplex PCR (Amin et al. 2011). A genus specific
multiplex PCR assay was designed targeting S. aureus, E. coli and Streptococcus species by
multiplex PCR. According to obtained results the developed assay was quite efficient with high
sensitivity and specificity for target species (Pradham et al. 2011).
A single reaction multiplex PCR was also developed for strain typing of pathogenic
strains A to E of staphylococcal enterotoxins (Sharma et al. 2000). For the simultaneous
detection of S. agalactiae, S. uberis and S. dysgalactiae, Surynek et al. (2014) performed a
multiplex quantitative PCR assay. For the simultaneous identification of S. aureus, S. agalactiae,
S. uberis and S. dysgalactiae major mastitis causing pathogens, a 16S to 23S rRNA spacer region
was targeted by multiplex PCR assay. The developed assay can be used as a routine diagnostic
tool for detection of these pathogens in mastitic milk samples (Phuektes et al. 2001). For the
simultaneous detection of ten mastitis pathogens a two reaction multiplex PCR approach was
used. It has the ability to rapidly identify these important bacterial pathogens (Shome et al.
2011). Multiplex is used together with real-time PCR and an assay was developed to detect four
of three of the common mastitis pathogens namely, S. aureus, S. agalactiae, and S. uberis
Review of Literature
31
directly from milk. This study ensures the potential use of real-time multiplex PCR assay for the
diagnosis of mastitis and other complex diseases (Gillespie and Oliver 2005).
A multiplex real-time PCR kit PathoProofTM is available commercially for detection of
eleven mastitis causing pathogens. It has shown higher sensitivity and specificity and is quite
rapid when compared with microbial culturing (Koskinen et al. 2009). The performance of any
diagnostic test is determined by calculating its sensitivity and specificity, which is calculated by
comparing against a perfect reference test. For diagnosis of mastitis the assumed gold standard
test which is microbial culturing is not even a perfect reference test. Latent class analysis is an
alternative approach (Hui and Walter 1980). There is no assumption of an accurate test or the test
under study. It is based on the assumption that disease status exists but is unknown (Toft et al.
2007). In one such study sensitivity and specificity were estimated for California mastitis test
and bacterial culturing by latent class analysis (Mahmmod et al. 2013).
Loop-mediated isothermal amplification (LAMP) is another exciting technology that was
first presented by Notomi et al. (2000). In the last few years, it has gained much popularity in the
field of diagnostics. It is quite rapid, economical, sensitive and specific method that has the
potential to be used as a field test with few modifications (Lee 2017). It is based on the strand
displacement activity of DNA at isothermal conditions in the presence of Bst polymerase. It
produces dumbbell shaped structures which serve as template for the further amplification. As a
result stem loop DNA of varied length are produced which gives a ladder like pattern when
visualized on agarose gel (Notomi et al. 2000; Tomita et al. 2008). Results can be directly
visualized by adding a dye like SYBR green, change in the color due to presence of magnesium
pyrophosphate a LAMP byproduct indicate the positive samples (Parida et al. 2008). Various
studies are focused on the development of LAMP assay for the detection of mastitis pathogens.
Review of Literature
32
For the detection of major mastitis pathogen such as S. aureus, S. agalactiae, S. uberis from
bovine mastitis milk a LAMP test was developed by (Tie et al. (2012), Bosward et al. (2016) and
Cornelissen et al. (2016) respectively. Researchers are focused to deal with limitations of LAMP.
Its use in combination with lateral flow assay and lyophilized and electric LAMP has a lot of
potential to serve as a field test for diagnosis of various diseases and for sex determination on
site (Centeno-Cuadros et al. 2016).
2.8. REFERENCES
Abera M, Demie B, Aragaw K, Regassa F, Regassa A. 2010. Isolation and identification of
Staphylococcus aureus from bovine mastitic milk and their drug resistance patterns in
Adama town, Ethiopia. J Vet Med Anim Heal. 2: 29–34.
Abunna F, Fufa G, Megersa B, Regassa A. 2013. Bovine mastitis: prevalence, risk factors and
bacterial isolation in small-holder dairy farms in Addis Ababa City, Ethiopia. Glob Vet.
10: 647–652
Addis MF, Tanca A, Uzzau S, Oikonomou G, Bicalho RC, Moroni P. 2016. The bovine milk
microbiota: insights and perspectives from -omics studies. Mol Biosyst. 12: 1–29.
Ahmad R. 2001. Studies on mastitis among dairy buffaloes. Pak Vet J. 21: 220–221
Ajitkumar P, Barkema HW, Buck JD. 2012. Rapid identification of bovine mastitis pathogens by
high-resolution melt analysis of 16S rDNA sequences. Vet Microbiol. 155: 332–340.
Akhtar A, Tanweer UAJ. 2016. Prevalence of mastitis and identification of causitive pathogens
in local and crossbred cows in Dera Ismail Khan. Pak J of Sci 64: 3.
Ali MA, Ahmad MD, Muhammad K, Anjum AA. 2011. Prevalence of sub-clinical mastitis in
Review of Literature
33
dairy buffaloes of Punjab, Pakistan. J Anim Plant Sci. 21: 477–480.
Ali T, Rahman A, Qureshi MS, Hussain MT, Khan MS, Uddin S, Iqbal M, Han B. 2014. Effect
of management practices and animal age on incidence of mastitis in Nili Ravi buffaloes.
Trop. Anim Health Prod. 46: 1279–1285.
Amin ASS, Hamouda RH, Abdel-all A. 2011. PCR assays for detecting major pathogens of
mastitis in milk samples 1. World J Dairy Food Sci. 6: 199–206.
Ararsa D, Tadele T, Aster Y. 2014. Prevalence of clinical and sub-clinical mastitis on cross bred
dairy cows at Holleta Agricultural Research Center, Central Ethiopia. J Vet Med Anim
Heal. 6: 13–17.
Arif A, Rehman MU, Bhat SA, Mir BA, Bhat RR, Mir MR, Bilal S, Hussain I. 2015. Scenario of
genetic selection and its impact on bovine mastitis. Int J Agro Vet Med Sci. 9: 242–252.
Ashfaq M, Razzaq A, Javed I. 2015. Livestock productivity under threat as diseases hound the
sector. Pakistan Today.
Ashfaq K, Muhammad G. 2008. Pathogens associated with bovine and bubaline mastitis in peri-
urban areas of Faisalabad, Pakistan. Pak. J. Life Soc. Sci 6: 86–88.
Bachaya H, Raza M, Murtaza S, Akbar IUR. 2011. Subclinical bovine mastitis in Muzaffar Garh
district of Punjab (Pakistan). J Anim Plant Sci. 21: 16–19.
Baird SC, Carman J, Dinsmore RP, Walker RL, Collins JK. 1999. Detection and identification
of Mycoplasma from bovine mastitis infections using a nested polymerase chain reaction.
J Vet Diagnostic Investig. 11: 432–435.
Review of Literature
34
Barrett DJ, Healy AM, Leonard FC, Doherty ML. 2005. Prevalence of pathogens causing
subclinical mastitis in 15 dairy herds in the Republic of Ireland. Irish Vet J. 58: 333.
Bartlett PC, Miller GY, Lance SE, Heider LE. 1992. Clinical mastitis and intramammary
infections on Ohio dairy farms. Prev Vet Med. 12: 59–71.
Bashir S 2015. Bacteriological observations on mastitis of dairy cows. UOFK.
Bhutto AL, Murray RD, Woldehiwet Z. 2012. California mastitis test scores as indicators of
subclinical intra-mammary infections at the end of lactation in dairy cows. Res Vet Sci.
92: 13–17.
Bian Y, Lv Y, Li Q. 2014. Identification of diagnostic protein markers of subclinical mastitis in
bovine whey using comparative proteomics. Bull Vet Inst Pulawy. 58: 385–392.
Biek R, O’Hare A, Wright D, Mallon T, McCormick C, Orton RJ, McDowell S, Trewby H,
Skuce RA, Kao RR. 2012. Whole genome sequencing reveals local transmission patterns
of Mycobacterium bovis in sympatric cattle and badger populations. PLoS Pathog. 8:
e1003008.
Blowey R, Edmondson P. 2010. The milking routine and its effect on mastitis. mastitis control in
dairy herds. 95–115.
Boonyayatra S, Fox LK, Gay JM, Sawant A, Besser TE. 2012. Discrimination between
Mycoplasma and Acholeplasma species of bovine origin using digitonin disc diffusion
assay, nisin disc diffusion assay, and conventional polymerase chain reaction. J Vet
Diagn Invest. 24: 7–13.
Bosward KL, House JK, Deveridge A, Mathews K, Sheehy PA. 2016. Development of a loop-
Review of Literature
35
mediated isothermal amplification assay for the detection of Streptococcus agalactiae in
Bovine Milk. J Dairy Sci. 99: 2142–2150.
Bottero MT, Dalmasso A, Soglia D, Rosati S, Decastelli L, Civera T. 2004. Development of a
multiplex pcr assay for the identification of pathogenic genes of Escherichia coli in milk
and milk products. Mol Cell Probes. 18: 283–288.
Bramely AJ, Cullor JS, Erskine RJ, Fox LK, Harmon RJ, Hogan JS, Nickerson SC, Oliver SP,
Smith KL, Sordillo LM. 1996. Current concepts of bovine mastitis. national mastitis
council.
Bradley AJ, Green MJ. 1997. “Clinical mastitis in dairy cows after’blitz’therapy. Vet Rec. 141:
179-180.
Bradley AJ, Leach KA, Breen JE, Green LE, Green MJ. 2007. Survey of the incidence and
aetiology of mastitis on dairy farms in England and Wales. Vet Rec. 160: 253–257.
Bramely AJ, Cullor JS, Erskine RJ, Fox LK, Harmon RJ, Hogan JS, Nickerson SC, Oliver SP,
Smith KL, Sordillo LM. 1996. Current concepts of bovine mastitis. National Mastitis
Council. 4th Ed. National Mastitis Council, Inc.
Calvinho LF, Canavesio VR, Iguzquiza IA, Marioni I, Puricelli FG, Neder VE, Tarabla HD,
Aubagna MD. 2007. Intramammary infections during the periparturient period in
Argentine dairy heifers. Rev Argent Microbiol. 39: 84–89.
Cantekin Z, Ergun Y, Dogruer G, Saribay MK, Solmaz H. 2015. Comparison of PCR and culture
methods for diagnosis of subclinical mastitis in dairy cattle. Kafkas Univ Vet Fak Derg.
21: 277-282.
Review of Literature
36
Centeno-Cuadros A, Abbasi I, Nathan R. 2016. Sex determination in the wild: a field application
of loop-mediated isothermal amplification successfully determines sex across three raptor
species. Mol Ecol Resour. 153–160.
Ceotto H, Dias RC, Nascimento JDS, Brito MA, Giambiagi‐deMarval M, Bastos MDC. 2012.
Aureocin A70 production is disseminated amongst genetically unrelated Staphylococcus
aureus involved in bovine mastitis. Lett Appl Microbiol. 54: 455– 461.
Charaya G, Sharma A, Kumar A, Goel P, Singh M. 2015. Detection of major mastitis pathogens
by multiplex polymerase chain reaction assay in buffalo milk. Indian J. Anim. Sci. 85:
122–125.
Charman N, Dyson R, Hodge A, Robertson N, Chaplin S. 2012. A survey of mastitis pathogens
in the South-eastern Australian dairy industry. In: proceedings of countdown symposium
pp 18–22.
Cheng D, Zhu S, Yin Z, Ding W, Mu Z, Su Z, Sun H. 2010. Prevalence of bacterial infection
responsible for bovine mastitis. african J Microbiol Res. 4: 1110–1116.
Clarridge JE, Alerts C. 2004. Impact of 16S rRNA gene sequence analysis for identification of
bacteria on clinical microbiology and infectious diseases. Clin Microbiol Rev. 17: 840–
862.
Collado R, Prenafeta A, González-González L, Pérez-Pons JA, Sitjà M. 2016. Probing vaccine
antigens against bovine mastitis caused by Streptococcus uberis. Vaccine. 34: 3848–
3854.
Contreras GA, JM Rodríguez. 2011. Mastitis: Comparative Etiology and Epidemiology. J
Review of Literature
37
Mammary Gland Biol Neoplasia. 16:339–356.
Cornelissen JBWJ, A De Greef, AE Heuvelink, M Swarts, HE Smith, FJ Van Der Wal. 2016.
Rapid detection of Streptococcus uberis in raw milk by loop mediated isothermal
amplification. J Dairy Sci. 99:4270–4281.
Cressier B, Bissonnette N. 2011. Assessment of an extraction protocol to detect the major
mastitis-causing pathogens in bovine milk. J Dairy Sci. 94: 2171–2184.
Das PK, E Joseph. 2005. Identification and antibigram of microbes associated with buffalo mas-
titis in Jabalpur, Madhya pradesh, India. Buffalo Bulletin. 24: 3–9.
Detilleux J, Kastelic JP, Barkema HW. 2015. Mediation analysis to estimate direct and indirect
milk losses due to clinical mastitis in dairy cattle. Prev Vet Med. 118: 449–456.
Dieser SA, Vissio C, Lasagno MC, Inés Bogni C, Larriestra AJ, Odierno LM. 2014. Prevalence
of pathogens causing subclinical mastitis in Argentinean dairy herds. Pak Vet J. 34: 124–
126.
Dmitriev A, Bhide M, Mikula I. 2006. cpn60 gene-based multiplex-pcr assay for simultaneous
identification of Streptococcal species. Acta Vet Brno. 75: 235–240.
dos Reis CBM, Barreiro JR, Mestieri L, de Felício Porcionato MA, dos Santos MV. 2013. Effect
of somatic cell count and mastitis pathogens on milk composition in Gyr cows. BMC Vet
Res. 9: 1.
Down PM, Green MJ, Hudson CD. 2013. Rate of Transmission: A major determinant of the cost
of clinical mastitis. J Dairy Sci. 96: 6301–6314.
Review of Literature
38
Driskell JD, Tripp RA. 2009. Emerging technologies in nanotechnology-based pathogen
detection. Clin Microbiol Newsl. 31: 137–144.
Ericsson UH, Lindberg A, Waller KP, Ekman T, Artursson K, Nilsson-Öst M, Bengtsson B.
2009. Microbial aetiology of acute clinical mastitis and agent-specific risk factors. Vet
Microbiol. 137: 90–97.
Esron DK, Lughano JK, Robinson HM, Angolwisye MK, Sindato C, Dominic MK. 2005.
Studies on mastitis, milk quality and health risks associated with consumption of milk
from pastoral herds in Dodoma and Morogoro regions. Tanzania J Vet Sci. 6: 213–221.
Fadlelmula A, Dughaym AMAL, Mohamed GE, Deib MKAL, Zubaidy AJAL, Ahsa A. 2009.
Bovine mastitis: epidemiological, clinical and etiological study in a Saudi Arabian large
dairy farms. Bulg J Vet Med. 12: 199–206.
Fan W, Plaut K, Bramley AJ, Barlow JW, Kerr DE. 2002. Adenoviral-mediated transfer of a
lysostaphin gene into the goat mammary gland. J Dairy Sci. 85: 1709–1716.
Fang W, Jiang C, Liu H. 1993. Epidemiologic aspects of bovine mastitis and its control in
several dairy herds in southeastern China. Prev Vet Med. 15: 169–180.
FAO. 2004. Impact of mastitis in smal scale dairy production systems. animal production and
health working Paper.13.
Federman C, Joo J, Almario JA, Salaheen S, Biswas D. 2016. Citrus-derived oil inhibits
Staphylococcus aureus growth and alters its interactions with bovine mammary cells. J
Dairy Sci. 99: 3667–3674.
Festa M, Brun P, Piccinini R, Castagliuolo I, Basso B, Zecconi A. 2013. Staphylococcus Aureus
Review of Literature
39
Efb Protein Expression in Nicotiana Tabacum and Immune Response to Oral
Administration. Res Vet Sci. 94: 484–489.
Fox LK, Gay JM. 1993. Contagious Mastitis. Vet Clin North Am Food Anim Pr. 9: 475–487.
Ganda EK, Bisinotto RS, Vasquez AK, Teixeira AGV, Machado VS, Foditsch C, Bicalho M,
Lima FS, Stephens L, Gomes MS, Dias JM. 2016a. Effects of Injectable Trace Mineral
Supplementation in Lactating Dairy Cows with Elevated Somatic Cell Counts. J Dairy
Sci. 99: 7319-7329.
Ganda EK, Bisinotto RS, Lima SF, Kronauer K, Decter DH, Oikonomou G, Schukken YH,
Bicalho RC. 2016b. Longitudinal metagenomic profiling of bovine milk to assess the
impact of intramammary treatment using a third-generation cephalosporin. Sci Reports.
6: 33–38.
