Journal of Clinical Neuroscience 19 (2012) 1011–1015

Contents lists available at SciVerse ScienceDirect

Journal of Clinical Neuroscience

journal homepage: www.elsevier .com/ locate/ jocn

Laboratory Study

Association of Parkinson’s disease with six single nucleotide polymorphismslocated in four PARK genes in the northern Han Chinese population

Yishu Zhou a, Xiaoguang Luo b, Fengrui Li a,c, Xiaofei Tian a, Lanhui Zhu a, Yichun Yang d, Yan Ren b,Hao Pang a,⇑a Department of Forensic Serology, China Medical University, 92 Beier Road, Heping District, Shenyang 110001, Chinab Department of Neurology, First Affiliated Hospital of China Medical University, Shenyang, Chinac Department of Forensic Medicine, Baotou Medical College, Baotou, Chinad Department of Neurosurgery, Affiliated Xinhua Hospital of Dalian University, Dalian, China

a r t i c l e i n f o

Article history:Received 5 July 2011Accepted 30 September 2011

Keywords:Parkinson’s diseasePARK genesPolymorphismPCR–RFLPMismatched multiplex amplification

0967-5868/$ - see front matter � 2011 Elsevier Ltd. Ahttp://dx.doi.org/10.1016/j.jocn.2011.09.028

⇑ Corresponding author. Tel.: +86 24 23256666; faxE-mail address: panghao8@gmail.com (H. Pang).

a b s t r a c t

Parkinson’s disease (PD) has widely been reported to be associated with mutations in the PARK genes. Toinvestigate potential genetic risk factors for PD in a northern Han Chinese population, six single nucleo-tide polymorphisms (SNP) (R366W, V380L, P196S, R1628P, G2385R and R461W) located in four PARKgenes were multiplex-amplified in two independent polymerase chain reaction (PCR) systems. Restric-tion fragment length polymorphisms (RFLP) were subsequently genotyped with Hae III endonucleasedigestion in samples from 202 patients with PD and 212 control participants. High-throughput, multi-plexed PCR–RFLP assays were able to accurately identify all six SNP. The genotypic frequency ofG2385R in PARK8 was significantly different between the patient and control groups; however, theremaining SNP were not associated with PD. No heterogeneity was observed in the R461W site, and onlyone P196S site was found in the patient group. The polymorphic sites R366W and V380L and R1628P andG2385R were not in linkage disequilibrium. Carriers of 2385R presented at a higher Hoehn–Yahr stagecompared to non-carriers. This study demonstrated an association of the G2385R allele with risk forPD in a northern Han Chinese population.

� 2011 Elsevier Ltd. All rights reserved.

1. Introduction The ethnic and regional backgrounds of the patients affected the

Susceptibility genes for Parkinson’s disease (PD) include thePARKIN gene (PARK2), which encodes an E3 ubiquitin-protein ligaseprotein,1 the PTEN Induced Kinase 1 gene (PINK1/PARK6), and agene that encodes a possible mitochondrial serine/threonine ki-nase.2 Additional susceptibility genes include the Leucine-Rich Re-peat Kinase 2 gene (LRRK2/PARK8), which encodes a 280 kDaprotein with serine/threonine kinase and GTPase functions,3 andPhospholipase A2 group VI (PLA2G6/PARK14), which is a cytosolicand calcium-independent phospholipase.4 Multiple base substitu-tions have been identified in the four susceptibility genes, andthe majority of the mutations are located within important func-tional motifs. Numerous investigations have shown that the muta-tions located on PARKIN and PINK1 are associated with early onsetPD, and the mutations located on LRRK2 are related to familialautosomal dominant PD and sporadic PD.5 Although the mutationslocated on PLA2G6 have been identified in patients with PD, theyare not pathogenic mutations.4

ll rights reserved.

: +86 24 23267698.

mutation rate of the loci mentioned above.6–9 Association of PDwith a single mutation in different genes has been analysed inmany regions, including certain Asian populations, and the resultshave consistently indicated significant associations. However,there has been no data on the prevalence of the aforementionedsingle nucleotide polymorphisms (SNP) in the PD susceptibilitygenes in the northern Han Chinese population. Additionally, meth-ods using multiple SNP detection in the PD-related loci are limited.We conducted a multiplexed polymerase chain reaction–restric-tion fragment length polymorphism (PCR–RFLP) assay with HaeIII endonuclease digestion to simultaneously identify six SNP andto study their possible associations with PD in a northern HanChinese population.

