Current Eye Research, 33:447–454, 2008Copyright ©c Informa Healthcare USA, Inc.ISSN: 0271-3683 print / 1460-2202 onlineDOI: 10.1080/02713680802130339

Aspergillus fumigatus Antigens ActivateImmortalized Human Corneal Epithelial

Cells via Toll-Like Receptors 2 and 4Jie Zhao and Xin-Yi WuDepartment of Ophthalmology,Qilu Hospital, ShandongUniversity, Jinan, China

ABSTRACT Purpose: To evaluate the role of toll-like receptors (TLR) 2 and4 in host responses to Aspergillus fumigatus by use of cultured telomerase-immortalized human corneal epithelial cells (HCECs). Methods: HCECs werestimulated with inactive antigens from A. fumigatus. The expression of TLR2and TLR4, phosphorylation of IκB-α (pIκB-α), and release of interleukin (IL)-1β and IL-6 was measured with and without inhibitors to TLR2 and TLR4.Results: Exposure of HCECs to A. fumigatus antigens resulted in up-regulationof TLR2 and TLR4, activation of pIκB, and release of IL-1β and IL-6 in HCECs,effects that could be inhibited by treatment with TLR2 and TLR4 antibodies.Conclusions: TLR2 and TLR4-nuclear factor-κB signaling pathways in cornealepithelium play important roles in inflammatory responses against A. fumigatusantigens.

KEYWORDS Aspergillus fumigatus; cytokines; keratitis; NF-κB; toll-like receptors

INTRODUCTIONFungal keratitis is an opportunistic infection of the cornea and often leads

to local inflammation, which causes cellular injury and tissue destruction. As-pergillus fumigatus infection is one of the leading causes of fungal keratitis andaccounts for approximately 12.1% of confirmed cases, with a gradual increasein the number of severe infected corneal ulcers in China in recent years.1 Undernormal conditions, the corneal epithelial cells constitute the frontline defenseagainst microbial pathogens, and the cornea is highly resistant to infection.2

Fungal keratitis always occurs after the epithelial integrity of the cornea hasbeen breached and the underlying fibroblasts are exposed to a wide array ofmicroorganisms.1,3

In addition to serving as a protective barrier, the corneal epitheliummay actively participate in the host innate immune response to micro-bial infection. It recognizes invading microorganisms by the innate im-mune system. The recognition is a first and essential step in successfulelimination of the microorganisms. This recognition is mediated at themolecular level by specific interaction of pathogen-associated molecular

Received 27 September 2007Accepted 15 April 2008

Correspondence: Xin-Yi Wu,Department of Ophthalmology, QiluHospital, Shandong University, Jinan,China. E-mail: xywu8868@163.com

447

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 10

/27/

14Fo

r pe

rson

al u

se o

nly.

patterns (PAMPs) with a distinct member of the toll-like receptor (TLR) family.4 TLRs identify their re-spective PAMPs, such as lipoprotein (recognition byTLR1/TLR2), peptidoglycan, lipopeptide, lipoprotein,and lipoteichoic acid (TLR2 and TLR6), fungal zy-mosan and mannan (TLR2), viral double-strandedRNA (dsRNA; TLR3), fungal cytoderm polycose,lipopolysaccharide of Gram-negative bacteria (TLR4),bacterial flagella flagellin (TLR5), unmethylated CpGdinucelotides (TLR9), and Bacillus coli strain 8NU(TLR11).5−7 Recognition of these patterns by TLRs in-duces the transduction of signals that are responsiblefor the activation of genes, especially proinflammatorycytokines, important for effective host defense.4

However, the mechanism by which the host corneacan successfully defend against invasive fungi is stillunknown. Recent studies indicate that recognition ofPAMPs in A. fumigatus by the innate immune systemis most notably mediated through TLR2 and TLR4.8

Whether intrinsic corneal cells recognize fungi via TLRsin the absence of immune cells (the cornea containsno vessels) is important for the development of fungalkeratitis. We previously showed that human corneal ep-ithelial cells (HCECs) express TLR2 and TLR4, whichrecognize and respond to A. fumigatus infection by theexpression of nuclear factor-κB (NF-κB) and the secre-tion of proinflammatory cytokines interleukin (IL)-8and tumor necrosis factor (TNF)-α.9,10 In the presentstudy, we further elucidate the underlying mechanismsof TLR2 and TLR4 regulating cytokine expression andtheir role in innate defense in HCECs in response toA. fumigatus challenge.