Genini S, Badaoui B, Sclep G, Bishop SC, Waddington D, van der Laan MH, Klopp C, Cabau C,
Seyfert HM, Petzl W, Jensen K. 2011. Strengthening insights into host responses to
mastitis infection in ruminants by combining heterogeneous microarray data sources.
BMC Genomics. 12: 225.
Gey A, C Werckenthin, S Poppert, RK Straubinger. 2013. Identification of pathogens in mastitis
milk samples with fluorescent in situ hybridization. J Vet Diagn Invest. 25:386–394.
Gilbert FB, Cunha P, Jensen K, Glass EJ, Foucras G, Robert-Granié C, Rupp R, Rainard P. 2013.
Differential response of bovine mammary epithelial cells to Staphylococcus aureus or
Escherichia coli agonists of the innate immune system. Vet Res. 44: 1–23.
Gillespie BE, Oliver SP. 2005. Simultaneous detection of mastitis pathogens, Staphylococcus
Review of Literature
40
aureus, Streptococcus uberis, and Streptococcus agalactiae by multiplex real-time
polymerase chain reaction. J Dairy Sci. 88: 3510–3518.
Gomes F, Saavedra MJ, Henriques M. 2016. Bovine mastitis disease/pathogenicity: evidence of
the potential role of microbial biofilms. Pathog Dis. 1–19.
Graber HU, Casey MG, Naskova J, Steiner A, Schaeren W. 2007. Development of a highly
sensitive and specific assay to detect Staphylococcus aureus in bovine mastitic milk. J
Dairy Sci. 90: 4661–4669.
Gröhn YT, Wilson DJ, González RN, Hertl JA, Schulte H, Bennett G, Schukken YH. 2004.
Effect of pathogen-specific clinical mastitis on milk yield in dairy cows. J Dairy Sci. 87:
3358–3374.
Gunasekera TS, Veal DA, Attfield PV. 2003. Potential for broad applications of flow cytometry
and fluorescence techniques in microbiological and somatic cell analyses of milk. Int J
Food Microbiol. 85: 269–279.
Günther J, Esch K, Poschadel N, Petzl W, Zerbe H, Mitterhuemer S, Blum H, Seyfert HM. 2011.
Comparative kinetics of Escherichia coli- and Staphylococcus aureus-specific activation
of key immune pathways in mammary epithelial cells demonstrates that S. aureus elicits
a delayed response dominated by interleukin-6 (IL-6) but not by IL-1A or tumor n. Infect
Immun. 79: 695–707.
Gurjar A, Gioia G, Schukken Y, Welcome F, Zadoks R, Moroni P. 2012. Molecular Diagnostics
applied to mastitis problems on dairy farms. Vet Clin North Am - Food Anim Pract 28:
565–576.
Review of Literature
41
Gurjar A, Klaessig S, Salmon S, Yancey RJ, Schukken YH. 2013. Evaluation of an alternative
dosing regimen of a j-5 mastitis vaccine against intramammary Escherichia coli
challenge in nonlactating late-gestation dairy cows. J Dairy Sci. 96: 5053–63.
Gurjar A, Gioia G, Schukken Y, Welcome F, Zadoks R, Moroni P. 2012. Molecular diagnostics
applied to mastitis problems on dairy farms. Vet Clin North Am - Food Anim Pract. 28:
565–576.
Halasa T, Huijps K, Østerås O, Hogeveen H. 2007. Economic Effects of bovine mastitis and
mastitis management: a review. Vet Q. 29: 18–31.
Halasa T, Nielen M, Whist C, Osterås O. 2009. Meta-analysis of dry cow management for dairy
cattle. part 2. cure of existing intramammary infections. J Dairy Sci. 92: 3150–7.
Hameed S, Arshad M, Ashraf M, Avais M, Shahid MA. 2012. Cross-sectional epidemiological
studies on mastitis in cattle and buffaloes of tehsil Burewala , Pakistan. J Anim Plant Sci.
22: 371–376.
Harmon RJ. 1994. Physiology of mastitis and factors affecting somatic cell counts. J Dairy Sci.
77: 2103–2112.
Hawari AD, Hassawi DS. 2008. Mastitis in one humped she-camels (Camelus Dromedarius) in
Jordan. J Biol Sci. 8: 958–961.
Hiitiö H, Riva R, Autio T, Pohjanvirta T, Holopainen J, Pyörälä S, Pelkonen S. 2015.
Performance of a real-time PCR assay in routine bovine mastitis diagnostics compared
with in-depth conventional culture. J Dairy Res. 82: 200–208.
Hogan JS, Gonzalez RN, Harmon RJ, Nickerson SC, Oliver SP, Pankey JW, Smith KL. 1999.
Review of Literature
42
Laboratory handbook on bovine mastitis. Natl Mastit Counc Madison, WI 6–10.
Hogeveen H, Pyorala S, Waller KP, Hogan JS, Lam TJ, Oliver SP, Schukken YH, Barkema HW,
Hillerton JE. 2011. In proceedings of the 50th annual meeting of the national mastitis
council, Arlington, USA. 36-48.
Hoque MN, Das ZC, Talukder AK, Alam MS, Rahman ANMA. 2015. Different screening tests
and milk somatic cell count for the prevalence of subclinical bovine mastitis in
Bangladesh. Trop Anim Health Prod. 47: 79–86.
Hui SL, Walter SD. 1980. Estimating the error rates of diagnostic tests. Biometrics. 167–71.
Hulsen J, Lam T, Green L, Stewart S. 2008. Udder health: a practical guide to first-rate udder
health. Roodbont publishers.
HurleyWL, Theil PK. 2011. Perspectives on immunoglobulins in colostrum and milk. nutrients.
3: 442–474.
Hussain R, Javed MT, Khan A. 2012. Changes in some biochemical parameters and somatic cell
counts in the milk of buffalo and cattle suffering from mastitis. Pak Vet J. 32: 418–421.
Huxley JN, Green MJ, Green LE, Bradley AJ. 2002. Evaluation of the efficacy of an internal teat
sealer during the dry period. J Dairy Sci. 85: 551–561.
Jackson CR, Fedorka-Cray PJ, Barrett JB. 2004. Use of a genus- and species-specific multiplex
PCR for identification of Enterococci use of a genus- and species-specific multiplex PCR
for identification of Enterococci. J Clin Microbiol. 42: 3558-3565.
Jiusheng W, Yuehuan L, Songhua H, Jiyong Z. 2008. Development of a rapid PCR test for
Review of Literature
43
identification of Streptococcus agalactiae in milk samples collected on filter paper disks.
Asian-Aust. J Anim Sci. 21: 124–130
Kang SJ, Cho Y, Kim KH, Cho ES. 2016. Proteomic analysis to elucidate the antibacterial action
of silver ions against bovine mastitis pathogens. Biol Trace Elem Res. 171: 101–106.
Karahan M, Acik MN, Cetinkaya B. 2011. Investigation of virulence genes by PCR in
Stapylococcus aureus isolates originated from subclinical bovine mastitis in Turkey. Pak
Vet J. 31: 249–253.
Karimuribo ED, Kusiluka LJ, Mdegela R, Kapaga AM, Sindato C, Kambarage MD. 2005.
Studies on mastitis, milk quality and health risks associated with consumption of milk
from pastoral herds in Dodoma and Morogoro regions. Tanzania J Vet Sci. 6: 213–221.
Khan AZ, Muhammad G. 2005. Quarter-wise comparative prevalence of mastitis in buffaloes
and crossbred cows. Pak Vet. J. 25: 9-12.
Kirk JH, Bartlett PC. 1984. Nonclinical Pseudomonas aeruginosa mastitis in a dairy herd. J Am
Vet Med Assoc. 184: 671–673.
Köck R, Kreienbrock L, Duijkeren E, Schwarz S. 2016. Antimicrobial resistance at the interface
of human and veterinary medicine. Vet Microbiol. 200:1.
Koivula M, Pitkälä A, Pyörälä S, Mäntysaari EA. 2007. Distribution of bacteria and seasonal and
regional effects in a new database for mastitis pathogens in Finland. Acta Agric Scand
Sect A. 57: 89–96.
Koskinen MT, Holopainen J, Pyörälä S, Bredbacka P, Pitkälä A, Barkema HW, Bexiga R,
Roberson J, Sølverød L, Piccinini R, Kelton D. 2009. Analytical specificity and
Review of Literature
44
sensitivity of a real-time polymerase chain reaction assay for identification of bovine
mastitis pathogens. J Dairy Sci. 92: 952–9.
Koskinen MT, Wellenberg GJ, Sampimon OC, Holopainen J, Rothkamp A, Salmikivi L,
Haeringen W, Lam TJGM, Pyörälä S. 2010. Field comparison of real-time polymerase
chain reaction and bacterial culture for identification of bovine mastitis bacteria. J Dairy
Sci. 93: 5707–15.
Kossaibati MA, Esslemont RJ. 1997. The costs of production diseases in dairy herds in England.
Vet J. 154: 41–51.
Kuang Y, Tani K, Synnott AJ, Ohshima K, Higuchi H, Nagahata H, Tanji Y. 2009.
“Characterization of bacterial population of raw milk from bovine mastitis by culture-
independent PCR–DGGE method. Biochem Eng J. 45: 76–81.
Lam TJ, Schukken YH, Grommers FJ, Smit JA, Brand A. 1993. Within-herd and between-herd
variation in diagnosis of clinical mastitis in cattle. J Am Vet Med Assoc. 202: 938–942.
Lange-Consiglio A, Spelta C, Garlappi R, Luini M, Cremonesi F. 2014. Intramammary
administration of platelet concentrate as an unconventional therapy in bovine mastitis:
first clinical application. J Dairy Sci. 97: 6223–30.
Lange CC, Brito MAVP, Reis DRL, Machado MA, Guimarães AS, Azevedo ALS, Salles EB,
Alvim MCT, Silva FS, Meurer IR. 2015. Species-level identification of Staphylococci
isolated from bovine mastitis in brazil using partial 16S rRNA sequencing. Vet
Microbiol. 176: 382–388.
Lee P. 2017. DNA amplification in the field: move over PCR, here comes LAMP. Mol Ecol
Review of Literature
45
Resour. (in press):138–141
Lee SU, Quesnell M, Fox LK, Yoon JW, Park YH, Davis WC, Falk D, Deobald CF, Bohach GA.
1998. Characterization of staphylococcal bovine mastitis isolates using the polymerase
chain reaction. J Food Prot. 61: 1384–1386.
Lehtolainen T, Røntved C, Pyörälä S. 2004. Serum amyloid A and TNF α in serum and milk
during experimental endotoxin mastitis. Vet Res. 35: 651–659.
Levison LJ, Miller-Cushon E, Tucker A, Bergeron R, Leslie K, Barkema HW, DeVries TJ. 2016.
“Incidence rate of pathogen-specific clinical mastitis on conventional and organic
canadian dairy farms. J Dairy Sci. 99: 1341–1350.
Machado VS, Bicalho MLS, Pereira RV, Caixeta LS, Knauer WA, Oikonomou G, Gilbert RO,
RC Bicalho. 2013. Effect of an injectable trace mineral supplement containing selenium,
copper, zinc, and manganese on the health and production of lactating holstein cows. Vet
J. 197: 451–456.
Madouasse A, Huxley JN, Browne WJ, Bradley AJ, Green MJ. 2010. Somatic cell count
dynamics in a large sample of dairy herds in England and Wales. Prev Vet Med. 96: 56–
64.
Mahmmod YS, N Toft, J Katholm, C Grønbæk, IC Klaas. 2013. Bayesian estimation of test
characteristics of real-time pcr, bacteriological culture and california mastitis test for
diagnosis of intramammary infections with Staphylococcus aureus in dairy cattle at
routine milk recordings. Prev Vet Med. 112:309–317.
Makovec JA, Ruegg PL. 2003. Results of milk samples submitted for microbiological
Review of Literature
46
examination in Wisconsin from 1994 to 2001. J Dairy Sci. 86: 3466–3472.
Malvisi M, Stuknyte M, Magro G, Minozzi G, Giardini A, Noncty D, Piccinini R. 2016.
Antibacterial activity and immunomodulatory effects on a bovine mammary epithelial
cell line exerted by nisin A-producing Lactococcus lactis strains. J Dairy Sci. 99: 2288–
2296.
Mansor R, Mullen W, Albalat A, Zerefos P, Mischak H, Barrett DC, Biggs A, Eckersall PD.
2013. A peptidomic approach to biomarker discovery for bovine mastitis. J Proteomics.
85: 89–98.
Martins RP, da Silva JAG, Nakazato L, Dutra V, Filho ESA. 2010. Prevalência E etiologia
infecciosa da mastite bovina na microrregião de Cuiabá-MT. Ciência Anim Bras. 11:
181–187.
McDougall S. 1999. Prevalence of clinical mastitis in 38 waikato dairy herds in early lactation.
New Zeal Vet J. 47: 143–149.
Mekonnen H, Tesfaye A. 2010. Prevalence and etiology of mastitis and related management
factors in market oriented smallholder dairy farms in Adama, Ethiopia. Rev Med Vet.
161 (12): 574–79. http://revmedvet.com/.
Meiri-Bendek I, Lipkin E, Friedmann A, Leitner G, Saran A, Friedman S, Kashi Y. 2002. A
PCR-based method for the detectionof Streptococcus agalactiae in milk. J Dairy Sci. 85:
1717–1723.
Miller RH, Paape MJ, Acton JC. 1986. Comparison of milk somatic cell counts by coulter and
fossomatic counters. J Dairy Sci. 69: 1942–1946.
Review of Literature
47
Milner P, Page KL, Hillerton JE. 1997. The effects of early antibiotic treatment following
diagnosis of mastitis detected by a change in the electrical conductivity of milk. J Dairy
Sci. 80: 859–863.
Miotto G, Magro M, Terzo M, Zaccarin M, Dalt LD, Bonaiuto E, Baratella D, Gabai G, Vianello
F. 2016. Protein Corona as a Proteome Fingerprint: The Example of Hidden Biomarkers
for Cow Mastitis. Colloid Surface B. 140: 40–49.
Moon JS, Koo HC, Joo YS, Jeon SH, Hur DS, Chung CI, Jo HS, Park YH. 2007. Application of
a new portable microscopic somatic cell counter with disposable plastic chip for milk
analysis. J Dairy Sci. 90: 2253–2259.
Muellner AN, Schaefer H, Lahaye R. 2011. evaluation of candidate dna barcoding loci for
economically important timber species of the mahogany family (Meliaceae). Mol Ecol
Resour. 11: 450–460.
Muhammad G, Naureen A, Asi MN, Saqib M, Rehman F. 2010. Evaluation of a 3% surf solution
(surf field mastitis test) for the diagnosis of subclinical bovine and bubaline mastitis.
Trop Anim Health Prod. 42: 57–464.
Mujawar LH, Moers A, Norde W, Amerongen AV. 2013. rapid mastitis detection assay on
porous nitrocellulose membrane slides. Anal Bioanal Chem. 405: 7469–7476.
Neder V, Signorini M, Cuatrin A, Gianre V, Calvinho L. 2015. Prevalence of pathogenic bacteria
of bovine mastitis in cold tank milk and evaluation of culture media for recourse and the
identification of Staphylococcus aureus. Fave Veterinary Sciences Section. 13: 20-27.
Neethirajan S. 2017. “Recent advances in wearable sensors for animal health management. Sens
Review of Literature
48
Biosensing Res. 12: 15–29
Nilsson L, Franklin A, Funke H. 1997. Antimicrobial drug susceptibility of bovine udder
pathogens in Sweden. Proceedings Society for Veterinary Epidemiology and Preventive
Medicine, Chester, England.
Notomi, T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. 2000.
Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28: E63.
Olde Riekerink RGM, Barkema HW, Kelton DF, Scholl DT. 2008. Incidence rate of clinical
mastitis on Canadian dairy farms. J Dairy Sci. 91: 1366–77.
Oliszewski R, Nunez de Kairuz MS, Gonzalez De Elias SN, Oliver G. 2002. Assessment of β-
glucuronidase levels in goat’s milk as an indicator of mastitis: comparison with other
mastitis detection methods. J Food Prot 65: 864–866.
Oliver SP, Gonzalez RN, Hogan JS, Jayarao BM, Owens WE. 2004. Microbiological procedures
for the diagnosis of bovine udder infection and determination of milk quality. (fourth
Edition) The National Mastitis Council, Inc., Verona, WI, USA.
Pankaj AS, Chhabra R, Sindhu N. 2013. Sub-clinical mastitis in murrah buffaloes with special
reference to prevalence, etiology and antibiogram. Buffalo Bull 32: 107–113.
Parada JL, Gonçalves D, Soccol VT, Lima M, Soccol CR. 2011. Bovine mastitis in the
metropolitan area of Curitiba: antibiotic resistance and antimicrobial control of the
infection. Braz Arch Biol Technol. 54 (4): 709–16.