2. Materials and methods

2.1. Patient characteristics

A total of 202 ethnic Han Chinese patients from northern Chinawere included in the study. Patients were diagnosed with idio-pathic PD by movement disorder neurologists at the First Affiliated

1012 Y. Zhou et al. / Journal of Clinical Neuroscience 19 (2012) 1011–1015

Hospital of China Medical University in the Liaoning province,China. All patients met the criteria for a clinical diagnosis of PD,presenting at least two of the three cardinal signs for PD (tremor,rigidity, and bradykinesia), and had a positive response to levodopatherapy. Unrelated control participants, matched for ethnicity, age,and gender, were recruited from the local community. Control par-ticipants were healthy and had not been diagnosed with neurode-generative diseases. There was no statistical difference in age orgender between the two groups (p > 0.05). Clinical characteristicsof the study population are shown in Table 1. Approval wasobtained from the appropriate local ethics committee prior torecruitment, and informed consent was obtained from all studyparticipants.

Peripheral blood samples were collected from participants, andDNA was extracted from leukocytes using the sodium dodecyl sul-fate–proteinase K phenol–chloroform method.

2.2. Mismatched primers design

We synthetically generated a Hae III restriction endonucleasesite in each amplified product using mismatched PCR primersbased on the published sequences adjacent to and including SNPrs33949390 (R1628P, 4883 G>C) and rs34778348 (G2385R, 7153G>A) of PARK8 (LRRK2), rs56092260 (R366W, 1096 C>T) andrs1801582 (V380L, 1138 G>C) of PARK2 (PARKIN), rs35802484(P196S, 586 C>T) of PARK6 (PINK1), and rs76718524 (R461W,1381C>T) of PARK14 (PLA2G6).10 The primer sets used for SNPdetection are shown in Table 2. Several bases were mismatchedin either the forward (50) or the reverse (30) primers to producesynthetic recognition sites for the Hae III restriction enzyme.

2.3. PCR–RFLP assay

PCR–RFLP was used to identify the polymorphisms of the SNP inDNA samples. PCR was conducted in a final volume of 20 lL PCRbuffer containing 1 � Es Taq Master Mix (CWBIO, Beijing, China),50–100 ng genomic DNA, and the indicated primer sets at theconcentrations listed in Table 2. Two triplex PCRs were performed

Table 1Clinical characteristics of patients with Parkinson’s disease and normal controls in a north

Group n No. males(%)

AAE, mean ± SD(years)

AAE, range(years)

AAO, mean ± SD(years)

Control 212 125 (59) 62.87 ± 10.44 34–86 NAPatient 202 106 (52.5) 62.68 ± 10.69 24–84 57.27 ± 11.09

AAE = age at enrollment, AAO = age at onset, NA = not applicable, PD = Parkinson’s disea

Table 2Characteristics of six single nucleotide polymorphisms in four PARK genes and the parameteParkinson’s disease in a northern Han Chinese population

SNP Nucleotidechanges

Aminochanges

Primersets

Primerdirection

Sequence 5

rs56092260 1096 C>T R366W Set 1 Forward GTGTTCTTTReverse CTCCAGTC

rs1801582 1138 G>C V380L Set 2 Forward AAAGAAGCReverse CTCCAGTC

rs35802484 586 C>T P196S Set 3 Forward GCCTGACCReverse TGCCCTTCT

rs33949390 4883 G>C R1628P Set 4 Forward CAAAACACReverse CTAGGAGC

rs34778348 7153 G>A G2385R Set 5 Forward GAACTAATReverse CCTTAAAA

rs76718524 1381C>T R461W Set 6 Forward GATCTCATReverse GCCTGCAC

bp = base pairs, SNP = Single nucleotide polymorphism.� Small letters show the mismatched bases used to artificially introduce endonuclease

under the following cycle conditions: denaturation at 94 �C for onemin; 35 cycles of denaturation at 94�C for 30 s, annealing at 62 �C(primer sets one, four, and six) or 60 �C (primer sets two, three andfive) for 30 s, and elongation at 72 �C for 30 s each; and a final elon-gation step of one min at 72 �C. For restriction enzyme digestion,1 lL PCR product and 2.5 U Hae III (TaKaRa, Dalian, China) weremixed in 10 lL TaKaRa M buffer. Two PCR products were incubatedat 37 �C for more than two hours and the digestion products wereseparated by polyacrylamide gel electrophoresis (T = 6%, C = 5%).The gels were dyed with 10� Genefinder (Bio-V, Xiamen, China),and PCR products were visualised under ultraviolet light. To con-firm the formation of synthetically mismatched sequences, directDNA sequencing of each PCR product fragment was performedusing the BigDye Terminator Cycle Sequencing Kit (Applied Biosys-tems, Foster City, CA, USA) with the matching primers.