MATERIALS AND METHODSReagents and Antibodies

A. fumigatus was purchased from the China Cen-ter for Type Culture Collection (CCTCC). Mouseanti-pIκB-α antibody was purchased from Cell Sig-naling Technology (Beverly, MA, USA). Mouse TLR2-neutralizing mAb was from Biolegend (San Diego, CA,USA). Rabbit TLR4-neutralizing mAb was from SantaCruz Biotechnology (Santa Cruz, CA, USA).

A. fumigatus AntigensConidia of A. fumigatus (strain CCTCC 93024)

were inoculated in 150-ml Erlenmeyer flasks containingSabouraud liquid medium (2% (w/v) glucose, 1% (w/v)mycopeptone). Flasks were shaken for 24 hr at 37◦C

and 200 rpm. Two-liter fermenters (LSL Biolafitte, SaintGermain en Laye, France) containing 1.2 l of Sabouraudmedium were inoculated with the shaken flask cultures.The 18-hr culture conditions were as follows: inoculum,8% (v/v); temperature, 26◦C; aeration, 50 l of air/min;agitation, 500 rpm. The mycelia recovered by filtrationwere washed twice and sterilized through incubation inethanol-phosphate-buffered saline (ethanol-PBS; 70%)for 24 hr at 4◦C. Then the mycelia were disrupted into20- to 40-µm pieces in a Potter-Elvehjem Tissue Grinderin KBM-2 and yielded 5 × 106 pieces/ml asA. fumigatushyphae antigen.7,8 The ethanol precipitate of A. fumiga-tus was prepared by precipitating the culture filtrate with4 volumes of ethanol after 18 hr of culture and storedat 4◦C. Protein content was measured by the Brad-ford technique (Bio-Rad, Hercules, CA, USA) accord-ing to the manufacturer’s instructions and estimated in10-µm equivalent BSA/ml as A. fumigatus supernatantantigen.2 A. fumigatus hyphae antigen and supernatantantigen were tested endotoxin free. Live A. fumigatuswas harvested from A. fumigatus mycelium grown onSabouraud dextrose agar (DIFCO) as described.5 Har-vested A. fumigatus was washed three times in sterilePBS and adjusted to 50 mg/ml−1 sterile PBS.11

HCEC Cultures and A. fumigatusChallenges

Human telomerase-immortalized corneal epithelialcells (kindly provided by Dr. Fu-Shin X. Yu, producedby Dr. Ilene K. Gipson) were maintained in a definedkeratinocyte serum-free medium (SFM; Invitrogen-Gibco, Carlsbad, CA, USA) in a humidified 5% CO2

incubator at 37◦C. After the cells attached, the mediumwas replaced with growth factor-free keratinocyte ba-sic medium (KBM; Invitrogen-Gibco), and cultureswere incubated overnight (growth factor starvation) asdescribed.12 In the course of treatment, HCECs wereincubated with fresh KBM containing live A. fumiga-tus, hyphae antigen or supernatant antigen for 12 hrand processed for RNA preparation. They were also in-cubated with fresh KBM containing hyphae antigen orsupernatant antigen. The cells were processed for RNAor protein preparation, and the conditioned media werecollected for cytokine assays at the indicated times.

TLR blocking experiments were conducted by in-cubating HCECs with monoclonal antibodies againstTLRs. HCECs were incubated at room tempera-ture with anti-TLR2, anti-TLR4, both anti-TLR2 and

J. Zhao and X.-Y. Wu 448

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 10

/27/

14Fo

r pe

rson

al u

se o

nly.

TABLE 1 Primers used for RT-PCR and quantitative real-timePCR

ProductGene Primer sequence size (bp)

TLR2 F:CTGCAAGCTGCGGAAGATAAT 107R:AGGACTTTATCGCAGCTCTCAGA

TLR4 F:GATTGCTCAGACCTGGCAGTT 142R:TGTCCTCCCACTCCAGGTAAGT

β-actin F: CACGATGGAGGGGCCGGACTCATC 240R: TAAAGACCTCTATGCCAACACAGT

anti-TLR4, or IgG control antibody for 1 hr. They werethen treated with hyphae antigen or supernatant anti-gen for 12 hr at 37◦C. The supernatants were collectedto evaluate the release of IL-1β and IL-6, and cells wereharvested to estimate the expression of pIκB-α.