Paradis MÈ, Haine D, Gillespie B, Oliver SP, Messier S, Comeau J, Scholl DT. 2012. Bayesian
estimation of the diagnostic accuracy of a multiplex real-time PCR assay and
Review of Literature
49
bacteriological culture for 4 common bovine intramammary pathogens. J Dairy Sci. 95:
6436–48.
Parida MM., Sannarangaiah S, Dash PK, Rao PVL, Morita K. 2008. Loop mediated isothermal
amplification (LAMP): a new generation of innovative gene amplification technique;
perspectives in clinical diagnosis of infectious diseases. Rev Med Virol. 18: 407–421.
Pengov A. 2002. Prevalence of mycototic mastitis in cows. Acta Vet Brno. 52: 133–136.
Perreten V, Endimiani A, Thomann A, Wipf JRK, Rossano A, Bodmer M, Raemy A, Sannes-
Lowery KA, Ecker DJ, Sampath R, Bonomo RA. 2013. Evaluation of PCR electrospray-
ionization mass spectrometry for rapid molecular diagnosis of bovine mastitis. J Dairy
Sci. 96: 3611–3620.
Petrovski KR, Williamson NB, Lopez-Villalobos N, Parkinson TJ, Tucker IG. 2011. Culture
results from milk samples submitted to veterinary diagnostic laboratories from August
2003 to December 2006 in New Zealand. NZ Vet J. 59: 317–322.
Petti CA, Polage CR, Schreckenberger P. 2005. The role of 16S rRNA gene sequencing in identi
cation of microorganisms misidenti ed by conventional methods. Society. 43: 6123–6125.
Petzer I, Karzis J, Watermeyer JC, Van Der Schans TJ, Van Reenen R. 2009. Trends in udder
health and emerging mastitogenic pathogens in South African dairy herds. J Dairy Sci.
84: 1140–1148.
Phuektes P, Mansell PD, Browning GF. 2001. Multiplex polymerase chain reaction assay for
simultaneous detection of Staphylococcus aureus and Streptococcal causes of bovine
mastitis. J Dairy Sci. 84: 1140–1148.
Review of Literature
50
Phuektes P, Browning GF, Anderson G, Mansell PD. 2003. Multiplex Polymerase chain reaction
as a mastitis screening test for Staphylococcus aureus, Streptococcus agalactiae,
Streptococcus dysgalactiae and Streptococcus uberis in bulk milk samples. J Dairy Sci.
70: 149–155.
Piccart K, Vásquez A, Piepers S, De Vliegher S, Olofsson TC. 2016. Short communication:
lactic acid bacteria from the honeybee inhibit the in vitro growth of mastitis pathogens. J
Dairy Sci. 99: 2940–2944.
Pol M, Ruegg PL. 2007. Relationship between Antimicrobial drug usage and antimicrobial
susceptibility of gram-positive mastitis pathogens. J Dairy Sci. 90: 249–261.
Pol M, Ruegg PL. 2007. Treatment practices and quantification of antimicrobial drug usage in
conventional and organic dairy farms in Wisconsin. J Dairy Sci. 90: 249–261.
Pomeroy B, Gurjar A, Sipka A, Klaessig S, Salmon S, Quesnell R, Schukken YH. 2016.
Intramammary immunization with ultraviolet-killed Escherichia coli shows partial
protection against late gestation intramammary challenge with a homologous strain. J
Dairy Sci. 99: 9014–9026.
Porter J, Anderson J, Carter L, Donjacour E, Paros M. 2016. In vitro evaluation of a novel
bacteriophage cocktail as a preventative for bovine coliform mastitis. J Dairy Sci. 99:
2053–2062.
Pradham P, Gopinath S, Reddy G, Dechamma HJ, Suryanarayana VS. 2011. Detection of major
pathogens in bovine sub-clinical mastitis by multiplex PCR directly from milk samples in
presence of an internal control. Indian J Fundam Appl Life Sci. 1: 209–218.
Review of Literature
51
Qayyum A, Khan JA, Hussain R, Avais M, Ahmad N, Khan MS. 2016. Investigation of milk and
blood serum biochemical profile as an indicator of sub-clinical mastitis in cholistani
cattle. Pak Vet J. 36: 275–279.
Quinn PJ, Carter ME, Markey BK, Carter GR. 1999. Clinical veterinary microbial. Wolfe,
Baltmore 327–344.
Radostitis OM, Gay CC, Blood DC, Hinchcliff KW. 2000. Veterinary medicine. 9th ed.
Ranjan R, Gupta MK, Singh KK 2011. Study of bovine mastitis in different climatic conditions
in jharkhand, India. India Vet World. 4(4): 205–208
Rasmussen MD. 2001. Automatic milking, how to define a threshold for dumping mastitic milk.
in: proceedings of the “2nd International symposium on mastitis and milk quality”,
Vancouver. pp 401–404.
Rees A, Fischer-Tenhagen C, Heuwieser W. 2017. Udder firmness as a possible indicator for
clinical mastitis. J Dairy Sci. (In press) 1–14.
Reis CBM, Barreiro JR, Mestieri L, Porcionato MAF, dos Santos MV. 2013. Effect of somatic
cell count and mastitis pathogens on milk composition in gyr cows. BMC Vet Res. 9(1):
67.
Reyes-Jara A, Cordero N, Aguirre J, Troncoso M, Figueroa G. 2016. Antibacterial effect of
copper on microorganisms isolated from bovine mastitis. Front Microbiol. 7: 1–10.
Riffon R, Sayasith K, Khalil H, Dubreuil P, Drolet M, Lagace J. 2001. Development of a rapid
and sensitive test for identi cation of major pathogens in bovine mastitis by PCR .
Society. 39: 2584–2589.
Review of Literature
52
Royster E, Wagner S. 2015. Treatment of mastitis in cattle. Vet Clin North Am - Food Anim
Pract. 31: 17–46.
Royster E, Godden S, Goulart D, Dahlke A, Rapnicki P, Timmerman J. 2014. Evaluation of the
Minnesota easy culture system II bi-plate and tri-plate for identification of common
mastitis pathogens in milk. J Dairy Sci. 97: 3648–59.
Ruegg PL. 2011. Risk factors associated with short-term post-treatment outcomes of clinical
mastitis. J Dairy Sci. 94: 3397–3410.
Ruegg PL, Erskine RJ, Morin DE. 2014. Mammary gland health. large anim intern Med. 5th ed
Mosby Elsevier, St Louis, MO 1015–1043.
Sadaf N, Ahmed K, Nafees MA, Khan T. 2016. Prevalence of sub-clinical mastitis, identification
of causative agents and sensitivity profile of isolates in northern Pakistan. Nature and
Science.14(12): 7–10.
Saini V, McClure JT, Léger D, Dufour S, Sheldon AG, Scholl DT, Barkema HW. 2012.
Antimicrobial use on Canadian dairy farms. J Dairy Sci. 95: 1209–1221.
Santos N, dos J, Fagundes PC, de Paiva Brito MAV, Dos Santos KRN, Bastos MDF. 2005.
Production of bacteriocins by coagulase-negative Staphylococci involved in bovine
mastitis. Vet Microbiol. 106 (1) : 61–71.
Sargeant JM, Leslie KE, Shirley JE, Pulkrabek BJ, Lim GH. 2001. Sensitivity and specificity of
somatic cell count and california mastitis test for identifying intramammary infection in
early lactation1. J Dairy Sci. 84: 2018–2024.
Scali, F, Camussone C, Calvinho LF, Cipolla M, Zecconi A. 2015. Which are important targets
Review of Literature
53
in development of S. aureus mastitis vaccine?. Res Vet Sci. 100: 88–99.
Schlaberg R, Simmon KE, Fisher MA. 2012. A systematic approach for discovering novel,
clinically relevant bacteria. Emerg Infect Dis. 18: 422–430.
Shaheen M, Tantary HA, Nabi SU. 2016. A treatise on bovine mastitis: disease and disease
economics, etiological basis, risk factors, impact on human health, therapeutic
management, prevention and control strategy. J Adv Dairy Res. 4: 1–10.
Schalm OW, Noorlander DO. 1957. Experiments and observations leading to development of the
california mastitis test. J Am Vet Med Assoc. 130: 199–204.
Sharif A, Muhammad G. 2009. Mastitis control in dairy animals. Pak Vet J. 29: 145–148.
Sharma N, SK Maiti. 2005. Effect of dietary supplementation of vitamin E and Selenium in sub
clinical mastitis in dairy cows. Indian J Vet Med. 25: 76.
Schmitt B, Henderson L. 2005. Diagnostic tools for animal diseases. Rev Sci Tech. 24(1): 243–
50.
Schukken YH, Hertl J, Bar D, Bennett GJ, González RN, Rauch BJ, Santisteban C, Schulte HF,
Tauer L, Welcome FL. 2009. Effects of repeated gram-positive and gram-negative
clinical mastitis episodes on milk yield loss in holstein dairy cows. J Dairy Sci. 92: 3091–
3105.
Schukken YH, Wilson DJ, Welcome F, Garrison-Tikofsky L, Gonzalez RN. 2003. Monitoring
udder health and milk quality using somatic cell counts. Vet Res. 34(5): 579–596.
Seegers H, Fourichon C. 2003. Production effects related to mastitis and mastitis economics in
Review of Literature
54
dairy cattle herds. Vet Res. 34(5): 475-491.
Shaheen M, Tantary H, Nabi S. 2016. A treatise on bovine mastitis: disease and disease
economics, etiological basis, risk factors, impact on human health, therapeutic
management, prevention and control strategy. J Adv Dairy Res. 4(1): 1–10.
Shamila-Syuhada AK, Rusul G, Wan-Nadiah WA, Chuah LO. 2016. Prevalence and antibiotics
resistance of Staphylococcus aureus isolates isolated from raw milk obtained from small-
scale dairy farms in Penang, Malaysia. Pak Vet J. 36(1): 98–102.
Sharma A, Chhabra R, Sindhu N. 2012. Prevalence of sub clinical mastitis in cows: its etiology
and antibiogram. Indian J Anim Res. 1: 46 (4).
Sharma NK, Rees CED, Christine ER, Dodd CER. 2000. Development of a single-reaction
multiplex pcr toxin typing assay for Staphylococcus aureus strains development of a
single-reaction multiplex PCR toxin typing assay for Staphylococcus aureus strains. Appl
Environ Microbiol. 66 (4): 1347–1353.
Shome BR, Das Mitra S, Bhuvana M, Krithiga N, Velu D, Shome R, Isloor S, Barbuddhe SB,
Rahman H. 2011. Multiplex PCR assay for species identification of bovine mastitis
pathogens. J Appl Microbiol. 111: 1349–1356.
Shook GE. 2006. Major advances in determining appropriate selection goals. J Dairy Sci. 89:
1349–1361.
Smolenski G, Haines S, Kwan FY-S, Bond J, Farr V, Davis SR, Stelwagen K, Wheeler TT.
2007. Characterisation of host defence proteins in milk using a proteomic approach. J
Proteome Res. 6: 207–215.
Review of Literature
55
Sol J. 1984. Control methods in summer mastitis: the importance of fly control. 1984. In:
Proceedings of the XIIIth World Congress on Diseases of Cattle, Durban. pp 17–21.
Spanamberg A, Wunder Jr EA, Brayer Pereira DI, Argenta J, Sanches EMC, Valente P, Ferreiro
L. 2008. Diversity of yeasts from bovine mastitis in southern Brazil. Rev Iberoam Micol
25: 154.
Spoor LE, McAdam PR, Weinert LA, Rambaut A, Hasman H, Aarestrup FM, Kearns AM,
Larsen AR, Skov RL, Fitzgerald JR. 2013. Livestock Origin for a human pandemic clone
of community-associated methicillin-resistant Staphylococcus aureus. MBio. 4: 1–6.
Sumathi BR, Veeregowda BM, Amitha RG. 2008. Prevalence and antibiogram profile of
bacterial isolates from clinical bovine mastitis. Vet World. 1: 237–238.
Taponen S, Salmikivi L, Simojoki H, Koskinen MTT, Pyörälä S. 2009. Real-time polymerase
chain reaction-based identification of bacteria in milk samples from bovine clinical
mastitis with no growth in conventional culturing. J Dairy Sci. 92: 2610–7.
Tarfarosh MA, Purohit SK. 2008. Isolation of Candida Spp. mastitic cows and milkers. VetScan.
3: 14–18.
Tekle, Yibrah, and Tsega Berihe. 2016. Bovine mastitis: prevalence, risk factors and major
pathogens in the Sidamo zone snnprs, Ethiopia. Eur J Biol Med Sci Res. 4: 27–43.
Tenhagen B, Ko G, Wallmann J, Heuwieser W. 2006. Prevalence of mastitis pathogens and their
resistance against antimicrobial agents in dairy cows in Brandenburg, Germany, J Dairy
Sci. 89(7): 2542-2551.
Tie Z, Chunguang W, Xiaoyuan W, Xinghua Z, Xiuhui Z. 2012. Loop-Mediated Isothermal
Review of Literature
56
Amplific J Biomed Biotechnol. Article No. 435982. p.5.
Timms, Leo L. 2004. Field trial evaluations of a novel persistent barrier teat dip for preventing
mastitis during the dry period and as a potential substitute for dry cow antibiotic therapy.
Anim Ind Rep. 650(1): 73.
Toft N, Åkerstedt J, Tharaldsen J, Hopp P. 2007. Evaluation of three serological tests for
diagnosis of maedi-visna virus infection using latent class analysis. Vet Microbiol. 120:
77–86.
Tomita N, Mori Y, Kanda H, Notomi T. 2008. Loop-mediated isothermal amplification (LAMP)
of gene sequences and simple visual detection of products. Nat Protoc. 3: 877–882.
Trevisi E, Zecconi A, Cogrossi S, Razzuoli E, Grossi P, Amadori M. 2014. Strategies for
reduced antibiotic usage in dairy cattle farms. Res Vet Sci. 96: 229–233.
Twomey DP, Wheelock AI, Flynn J, Meaney WJ, Hill C, Ross RP. 2000. Protection against
Staphylococcus aureus mastitis in dairy cows using a bismuth-based teat seal containing
the bacteriocin, lacticin 3147. J Dairy Sci. 83: 1981–1988.
Viguier C, Arora S, Gilmartin N, Welbeck K, O’Kennedy R, O’Kennedy R. 2009. Mastitis
detection: current trends and future perspectives. Trends Biotechnol. 27: 486–493.
Viora L, Graham EM, Mellor DJ, Reynolds K, Simoes PB, Geraghty TE. 2014. Evaluation of a
culture-based pathogen identification kit for bacterial causes of bovine mastitis. Vet Rec.
175: 89.
Virdis S, Scarano C, Cossu F, Spanu V, Spanu C, De Santis EPL. 2010. Antibiotic resistance in
Staphylococcus aureus and coagulase negative Staphylococci isolated from goats with
Review of Literature
57
subclinical mastitis. Vet Med Int. Article No.517060.
Vliegher SD, Fox LKK, Piepers S, McDougall S, Barkema HW. 2012. Invited review: mastitis in
dairy heifers: nature of the disease, potential impact, prevention, and control. J Dairy Sci.
95 (3): 1025–1040.
Volling O, Krömker V. 2008. Udder health management practices in dairy enterprises to reduce
the incidence of bovine mastitis. Dtsch Tierarztl Wochenschr. 115: 410–420.
Wang M, Zhang Y, Zhu J. 2016. Anti-Staphylococcus aureus single-chain variable region
fragments provide protection against mastitis in mice. Appl Microbiol Biotechnol. 100:
2153–2162.
wellenberg gj, van der poel whm, van oirschot jt. 2002. viral infections and bovine mastitis: a
review. Vet Microbiol. 88: 27–45.
Wichmann F, Udikovic-kolic N, Andrew S. 2014. Diverse antibiotic resistance genes in dairy
cow manure. MBio. 5: 1–9.
Wilson DJ, Gonzalez RN, Das HH. 1997. Bovine mastitis pathogens in New York and
Pennsylvania: prevalence and effects on somatic cell count and milk production. J Dairy
Sci. 80: 2592–2598.
Woo PCY, Lau SKP, Teng JLL, Tse H, Yuen KYY. 2008. Then and now: use of 16S rDNA
gene sequencing for bacterial identification and discovery of novel bacteria in clinical
microbiology laboratories. Clin Microbiol Infect. 14 (10): 908–934.
Woolford MW, Williamson JH, Day AM, Copeman PJA. 1998. The prophylactic effect of a teat
sealer on bovine mastitis during the dry period and the following lactation. New Zealand
Review of Literature
58
Vet J. 46: 12–19.
Xinjiang S. 2008. Polymorphism analysis of the promoter of cow lactoferrin gene with PCR-
RFLP and its correlation with subclinical mastitis. Acta Agricultur Slovea. 92 :185-187.
Yang F-Li, Li X-S, He B-X, Du Y-L, Li G-H, Yang B-B. 2011. Bovine mastitis in subtropical
dairy farms, 2005-2009. J Anim Vet Adv. 10: 68–72.