2.4. Statistical analysis

Results were analysed using the Statistical Package for the SocialSciences version 13.0 (SPSS version 13.0) and PLINK-1.07 versionfor Windows (http://pngu.mgh.harvard.edu/purcell/plink/).11 Atwo-tailed p-value 60.05 was considered significant.

3. Results

3.1. Genotyping of six SNP

Following DNA sequencing confirmation, we performed mis-matched multiplex PCR amplification and subsequent RFLP analy-sis. The results showed that the mismatched sequences containingthe Hae III recognition site were specifically amplified at all loci.The sizes of the amplified PCR products were 270 base pairs (bp)(R461W), 152 bp (R366W), and 105 bp (R1628P) for PCR groupone (lane 1) and 237 bp (G2385R), 198 bp (P196S) and 122 bp(V380L) for PCR group two (lane 8) (Fig. 1). PCR products were di-gested using Hae III and separated by electrophoresis. The undi-gested fragments that remained represented the 461W, 366W,

ern Han Chinese population

AAO, range(years)

Hoehn–Yahr stage,mean ± SD

Disease duration, mean ± SD(years)

NA NA NA27–83 1.77 ± 0.74 3.88 ± 3.26

se, SD = standard deviation.

rs for mismatched multiplex polymerase chain reaction amplification in patients with

0 ? 30 Fragment size(no. bp)

Primerconcentration (lM)

TGCAGTTTGCCTTCgGC� 152 (132, 20) 0.25CCCCACTGTATCCGGAG 0.25GTACCATGAAGGGGAGaGCAGTGgC� 122 (90, 32) 0.2

CCCCACTGTATCCGGAG 0.2CGTTGGACACGAGA 198 (167, 31) 0.2CCTGGTGCACTGGTACCT 0.2

CCTAAGGGCATTATTTgGC� 105 (79, 26) 0.3TTAAAATACTGTGACATGTAGTTCT 0.3ATAAGGTTGTATTACACGTAGAAATT 237 (209, 28) 0.4AGTGCACGCAGTCTATTAGgC� 0.4GCACATCTCACGGGgC� 270 (250, 20) 0.3CGCCCAGCATTAA 0.3

sites (set 1, 2, 4, 5 and 6) and improve primer binding (set 2).

Fig. 1. The electrophoretic pattern of the mismatched multiplex polymerase chain reaction (PCR)–restriction fragment length polymorphism in the six single nucleotidepolymorphisms (SNP) of the PARK gene in a polyacrylamide gel stained by Genefinder (Bio-V, Xiamen, China). The lane marked M shows a DNA ladder ranging from 100 to300 base pairs as a molecular size marker. Lanes one and eight are PCR products. Lanes two to six show results from six participants in this study, demonstrating all genotypesfor each SNP we identified. Genotypes are listed below the corresponding lanes. bp = base pairs.

Y. Zhou et al. / Journal of Clinical Neuroscience 19 (2012) 1011–1015 1013

R1628, 2385R, 196S and V380 alleles, while the fragments of250 bp, 132 bp, 79 bp, 209 bp, 167 bp and 90 bp represented theR461, R366, 1628P, G2385, P196 and 380L alleles, respectively.Fragments smaller than 32 bp migrated out of the gel under theelectrophoresis conditions. This novel mismatched multiplexPCR–RFLP assay demonstrated that the genotypes of the six SNPcan be successfully identified.

3.2. Genetic parameters and association analysis

Genotypic frequencies of the six SNP located in four genes wereinvestigated using 202 patients and 212 control participants. Therelated genetic parameters of each SNP site are shown in Table 3.Results from linkage disequilibrium analysis conducted for fourSNP located on the same gene showed that neither R366W andV380L, nor R1628P and G2385R, were in linkage disequilibrium(both r2 < 0.5, data not shown), even though R366W and V380Lare located less than 50 bp apart. Subsequent association analysesof the six SNP showed that the genotype distribution of G2385Rwas significantly different between the two groups (p = 0.0258;odds ratio [OR] = 2.156, 95% confidence interval [CI]: 1.081–4.297). Additionally, the frequencies of the 1628P and 380L allelesin the control group were slightly greater than those in the patientgroup, but these differences were not significant (p > 0.05). Furtherassociation tests between G2385R grouped by gender showed thatthere was a significant difference between patients and controls inthe female group (p = 0.010; OR = 9.396; 95% CI: 1.19–74.18).

