1

o3

M

*m

†

S

Fm(((ib

Auton

Authors

Departmentof Medicine,3National InsMaryland 20

*Correspondmark.dellacq

†these autho

SUPPLEM

Figure S1. Cameasured by f(A) The CaMK(B) CaMKIIα(C) Comparisn ANOVA w

before and aft

nomous C

: Steven J. CKather

t of Pharmac, Aurora, Costitute of Ne0892, USA.

dence to: K.Uqua@ucdenv

rs contribute

MENTAL F

aMKII inhibfEPSP amplitKII inhibitor isoform knocon of the mea

with Newman ter LFS). Qua

CaMKII mdiffe

Coultrap1†, Rrine W. Roch

cology, and 2

olorado 8004urological D

U.B., email: ver.edu .

ed equally.

FIGURES:

bition and kntude, Related tatCN21 (5 µck-out blocksan LTD at 50Keuls postho

antifications in

mediates boerential su

Ronald K. Fhe3, Mark L

2Department45, USA; Disorders and

ulli.bayer@

nockout abolito Figure 1, w

µM) blocks LFs LFS-induced-60 min after

oc analysis (orn all panels sh

oth LTP anubstrate sit

Freund1†, He. Dell’Acqua

t of Pediatric

d Stroke, Na

@ucdenver.ed

ishes low-frewhich showsFS-induced Ld LTD. LFS under v

r, for inductiohow mean±SE

nd LTD ute selectio

eather O’Leaa1*, and K. U

cs University

ational Institu

du; or M.L.D

equency stimthe correspon

LTD.

various conditon of LTD, inEM.

using a men

ary1,2, JennifUlrich Bayer

y of Colorad

utes of Heal

D., email:

mulation (LFSnding fEPSP

tions. *: p<0.0n paired t-tests

echanism f

fer L. Sanderr1*

do Denver –

lth, Bethesda

S)-induced Lslopes.

05; ns: not sigs comparing f

for

rson1,

School

a,

LTD, as

gnificant, fEPSP

F(f(li((hb1(h(a(peP(k

Figure S2. Th(A) Schematiflanked by 2.5(B) The wildocations of endicated prim

(C) Example o(D) Insertion here) and in tbrain areas. Sh1D, which use(E) The CaMhippocampal e(F) CaMKII isas assessed by(1,000 g supepellet from aenriched tritonPSD marker P(G) Direct coknockout mic

he CaMKIIαic of the gen5 and 3.3 kb od type and trexons E9-E1

mer combinatiof diagnostic of the neo-ca

the hippocamhown is a Weed α- and β-sp

MKIIα knockextracts usingsoforms and Py Western anaernatant); S3a 10,000 g sn-insoluble fr

PSD95. omparison ofe shows high

α knockout mne targeting vof CaMKIIα gransgenic Ca1, of the loxions). PCR results f

assette targetimpus (see Figuestern analysipecific antibo

k-out do not g an antibody PSD95 in difalysis. The am: cytosolic frsynaptosomalraction of the

f CaMKII iser levels of C

mouse has incvector for Cagene sequenceaMKIIα gene P/neo cassett

for wild type,ing vector bloure 1D). Thisis using an an

odies) and quaexpress a tragainst the N

fferent fractionmount of loadraction (100,0 supernatant)

e synaptosom

oforms in thCaMKIIβ isofo

creased CaMaMKIIα isofoes, including

locus near te transgene,

, heterozygouocked expresss also enhancntibody recogantification (nruncated kinaN-terminal kinns from neoc

ded protein is 000 g supern); TS: Tritonoes. CaMKII

he PSD-enricform in the kn

MKIIβ expresorm knock-ouexons E9, E1the transgenand of the d

us, and homozsion of CaMKced expressiognizing all Can=4-6). Meanase domain, nase domain tcortex of CaM indicated fornatant); P3: mn-soluble fraIα knockout d

ched fraction nockout mice.

ssion, Relatedut, with a 1.910, and E11. e integrationdiagnostic PC

zygous transgKIIα, both in

on of the CaMaMKII isformn±SEM is sho

as shown bythat detects b

MKIIα wild tyr each fractiomicrosomomaction of syndid not affect

from wild t.