Yasser M. 2014. The future of PCR technologies in diagnosis of bovine mastitis pathogens. Adv
Dairy Res. 2: 1–2.
Zasloff M. 2002. Antimicrobial Peptides of Multicellular Organisms. Nature. 415: 389–395.
Zhu H, Du M, Fox L, Zhu MJ. 2016. Bactericidal effects of cinnamon cassia oil against bovine
mastitis bacterial pathogens. Food Control. 66: 291–299.
59
CHAPTER 3
EXPERIMENT NO. 1
A novel multiplex PCR assay for simultaneous detection of nine clinically significant
bacterial pathogens associated with bovine mastitis.
Molecular and Cellular Probes. 33 (2017): 57-64. doi: 10.1016/j.mcp.2017.03.004
3.1. ABSTRACT
For rapid and simultaneous detection of nine bovine mastitic pathogens, a sensitive and
specific multiplex PCR assay was developed. The assay was standardized using reference strains
and validated on mastitic milk cultures which were identified to species level based on 16S
rRNA sequencing. Multiplex PCR assay also efficiently detected the target bacterial strains
directly from milk. Detection limit of the assay was up to 50 pg for DNA isolated from pure
cultures and 104 CFU/ml for spiked milk samples. As estimated by latent class analysis, the assay
was sensitive up to 88% and specific up to 98% for targeted mastitic pathogens, compared with
the bacterial culture method and the 16S rRNA sequence analysis. This novel molecular assay
could be useful for monitoring and maintaining the bovine udder health, ensuring the
bacteriological safety of milk, and conducting epidemiological studies.
3.2. INTRODUCTION
Bovine mastitis is the most common and significant disease of dairy animals. It is multi-
factorial in nature and very difficult to control due to the involvement of a large number of
pathogens. According to surveys, mastitis is one of the major diseases in the Pakistan dairy
sector (Hussain et al. 2012). The extensive knowledge of the etiology of mastitis is fundamental
for the development of an efficient diagnostic technique as well as control of the disease. More
Experiment No. 1
60
than 150 bacterial species are identified as mastitic pathogens. There are three major categories
of bacteria that can infect the bovine mammary gland. They are environmental, contagious and
the opportunist microbes (Kuang et al. 2009). The contagious pathogens live on the udder and
are transmitted from infected to uninfected teats during the milking process. They mainly
include; Streptococcus agalactiae (S. agalactiae), Staphylococcus aureus (S. aureus) and
Mycoplasma bovis (M. bovis). Environmental pathogens usually reside in the housing and
bedding and tend to enter the teat canal during the milking process; most common among them
are Streptococcus uberis (S. uberis) and Streptococcus dysagalactiae (S. dysagalactiae) and
environmental coliforms (gram negative bacteria Escherichia coli (E. coli), Klebsiella spp.,
Citrobacter spp., Enterobacter spp., (including Enterobacter faecalis and Enterobacter faecium),
and other gram negative bacteria such as Serratia, Pseudomonas and Proteus (Radostitis et al.
2000). Coagulase negative species Staphylococcus epidermidis (S. epidermidis), Staphylococcus
simulans, Staphylococcus saprophyticus, and Staphylococcus chromogenes (S. chromogenes)
are the opportunist pathogens and they stay on the lining of teat or udder skin (dos Santos
Nascimento et al. 2005).
The primary diagnosis for mastitis is based on physiological symptoms visible to naked
eye, such as swelling and inflammation of the mammary gland or the apparent changes in the
milk. Because such symptoms appear only at the chronic or clinical state of mastitis, its earlier
diagnosis relies on a multitude of simple diagnostic methods. The most commonly employed
among these methods are the measurement of somatic cell count and enzymatic analysis (Hiitiö
et al. 2015). California mastitis test and Surf field mastitis test are also used. But these simple
methods hold many discrepancies which could increase the likelihood for false positive or false
negative findings. Also these simple methods are unable to provide information on the identity of
Experiment No. 1
61
the causative agent and severity of the infection. Accurate information on these factors is
prerequisite to tailor an effective treatment, which is routinely obtained by culturing methods.
The bacterial culture is however very expensive, time-consuming and labor-intensive (Viguier et
al. 2009).
There has been remarkable progress in molecular biology-based techniques in the last
few years. Molecular diagnostics have the ability to identify the organism with great sensitivity
and specificity and can also distinguish between very closely related organisms. These molecular
diagnostic methods have many advantages over the traditional bacteriology techniques in terms
of low cost and accurate detection. With the advancement in molecular techniques, quick and
accurate diagnosis of veterinary diseases has become possible (Biek et al. 2012).
PCR is a promising tool for efficient and accurate identification of microbes. It has
become the routine diagnostic method for diagnosis of various plant and animal diseases, despite
false positive results can be obtained even after the underlying infection has been cured
(Koskinen et al. 2010).
The performance of diagnostic tests is usually determined by sensitivity (proportion of
true positive among diseased) and specificity (the proportion of true negative among non-
diseased). The evaluation of a diagnostic test is therefore dependent on a reference population,
the population of truly infected and the population of truly non-infected subjects (Matope et al.
2011). However, no perfect reference or gold standard for the diagnosis of mastitis is available
(Sanford et al. 2006). One of the frequently used approaches to evaluate a diagnostic test with
unknown infection status when multiple tests are available is latent class analysis (LCA) (Hui
and Walter 1980). LCA still assumes infection status is dichotomous (animal is either positive or
negative) and such a status does not need to be known as it is assumed to be latent. This
Experiment No. 1
62
Bayesian approach has been frequently used to evaluate various diagnostic assays of veterinary
concern (Gardner 2002).
The current study was designed to develop a multiplex PCR assay for the detection of
nine critically important bacterial pathogens associated with bovine mastitis and compare the
LCA sensitivity and specificity estimates of the developed assay with those of bacterial culture
and 16S rRNA sequence analysis.
3.3. MATERIALS AND METHODS
3.3.1. Bacterial strains
The bacterial strains used for the assay development were obtained through the American
Type Culture Collection (Manassas, VA) and Quality Milk Production Services (Cornell
University, Ithaca, NY). These reference strains included S. agalactiae, S. dysagalactiae, S.
uberis, S. aureus, E. coli, Staphylococcus haemolyticus (S. haemolyticus), S. chromogenes, M.
bovis and S. epidermidis. All of these bacterial isolates were grown at 37°C on sheep blood agar,
with further growth enrichment in a nutrient broth. For the growth of M. bovis, Hayflick agar
plates containing 15% horse serum were incubated at 35oC with CO2 enrichment for 48 hrs or till
colonies appeared.
3.3.2. Extraction of bacterial genomic DNA
DNA was extracted from bacterial cultures using Qiagen DNeasy Blood and Tissue Kit
(Life Technologies, Carlsbad, CA). Genomic DNA was quantified using Nanodrop 2000
spectrophotometer (Thermo Fisher Scientific, Waltham, MA, USA) and stored at -20oC until
further use.
Experiment No. 1
63
3.3.3. Primer designing
Multiplex PCR assay primers were designed from intraspecific conserved regions of
target genes. The primers were designed using Primer3 software v0.4.0 (Untergasser et al. 2012)
and synthesized through services provided by Invitrogen (Minneapolis, MN, USA). Detailed
information on targeted organisms and genes, primer sequences and size of PCR amplicons is
presented in Table 3.1.
Table No. 3.1: Oligonucleotide primers used for multiplex PCR assay
Organism Gene Name Primer sequence size
(bps)
Source
M. bovis
S. agalactiae
S. dysagalactiae
S. uberis
S. aureus
E. coli
S. haemolyticus
S. chromogenes
S. epidermidis
16S
rRNA
16S
rRNA
16S
rRNA
Cpn60
16S
rRNA
phoA
16S
rRNA
16S
rRNA
rdr
Mb-F
Mb-R
Sg-F
Sg-R
Sd-F
Sd-R
Su-F
Su-R
Sa-F
Sa-R
Ec-F
Ec-R
Sh-F
Sh-R
Sc-F
Sc-R
SERF
SERR
GATGTTTAGCGGGGTTGAGA
TTGAGCCCCAAAATTTAACG
CGCTGAGGTTTGGTGTTTACA
CACTCCTACCAACGTTCTTC
ACCATGTGACGGTAACTAACCA
TATTACCGGCAGTCTCGCT
AATTGGCATTCGTCGCGGTA
GCATCCCTTCAACCACTTCAA
GAACCGCATGGTTCAAAAGT
CATTTCACCGCTACACATGG
ACGAAAAAGATCACCCAACG
GATCCTTTTCCGCCTTTTTC
AGTCGAGCGAACAGACAAGG
CCTCCTGTCGTCACCCAATC
AAGTCGAGCGAACTGACGAG
TCGTTTACGGCGTGGACTAC
AAGAGCGTGGAGAAAAGTATCAAG
TCGATACCATCAAAAAGTTGG
354
405
695
239
518
196
1451
768
130
*KX230478
(Riffon et al.
2001)
*KT881396
*AF485804
*KX447585
*FJ546461
*KJ623587
*AJ343945
(Shome et al.
2011)
* Designed for the current study using source DNA sequences retrieved from NCBI
Experiment No. 1
64
3.3.4. Optimization of monoplex PCR assays
For optimization of monoplex PCR assays, varying concentrations of magnesium (1.5,
2.0 and 2.5 mM), Taq DNA polymerase (1.0, 1.5, 2.0, and 2.5 U per reaction), and primers (0.5,
1.0, and 1.5 μM) were used in 25 μL reaction volume. Every PCR reaction mixture contained
200 μM dNTPs and 100-200 ng of template DNA and was thermally cycled once at 94oC for 5
min, followed by 30 cycles at 94oC for 30 s; 58oC for 30 s, 72oC for 1 min and finally once at
72oC for 10 min. The amplified products were electrophoresed through 1.2% agarose gel
containing ethidium bromide and analyzed under UV light.
3.3.5. Optimization of multiplex PCR Assay
To optimize the multiplex PCR assay, different combinations of individual PCRs with
varying concentrations of primers and template DNA were used. The final protocol included all
the nine sets of primer pairs, every set targeting a unique mastitic pathogen. Different
concentrations of primers were used to obtain specific results. Every multiplex PCR reaction
mixtures contained 1× HotStartTaq Master Mix (Qiagen, Mississauga, ON), 5 μL of primer mix,
50-200 ng of template DNA in 50 μL reaction volume The PCR conditions included an initial
activation step at 95°C for 5 min, followed by 10 cycles of amplification (95°C for 30 s, 62-53°C
(1°C decrease in every cycle) for 30 s, and 72°C for 1 min), 25 cycles of further amplification
(95°C for 30 s, 53°C for 30 s, and 72°C for 1 min) and a final extension step at 72°C for 10 min.
3.3.6. Analytic sensitivity of multiplex PCR assay
DNA extracted from bacterial cultures of target species was quantified using Nanodrop
(Thermo Scientific 2000 spectrophotometer) and serially diluted in the range of 100 ng to 0.01
pg using nuclease free water. PCR reactions were performed for all these DNA concentrations to
Experiment No. 1
65
determine the sensitivity of primers. The limit of detection (LOD) of multiplex PCR assay was
tested on artificial blends of serially diluted DNA samples.
To further assess the LOD of the developed assay, pasteurized milk was spiked with all
the target bacterial species individually as well as in random combinations up to three species per
reaction. Serial dilutions of spiked milk were made in the range of 106 CFU/ml to 100 CFU/ml.
DNA was isolated from these dilutions of spiked milk and amplified under optimized conditions.
Un-inoculated pasteurized milk served as a negative control.
3.3.7. Sample collection
A total of 223 milk samples were collected aseptically from dairy cows and buffalos
suspected of being affected by mastitis. All these milk samples were stored at -20oC until further
analysis.
3.3.8. Surf field mastitis test and California mastitis test
Three percent Surf solution was prepared by dissolving 3 g of commonly used detergent
powder (Surf Excel, UnileverTM, Pakistan) in 100 ml final volume. Milk samples and Surf
solution were mixed in equal quantities in Petri dishes. The formation of gel indicated the status
of mastitis (Muhammad et al. 1995). For California mastitis test, a four-well plastic paddle was
used. Equal volumes of the test reagent and milk samples were added in each well and gently
agitated. The reaction was scored on a scale of 0 (mixture remains unchanged) to 3 (almost-solid
gel forms), with a score of 2 or 3 being considered a positive result (Verbeek et al. 2008).
3.3.9. Bacterial culture from milk samples
Bacterial culturing was performed according to standards listed by Hogan et al. (Hogan et
al. 1999). Ten microliters of each milk sample was cultured on blood agar, MacConkey’s agar
and nutrient agar. The inoculated plates were incubated at 37oC for 24-48 hrs. The bacterial
Experiment No. 1
66
isolates were identified on the basis of their cultural and morphological characteristics, gram
staining and hemolytic patterns. Single defined colonies were picked and cultured in nutrient
broth at 37oC overnight in a shaking incubator. DNA was isolated from the bacterial cultures
through an organic DNA extraction method (Sambrook JaR 2001).
3.3.10. Milk bacterial DNA extraction and quantification
Bacterial DNA was extracted directly from milk following the method described by
Cremonesi et al. (Cremonesi et al. 2006), with slight modifications. Instead of 500 μL, 3 ml of
milk was used and the amount of lysis buffer and binding solutions was adjusted accordingly.
DNA quantification was done by optical density measurements using Nanodrop (Thermo
Scientific 2000 spectrophotometer). Working DNA dilutions were prepared and stored at -20oC
until further use.
3.3.11. PCR amplification and DNA sequencing
For species identification of mastitic milk cultures, a set of universal primers (27F &
1492R) targeting the 16S rRNA gene was used (Jiang et al. 2006). PCR was performed on DNA
isolated from bacterial cultures as well as mastitic milk samples. Detection of PCR products was
carried out by agarose gel electrophoresis. PCR products were purified and sequenced through
Sanger dideoxy sequencing (ABI Genetic Analyzer, 3130xl, Life Technologies) and results were
analyzed through various bioinformatics tools including Chromas Lite 2.1 software
(Technelysium Pty Ltd, Australia).
3.3.12. Pathogen detection in milk samples by multiplex PCR assay
The target mastitic pathogens were detected from randomly collected milk samples using
the developed multiplex PCR assay. The obtained results were compared with those of culture
method and 16S rRNA sequence analysis.
Experiment No. 1
67
3.3.13. Statistical analysis
The specificities and sensitivities of the developed multiplex PCR assay, bacterial culture
and 16S rRNA sequencing were estimated for every target species by applying LCA (Hui and
Walter 1980). The LCA was carried out in OpenBUGS version 3.2.2 rev 1063 (Lunn et al. 2000)
and R version 3.0.2 (Team 2013). In LCA, all the parameters need to have their prior
distributions specified. However, in the current study, no prior information was assumed so
uninformative priors in the form of uniform distribution, i.e. Beta (1,1) distribution, were
specified (three Se, three Sp and prevalence) to avoid any bias. The Bayesian method uses a
Markov Chain Monte Carlo (MCMC) sampling algorithm to numerically approximate the
posterior distribution. To allow convergence, the first 10,000 samples were discarded as burn-in;
the following 50,000 iterations were used for posterior inference. The MCMC chain, after initial
burn in, was assessed by visual inspection of time-series plots of variables (Toft et al. 2007).
Posterior inference was estimated in the form of mean, with associated standard error (standard
deviation of the MCMC iterations). The possible combinations of the target species for the three
tests were +++, ++-, +-+, +--, -++, -+-, --+, ---, depending on if diagnostic tests were positive or
negative for 16S rRNA sequence analysis, bacterial culture, and multiplex PCR assay,
respectively.
3.4. RESULTS
3.4.1. Optimization of monoplex PCR assays
All the reference strains were specifically amplified by monoplex PCRs. There was no
prominent difference in optimized conditions of monoplex PCR assays. The final reaction
mixture for every monoplex PCR contained 2U of Taq DNA polymerase, 1.5 mM MgCl2 and
1μM primer concentration. PCR product sizes obtained for S. epidermidis, E. coli, S. uberis, M.
Experiment No. 1
68
bovis, S. agalactiae, S. aureus, S. dysagalactiae, S. chromogenes and S. haemolyticus were 130,
196, 239, 343, 405, 518, 695, 768 and 1451 bps, respectively, as shown in Figure No. 3.1.
Figure No. 3.1: Monoplex PCR for reference strains of bacterial pathogens. Lane L: 100 bp DNA
ladder, Lane 1: S. epidermidis (130 bp), Lane 2: E. coli (196 bp), Lane 3: S. uberis (239 bp), Lane 4: M.
bovis (343 bp), Lane 5: S. agalactiae (405 bp), Lane 6: S. aureus (518 bp), Lane 7: S. dysagalactiae (695
bp), Lane 8: S. chromogenes (768 bp)
3.4.2. Optimization of multiplex PCR assay
Different combinations of monoplex PCR assays were tested and finally all the nine
target pathogens were detected in a single reaction. When the primers were added in equal
concentrations, few of the target species were not detected. The final primer mix included primer
pairs in the following concentrations: Mb (0.45 µM), Sg (0.30 µM), Sd (0.50 µM), Su (0.40
µM), Sa (0.35 µM), Ec (0.55 µM), Sh (0.30 µM), Sc (0.45 µM) and SERF (0.25 µM). All the
primers targeting the 16S rRNA, PhoA, Cpn60 and rdr genes were species-specific and they
efficiently detected the target pathogens as shown in Figure No. 3.2.
