27
Aylwyn Scally, Wellcome Trust Sanger Institute March 2012

Aylwyn Scally, Wellcome Trust Sanger Institute March 2012 · • Position of the start of the variant (POS) • Unique identifiers of the variant (ID) • Reference allele (REF) •

Embed Size (px)

Citation preview

Aylwyn Scally, Wellcome Trust Sanger Institute March 2012

Key tasks in sequence analysis

•  Data handling •  Alignment to a reference sequence •  Alignment file handling •  Variant calling

•  SNPs, genotypes •  structural variation

•  Sequence assembly

Data handling

•  Important to have a data hierarchy corresponding to experimental factors

lane/run

library

sequencing technology

individual

strain/subspecies/population

species hsa

YRI

NA12878

SLX

NA12878-WG

297_1 297_2

454

CEU

NA19240

SLX

NA19240-WG

505_7 505_8

Raw sequence data

•  FASTQ format •  original Sanger standard for capillary data •  derived from FASTA format •  sequence and an associated per base quality

score •  PHRED quality scores encoded as ASCII

printable characters (ASCII 33–126) •  standard offset 33 but older Solexa/Illumina variants

used 64 @title

sequence +optional_text

quality

@SRR010930.8436795/1!ACCCCAGGATCAACACTTCACATGCATTAGCAGAGAGAGATAAATCAA!+!=>=??A?<@B@A:?B?D;AC@@CAAAD<AAA:99?:@=?@B@77C><4!

PHRED quality scores

•  Encodes the probability of an erroneous call •  quality score Q = –10 log10 P •  error probability P = 10–Q/10

•  example: call with Q = 30 has error probability P = 10-3 = 1 in 1000

•  ASCII encoding ! ” # $ % & ’ ( ) * + , - . / 0 1 2 3 4 !0 1 2 3 4 5 6 7 8 9 10 11 12 13 14 15 16 17 18 19!

encoding Q score

DATA PROCESSING

ALIGNMENT

SAM FILE PROCESSING

Alignment pipeline

•  Get data •  Prepare and index reference

•  sequence names; alternate haplotypes etc •  Align data

•  by lane or smaller unit – optimise throughput •  Sort by position •  Merge alignments •  Improve alignments •  Merge libraries •  Index final alignment

Alignment pipeline

BAM BAM BAM Library merge Library

… Alignment

Fastq

BAM

BAM

Fastq

BAM

BAM

Fastq

BAM

BAM

Fastq

BAM

BAM

Fastq

BAM

BAM BAM Improvement

Lane/plex

BAM BAM Sample/Platform Sample merge

bwa •  bwa index [-a bwtsw|div|is] [-c] <in.fasta>

•  Burroughs-Wheeler transform construction algorithm •  ‘bwtsw’ for vertebrate sized genomes, ‘is’ for smaller genomes

•  bwa aln [options] <prefix> <in.fq> •  align each single-ended fastq file individually •  <prefix> is name of reference file •  options control alignment parameters, scoring matrix, seed length

•  bwa sampe [options] <prefix> <in1.sai> <in2.sai> <in1.fq> <in2.fq> •  generates pairwise alignment from sai files produced by bwa aln •  produces SAM output

•  bwa bwasw [options] <prefix> <query.fa> •  alignment of long reads in query.fa •  produces SAM output

bwa usage notes

•  bwa finds matches up to a finite edit distance •  by default for 100-bp reads allows 5 edits

•  Important to quality-clip reads •  -q in bwa aln, e.g. set to 20

•  Non-ACGT bases on reads are treated as mismatches

•  Parallelise for speed •  split data into 1 Gbp blocks •  bwa takes ~8 hrs per block

•  Check for truncated BAM files •  e.g. with samtools flagstats

Alignment improvement

•  Library duplicate removal •  samtools, Picard

•  Realignment around indels •  GATK

•  Base quality recalibration •  GATK

Library duplicate removal •  PCR amplification step in library preparation can result

in duplicate DNA fragments •  PCR-free protocols exist but require larger volumes of

input DNA •  Generally a low number of duplicates in good libraries;

increases with depth of sequencing •  Duplicates can result in false SNP calls

•  manifest as high read depth support •  Removal method

•  Identify read-pairs where outer ends map to the same position on the genome and remove all but one copy

•  samtools rmdup •  Picard/GATK MarkDuplicates

Realignment •  Short indels in the sample relative to reference pose

difficulties for alignment •  Indels occurring near the ends of reads often not aligned

correctly •  Aligners prefer to introduce SNPs rather than an indel

•  Realignment algorithm •  Input set of known indel sites and a BAM file

•  Previously published indel sites, dbSNP, 1000 Genomes, or estimate from alignment

•  At each site, model the indel and reference haplotypes and select best fit with data

•  New BAM file produced, modified where indels have been introduced by realignment

•  Implemented in GATK (IndelRealigner function)

Additional alignment issues

•  Separate chromosomal BAMs •  easier to process in parallel

•  Realign/assemble unmapped reads •  recover sequence missed due to reference

incompatibility or incompleteness

SAM/BAM

•  Sequence Alignment/Map format •  unified format for storing read alignments to a

reference genome •  BAM (Binary Alignment/Map) format

•  binary equivalent of SAM •  Features

•  stores alignments from most alignment programs •  supports multiple sequencing technologies •  supports indexing for quick retrieval •  reads can be classed into logical groups