d to Figure 1.9 kb loxP/ne

n site. MarkeCR products

genic mice. n the neocorteMKIIβ isoform

ms (in contrastown. y Western-anoth CaMKIIα

ype and knockn. S1: startingal fraction (1

naptosomes; Tt the distribut

type versus

eo-cassette

ed are the (with the

ex (shown m in both t to Figure

nalysis of α and β. kout mice, g material 100,000 g TP: PSD-tion of the

CaMKIIα

F(mbiWa(safdsm

FGa(sd(hcW

Figure S3. Co(A) Expressiomice was deteboth isoformsn wild type m

While α isoforaltered (n.s.: p(B) CaMKIIαstimulus inputany, T286A slflatter output differences westudies that dimutant mice (

Figure S4. CGluA1 phospand 3. (A) Chemicalslice tested. Sdeviation (in c(B) As previohere, maximacould be influWestern analy

omparison oon of the CaMermined by W; left panel) a

mice (right panrm expressionp>0.2). wild type ant to fEPSP siglices appearedcurves (the laere significanid not find inp(Giese et al., 1

hemical LTDphorylation a

l LTD stimulihown is the mcontrast to the

ously describeal de-phosphouenced by theysis (lower pa

f CaMKIIα wMKIIα and β isWestern-analysand quantifiednels). Expresn appeared sl

d mutant hippgnal output, cd to have sligatter consistennt (ANOVA; pput/output dif1998; Silva et

D stimuli in at the PKA s

i (chem. LTDmean depressie SEM showned, chemical Lorylation was exact timing

anel) and quan

wild type andsoforms in thesis (using thed by immuno-sion of the β ightly reduce

pocampal slicconsistent withghtly steeper ont with anothep=0.6025, F=fferences betwt al., 1992). Q

hippocampaite S845, as p

D; 30 µM NMion at 30 to 6n in all other pLTD stimuli s not yet obse

g of the “0 mintified (upper

d T286A mue hippocampu antibody aga-detection valisoform was ud (*: p=0.025

ces show no sh previous stuoutput curveser previous re=0.5221). Theween wild typQuantification

al slices prodpreviously de

MDA for 3 mi60 min after stpanels). significantly rerved immedn” time pointr panel). Mean

utant mice, Rus of CaMKIainst the N-terlues (IDVs) nunaltered in t5), the ratio o

significant difudies (Giese e, while knock

eport; Hinds eese results arepe mice and Cns in all panel

duces robust escribed (Lee

in) produced timulation. H

reduces GluAdiately after tht). GluA1 S84

an±SEM is sh

Related to FiguIα wild type vrminal kinase

normalized to the T286A mif the isoform

fference in theet al., 1998; Skout slices appet al., 1998). He confirmatoryCaMKIIα knols show mean

synaptic depe et al., 1998

robust synapHere, error bar

A1 S845 phoshe LTD-stim45 phosphoryown.

ure 2. versus T286Ae domain thatCaMKIIα ex

ice (n.s.: p>0s was not sign

e relationshipSilva et al., 19peared to havHowever, nony of two prevckout or T28

n±SEM.

pression and8), Related to

tic depressionrs indicate the

sphorylation. mulus (a differylation was de

A mutant t detects xpression 0.2). nificantly

p of 992). If ve slightly ne of the vious 6A

d reduced Figures 2

n in every e standard

However, rence that etected by

SUPPLEMENTAL EXPERIMENTAL PROCEDURES

Statistical analysis. Statistical analysis was done by ANOVA with Newman-Keuls posthoc analysis for multiple comparisons, by t-test for individual comparison, or –for significance of LTD- by paired t-test compared

to baseline before LFS. Quantifications are shown as mean±SEM unless noted otherwise.