L 1 2 3 4 5 6 7 8
1.5kb
600bps
100bps
Experiment No. 1
69
Figure No. 3.2: Multiplex PCR assay for mastitic bacterial pathogens. Lane L: 100 bp DNA ladder,
Lane 1: S. epidermidis (130 bp), & S. uberis (239 bp), Lane 2: E. coli (196 bp) & M. bovis (343 bp),
Lane 3: S. uberis (239 bp) & S. agalactiae (405 bp), Lane 4: E. coli (196 bp) & S. aureus (518 bp), Lane
5: M. bovis (343 bp), S. dysagalactiae (695 bp) & S. chromogenes (768 bp), Lane 6: S. uberis (239 bp), S.
aureus (518 bp) & S. chromogenes (768 bp), Lane 7: E. coli (196 bp), S. chromogenes (235 bp), S.
agalactiae (405 bp), S. dysagalactiae (695 bp) & S. haemolyticus (1451 bp), Lane 8: E. coli (196bp), M.
bovis (343 bp), S. aureus (518 bp), S. chromogenes (768 bp) & S. haemolyticus (1451 bp), Lane 9: all the
nine pathogens.
3.4.3. Analytic sensitivity of multiplex PCR assay
The sensitivity of monoplex PCR assay for each target bacteria was higher as compared
to duplex or triplex PCR assays. S. aureus, S. uberis, S. chromogenes and S. dysgalactiae were
detected at DNA concentration as low as 0.1 pg, S. agalactiae, S. haemolyticus and M. bovis
were detected at 1 pg or higher DNA concentration, while E. coli and S. epidermidis were
detected at 10 pg of DNA concentration. Multiplex PCR assay was comparatively less sensitive
than monoplex PCR assays. The LOD of multiplex PCR assay was in the range of 1.0 to 50 pg
DNA for all possible random combinations of the target species. DNA samples isolated from
L 1 2 3 4 5 6 7 8 9
1.5kb
600bps
100bps
Experiment No. 1
70
milk samples spiked with different combinations of the target species were amplified with
different sensitivities. The LOD for S. aureus, S. dysgalactiae, S. agalactiae & S. chromogenes
was 101 CFU/ml; E. coli, S. uberis & M. bovis were detected at 102 CFU/ml, while S.
epidermidis & S. haemolyticus were detected at 103 CFU/ml. Sensitivity for random
combinations of two or three bacterial species was in the range of 101 to 104 CFU/ml as shown in
Table No. 3.2.
Table No. 3.2: Analytic sensitivity of multiplex PCR assay
Bacterial species Sensitivity pg/ml (serial dilutions of
DNA from pure cultures)
Monoplex PCR Multiplex PCR
Sensitivity CFU/ml (serial dilutions of
inoculated milk samples)
Monoplex PCR Multiplex PCR
E. coli 10 10 102 102
S. aureus 0.1 1 101 102
S. agalactiae 1 1 101 101
S. dysgalactiae 0.1 1 101 102
S. haemolyticus 1 10 103 104
S. chromogenes 0.1 10 101 102
S. epidermidis 10 50 103 104
M. bovis 1 10 102 104
S. uberis 0.1 10 102 103
3.4.4. Pathogen detection by 16S rRNA sequencing
The detection of bacterial pathogens based on 16S rRNA sequencing was considered as
gold standard to compare the results of the developed multiplex PCR assay with those of
bacterial culture. The results of California mastitis test showed that out of 223 milk samples, 200
were positive for mastitis. Among these positive samples, 158 were found to have one or two
target pathogens, totaling to 276 different bacterial strains out of which 198 were identified as
Staphylococci, Streptococci, and E. coli. Six milk samples showed no growth on any growth
media. M. bovis was not recovered from any of the milk samples. On the basis of 16S rRNA
Experiment No. 1
71
sequencing, 58 bacterial isolates were identified as S. aureus, 37 as E. coli, 29 as S. uberis, 27 as
S. dysagalactiae, 23 as S. agalactiae, 9 as S. haemolyticus, 8 as S. chromogenes, 7 as S.
epidermidis, 14 as S. simulans, 20 as S. pyogenes, 24 as Bacillus sp. and 15 as Corynebacterium
sp. Bacterial species other than these common mastitic pathogens were also detected from the
milk samples, including Bacillus jeotgali, Staphylococcus saprophyticus, Corynebacterium
confusum, Brevibacillus formosus and Escherichia fergusonii.
3.4.5. Pathogen detection in milk samples by multiplex PCR assay
After being validated on DNA isolated from milk cultures, multiplex PCR assay was
tested to detect the target pathogens by using DNA extracted directly from milk. The assay
achieved efficient identification of the target bacteria, as shown in Figure No. 3.3. S. aureus, E.
coli, S. uberis, S. dysagalactiae, S. agalactiae, S. haemolyticus, S. chromogenes and S.
epidermidis were detected for 57, 37, 29, 27, 23, 9, 8 and 7 times, respectively. None of the milk
samples under study was positive for M. bovis.
According to the multiplex PCR assay, 54.5% of the total milk samples were positive for
a single target species, 24.5% were positive for more than one target species, whereas 21% were
negative for all the target bacterial species. S. aureus & S. uberis, E. coli & S. uberis, E. coli & S.
dysagalactiae, S. epidermidis & S. agalactiae, S. epidermidis & S. dysagalactiae, and S. aureus
& E. coli were detected in the form of combined bovine intramammary infection.
3.4.6. Sensitivity and specificity estimation by LCA
Table 3.3 shows the frequency distribution of all the combinations of the test results for
each target species. The relatively high frequencies for entries ‘+ + +’ and ‘− − −’ indicate an
overall high agreement between the test results of the three diagnostic assays used.
Experiment No. 1
72
Figure No. 3.3: Identification of bacterial pathogens from milk by multiplex PCR assay. Lane L: 100 bp
DNA ladder, Lanes 1 & 2: E. coli (196 bp), Lanes 3 & 4: S. epidermidis (130 bp), Lanes 5 & 6: S.
agalactiae (405 bp), Lanes 7 & 8: S. dysagalactiae (695 bp), Lanes 9 & 10: S. epidermidis (130 bp),
Lanes 11 & 12: E. coli (196 bp), Lanes 13 & 14: S. aureus (518 bp), Lane 15: S. agalactiae (405 bp) & S.
epidermidis (130 bp), Lane 16: S. dysagalactiae (695 bp) & S. epidermidis (130 bp), Lane 17: E. coli
(196 bp) & S. aureus (518 bp)
Table No. 3.3: The test results for 16S rRNA sequence analysis, bacterial culture and multiplex PCR
assay
Test combinations + + + + + − + − + + − − − + + − + − − − + − − −
Species
S. aureus 45 0 12 0 1 3 0 139
E. coli 31 0 6 1 0 2 0 160
S. uberis 23 0 6 0 0 1 0 170
S. dysagalactiae 19 0 8 0 0 4 0 169
S. agalactiae 19 0 4 0 0 2 0 15
S. haemolyticus 6 0 3 1 0 0 0 190
S. chromogenes 6 0 2 1 0 0 0 191
S. epidermidis 5 0 2 1 0 0 0 192
The LCA sensitivity and specificity estimates for 16S rRNA sequence analysis, bacterial
culture method and multiplex PCR assay are given in Table No. 3.4 and 3.5. The results showed
L 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17
2.0kb
500bp
100bp
Experiment No. 1
73
that sensitivity and specificity estimates were highest for 16S rRNA sequence analysis followed
by multiplex PCR assay; bacterial culture method showed lower values for both. As the
sensitivity and specificity estimates were closer to 1.0 in the case of 16S rRNA sequence
analysis, it can be assumed as a gold standard.
Table No. 3.4: Specificity and standard error of all the detected bacterial pathogens calculated by LCA
Bacterial Sample 16S rRNA Bacterial Culture Multiplex PCR
Mean SE Mean SE Mean SE
S. aureus 0.992 0.007 0.972 0.014 0.992 0.007
E. coli 0.989 0.008 0.982 0.010 0.993 0.006
S. uberis 0.994 0.006 0.988 0.008 0.994 0.006
S. dysagalactiae 0.994 0.006 0.971 0.013 0.994 0.006
S. agalactiae 0.994 0.006 0.983 0.010 0.994 0.006
S. haemolyticus 0.990 0.007 0.994 0.005 0.994 0.005
S. chromogenes 0.990 0.007 0.994 0.005 0.994 0.005
S. epidermidis 0.990 0.007 0.994 0.005 0.994 0.005
Table No. 3.5: Sensitivity and standard error of all the detected bacterial pathogens estimated by LCA
Bacterial samples 16S rRNA Bacterial Culture Multiplex PCR
Mean SE Mean SE Mean SE
S. aureus 0.966 0.023 0.784 0.052 0.982 0.017
E. coli 0.974 0.026 0.816 0.062 0.969 0.029
S.uberis 0.967 0.032 0.774 0.073 0.967 0.032
S. dysagalactiae 0.964 0.034 0.690 0.084 0.964 0.035
S. agalactiae 0.957 0.040 0.798 0.079 0.957 0.040
S. haemolyticus 0.905 0.086 0.622 0.141 0.890 0.096
S. chromogenes 0.898 0.091 0.685 0.142 0.880 0.103
S. epidermidis 0.886 0.101 0.648 0.152 0.862 0.115
Experiment No. 1
74
3.5. DISCUSSION
The current study developed a novel multiplex PCR assay for robust and accurate
detection of nine bacterial pathogens frequently associated with bovine mastitis. Accurate
diagnosis is an important step between cause and cure of the disease. The development of an
economical, simple and rapid diagnostic tool has always been fundamental for the management
of udder health (Mustafa et al. 2013).
Sequence analyses of conserved “housekeeping” genes such as the bacterial 16S rRNA
gene are increasingly being used to identify bacterial species in clinical practice and scientific
investigations (Petti et al. 2005). In the case of 16S rRNA analysis, species identification is
easiest when most or the entire gene can be sequenced. 16S rRNA gene sequencing allows
robust, highly reproducible and accurate identification of bacteria and is, therefore, favored over
phenotypic testing. In addition, 16S rRNA sequencing allows discovery of novel, clinically
relevant bacteria and the test results are objective (Woo et al. 2008). DNA sequencing is,
however, impractical in medical diagnostics where assay time and speed are often of essence
(Chakravorty et al. 2007). Also DNA sequencing becomes expensive when individual tests for
every target species are performed for mastitis cases involving more than single pathogens.
Based on this rationale, our research focused on the development of multiplex PCR assay
capable of detecting multiple pathogens in a single reaction.
Primers were designed from the 16S rRNA gene for M. bovis, S. agalactiae, S.
dysagalactiae, S. chromogenes, S. haemolyticus and S. aureus, from the PhoA gene for E. coli,
the Cpn60 gene for S. uberis and the rdr gene for S. epidermidis. Selection was based on the
specificity, Tm and difference in amplicon size. All the primers were tested with reference strains
for the validation of the assay. E. coli shows great homology in sequence with other species of
Experiment No. 1
75
Enterobacteriaceae, so multiple targets are required for its identification (Horakova et al. 2008).
Because it was not possible to target multiple genes for E. coli in our multiplex PCR assay, we
have chosen PhoA gene for designing primers which specifically detect E. coli.
When the multiplex PCR assay was tested to detect pathogens from mastitic milk, it
proved to be very efficient and accurate. The assay detected all the bacterial species isolated by
culture method, and identified the pathogens in the culture-negative samples too. In subclinical
mastitis, samples with no bacterial growth are generally very common. Microorganisms do not
exist as pure culture but appear in the form of complex communities. The existing methods in
clinical microbiology lack the ability to rapidly catalog and comprehensively classify the
diversity of organisms present in case specimens (Schlaberg et al. 2012). Individual strains may
surpass others when co-cultured, and overwhelming numbers of species may be present,
prohibiting a comprehensive workup. The conventional method for bacterial identification is
based on bacterial culturing, followed by examination of phenotypic, biochemical, and
enzymatic characteristics of bacteria. However, the microbial culture of milk samples presents
many limitations (Taponen et al. 2009). Most bacterial species were detected by the bacterial
culture method, but where not detected, was probably due to either absence of viable bacterial
cells or due to the fact that bacterial colonies are selected on the basis of morphological features,
and hence there is a chance of missing a species which has a similar phenotype. Microbial
culturing is considered as a gold standard but it has its own limitations, rendering it imperfect as
a true reference test.
The analytic sensitivity of multiplex PCR assay reported by Lee et al. (Lee et al. 2008)
ranged from 105 CFU/ml to 102 CFU/ml which is comparable to previous studies. However, it
was slightly lower as compared to another multiplex PCR assay whose detection limit was in the
Experiment No. 1
76
range of 102 CFU/ml to 100 CFU/ml (Shome et al. 2011). The analytic sensitivity of our
multiplex PCR assay was up to 50 pg for DNA isolated from pure cultures and 104 CFU/ml for
spiked milk samples which is comparable to other developed assays. According to Reher et al.
(Reyher et al. 2011), if more than two different bacterial species are detected in a single mastitic
milk sample it is marked as contaminated, with an exception of S. aureus and S. agalactiae. In
this regard, we combined a maximum of two or three target bacterial strains randomly to check
the sensitivity of multiplex PCR assay. In a recently reported study, 33.5% of quarters were
infection free; however, single pathogens were detected in 43.5% of mastitis positive quarters,
two bacterial species were identified in 19.2% of infection and very small percentage of
infections 3.8% were due to three pathogens (Goli et al. 2012). Somewhat similar results had
also been reported in another study (Rysanek et al. 2007). Detection limit of multiplex PCR
assay is usually low as compared to monoplex PCR. In a study designed for detection of S.
aureus and Yersinia enterocolitica, the detection limit of multiplex PCR assay applied on DNA
isolated from bacterial culture was 100 CFU/ml. However, it decreased to 103 CFU/ml and 104
CFU/ml when DNA obtained from spiked milk samples was subjected to monoplex and
multiplex PCR assays, respectively (Ramesh et al. 2002).
The sensitivity and specificity of a test are usually determined by comparison with a
reference test which is supposed to determine the true disease state of the animals
unambiguously. But this is only possible in the presence of perfect reference test (Kraemer
1992). The true disease state, however, is rarely known in practice, because perfect test results
may be difficult or impossible to obtain. The sensitivity and specificity were estimated by
applying LCA model for evaluation of the developed multiplex PCR assay. The results showed
that multiplex PCR assay had higher sensitivity and specificity as compared to bacterial culture
Experiment No. 1
77
for all the target species. It has been elaborated that a PCR assay can efficiently detect DNA
from both viable and nonviable bacteria while bacterial culture is only capable of detecting
viable bacteria. In those cases where the infection is cured, bacterial DNA can still be detected in
the udder and false positive PCR assay results can be obtained (Koskinen et al. 2010).
The sensitivity and specificity of a real-time PCR assay for the detection of bovine
mastitic pathogens was found to be 100% for almost all the target species (Koskinen et al. 2009).
In another study, a rapid PCR test was developed for the identification of S. agalactiae in milk
samples collected on filter paper disks. The diagnostic sensitivity of the test was 96.15% and
specificity was 98.60% (Wu et al. 2008). Paradis et al. (Paradis et al. 2012) used an LCA model
for estimation of sensitivity and specificity of multiplex real-time PCR assay for the detection of
S. aureus, S. uberis, E. coli, and S. agalactiae. Sensitivity was found to be in the range of 66% to
96% and specificity was ≥ 99% for all the target species. In the present study, similar levels of
test performance for multiplex PCR assay have been achieved; however, our assay is capable of
detecting nine instead of four bacterial species.
3.6. CONCLUSION
To the best of our knowledge, the developed multiplex PCR assay is the first to achieve a
low-cost, high-throughput capacity, and fast turnaround time for simultaneous detection of nine
bacterial mastitic pathogens and appears to be sufficiently specific and sensitive for disease
diagnosis and the target species differentiation. The specificities and sensitivities estimated by
LCA clearly indicate that the assay has a similar performance level to the 16S rRNA sequence
analysis; however, it is far more rapid to perform. This novel molecular assay could be helpful
for correct and timely identification of bovine mastitic pathogens, which is crucial for the control
and treatment of the disease.
Experiment No. 1
78
3.7. REFERENCES
Biek R, O’Hare A, Wright D, Mallon T, McCormick C, Orton RJ, McDowell S, Trewby H, Skuce
RA, Kao RR. 2012. Whole genome sequencing reveals local transmission patterns of
Mycobacterium bovis in sympatric cattle and badger populations. PLoS Pathog. 8:
e1003008.