RT-PCR Detection of TLR2 and TLR4mRNA

RNA was isolated with TRIzol (Invitogen), and 2 µgof total RNA was reverse transcribed with a first-strandsynthesis system for RT-PCR (SuperScript, Invitrogen).cDNA was amplified by PCR with specific primers forhuman TLR2 and TLR4 (Table 1). The expression ofTLR2 and TLR4 was assessed at an annealing tempera-ture of 55◦C for 35 cycles. In all experiments, negativecontrols were no reverse transcription or no RNA. ThePCR products and internal control β-actin underwentelectrophoresis on 1.5% agarose gels containing ethid-ium bromide. A digital camera (EDAS 290 system, East-man Kodak, New Haven, CT, USA) was used to captureimages.

Quantitative Real-Time RT-PCRDetection of TLR2 and TLR4 mRNATotal RNA was isolated from HCECs with use of

TRIzol reagent (Invitogen). Total RNA was quantifiedby spectrophotometry and reverse transcribed with useof the M-MLV Reverse Transcriptase System (Promega,Madison, WI, USA) and oligo (dT) (T 12-18) primers.Quantitative real-time RT-PCR involved use of Light-Cycler (Roche Applied Science, Indianapolis, IN, USA)and the SYBR-based method in a 20-µl reaction volumefollowing the manufacturer’s instructions. Primers usedare shown in Table 1. A standard curve of cycle thresh-olds was created by serial dilutions of cDNA samplesand used to calculate the relative abundance. Melting-curve analysis was performed to confirm production of

a single product in each reaction. The specificity of theamplification products was confirmed further by elec-trophoresis on a 1.5% agarose gel. The expression ofTLR2 and TLR4 mRNA was normalized to that of thehousekeeping gene β-actin. Data were analyzed with useof Light Cycle software 4.0 (Roche Applied Science).

Western Blot Analysis of pIκB-α,TLR2, and TLR4 Protein

The harvested cells were ruptured with a Disruptor(Farmingdale, NY, USA) and centrifuged. The supernate(i.e., total protein) was separated on 12% acrylamideSDS-PAGE and electroblotted onto a nitrocellulosemembrane. The membrane was blocked with 5% (w/v)fat-free milk and then incubated with a monoclonalantibody to TLR2 (1:1000), a monoclonal antibodyto TLR4 (1:1000), or a polyclonal antibody to pIκB-α(1:1000) overnight at 4◦C and then with horseradishperoxidase-conjugated secondary antibodies (1:1000)for 1 hr at room temperature. The membrane wasexposed to electrochemiluminescence (ECL) reagentsand then to x-ray film. The expression of proteinswas detected with use of Scion image software (ScionCorp., Frederick, MD, USA). The value of density ratiorepresented the level of each subunit protein.

ELISA Determination of IL-1β and IL-6in HCEC Culture Media

The concentrations of IL-1β and IL-6 in the cell cul-ture supernatants were determined by ELISA. HCECswere plated 5 × 106 cells per well in six-well plates. Af-ter overnight growth-factor starvation, cells were pre-treated with or without antibodies, then challengedwith hyphae or supernatant in a 2-ml volume for 12hr, and culture media were harvested for measurementof IL-1β and IL-6. The assays followed the manufac-turer’s instructions (R&D Systems Inc., Minneapolis,MN, USA). The amounts of IL-1β and IL-6 in culturemedia were expressed as mean picogram or nanogramsof cytokine per milliliter. Data are expressed as means ±SEM of experiments performed in triplicate that wererepeated three times with similar results.

StatisticsStatistical significance of differences was determined

with ANOVA using SPSS (version 11.5). Differenceswere considered statistically significant at p < 0.05.

449 A. fumigatus Activate HCECs via TLR2 and 4

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 10

/27/

14Fo

r pe

rson

al u

se o

nly.