Generation and maintenance of CaMKIIα mutant mice. For the CaMKIIα knockout mice, the gene targeting vector (based on the C57BL/6 mouse gene sequence) containing a loxP-flanked neomycin resistance cassette between exons E9 and E10 (Figure S2A,B) was constructed in the Rocky Mountain Neurological Disorders Gene Targeting Core. Using C57BL/6-129 hybrid embryonic stem cells, chimeric founders were generated, tested for germ-line transmission, and back-crossed with C57BL/6 mice as described (Sanderson et al., 2012). PCR-based genotyping was done with 2.5 µM forward primer fCKi9 (TGGGGAGAGCCAGTGGCCTA) and reverse primers rCKi9 (TGGGCCTGTCCCTTGCCTC; for wild type allele) or rCass (CCCCGTGCCTTCCTTGACCC; for transgenic allele; Figure S2B,C) for 35 cylces (30 sec at 94, 58 and 72oC; preceded by 4 min at 94oC and followed by 4 min at 72oC) using 8 µl PCR mix (Sigma) and 2 µl genomic DNA from tail snips prepared using REDExtract-N-Amp tissue PCR kit (Sigma). CaMKIIα T286A mice (Giese et al., 1998) that were back-crossed to C57BL/6 were kindly provided by Dr. Ryohei Yasuda (Max Planck Florida), with permission from Dr. Alcino Silva (UCLA) and Dr. Karl-Peter Giese (University College London) and were genotyped using the described PCR primers (Giese et al., 1998). Like the CaMKIIα knockout mice, the T286A mice were further back-crossed with C57BL/6 mice in house, and mice from the in house C57BL/6 line were used as control in our experiments.

Electrophysiology: field recordings in slices. Slice electrophysiology was performed essentially as described (Sanderson et al., 2012). After sacrifice, brains were rapidly removed and immersed in ice-cold, sucrose containing cutting buffer (in mM: 87 NaCl, 2.5 KCl, 7 MgCl2, 0.5 CaCl2, 1.25 NaH2PO4, 25 D-glucose, 35 sucrose, and 25 NaHCO3) for 40-60 s. Transverse slices (400 μm) were made using a Tissue Chopper (McIlwain) and stored in individual chambers for recovery (at least 60 min). Recording was done under superfusion with artificial cerebrospinal fluid (aCSF; in mM: 126 NaCl, 3.0 KCl, 1.5 MgCl2, 2.4 CaCl2, 1.2 NaH2PO4, 11 D-glucose, and 25.9 NaHCO3) at a bulk flow rate of 2-3 ml/min at 31°C. All solutions were saturated with 95% O2 / 5% CO2. Before each experimental run, an input-output curve was generated by increasing the stimulus voltage and recording the synaptic response until either a maximum was reached, or evidence of a population spike was observed on the fEPSP response. Also, paired-pulse tests were run with a pulse interval of 50 ms. Synaptic field excitatory postsynaptic potential (fEPSP) responses were evoked with bipolar tungsten electrodes placed in the CA3 to CA1 dendritic field layer. Test stimuli were delivered every 20 seconds with the stimulus intensity set to 50-60% of the maximum synaptic response. After a 20-30 min control period, LFS was applied for 15 min at 1 Hz (900 pulses) at test stimulation

intensity. Slopes and amplitudes of fEPSP responses were recorded for 60 min following LFS, and their average over 2 min (6 responses) was plotted.

Preparation and stimulation of slices for biochemical analysis. Hippocampal slices for biochemistry were prepared and treated as previously described (Sanderson et al., 2012). Preparation from 21-24 day old mice was done similarly as described for the electrophysiology. However, a Vibratome was used for cutting, and the CA3 region was removed. For LTD stimuli, slices were exposed to 20 µM NMDA for 3 min at 31oC, washed with aCSF, and recovered for different times as indicated. Three to four slices were collected for each time point and sonicated in 100 mM Tris pH8, 10 mM EDTA, 1% SDS. These homogenates were heated to 95oC for 5 min, then stored at -70oC. Protein concentration was determined by BCA assay (Pierce), and equal protein amounts (typically 10 µg) were loaded for Western-analysis.