•  e.g. lanes, libraries, individuals

SAM file format •  Header •  Alignment lines (one per read)

•  11 mandatory fields •  several optional fields (format TAG:TYPE:VALUE)

Col Field Type Description 1 QNAME str query name of the read or the read pair 2 FLAG int bitwise flag (pairing, mapped, mate mapped, etc.) 3 RNAME str reference sequence name 4 POS int 1-based leftmost position of clipped alignment 5 MAPQ int mapping quality (Phred scaled) 6 CIGAR str extended CIGAR string (details of alignment) 7 RNEXT str mate reference name (‘=’ if same as RNAME) 8 PNEXT int position of mate/next segment 9 TLEN int observed template length 10 SEQ str segment sequence 11 QUAL str ASCII of Phred-scaled base quality

SAM format

•  Example

•  http://picard.sourceforge.net/explain-flags.html

IL4_315:7:105:408:43!177!X!1741!0!1S35M!X!56845228!0!ATTTGGCTCTCTGCTTGTTTATTATTGGTGTATNGG!+1,1+16;>;166>;>;;>>;>>>>>>,>>>>>+>>!

QNAME FLAG

RNAME POS

MAPQ CIGAR RNEXT PNEXT

TLEN SEQ

QUAL

SAM/BAM file processing tools •  samtools

•  C program and library •  http://samtools.sourceforge.net

•  view: SAM-BAM conversion •  sort, index, merge multiple BAM files •  flagstat: summary counts of mapping flags

•  Picard •  Java program suite

http://picard.sourceforge.net •  MarkDuplicates, CollectAlignmentSummaryMetrics,

CreateSequenceDictionary, SamToFastq, MeanQualityByCycle •  Pysam

•  Python interface to samtools API •  http://code.google.com/p/pysam/

Variant calling •  Call SNPs with genotypes (heterozygous and

homozygous), indels and structural variants •  Tools

•  samtools, bcftools •  GATK, SOAPsnp, Dindel •  SVMerge

•  File formats: •  VCF, pileup

•  Filters and calling protocols •  depth, quality, strand bias, multiple samples

•  Indels harder to call accurately than SNPs •  structural variation harder still

Variant Call Format (VCF)

•  Stores polymorphism data with annotation •  SNPs, insertions, deletions and structural variants

•  Can be indexed for fast data retrieval •  Variant calls across many samples •  Metadata

•  e.g. dbSNP accession, filter status, validation status •  Arbitrary tags can be used to describe new types

of variant •  Note: binary BCF produced by samtools

•  get vcf with samtools mpileup | bcftools view

VCF Format •  Header

•  Arbitrary number of INFO definition lines starting with ‘##’ •  Column definition line starts with single ‘#’

•  Mandatory columns •  Chromosome (CHROM) •  Position of the start of the variant (POS) •  Unique identifiers of the variant (ID) •  Reference allele (REF) •  Comma separated list of alternate non-reference alleles

(ALT) •  Phred-scaled quality score (QUAL) •  Site filtering information (FILTER) •  User extensible annotation (INFO)

VCF format

•  Example 3!74393!.!G!T!999!. DP=31;AF1=0.7002;AC1=4;DP4=4,0,22,2;… GT:PL:DP:GQ!1/1:181,57,0:19:57!1/1:90,15,0:5:16!0/0:0,12,85:4:7!

CHROM POS

ID REF ALT

QUAL FILTER

INFO FORMAT sample1 sample2 sample3

see H. Li, Bioinformatics 27(21): 2987–2993 (2011) for details of likelihood and population genetic calculations

More information •  SNP calling and genotyping

•  Samtools •  http://bioinformatics.oxfordjournals.org/content/25/16/2078.long •  http://samtools.sourceforge.net

•  GATK •  http://www.broadinstitute.org/gsa/wiki/index.php/

The_Genome_Analysis_Toolkit •  VCF

•  VCFtools •  http://vcftools.sourceforge.net •  Danacek et al. Bioinformatics 27(15): 2156-2158 (2011)

•  http://www.1000genomes.org/wiki/Analysis/Variant%20Call%20Format/vcf-variant-call-format-version-41

Structural variation

Structural variation •  Read depth and pairing information used to detect events

•  deviations from the expected fragment size •  presence/absence of mate pairs •  excessive/reduced read depth (CNV)

•  Several methods/tools released •  SVMerge pipeline

•  makes SV predictions using a collection of callers •  Input is one BAM file per sample •  callers run individually & outputs converted into standard BED

format •  calls merged •  computationally validated using local de novo assembly •  http://svmerge.sourceforge.net/

Assembly

•  Tools •  Abyss

•  http://www.bcgsc.ca/platform/bioinfo/software/abyss •  SGA

•  https://github.com/jts/sga •  SOAPdenovo

•  http://soap.genomics.org.cn/soapdenovo.html •  ALLPATHS-LG

•  http://www.broadinstitute.org/software/allpaths-lg/blog •  Cortex

•  http://cortexassembler.sourceforge.net/ •  Velvet

•  http://www.ebi.ac.uk/~zerbino/velvet/

Assembly metrics

•  N50, N10, N90 etc •  x % of assembly is in fragments larger than

Nx •  Number of contigs, mean/max contig

length •  Realignment

•  fraction of read pairs mapped correctly •  correct homozygous SNPs •  identify breakpoints

Thanks to Thomas Keane and the Vertebrate Resequencing team at WTSI for several slides