FIGURE 1 Expression of TLR2 and TLR4 in HCECs treated withlive A. fumigatus (lane 1), supernatant (lane 2), or hyphae (lane 3)for 6 hr. PCR products were separated by electrophoresis andstained. Results are representative of three independent experi-ments. U: Untreated. 93 × 34 mm (300 × 300 DPI).

RESULTSEffect of A. fumigatus Supernatant orHyphae on TLR2 and TLR4 Expression

in HCECsWe used RT-PCR and Western blot analysis to deter-

mine whether TLR2 and TLR4 expression is induced inHCECs in response to A. fumigatus. The mRNA levelsof TLR2 and TLR4 were significantly higher in HCECson the 6-hr challenge with A. fumigatus, supernatant,and hyphae than with no treatment (Fig. 1). Real-timePCR revealed that both hyphae and supernatant treat-ment upregulated the mRNA expression of TLR2 andTLR4 in HCECs in a time-dependent manner (Fig. 2),with supernatant inducing a higher level of TLR2 thandid hyphae. The expression of TLR2 and TLR4 was el-evated at 2 hr in HCECs treated with both supernatant(Fig. 3A) and hyphae (Fig. 3B) and remained elevatedup to 6 hr as compared with untreated cells.

FIGURE 2 TLR2 and TLR4 mRNA expression in (A) supernatant- or (B) hyphae-treated HCECs compared with that in untreated HCECsfor 2, 4, and 6 hr. Bars represent mean ± SEM of three independent experiments. The asterisk represents p < 0.05 versus the untreatedcells. 174 × 85 mm (300 × 300 DPI).

Up-Regulation of pIκB-α andCytokines in A. fumigatus

Supernatant- or Hyphae-ChallengedHCECs

Concomitant with TLR2 and TLR4 expression, weused Western blot analysis to examine pIκB-α expres-sion in HCECs stimulated with supernatant or hyphaeat the indicated times (Fig. 3). Treatment for 6 hr up-regulated pIκB-α. On ELISA, exposure of HCECs tosupernatant or hyphae for 12 hr increased the levelsof IL-1β and IL-6 (Fig. 4), with supernatant inducing ahigher level of IL-1β than hyphae (Fig. 4).

A. fumigatus Supernatant orHyphae-Induced pIκB-α Expressionand Cytokine Secretion Depends on

TLR2 and TLR4We next sought to determine whether the expres-

sion of pIκB and cytokines induced by A. fumigatussupernatant or hyphae in HCECs depended on TLR2or TLR4. HCECs were pre-incubated for 1 hr withTLR2- or TLR4-neutralizing antibody or an IgG iso-type control antibody and then stimulated for 6 or 12hr with A. fumigatus supernatant or hyphae. The cul-ture media were then collected and underwent ELISAassay for IL-1β and IL-6 expression (Fig. 4). Cells wereharvested and underwent Western blot analysis forpIκB (Fig. 3). TLR2 and TLR4 antibodies significantly

J. Zhao and X.-Y. Wu 450

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 10

/27/

14Fo

r pe

rson

al u

se o

nly.

FIGURE 3 Western blot analyses of the protein expression of pIκB, TLR2, and TLR4 in HCECs following A. fumigatus supernatant (A)and hyphae (B) stimulation for the indicated times. The expression of pIκB was detected in HCECs after challenge with supernatant (C) orhyphae (D). Bars represent mean ± SEM of three independent experiments. The asterisk represents p < 0.05 versus the untreated cells.209 × 144 mm (72 × 72 DPI).

inhibited the supernatant- or hyphae-induced secre-tion of IL-1β and IL-6 from HCECs. As shown inFigure 4, compared with untreated cells, HCECs prein-cubated with both TLR2 and TLR4 antibodies showeddecreased supernatant-induced IL-1β accumulation inculture medium by 74% and IL-6 by 86% and de-creased hyphae-induced IL-1β accumulation in culturemedium by 68% and IL-6 by 86%. Compared with un-treated cells, HCECs preincubated with TLR2 antibodyshowed 67% reduction of supernatant-induced releaseof IL-1β, and 58% reduction of hyphae-induced releaseof IL-1β. Preincubation of HCECs with TLR4 antibodyresulted in 47% and 85% reduction of supernatant-induced release of IL-1β and IL-6, respectively, and

52% and 84% reduction of hyphae-induced release ofIL-1β and IL-6, respectively. The production of pIκB-αinduced by both supernatant and hyphae was inhib-ited in HCECs pretreated with anti-TLR2 antibody oranti-TLR4 antibody (Figs. 3C and 3D). Treatment ofHCECs with TLR2- and TLR4-neutralizing antibodiessignificantly decreased supernatant- or hyphae-inducedpIκB-α production (Figs. 3C and 3D).