Carriers of 2385R presented at a higher Hoehn–Yahr stage com-pared to non-carriers (1.82 ± 0.58 compared with 1.76 ± 0.76,p = 0.016, Table 4). Only a few of the patients with PD had a con-firmable family history, and two were carriers of G2385R.

4. Discussion

Hundreds of SNP have been found in the 16 PD susceptibilitygenes, and their associations with human PD have been widely ex-plored. However, high-throughput detection of multiple SNP lo-cated on these loci has rarely been reported. Multiplexing, whichallows simultaneous assessment of multiple SNP, is an efficient, ra-pid, and economical way to augment genotyping output and isreadily performed using PCR–RFLP. We focused on mismatchedmultiplex PCR amplification and subsequent RFLP analysis basedon the sequences flanking the SNP sites of PARK genes to detectas many SNP as possible. We successfully identified six SNPthrough two independent triplex PCR and single-enzyme restric-tion endonuclease digestions. Additionally, the well-known muta-tion, rs104893877 (A53T, 203G>A) in PARK1 (SNCA), can also bedetected using this technique. We did not further investigate thisSNP because the frequency of the 53T allele was low in the inves-tigated East Asian populations.12 The results suggest that this mis-matched multiplex PCR–RFLP analysis could be applied for thedetection of more SNP in various susceptibility genes.

Multiple studies have shown that mutations in LRRK2 occur at arelatively high frequency (2%) in patients with sporadic late-onset

Table 3Genotypes of six single nucleotide polymorphisms in four PARK genes and related parameters in patients with Parkinson’s disease (PD) and normal controls in a northern HanChinese population

Genotype No. patients Frequency No. controls Frequency Association with PD

Parameters of six SNP�

rs56092260 CC 199 0.985 209 0.986 OR = 1.05CT 3 0.015 3 0.014 95% CI: 0.211–5.232TT 0 0 0 0 p = 0.953

rs1801582 GG 180 0.891 181 0.854 OR = 0.765GC 21 0.104 31 0.146 95% CI 0.438–1.336CC 1 0.005 0 0 p = 0.346

rs35802484 CC 201 0.995 212 1 OR = NACT 1 0.005 0 0 95% CI: NATT 0 0 0 0 p = 0.305

rs33949390 GG 200 0.990 207 0.976 OR = 0.417GC 2 0.010 5 0.024 95% CI: 0.080–2.161CC 0 0 0 0 p = 0.282

rs34778348 GG 176 0.871 200 0.943 OR = 2.264GA 25 0.124 11 0.052 95% CI: 1.151–4.453AA 1 0.005 1 0.005 p = 0.015

rs76718524 CC 202 1 212 1 OR = NACT 0 0 0 0 95% CI: NATT 0 0 0 0 p = NA

Parameters of rs34778348 in the female grouprs34778348 GG 87 0.906 85 0.988 OR = 9.396

GA 8 0.083 1 0.012 95% CI: 1.19–74.18AA 1 0.011 0 0 p = 0.010

� All SNP genotypes were in Hardy–Weinberg equilibrium. CI = confidence interval, NA = not applicable, OR = odds ratio, SNP = single nucleotide polymorphism.

Table 4Clinical characteristics of carriers (GA + AA) and non-carriers (GG) of G2385R inpatients with Parkinson’s disease

Characteristics GA + AA GG p-valuea

Age at onset (years)� 56.12 ± 12.48 57.99 ± 10.95 0.887Hoehn–Yahr stage� 1.82 ± 0.58 1.76 ± 0.76 0.016Disease duration� 4.05 ± 2.82 3.86 ± 3.33 0.525

a p-values compare carriers to non-carriers.� Data are reported as the mean ± standard deviation.