Chakravorty S, Helb D, Burday M, Connell N. 2007. A detailed analysis of 16S ribosomal RNA
gene segments for the diagnosis of pathogenic bacteria. J Microbiol Methods. 69: 330–339.
Cremonesi P, Castiglioni B, Malferrari G, Biunno I, Vimercati C, Moroni P, Morandi S, Luzzana
M. 2006. Technical note: Improved method for rapid DNA extraction of mastitis pathogens
directly from milk. J Dairy Sci. 89: 163–169.
dos Santos Nascimento J, Fagundes PC, de Paiva Brito MAV, Dos Santos KRN, de Freire Bastos
MC. 2005. Production of bacteriocins by coagulase-negative staphylococci involved in
bovine mastitis. Vet Microbiol. 106: 61–71.
Gardner IA. 2002. The utility of Bayes’ theorem and Bayesian inference in veterinary clinical
practice and research. Aust Vet J. 80: 758–761.
Goli M, Ezzatpanah H, Ghavami M, Chamani M, Aminafshar M, Toghiani M, Eghbalsaied S.
2012. The effect of multiplex-PCR-assessed major pathogens causing subclinical mastitis
on somatic cell profiles. Trop Anim Health Prod. 44: 1673–1680.
Hiitiö H, Riva R, Autio T, Pohjanvirta T, Holopainen J, Pyörälä S, Pelkonen S. 2015. Performance
of a real-time PCR assay in routine bovine mastitis diagnostics compared with in-depth
conventional culture. J Dairy Res. 82(02): 200-208.
Hogan JS, Gonzalez RN, Harmon RJ, Nickerson SC, Oliver SP, Pankey JW, Smith KL. 1999.
Experiment No. 1
79
Laboratory handbook on bovine mastitis. Natl Mastit Counc. Madison, WI 6–10.
Horakova K, Mlejnkova H, Mlejnek P. 2008. Specific detection of Escherichia coli isolated from
water samples using polymerase chain reaction targeting four genes: cytochrome bd
complex, lactose permease, β‐d‐glucuronidase, and β‐d‐galactosidase. J Appl Microbiol.
105: 970–976.
Hui SL, Walter SD. 1980. Estimating the error rates of diagnostic tests. Biometrics. 167–171.
Hussain R, Javed MT, Khan A. 2012. Changes in some biochemical parameters and somatic cell
counts in the milk of buffalo and cattle suffering from mastitis. Pak Vet J. 32: 418–421.
Jiang H, Dong H, Zhang G, Yu B, Chapman LR. Fields MW. 2006. Microbial diversity in water
and sediment of Lake Chaka, an athalassohaline lake in northwestern China Appl Environ
Microbiol. 72: 3832–3845.
Koskinen MT, Holopainen J, Pyörälä S, Bredbacka P, Pitkälä A, Barkema HW, Bexiga R,
Roberson J, Sølverød L, Piccinini R, Kelton D, Lehmusto H, Niskala S, Salmikivi L. 2009.
Analytical specificity and sensitivity of a real-time polymerase chain reaction assay for
identification of bovine mastitis pathogens. J Dairy Sci. 92: 952–9.
Koskinen MT, Wellenberg GJ, Sampimon OC, Holopainen J, Rothkamp A, Salmikivi L, van
Haeringen Wa, Lam TJGM, Pyörälä S. 2010. Field comparison of real-time polymerase
chain reaction and bacterial culture for identification of bovine mastitis bacteria. J Dairy
Sci. 93: 5707–15.
Kraemer HC. 1992. Evaluating medical tests: Objective and quantitative guidelines. Sage
publications Newbury Park, CA.
Kuang Y, Tani K, Synnott AJ, Ohshima K, Higuchi H, Nagahata H, Tanji Y. 2009.
Experiment No. 1
80
Characterization of bacterial population of raw milk from bovine mastitis by culture-
independent PCR–DGGE method. Biochem Eng J. 45: 76–81.
Lee K-H, Lee J-W, Wang S-W, Liu L-Y, Lee M-F, Chuang S-T, Shy Y-M, Chang C-L, Wu M-C,
Chi C-H. 2008. Development of a novel biochip for rapid multiplex detection of seven
mastitis-causing pathogens in bovine milk samples. J Vet diagnostic Investig. 20: 463–471.
Lunn DJ, Thomas A, Best N, Spiegelhalter D. 2000. WinBUGS-a Bayesian modelling framework:
concepts, structure, and extensibility. Stat Comput. 10: 325–337.
Matope G, Muma JB, Toft N, Gori E, Lund A, Nielsen K, Skjerve E. 2011. Evaluation of
sensitivity and specificity of RBT, c-ELISA and fluorescence polarisation assay for
diagnosis of brucellosis in cattle using latent class analysis. Vet Immunol Immunopathol.
141: 58–63.
Muhammad G, Athar M, Shakoor A, Khan MZ, Rehman F, Ahmad MT. 1995. Surf Field Mastitis
Test: An inexpensive new tool for evaluation of wholesomeness of fresh milk. Pakistan J
Food Sci. 5: 91–93.
Mustafa YS, Awan FN, Zaman T. 2013. Prevalence and antibacterial susceptibility in mastitis in
buffalo and Cow in district Lahore-Pakistan. Buffalo Bull. 32: 307–314.
Paradis M-È, Haine D, Gillespie B, Oliver SP, Messier S, Comeau J, Scholl DT. 2012. Bayesian
estimation of the diagnostic accuracy of a multiplex real-time PCR assay and
bacteriological culture for 4 common bovine intramammary pathogens. J Dairy Sci. 95:
6436–48. doi:10.3168/jds.2012-5328
Petti Ca, Polage CR, Schreckenberger P. 2005. The Role of 16S rRNA Gene Sequencing in Identi
cation of Microorganisms Misidenti ed by Conventional Methods. Society 43: 6123–6125.
Experiment No. 1
81
Radostitis OM, Gay CC, Blood DC, Hinchcliff KW. 2000. Veterinary medicine 9th ed. WB
Sauders. London.
Ramesh A, Padmapriya BP, Chrashekar A, Varadaraj MC. 2002. Application of a convenient DNA
extraction method and multiplex PCR for the direct detection of Staphylococcus aureus and
Yersinia enterocolitica in milk samples. Mol Cell Probes. 16: 307–314.
Reyher KK, Dufour S, Barkema HW, Des Côteaux L, Devries TJ, Dohoo IR, Keefe GP, Roy J-P,
Scholl DT. 2011. The National Cohort of Dairy Farms—A data collection platform for
mastitis research in Canada. J Dairy Sci. 94: 1616–1626.
Riffon R, Sayasith K, Khalil H, Dubreuil P, Drolet M, Lagace J. 2001. Development of a Rapid and
Sensitive Test for Identi cation of Major Pathogens in Bovine Mastitis by PCR ´. Society
39: 2584–2589.
Rysanek D, Babak V, Zouharova M. 2007. Bulk tank milk somatic cell count and sources of raw
milk contamination with mastitis pathogens. Vet Med (Praha). 52: 223–230.
Sambrook JRDW. 2001. Molecular Cloning: A Laboratory Manual. 3rd ed Cold Spring Harbor
Laboratory Press.
Sanford CJ, Keefe GP, Sanchez J, Dingwell RT, Barkema HW, Leslie KE, Dohoo IR. 2006. Test
characteristics from latent-class models of the California Mastitis Test. Prev Vet Med. 77:
96–108.
Schlaberg R, Simmon KE, Fisher MA. 2012. A systematic approach for discovering novel,
clinically relevant bacteria. Emerg Infect Dis. 18: 422–430.
Shome BR, Das Mitra S, Bhuvana M, Krithiga N, Velu D, Shome R, Isloor S, Barbuddhe SB,
Rahman H. 2011. Multiplex PCR assay for species identification of bovine mastitis
Experiment No. 1
82
pathogens. J Appl Microbiol. 111: 1349–1356.
Taponen S, Salmikivi L, Simojoki H, Koskinen MTT, Pyörälä S. 2009. Real-time polymerase chain
reaction-based identification of bacteria in milk samples from bovine clinical mastitis with
no growth in conventional culturing. J Dairy Sci. 92: 2610–2617.
Team RC. 2013. R: A language and environment for statistical computing.
Toft N, Åkerstedt J, Tharaldsen J, Hopp P. 2007. Evaluation of three serological tests for diagnosis
of Maedi-Visna virus infection using latent class analysis. Vet Microbiol. 120: 77–86.
Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. 2012.
Primer3—new capabilities and interfaces. Nucleic Acids Res. 40: e115–e115.
Verbeek CJR, Xia SS, Whyte D. 2008. Rheology of the gel formed in the California Mastitis Test. J
Dairy Res. 75: 385–391.
Viguier C, Arora S, Gilmartin N, Welbeck K, O’Kennedy R, O’Kennedy R. 2009. Mastitis
detection: current trends and future perspectives. Trends Biotechnol. 27: 486–493.
Woo PCY, Lau SKP, Teng JLL, Tse H, Yuen K-YY. 2008. Then and now: use of 16S rDNA gene
sequencing for bacterial identification and discovery of novel bacteria in clinical
microbiology laboratories. Clin Microbiol Infect. 14: 908–934.
Wu J, Liu Y, Hu S, Zhou J. 2008. Development of a rapid PCR test for identification of
Streptococcus agalactiae in milk samples collected on filter paper disks. Asian-Australasian
J Anim Sci. 21: 124–130.
Experiment No. 2
83
CHAPTER 4
EXPERIMENT NO. 2
Development and validation of loop-mediated isothermal amplification assay for the
detection of Mycoplasma bovis from mastitic milk samples.
Folia Microbiologica. Revised Manuscript submitted. 5 May, 2017.
Article No. FOLM-D-16-00551R1.
4.1. ABSTRACT
Mycoplasma mastitis is often difficult to control due to a lack of rapid and accurate
diagnostic tools. The aim of the current study was to develop a loop-mediated isothermal
amplification (LAMP) assay for the detection of Mycoplasma bovis (M. bovis) from mastitic
milk samples. The assay was developed using primers designed for three different target genes:
uvrC, 16S rRNA and gyrB, and validated using mastitic milk samples previously found positive
for the target pathogen. Specificity of the developed assay was determined by testing cross-
reactivity of LAMP primers against closely related bovine mastitis bacterial pathogens. The
sensitivity was found to be higher compared to conventional PCR. The LAMP assay was also
capable of detecting M. bovis from PCR-negative clinical mastitic milk samples. The uvrC
primers were found to be more sensitive, while gyrB primers were more specific; however, 16S
rRNA primers were less specific and sensitive compared to either uvrC or gyrB primers. Cohen’s
kappa values for uvrC, gyrB and 16S rRNA primers used in the LAMP assays were 0.940, 0.970
and 0.807, respectively. All three tests showed a high level of agreement between the test results
and the true positive status as indicated on the receiver operating characteristic (ROC) curve. Our
findings suggest that the newly developed LAMP assays targeting uvrC and gyrB could be a
useful tool for rapid and accurate diagnosis of mastitis caused by M. bovis.
Key words: Mycoplasma bovis; Mastitis; Loop-mediated isothermal amplification; PCR.
Experiment No. 2
84
4.2. INTRODUCTION
Bovine mastitis is one of the most common dairy diseases, and is usually caused by intra-
mammary microbial infections. Mycoplasma is one of the bovine mastitis bacterial pathogens,
affecting the economic viability of the dairy industry with reduced milk production (Maunsell et
al. 2011). Among pathogenic Mycoplasma species, a few are of concern causing bovine mastitis;
M. bovis is the most important of these (Boonyayatra et al. 2012a). New York farms and
veterinary clinics recently reported that 78% of Mycoplasma mastitis caseload is due to M. bovis
(Gioia et al. 2016).
A reliable, rapid and inexpensive diagnostic tool is crucial for the prevention and control
of M. bovis mastitis. Conventional diagnostic methods cannot specifically identify the pathogen
at the species or strain level. M. bovis infection is routinely diagnosed by serological tests and
bacterial culture. The National Mastitis Council recommends incubation of Mycoplasma cultures
for at least seven to 10 days before reading the results. Subculture is also required for further
identification (Nicholas and Ayling 2003). These methods are time-consuming and labor-
intensive, and often give false negative results because of the fastidious culture requirements of
Mycoplasma.
Molecular methods have the potential to identify the target pathogens within a few hours,
with high specificity and sensitivity. Many research groups have developed PCR-based methods
to discriminate between closely-related species, or to rapidly catalogue important species,
particularly M. bovis. These methods have been used with or without employing a bacterial
culture (Boonyayatra et al. 2012b). Standard PCR and real-time PCR are currently in routine use
for M. bovis detection (Cai et al. 2005; Foddai et al. 2005).
Experiment No. 2
85
LAMP is a very simple technique, in which nucleic acid is amplified with high specificity
and sensitivity. Four LAMP primers and a DNA polymerase with strand displacement activity
are required (Nagamine et al. 2002). The LAMP method is based on its ability to amplify nucleic
acids under isothermal conditions in the range of 55°C to 65°C, without requiring DNA
denaturation and the use of thermocycler (Fukuta et al. 2003). LAMP has been shown to be a
useful method for genetic testing, species identification and rapid diagnosis of various infectious
diseases (Kurosaki et al. 2009; Fu et al. 2011). Recently, LAMP has been used to develop
reliable and rapid diagnostic assays for vesicular stomatitis New Jersey virus (Fowler et al. 2016)
and tuberculous meningitis (Modi et al. 2016). M. bovis detection by LAMP was first reported by
Bai et al. (2011). However, the method for detection of M. bovis from mastitic milk has not yet
been developed. The current study describes the development of a fast and simple LAMP assay
for detecting M. bovis directly from mastitic milk, on the basis of primers designed from three
different target genes. The main goal of this study was to develop a rapid, inexpensive and
simple molecular tool for herd screening.
4.3. MATERIALS AND METHODS
4.3.1. Bacterial strains and clinical samples
Standard bacterial strains and mastitic milk samples used for the development and
validation of the LAMP assay were obtained from Quality Milk Production Services (QMP),
Cornell University, Ithaca, NY. All the bacterial strains and milk samples were identified by
QMP to species level with the help of routine diagnostic tests and confirmed by 16S rRNA
sequence analysis. The milk samples studied came from 95 dairy farms between 1 January 2012
and 31 December 2015. The use of Mycoplasma isolates from these milk samples provided the
highest available degree of clonal diversity for the assay validation. Standard bacterial strains
Experiment No. 2
86
included M. bovis, Mycoplasma californicum, Escherichia coli, Mycoplasma bovigenitalium,
Staphylococcus aureus, Streptococcus dysgalactiae and Streptococcus uberis. Mycoplasma
strains were cultured on Hayflick medium containing 15% horse serum and incubated for up to
seven days at 37 °C with CO2 enrichment. For all other bacterial species, blood agar was used for
culturing. Fifty M. bovis isolates and five samples from each of the other strains were collected.
All the milk samples were stored at −20 °C until use.
4.3.2. Designing of LAMP and PCR primers
Two new sets of LAMP primers targeting 16S rRNA and gyrB regions from M. bovis
genome (GenBank accession # CP002188.1) were designed using Primer Explorer V4
(http://primerexplorer.jp/elamp4.0.0/index.html; Eiken Chemical Co., Japan). Due to inefficient
and inconsistent target amplification using the first set of gyrB primers, four additional sets of
LAMP primers from the gyrB gene were designed so that a set showing the best results could be
selected for further analysis. Another set of previously reported LAMP primers targeting the
uvrC gene (Bai et al. 2011) was also used for comparison. Each set of primers was composed of
four oligonucleotides, each comprising two outer (F3 and B3) and two inner (FIP and BIP)
oligonucleotides. The FIP primer is a composite of a complementary sequence of F1 primer
(F1C) and the sense sequence of the F2 primer. Similarly, the BIP primer consists of a
complementary sequence of B1 primer (B1C) connected to the sense sequence of B2 primer
(Table 4.1 & Figure 4.1). Of note, uvrC LAMP primers have been modified in this study to
exclude a T linker, which is often used as a connector between F1C and F2 primers and B1C and
B2 primers (Bai et al. 2011; Centeno-Cuadros et al. 2016). The same 16S rRNA and gyrB LAMP
primers (16-F3 & 16-B3 and g-F3 & g-B3) were also used as PCR primers in individual PCR
Experiment No. 2
87
assays. All the primers were synthesized through services provided by Invitrogen (Minneapolis,
MN, USA).
Figure. No. 4.1: Location of LAMP primers in the target gyrB and 16S rRNA gene sequences (also see
Table 4.1 and consult the text under the heading “Designing of LAMP and PCR primers”).