Western-analysis of protein expression and phosphorylation. Western-analysis was performed as essentially as described previously (Buard et al., 2010; Coultrap et al., 2012; Coultrap and Bayer, 2012; Vest et al., 2007), after SDS-PAGE on 10% Criterion gels (BioRad) and electro-transfer (Idea Scientific) onto activated PVDF membrane (Perkin Elmer). Blots were blocked by incubation in 5% BSA or non-fat dry milk for 1 hour at room temperature, followed by overnight incubation at 4°C in primary antibody. Antibodies against GluA1 phospho-S567 (1:2000, generated as described; Lu et al., 2010), GluA1 phospho-S845 (1:1000, Phosphosolutions) and total GluA1 (1:3000, Millipore) were diluted in 1% BSA. Antibodies against GluA1 phospho-S831 (1:1000, Phosphosolutions), CaMKII phospho-T286 (1:3000, Phosphosolutions), CaMKIIα and β (1:2000, BD Pharmingen), the N-terminal kinase domain of CaMKIIα and β (1:5000, GeneTex), CaMKIIα (1:2000, CBα2 produced in house), and CaMKIIβ (1:2000, CBβ1 produced in house) were diluted in 1% non-fat dry milk. Following incubation with HRP-conjugated secondary antibody (in 1% BSA or non-fat dry milk), blots were incubated in Western lightning plus (Perkin Elmer) or Supersignal west femto (Pierce) ECL reagent, and then imaged in an Chemimager (Alpha Innotech). The signals from Western-analysis were quantified as Immuno-detection values (IDVs), as described (Buard et al., 2010; Coultrap et al., 2012; Vest et al., 2007).

Protein purification. CaMKIIα and CaM were purified from baculovirus/Sf9-cell and bacterial expression systems, respectively, as previously described (Coultrap et al., 2012; Coultrap and Bayer, 2012; Coultrap et al., 2010). GST-fusion proteins with cytoplasmic glutamate receptor regions (GluA1 loop1, GluA1 C-tail, GluN2B-C) were purified after bacterial expression. Briefly, cDNA was expressed in Oneshot BL21 star bacteria cells (Invitrogen) and grown until OD600=~0.6. Then, expression was induced by addition of 1 mM IPTG for 3 hours. Cells were pelleted at 2500 x g, resuspended in 20 mM Tris pH 7.55, 150 mM NaCl, 1 mM EDTA, 0.1% Tween-20, 1 mg/ml lysozyme, 10 µg/ml RNase A, 20 µg/ml DNase I, with protease inhibitors (Roche Complete). After several freeze thaw cycles and sonication a 10,000 x g supernatant containing the GST-fusion protein was collected and frozen at -80°C. Proteins were batch purified with Glutathione sepharose 4B (GE Healthcare), washed three times with TBS and eluted with

100 mM reduced glutathione in 200 mM Tris pH 9.0. The glutathione was removed by dialysis against 2 liters of 50 mM Tris pH 7.6, 300 mM NaCl twice for 2 hours.

In vitro phosphorylation assays. Similar as previously described (Buard et al., 2010; Coultrap et al., 2012; Coultrap and Bayer, 2012; Coultrap et al., 2010), purified CaMKII (250 nM kinase subunits) was auto-phosphorylated at T286 for 10 min on ice in 50 mM PIPES pH 7.1, 10 mM MgCl2, 100 µM ATP, 1 mM CaCl2, 1 µM CaM, and 0.1% BSA. Then, CaMKII (10 nM kinase subunits)-mediated substrate phosphorylation was performed in 50 mM PIPES pH 7.1, 10 mM MgCl2, 100 µM ATP, 0.1% BSA at 30oC, either in presence of 1.5 mM Ca2+ and 10 µM CaM (or as indicated) or in presence of 0.1 µM CaM and 2 mM EGTA (and 0.1 mM Ca2+, resulting in less than 20 nM free Ca2+). Substrate was either purified GST-GluA1-loop1 (containing loop1 and S567; 2 µM) or GST-GluA1-Ctail (containing the C-terminus with S831; 2 µM).

Protein-protein binding assays. Ca2+/CaM-stimulated binding of CaMKIIα (50 nM) to GST-GluN2B immobilized on anti-GST-coated microtiter-plate wells (Pierce) was done essentially as described previously (Bayer et al., 2001; Vest et al., 2007), but in presence of 1 mM ADP. Bound CaMKII was eluted for 10 min at 95oC in SDS-buffer and detected by Western-analysis. Competition of various peptides with the binding was tested by adding the indicated amounts prior to addition of CaMKII to wells.

SUPPLEMENTAL REFERENCES Coultrap, S.J., and Bayer, K.U. (2012). Ca2+/Calmodulin-Dependent Protein Kinase II (CaMKII). In Neuromethods: Protein Kinase Technologies, H. Mukai, ed. (Springer), pp. 49-72.