1014 Y. Zhou et al. / Journal of Clinical Neuroscience 19 (2012) 1011–1015

PD.3,9,13 Two polymorphic variants found almost exclusively amongthe Asian population (G2385R and R1628P) have been shown to in-crease the risk for PD two-fold.9,14–22 In Chinese populations fromSingapore, Taiwan, and southern China, and the Korean andJapanese populations, LRRK2 G2385R has a frequency of 6.7–11.6%in patients with sporadic PD and 3.6–5.6% in control partici-pants.16,17,23,24 Interestingly, the G2385R variant has not beenshown to be a risk factor for PD among Indian and Malaysian popu-lations in Singapore.20 To date, LRRK2 G2385R has not been reportedin Caucasian populations. Results from different studies of the poly-morphic R1628P site are conflicting.22,25 The LRRK2 R1628P varianthas been reported as a genetic risk factor for PD in ethnic Chineseindividuals from Taiwan, Singapore, and southern China;18,21,22,25–27

however, the R1628P variant was not detected in Japanese individ-uals.18 The frequency of the LRRK2 R1628P variant was very low,and it did not appear to be a genetic risk factor in ethnic Korean,Malaysian and Indian populations.22 Our findings demonstrate thatthe LRRK2 G2385R variant may be a genetic risk factor for sporadicPD in the northern Han Chinese population, and its allele frequencyis similar to that of the ethnic Chinese population in Singapore, Tai-wan, and southern China, and of Korean and Japanese populations.However, the allele frequencies of LRRK2 R1628P in the northernHan Chinese population were different from those in ethnic Chinesepopulations from Singapore, Taiwan, and southern China, but simi-lar to those in Japanese and Korean populations. The patients withPD from different areas may contribute to the discrepancies orpossess common genetic variables of PD-related loci that modestlycontribute to the risk for PD.28

Associations between PD and the coding polymorphismsR366W and V380L in PARKIN have also been studied. Martínezet al. reported that both polymorphisms were found in equal fre-quencies in patients and controls, and their results did not supporta role for these two PARKIN-coding polymorphisms in Mexican pa-tients with PD.1 In this study, we found no difference in the allelicfrequency in the R366W site between the two groups. Althoughthe number of the V380L allele carriers in the control group wasslightly greater than that in the patient group, there was no statis-tically significant difference.

Increasing numbers of patients with PD with PINK1 mutationsare being reported worldwide.2 One heterozygous mutation,P196L, was identified in Italian patients with PD.6 In another inves-tigation, a single heterozygous deletion (P196QfsX25) was identi-fied in one Japanese patient with PD through an extensivemutation analysis in a large number of patients with PD in 13countries.7 The missense mutation R461W in PLA2G6 has only beeninvestigated by the 1000 Genomes Project in a subset of 25 individ-uals from Nigeria and showed an average heterozygosity (0.039).We also investigated two SNP in PINK1 and PLA2G6, which wererare in the northern Han Chinese population. Only one individualwas heterozygous for P196S in PINK1 in the patient group, andno mutations of R461W were found in either group. We also notethat the single base deletion P196QfsX25 could also be identifiedas the P196S variant under our experimental conditions due toan unchanged restriction enzyme site. Furthermore, alternativemethods are required to determine whether P196QfsX25 is presentin the non-P196S samples.

5. Conclusion

Genetic parameters and association analysis of six SNP showedthat these alleles were not frequent in a population from mainlandChina. Studies on R366W, V380L, R1628P, and G2385R have beenpreviously reported in a southern Han Chinese population butnot in northern Han Chinese populations. This is the first studyof these polymorphisms in a northern Han Chinese population,and data for P196S and R461W were first reported for a populationin mainland China.

Y. Zhou et al. / Journal of Clinical Neuroscience 19 (2012) 1011–1015 1015

Acknowledgement

This work was supported by grant from National NaturalScience Foundation of China (30771833).

References

1. Martinez HR, Gonzalez-Gonzalez H, Cantu-Martinez L, et al. PARKIN-codingpolymorphisms are not associated with Parkinson’s disease in a populationfrom northeastern Mexico. Neurosci Lett 2010;468:264–6.

2. Deas E, Plun-Favreau H, Wood NW. PINK1 function in health and disease. EMBOMol Med 2009;1:152–65.

3. Di Fonzo A, Rohe CF, Ferreira J, et al. A frequent LRRK2 gene mutation associatedwith autosomal dominant Parkinson’s disease. Lancet 2005;365:412–5.

4. Tan EK, Ho P, Tan L, et al. PLA2G6 mutations and Parkinson’s disease. Ann Neurol2010;67:148.

5. Papapetropoulos S, Adi N, Shehadeh L, et al. Is the G2019S LRRK2 mutationcommon in all southern European populations? J Clin Neurosci2008;15:1027–30.

6. Bonifati V, Rohe CF, Breedveld GJ, et al. Early-onset parkinsonism associatedwith PINK1 mutations: frequency, genotypes, and phenotypes. Neurology2005;65:87–95.