4.3.3. Isolation of genomic DNA
Genomic DNA was extracted from single culture colonies of standard bacterial strains
and clinical mastitic milk samples using Qiagen DNeasy Blood and Tissue Kit (Life
Technologies, Carlsbad, CA). The extraction was carried out according to the manufacturer’s
instructions, with the modification of an increase in incubation time at 56 °C after adding buffer
Experiment No. 2
88
AL. The DNA was quantified using Nanodrop 2000c (Thermo Fisher Scientific Inc., Waltham,
MA, USA) and stored at −20 °C until further use.
Table No. 4.1: Sequences of LAMP and PCR primers used in the current study
Target
gene
Primer Primer sequence
16S
RNA*
gyrB*
uvrC
16-F3
16-B3
16-FIP
16-BIP
g-F3
g-B3
g-FIP
g-BIP
F3
B3
FIB
BIP
uvrC1
uvrC2
GTGTCGTGAGATGTTCGGTT
ACCACTTCGCTTCTCTTTGT
ACTCGGGCAGTCTCCTTAGAGTCAACGAGCGCAACCCTTA
AATCGGGAGGAAGGTGGGGATTGTAGCACGTGTGTAGCC
TAATTCAGCTGGCGGTTC
CAGCATCAGTCATAATAATTACCTT
GGCGAAACCTTTTCAGCATTAAAGCAAAAATGGGTAGGGA
AATCTCGCTTATAACTGCTTTGGGGTATCTAAGCTTGTTGATGTCAA
AGAAACAGACAAAAAATTAGTTCAC
AAGCACCCTATTGATTTTTACTC
GATTTTTGCATAGCTTTTAAAGTGAGAAGGCAAACTAAGAAACATAAAAGG
GACGCTTCAGTTGAAGAATTATCAAATCCTTATTTTTAATGCTTTTGGC
TAATTTAGAAGCTTTAAATGAGCGC
CATATCTAGGTCAATTAAGGCTTTG
*Designed for the current study using source DNA sequences retrieved from NCBI. uvrC1 & uvrC2 are
PCR primers which along with uvrC LAMP primers have been reported by Bai et al. (Bai et al. 2011).
16S rRNA LAMP primers 16-F3 & 16-B3 and gyrB LAMP primers g-F3 & g-B3 were also used as PCR
primers in individual PCR assays in the current study.
4.3.4. LAMP assay
The LAMP reaction was performed in a total volume of 12.5 μL. This contained: 4.5 μL
of RNAse free water, 3.0 μL of 5M Betaine (Sigma, Germany), 1.5 μL of 10× Thermopol buffer
(New England Biolabs, USA), which consists of 10 mM (NH4)2SO4, 20 mM Tris-HCl, 10 mM
KCl, 2 mM MgSO4 and 0.1% Triton X-100, 1.0 μL of 2.5 mM of each dNTP, 0.75 μL of primer
Experiment No. 2
89
mix having different concentrations of outer and inner primers, 0.75 μL of 8,000 U/mL Bst
polymerase (New England Biolabs) and 1.0 μL of DNA template. Optimization of the LAMP
assay was carried out using DNA extracted from single culture colonies of standard M. bovis
isolates. A heat block was used for incubating the reaction mixture. Amplification was
performed at 55 °C to 65 °C for 60 minutes and stopped at 80 °C for 5 minutes.
4.3.5. Specificity and sensitivity of LAMP assay
Specificity of the LAMP assay was examined by amplifying DNA isolated from standard
bacterial isolates of M. bovis, M. californicum, E. coli, M. bovigenitalium, S. aureus, S.
dysgalactiae and S. uberis. To determine the sensitivity of the LAMP assay and PCR, 10-fold
serial dilutions (50 ng/reaction − 5 pg/reaction) of genomic DNA were analyzed. To further
assess the limit of detection of the developed assay, pasteurized milk was spiked with M. bovis
and serial dilutions were made in the range of 5×106 CFU/mL to 5×100 CFU/mL. DNA was
isolated from these dilutions of spiked milk and amplified under optimized conditions. Un-
inoculated pasteurized milk served as a negative control.
4.3.6. Analysis of LAMP products
The LAMP reaction products were detected on 2% agarose gel stained with ethidium
bromide and examined under UV light. A ladder-like band pattern is indicative of a positive
LAMP reaction. As an alternative, the LAMP reaction products were also visualized directly by
adding 0.5 μL of 10× SYBR Green dye (Invitrogen, USA) to the reaction tube and observing any
change in the color. The solution turned yellowish-green to indicate a positive LAMP reaction
and remained orange when there was no amplification. A change in color is due to the presence
of a large amount of DNA amplification that has reacted with the magnesium pyrophosphate
(Notomi et al. 2000; Parida et al. 2008).
Experiment No. 2
90
4.3.7. PCR assay
Standard PCR assays targeting 16S rRNA, gyrB and uvrC gene sequences were
performed in a 25 μL reaction volume containing 1 μM of each primer, 2.5U of Taq DNA
polymerase, 200 μM of each dNTP, 1.5 μL of 25 mM MgCl2, 2.5 μL of 10× PCR buffer and 1
μL of template DNA. PCR conditions were set at 95 °C for 5 minutes, followed by 30 cycles at
95 °C for 45 seconds, 54 °C for 30 seconds, and 72 °C for 45 seconds. A final extension was
done at 72 °C for 10 minutes.
4.3.8. Statistical analysis
Sensitivities (Se) and specificities (Sp) were estimated for each of the three LAMP
assays, with exact confidence intervals for these estimates using the ‘binom.test’ function
implemented in the statistical package ‘R’ (R Core Team 2013). Formal comparisons were made
both for Se and Sp between pairs of tests using the Fisher exact test using the ‘fisher.test’
function. In addition, overall performance of each test was assessed using Cohen’s kappa
statistics from the ‘vcd’ package. The kappa function assessed the overall agreement between the
test results of each LAMP assay and the true mastitis status. A receiver operator characteristic
(ROC) curve was used to display the results of specificity and sensitivity for all three LAMP
assays.
4.4. RESULTS
All of the three sets of LAMP primers were found to detect the target pathogen M. bovis
in DNA extracted from the pure culture colonies and the characterized clinical mastitic milk
samples. The LAMP assay targeting the gyrB gene was the most difficult to optimize. Only one
out of five sets of LAMP primers designed from the gyrB gene showed efficient amplification,
and was therefore selected for further analysis.
Experiment No. 2
91
4.4.1. Optimization of LAMP assay
To optimize conditions for each of the three LAMP assays, different concentrations of
primers and a range of temperatures from 55 °C to 65 °C were used. The best results for each of
three sets of LAMP primers were obtained at the primer concentration of 3 μM for each of the
outer primers and 30 μM for each of the inner primers. The optimum temperature for the uvrC
and 16S rRNA sets of primers was 58 °C, and 61 °C for the gyrB set of primers.
4.4.2. Detection of M. bovis by LAMP assay and PCR
The results of LAMP assays were analyzed either by running the amplified DNA
products on 2% agarose gel or by observing visually any change in the color after adding SYBR
Green I. A ladder-like band pattern and a color change on the addition of SYBR Green I, from
orange to yellowish-green, were the indications of a positive result as shown in Fig. 2A & 2B. In
the case of conventional PCR, the positive samples were identified on the basis of the size of
bands corresponding to 194 bp, 221 bp and 238 bp for the 16S rRNA, gyrB and uvrC primers,
respectively, when subjected to 2% agarose gel electrophoresis as shown in Figure No. 4.2C.
4.4.3. Specificity and sensitivity of LAMP assay
To evaluate the specificity of each of the three LAMP assays, 80 isolates, 50 from M.
bovis and five from each of six other bacterial pathogens were scrutinized. All three sets of
primers designed for LAMP specifically detected M. bovis from bacterial cultures as well as
from the clinical mastitic milk samples (Table No. 4.2).
In order to determine the sensitivity of each of the three LAMP assays, 10-fold serial dilutions
were made of DNA extracted from pure cultures as well as directly from mastitic milk samples,
in the range of 50 ng/reaction to 5 pg/reaction. Because all the LAMP assays were capable of
detecting 5 pg of DNA, further dilutions were made to reach their limit of detection. The limit of
Experiment No. 2
92
detection of LAMP assays was 0.01 pg and 0.1 pg in the case of pure culture and clinical mastitic
milk samples, respectively. The limit of the PCR assays was 50 pg and 5 ng in the case of pure
culture and clinical mastitic milk samples, respectively. The sensitivity of LAMP assays and
PCR was also determined in terms of CFU by making 10-fold serial dilutions of pasteurized milk
spiked with M. bovis in the range of 5×106 CFU/mL to 5×100 CFU/mL. The limit of detection
for each of the three LAMP assays was 5×101 CFU/mL, and it was 5×101 CFU/mL for PCR
employing 16S rRNA primers and 5×102 CFU/mL for PCR employing uvrC primers or gyrB
primers. Overall, every LAMP assay was 10 times more sensitive than corresponding
conventional PCR assays.
Figure No. 4.2: Results of LAMP assay and conventional PCR. A. Agarose gel showing characteristic
ladder-like band pattern of the LAMP products. L: DNA ladder, Lanes 1, 2 & 3: M. bovis detected by
uvrC primers, Lanes 4 & 5: M. bovis detected by gyrB primers, Lanes 6 & 7: M. bovis detected by 16S
rRNA primers, Lanes 8, 9 & 10: S. uberis with 16S rRNA, uvrC and gyrB primers, respectively. B.
Visualization of color change in the LAMP products on addition of SYBR green I, from orange to
yellowish-green. Lanes 1, 2 & 3: M. bovis detected by uvrC, gyrB and 16S rRNA primers, respectively, 4:
S. uberis with gyrB primers, 5: no template added with gyrB primers. C. Agarose gel showing PCR
Experiment No. 2
93
products with corresponding band size for each of three PCR primer sets. L: 100 bp DNA ladder, 1, 2 &
3: M. bovis detected by uvrC (238 bp), gyrB (221 bp) and 16S rRNA (194 bp) PCR primers, respectively.
Table No. 4.2: Results on M. bovis detection from known bacterial isolates and clinical mastitic milk
samples using three different sets of PCR and LAMP primers
Target gene
Assay type
uvrC
PCR LAMP
gyrB
PCR LAMP
16S rRNA
PCR LAMP
Bacterial isolates
Mycoplasma bovis
Mycoplasma californicum
Escherichia coli
Mycoplasma bovigenitalium
Staphylococcus aureus
Streptococcus dysgalactiae
Streptococcus uberis
Mastitic milk samples
49/50 50/50
1/5 0/5
0/5 0/5
0/5 0/5
0/5 0/5
0/5 0/5
0/5 0/5
44/50 48/50
0/5 0/5
0/5 0/5
0/5 0/5
0/5 0/5
0/5 0/5
0/5 0/5
45/50 46/50
0/5 1/5
0/5 0/5
0/5 0/5
0/5 0/5
0/5 0/5
0/5 0/5
Mycoplasma bovis
Mycoplasma californicum
Escherichia coli
Mycoplasma bovigenitalium
Staphylococcus aureus
Streptococcus dysgalactiae
Streptococcus uberis
25/30 30/30
2/6 1/6
0/6 0/6
0/6 1/6
0/6 0/6
0/6 0/6
0/6 0/6
24/30 29/30
0/6 0/6
0/6 0/6
0/6 0/6
0/6 0/6
0/6 0/6
0/6 0/6
24/30 26/30
1/6 2/6
0/6 1/6
0/6 0/6
0/6 0/6
0/6 0/6
0/6 0/6
4.4.4. Evaluation of LAMP assay on clinical samples
Sixty six clinical mastitic milk samples positive for common pathogens including M.
bovis were subjected to each of the three LAMP assays and PCR. Every LAMP assay efficiently
detected M. bovis from these clinical samples. PCR was comparatively less efficient in detecting
M. bovis from cultures as well as clinical mastitic milk samples (Table No. 4.2).
Experiment No. 2
94
4.4.5. Cohen’s kappa and ROC analysis
The performance of each of the three LAMP assays and PCR for the detection of the
target pathogen is summarized in Table 3. The sensitivity and specificity estimates were high for
all three LAMP assays, although the assay employing 16S rRNA primers generated slightly
lower measures for both. The same was also evident from measures by the kappa statistics,
although all of the three LAMP assays demonstrated a high level of agreement between the test
results and the true mastitis status. There were nonsignificant differences in Se or Sp values
between all pairs of tests (P = 0.12 for Se of uvrC vs 16S rRNA, and P > 0.3 for all other pairs of
tests). According to the ROC curve, on the basis of specificity and sensitivity, the most
appropriate diagnostic test should be closest to the top left hand corner of the curve. All three
tests were quite close to this point, particularly uvrC and gyrB (Figure No. 4.3).
Figure No. 4.3: ROC curve displaying sensitivity and specificity estimates for three different LAMP
assays employing 16S rRNA: green color, gyrB: blue color and uvrC: red color as target loci within the
M. bovis genome.
0
0.1
0.2
0.3
0.4
0.5
0.6
0.7
0.8
0.9
1
0 0.5 1
Sen
siti
vity
1-Specificity
Experiment No. 2
95
Table No. 4.3: Performance of the three LAMP assays for the detection of M. bovis as determined by
estimates of sensitivity, specificity and Cohen’s kappa statistics
Estimate of Estimate of Cohen’s
Test sensitivity 95% CI specificity 95% CI kappa
uvrC 30 / 30 (100.0%) (88.4%, 100.0%) 36 / 38 (94.7%) (82.3%, 99.4%) 0.940
gyrB 30 / 31 (96.8%) (83.3%, 99.9%) 36 / 36 (100.0%) (90.3%, 100.0%) 0.970
16S rRNA 30 / 34 (88.2%) (72.5%, 96.7%) 36 / 39 (92.3%) (79.1%, 98.4%) 0.807
4.5. DISCUSSION
The present study has achieved the development of a rapid, sensitive and specific LAMP
assay for the detection of M. bovis in mastitic milk samples. The three LAMP assays differ based
on the three target genes of M. bovis: uvrC, gyrB and 16S rRNA. The assay is essentially a
combination of three distinct LAMP assays, each targeting a different locus from the M. bovis
genome (uvrC, gyrB or 16S rRNA). Amplification of three targets for the detection of the same
species nullifies chances of having false-positive or false-negative results, thereby ensuring high
confidence in the disease diagnosis.
The assay was developed with the use of 80 standard isolates from seven different bovine
mastitis pathogens including M. bovis, and validated on 66 bovine mastitic milk samples
identified to species level by 16S rRNA sequencing. To further validate the assay, 20 random
DNA samples out of a total of 158 mastitic milk samples, recently reported to contain one or two
bovine mastitis pathogens other than M. bovis (Ashraf et al. 2017), were also subjected to assay
analysis. As expected, no amplification occurred in any of the three LAMP or PCR assays. All
three targets were found to be efficient and accurate in the detection of the target bacterial
Experiment No. 2
96
pathogen; however, some instances of false-negative and false-positive amplification were also
observed (Table 4.2).
The false-negative results in the case of the three PCR assays are a reflection of lower
sensitivity of conventional PCR compared to LAMP. Conventional PCR is reported to be
10−100 times less sensitive than LAMP (Bai et al. 2011; Higa et al. 2016; Wang et al. 2017).
Alternatively, false-positive detections can be attributed to carry-over or cross-sample
contamination amplified due to high sensitivity of LAMP (Le et al. 2012). Also, background
amplification in the absence of a DNA template due to the formation of primer dimers may be
responsible (Kimura et al. 2011; Wang et al. 2015). Regarding the current study, neither the
former nor the later possibilities fully explain the false-positive PCR or LAMP detections, as
amplification was absent from DNA template-free reactions. The most probable explanation for
the uvrC target seems to be the presence of irrelevant DNA co-isolated from a complex matrix
such as mastitic milk. In the case of the 16S rRNA target, rare false-positive detection events
may have occurred due to the presence of very few variations in the primer binding sites among
different bovine mastitis pathogens.
Some non-target strains may also harbor nearly exact target primer binding sites as was
revealed by multiple sequence alignment of concerned microbial species. Of note, 16S rRNA
showed sequence variations even in different isolates from the same species. Interestingly, very
closely related Mycoplasma mastitis species such as M. agalactiae, M. alkalescens, M.
canadense and M. bovigenitalium are quite different at the target primer binding sites at least in
one of the two target genes (gyrB & 16S rRNA). This ensures 100% sensitivity and specificity of
the LAMP assay employing all three targets for the detection of M. bovis.