7. Kumazawa R, Tomiyama H, Li Y, et al. Mutation analysis of the PINK1 gene in391 patients with Parkinson disease. Arch Neurol 2008;65:802–8.

8. Nuytemans K, Theuns J, Cruts M, et al. Genetic etiology of Parkinson diseaseassociated with mutations in the SNCA, PARK2, PINK1, PARK7, and LRRK2genes: a mutation update. Hum Mutat 2010;31:763–80.

9. Tomiyama H, Li Y, Funayama M, et al. Clinicogenetic study of mutations inLRRK2 exon 41 in Parkinson’s disease patients from 18 countries. Mov Disord2006;21:1102–8.

10. Pang H, Ding Y, Li Y, et al. Mismatched multiplex PCR amplification andsubsequent RFLP analysis to simultaneously identify polymorphisms oferythrocytic ESD, GLO1, and GPT genes. J Forensic Sci 2011;56(Suppl. 1):S176–8.

11. Purcell S, Neale B, Todd-Brown K, et al. PLINK: a tool set for whole-genomeassociation and population-based linkage analyses. Am J Hum Genet2007;81:559–75.

12. Choi JM, Woo MS, Ma HI, et al. Analysis of PARK genes in a Korean cohort ofearly-onset Parkinson disease. Neurogenetics 2008;9:263–9.

13. Nichols WC, Pankratz N, Hernandez D, et al. Genetic screening for a singlecommon LRRK2 mutation in familial Parkinson’s disease. Lancet2005;365:410–2.

14. An XK, Peng R, Li T, et al. LRRK2 Gly2385Arg variant is a risk factor ofParkinson’s disease among Han-Chinese from mainland China. Eur J Neurol2008;15:301–5.

15. Di Fonzo A, Wu-Chou YH, Lu CS, et al. A common missense variant in the LRRK2gene, Gly2385Arg, associated with Parkinson’s disease risk in Taiwan.Neurogenetics 2006;7:133–8.

16. Farrer MJ, Stone JT, Lin CH, et al. Lrrk2 G2385R is an ancestral risk factor forParkinson’s disease in Asia. Parkinsonism Relat Disord 2007;13:89–92.

17. Funayama M, Li Y, Tomiyama H, et al. Leucine-rich repeat kinase 2 G2385Rvariant is a risk factor for Parkinson disease in Asian population. Neuroreport2007;18:273–5.

18. Ross OA, Wu YR, Lee MC, et al. Analysis of Lrrk2 R1628P as a risk factor forParkinson’s disease. Ann Neurol 2008;64:88–92.

19. Tan EK, Peng R, Wu YR, et al. LRRK2 G2385R modulates age at onset inParkinson’s disease: A multi-center pooled analysis. Am J Med Genet BNeuropsychiatr Genet 2009;150B:1022–3.

20. Tan EK, Skipper LM. Pathogenic mutations in Parkinson disease. Hum Mutat2007;28:641–53.

21. Tan EK, Tan LC, Lim HQ, et al. LRRK2 R1628P increases risk of Parkinson’sdisease: replication evidence. Hum Genet 2008;124:287–8.

22. Tan EK, Tang M, Tan LC, et al. Lrrk2 R1628P in non-Chinese Asian races. AnnNeurol 2008;64:472–3.

23. Kim JM, Lee JY, Kim HJ, et al. The LRRK2 G2385R variant is a risk factor forsporadic Parkinson’s disease in the Korean population. Parkinsonism RelatDisord 2010;16:85–8.

24. Zabetian CP, Yamamoto M, Lopez AN, et al. LRRK2 mutations and risk variantsin Japanese patients with Parkinson’s disease. Mov Disord 2009;24:1034–41.

25. Lu CS, Wu-Chou YH, van Doeselaar M, et al. The LRRK2 Arg1628Pro variant is arisk factor for Parkinson’s disease in the Chinese population. Neurogenetics2008;9:271–6.

26. Yu L, Hu F, Zou X, et al. LRRK2 R1628P contributes to Parkinson’s diseasesusceptibility in Chinese Han populations from mainland China. Brain Res2009;1296:113–6.

27. Zhang Z, Burgunder JM, An X, et al. LRRK2 R1628P variant is a risk factor ofParkinson’s disease among Han-Chinese from mainland China. Mov Disord2009;24:1902–5.

28. Sutherland GT, Halliday GM, Silburn PA, et al. Do polymorphisms in the familialParkinsonism genes contribute to risk for sporadic Parkinson’s disease? MovDisord 2009;24:833–8.