Experiment No. 2
97
So far, two LAMP assays have been reported for the detection of M. bovis, one based on
the uvrC gene region by Bai et al. (2011) and the other based on the oppD/F gene region by Higa
et al. (2016). In the latter, the assay sensitivity was improved by using loop primers in addition to
four traditional LAMP oligonucleotides. Both these studies detected M. bovis from clinical
samples of respiratory disease using different DNA extraction protocols, signal detection
strategies and amplification reagents, with varying sensitivities and specificities estimated in
different ways. Our LAMP assay is the first to target M. bovis DNA isolated directly from
mastitic milk. In addition to two new sets of LAMP primers (gyrB & 16S rRNA), a previously
reported set of uvrC primers was also included in the current study, after excluding the optional
TTTT linker from FIP and BIP primers (Bai et al. 2011). The uvrC region was included in this
study because of its power to differentiate M. bovis even from closely related species M.
agalactiae (Subramaniam et al. 1998; Thomas et al. 2004). The design of FIP and BIP primers
without the TTTT linker does not compromise the assay sensitivity as our uvrC assay revealed
100% sensitivity equivalent to the same parametric value obtained with the use of primers
including the TTTT linker (Bai et al. 2011; Higa et al. 2016; Wang et al. 2017).
The sensitivity and specificity of our LAMP assay were comparable to those estimated
for previously reported assays (Table 3) (Bai et al. 2011; Higa et al. 2016). The sensitivity and
specificity estimates reported for previous LAMP assays for the detection of M. bovis were
100% and 74% respectively (Bai et al. 2011), and 97.2% and 90.9% respectively (Higa et al.
2016). Our assay showed 100% sensitivity with the uvrC target region and 100% specificity with
the gyrB target region. The limit of detection of our LAMP assay in terms of CFU (5×101
CFU/reaction) is also comparable to previously reported LAMP assays (Bai et al. 2011; Higa et
al. 2016; Wang et al. 2017). Most of the studies that developed LAMP assays targeted a single
Experiment No. 2
98
genomic target, which may cause false-negative identification of the target pathogen due to the
presence of inhibitors in extracted DNA (Bai et al. 2011; Higa et al. 2016; Centeno-Cuadros et
al. 2016; Wang et al. 2017). Our assay has advantages over single-target LAMP assays because it
employs amplification of three different targets, in different tubes set at two different isothermal
conditions, thus ruling out the concerns related to the presence of amplification inhibitors in
DNA. Amplification of three targets at two different temperatures can simply be achieved with
the use of two separate heat-blocks, even in field conditions.
The gyrB, a housekeeping gene encoding the B subunit of DNA gyrase, is a prokaryotic
type II topoisomerase. It regulates supercoiling of DNA and modulates gene expression of
virulence genes (Nitiss 2009). It plays a role in virulence and is widely used as a molecular tool
for the detection of bacteria and for phylogenetic analysis (Foysal et al. 2013). Like gyrB, the
16S rRNA gene, which is conserved in bacteria, is commonly used for the detection of bacteria
(Liu et al. 2015). The two genes were therefore considered as additional targets along with the
uvrC locus for the development of the assay.
LAMP tests have also been developed for the identification of other pathogens involved
in mastitis (Tie et al. 2012). A LAMP assay was developed for the detection of S. agalactiae
DNA from milk samples in a single tube as well as 96-well plate formats, both having high
specificity and sensitivity compared to conventional PCR (Bosward et al. 2016). S. aureus, the
most common bovine mastitis pathogen, was efficiently detected in mastitic milk samples using
LAMP assay by Tie et al. (2012). Among Mycoplasma species, M. bovis is the most common in
causing bovine mastitis. It is often difficult to detect in milk due to its complex and labor-
intensive culturing requirements (Cai et al. 2005).
Experiment No. 2
99
4.6. CONCLUSION
The LAMP method developed here for the detection of M. bovis in mastitic milk samples
proved to be more specific, sensitive and rapid when compared to conventional PCR. The direct
use of mastitic milk for DNA isolation without the need of prior culturing has reduced the
turnaround time of the assay. One highly beneficial feature of the LAMP assay is that it is simple
and can be carried out at farm level without the need of any expensive equipment. With further
developments such as designing a new set of gyrB LAMP primers capable of amplifying the
target DNA at 58 °C and optimization of simple chemical or physical treatments for direct use of
milk as DNA source, the developed assay could also become a routine test for early and specific
detection of M. bovis in field conditions, which is a prime focus of assay development in
veterinary medicine for disease surveillance (Vidic et al. 2017).
4.7. REFERENCES
Ashraf A, Imran M, Yaqub T, Tayyab M, Shehzad W, Thomson PC. 2017. A novel multiplex
PCR assay for simultaneous detection of nine clinically significant bacterial pathogens
associated with bovine mastitis. Mol Cell Probes.(In press)
Bai Z, Shi L, Hu C, Chen X, Qi J, Ba X, Peng Q, Chen Y, Chen H, Guo A. 2011. Development
of a loop-mediated isothermal amplification assay for sensitive and rapid detection of
Mycoplasma bovis. African J Biotechnol. 10: 12333–12338.
Boonyayatra S, Fox LK, Besser TE, Sawant A, Gay JM, Raviv Z. 2012. A PCR assay and PCR-
restriction fragment length polymorphism combination identifying the 3 primary
Mycoplasma species causing mastitis. J Dairy Sci. 95: 196–205.
Boonyayatra S, Fox LK, Gay JM, Sawant A, Besser TE. 2012. Discrimination between
Mycoplasma and Acholeplasma species of bovine origin using digitonin disc diffusion
Experiment No. 2
100
assay, nisin disc diffusion assay, and conventional polymerase chain reaction. J Vet
Diagn Invest. 24: 7–13.
Bosward KL, House JK, Deveridge A, Mathews K, Sheehy PA. 2016. Development of a loop-
mediated isothermal amplification assay for the detection of Streptococcus agalactiae in
bovine milk. J Dairy Sci. 99: 2142–2150.
Cai HY, Bell-Rogers P, Parker L, Prescott JF. 2005. Development of a real-time PCR for
detection of Mycoplasma bovis in bovine milk and lung samples. J Vet Diagn Invest. 17:
537–345.
Centeno-Cuadros A, Abbasi I, Nathan R. 2016. Sex determination in the wild: A field
application of loop-mediated isothermal amplification successfully determines sex across
three raptor species. Mol Ecol Resour. 153–160.
Foddai A, Idini G, Fusco M, Rosa N, De La Fe C, Zinellu S, Corona L, Tola S. 2005. Rapid
differential diagnosis of Mycoplasma agalactiae and Mycoplasma bovis based on a
multiplex-PCR and a PCR-RFLP. Mol Cell Probes. 19: 207–212.
Fowler VL, Howson ELA, Madi M, Mioulet V, Caiusi C, Pauszek SJ, Rodriguez LL, King DP.
2016. Development of a reverse transcription loop-mediated isothermal amplification
assay for the detection of vesicular stomatitis New Jersey virus: Use of rapid molecular
assays to differentiate between vesicular disease viruses. J Virol Methods. 234: 123–131.
Foysal MJ, Rahman MM, Prodhan MSH. 2013. PCR based molecular detection of the gyr-B-2
gene from the Klebsiella Sp. isolates from patients who were suffering with pneumonia
and urinary tract infections (UTIs). J Clin Diagnostic Res. 7: 23–25.
Fu S, Qu G, Guo S, Ma L, Zhang N, Zhang S, Gao S, Shen Z. 2011. Applications of loop-
Experiment No. 2
101
mediated isothermal DNA amplification. Appl Biochem Biotechnol. 163: 845–850.
Fukuta S, Iida T, Mizukami Y, Ishida A, Ueda J, Kanbe M, Ishimoto Y. 2003. Detection of
Japanese yam mosaic virus by RT-LAMP. Arch Virol. 148: 1713–1720.
Gioia G, Werner B, Nydam DVD, Moroni P. 2016. Validation of a mycoplasma molecular
diagnostic test and distribution of mycoplasma species in bovine milk among New York
State dairy farms. J Dairy Sci. 99: 4668–4677.
Higa Y, Uemura R, Yamazaki W, Goto S, Goto Y, Sueyoshi M. 2016. An improved loop-
mediated isothermal amplification assay for the detection of Mycoplasma bovis. J Vet
Med Sci. 78: 1343–1346.
Kimura Y, de Hoon MJL, Aoki S, Ishizu Y, Daub CO, Lezhava A, Arner E, Hayashizaki Y,
Kawai Y, Kogo Y. 2011. Optimization of turn-back primers in isothermal amplification. In:
Bioinformatics and Biomedicine Workshops (BIBMW), 2011 IEEE International
conference on. IEEE, pp 909–911.
Le TH, Nguyen NT, Truong NH, Van De N. 2012. Development of mitochondrial loop-mediated
isothermal amplification for detection of the small liver fluke Opisthorchis viverrini
(Opisthorchiidae; Trematoda; Platyhelminthes). J Clin Microbiol. 1: 50(4):1178-1184.
Liu, A, Wang C, Liang Z, Zhou ZW, Wang L, Ma Q, Wang G, Zhou SF, Wang Z. 2015. High-
throughput sequencing of 16S rDNA amplicons characterizes bacterial composition in
cerebrospinal fluid samples from patients with purulent meningitis. Drug Des Devel
Ther. 9: 4417–4429.
Maunsell FP, Woolums AR, Francoz D, Rosenbusch RF, Step DL, Wilson DJ, Janzen ED. 2011.
Mycoplasma bovis Infections in Cattle. J Vet Intern Med. 25: 772–783.
Experiment No. 2
102
Modi M, Sharma K, Sharma M, Sharma A, Sharma N, Sharma S, Ray P, Varma S. 2016.
Multitargeted loop-mediated isothermal amplification for rapid diagnosis of tuberculous
meningitis. Int. J. Tuberc. Lung Dis. 20: 625–630.
Nagamine K, Hase T, Notomi T. 2002. Accelerated reaction by loop-mediated isothermal
amplification using loop primers. Mol Cell Probes. 16: 223–229.
Nicholas RAJ, Ayling RD. 2003. Mycoplasma bovis: Disease, diagnosis, and control. Res Vet.
Sci. 74: 105–112.
Nitiss JL. 2009. DNA topoisomerase II and its growing repertoire of biological functions. Nat
Rev Cancer. 9(5): 327-337.
Notomi T, Okayama H, Masubuchi H, Yonekawa T, Watanabe K, Amino N, Hase T. 2000.
Loop-mediated isothermal amplification of DNA. Nucleic Acids Res. 28: E63.
Parida MM, Sannarangaiah S, Dash PK, Rao PVL, Morita K. 2008. Loop mediated isothermal
amplification (LAMP): A new generation of innovative gene amplification technique;
perspectives in clinical diagnosis of infectious diseases. Rev Med Virol. 18: 407–421.
Subramaniam S, Bergonier D, Poumarat F, Capaul S, Schlatter Y, Nicolet J, Frey J. 1998.
Species identification of Mycoplasma bovis and Mycoplasma agalactiae based on the uvrC
genes by PCR. Mol Cell Probes. 12:161–169.
Team RC, 2013. R: A language and environment for statistical computing.
Thomas A, Dizier I, Linden A, Mainil J, Frey J, Vilei EM. 2004. Conservation of the uvrC gene
sequence in Mycoplasma bovis and its use in routine PCR diagnosis. Vet J. 168:100–102.
Tie Z, Chunguang W, Xiaoyuan W, Xinghua Z, Xiuhui Z. 2012. Loop-mediated isothermal
amplification for detection of Staphylococcus aureus in dairy cow suffering from
Experiment No. 2
103
mastitis. J Biomed Biotechnol. 435982.
Untergasser A, Cutcutache I, Koressaar T, Ye J, Faircloth BC, Remm M, Rozen SG. 2012.
Primer3—new capabilities and interfaces. Nucleic Acids Res. 40:e115–e115.
Vidic J, Manzano M, Chang C-M, Jaffrezic-Renault N. 2017. Advanced biosensors for detection
of pathogens related to livestock and poultry. Vet Res. 48:11.
Wang D-G, Brewster JD, Paul M, Tomasula PM. 2015. Two methods for increased specificity
and sensitivity in loop-mediated isothermal amplification. Molecules. 20:6048–6059.
Wang J, Zhang Y, Cui Y, Yan Y, Wang X, Wang R, Jian F, Zhang L, Ning C. 2017. A rapid,
simple and sensitive loop-mediated isothermal amplification method to detect Anaplasma
bovis in sheep and goats samples. Parasitol Int 16:30568–305672. doi:
10.1016/j.parint.2017.03.005
104
CHAPTER 5
SUMMARY
The livestock sector plays a critical role in strengthening the economy of Pakistan.
Control of livestock diseases is the primary objective of government livestock departments.
Bovine mastitis is among the most significant diseases of livestock as reported by various field
surveys in Pakistan. Despite considerable knowledge about mastitis and its etiology, this disease
is still prevalent in many dairy herds; it remains most difficult to eradicate or control. It is an
inflammation of mammary gland resulting in decreased milk production, veterinary care costs
and culling losses.
In animal health improvement, there is a paradigm shift from treatment of clinical illness
to disease prevention. Recognition of disease is the foundation of disease control and prevention.
California mastitis test and somatic cell counting are the most commonly used methods for
diagnosis of bovine mastitis. These methods are unable to identify the causative agent. Detection
of pathogen is critically important for better control of mastitis. Microbial culturing and
biochemical tests are traditionally used methods for pathogen identification. But, these methods
are very time consuming and can only detect viable bacteria from the sample and can lead to
false negative results. The progress in molecular methods based on PCR has improved the
veterinary diagnostics.
For the identification of bovine mastitis pathogens, an economical, rapid and sensitive
molecular diagnostic assay was developed using multiplex PCR, detecting the pathogenic
species-specific DNA. The target species are S. aureus, E. coli, S. uberis, S. agalactiae, S.
dysagalactia, S. haemolyticus, S. epidermidis, S. chromogenes and M. bovis. Multiplex PCR
assay was developed for the detection of these significantly important bacterial pathogen
Summary
105
causing bovine mastitis. Species specific primers were designed which have the ability to
specifically amplify the particular gene in the target species. For this purpose various gene
regions were selected for different bacterial species which included 16S rRNA, cpn60, phoA and
rdr. Initially monoplex PCRs were optimized individually for each target species. For optimizing
multiplex PCR assay, various combinations of individual PCRs with varying concentrations of
primers and template DNA were used. The final protocol included all the nine sets of primer
pairs, every set targeting a unique mastitic pathogen. Multiplex PCR assay was checked for its
specificity and analytic sensitivity was calculated. Mastitic milk samples were collected
aseptically from various farms. Initial screening was based on Surf field mastitis test and
California mastitis test. Milk samples were cultured on nutrient agar, blood sheep agar and
MacConkey’s agar. The bacterial isolates were identified and further sub-cultured in nutrient
broth. All the isolates were identified on the basis of 16S rRNA sequencing analysis.
The developed multiplex PCR assay was used to detect the target bacterial pathogens
from the collected milk samples. Limit of detection of developed assay was up to 50 pg for DNA
isolated from pure cultures and 104 CFU/ml for spiked milk samples. The results obtained by 16S
rRNA sequencing, bacterial culture based identification and multiplex PCR assay were
compared. Sensitivity and specificity were calculated using latent class analysis, specificity was
up to 88% and sensitivity was up to 98% for targeted mastitic pathogens. The developed
multiplex PCR detected nine bacterial species in a single reaction. Multiplex PCR assay has also
detected the bacterial pathogens in a few culture-negative mastitis milk samples. This is the first
multiplex PCR assay which can efficiently detect nine important mastitic bacterial pathogens in a
single reaction. The development of multiplex PCR assay is useful in early diagnosis and
prevention & control of bovine mastitis.
Summary
106
Mycoplasma is often ignored as a major mastitis-causing pathogen due to lack of rapid
and accurate diagnostic tools. In this study a LAMP assay was developed for the identification of
M. bovis from clinical mastitic milk samples. LAMP primers were designed from three gene
regions including uvrC, 16S rRNA and gyrB. Bacterial reference strains and mastitic milk
samples positive for M. bovis were collected from Quality Milk Production Services, Cornell
University, Ithaca, NY. Bacterial strains were further cultured on Hayflick medium containing
15% horse serum and incubated for up to 7 d at 37°C with CO2 enrichment. DNA was isolated
from mastitic milk samples and bacterial culture using Qiagen DNeasy Blood and Tissue Kit
(Life Technologies, Carlsbad, CA) according to the manufacturer’s instructions with few
modifications. PCR and LAMP assay was performed for all the samples obtained. Analytic
sensitivity was calculated and the limit of detection was up to 50pg/reaction for LAMP assay
which is higher as compared to PCR.
Sensitivity and specificity was calculated for each of the three tests. Cohen’s kappa
values obtained were 0.940 for uvrC, 0.970 for gyrB and 0.807 for 16S rRNA. All three tests
showed a high level of agreement between test results and the true mastitis status, indicated by
the receiver operating characteristic (ROC) curve. A robust, sensitive and specific LAMP assay
has been developed for the detection of M. bovis from mastitic milk. These novel molecular
assays could be helpful for correct and timely identification of bovine mastitic pathogens, which
is crucial for the control and treatment of the disease. Molecular diagnostic assays have been
developed in the current study based on multiplex PCR assay and loop-mediated isothermal
amplification assay.