DISCUSSIONOur data support that TLR2 and TLR4 from the

corneal epithelium play critical roles in the defenseagainst fungal infection. We demonstrated that the

451 A. fumigatus Activate HCECs via TLR2 and 4

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 10

/27/

14Fo

r pe

rson

al u

se o

nly.

FIGURE 4 Aspergillus fumigatus supernatant- and hyphae-induced IL-1β and IL-6 depends on TLR2 and TLR4. Bars represent mean ±SEM of three independent experiments. The asterisk represents p < 0.05 versus the corresponding value for cells treated with supernatantor hyphae. 140 × 183 mm (72 × 72 DPI).

expression of TLR2 and TLR4 and the release of IL-1β and IL-6 was increased in cells stimulated with su-pernatant or hyphae from A. fumigatus. The expressionof pIκB was also enhanced by exposure to supernatantand hyphae. The release of IL-1β and IL-6 depended onTLR2 and TLR4. In brief, our findings suggest that theincreased expression of TLR2 and TLR4 in response toA. fumigatus may result in the expression of cytokinesthat activate underlying stromal keratocytes and recruitpolymorphonuclear neutrophil leukocytes to the infec-tion site.

TLRs expressed by corneal epithelial cells may beimportant in inflammation and immunity in response

to pathogens.13–16 TLRs are the “eyes” of innate im-munity, can identify their respective PAMPs, and sig-nal intracellularly to activate the downstream signalingcascades that culminate in the phosphorylation ofIκB-α. This process facilitates the release and nucleartranslocation of active NF-κB and transcription of sev-eral cytokines and chemokines such as IL-1β, TNF-α,IL-6, and IL-8 that regulate the inflammatory and innateimmune response against microbes.17,18

To determine the roles of TLR2 and TLR4 on chal-lenge with A. fumigatus, we investigated TLR2 and TLR4activation in HCECs. RT-PCR results revealed TLR2and TLR4 triggered by A. fumigatus supernatant and

J. Zhao and X.-Y. Wu 452

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 10

/27/

14Fo

r pe

rson

al u

se o

nly.

hyphae, as well as live A. fumigatus. Interestingly, stim-ulation with supernatant, hyphae, and live A. fumiga-tus produced similar results. Hyphae are the growthunits of fungi, and while the fungi invade the cornealstroma, digestion of collagen fibrils occurs around thehyphae.19 The fungal supernatant antigens are mostlydissolvable proteins such as toxin and hydrolase (gly-coprotein, polysaccharide) secreted by fungi and are re-sponsible for destruction of basement membrane anddigestion of collagen fibrils.20,21 Our results suggest thatpathogenic and non-pathogenic A. fumigatus were rec-ognized in a similar manner. We next studied the effectsof supernatant or hyphae on the expression of TLR2and TLR4 in HCECs. The expression of TLR2 andTLR4 was enhanced in supernatant- or hyphae-treatedHCECs. Thus, both TLR2 and TLR4 were essential forresponses against A. fumigatus supernatant and hyphaein HCECs.

For detailed analysis of the specific contribution ofTLR2 and TLR4, we investigated NF-κB activation inHCECs upon challenge with A. fumigatus. Becausephosphorylation of IκB-α at Ser32 is essential for releaseof active NF-κB, phosphorylation at this site is an excel-lent marker of NF-κB activation. Western blot analysisrevealed pIκB activation triggered by supernatant andhyphae and impaired by TLR2- or TLR4-neutralizingantibody. These results agree with data published byMeier et al., who indicated that A. fumigatus conidia andA. fumigatus hyphae induced mouse macrophage acti-vation and translocation of NF-κB, as well as cytokineexpression, in a TLR2- and TLR4-dependent manner.7

Our analysis of pIκB-α activated by supernatant or hy-phae revealed that the activation of NF-κB was pro-moted in a TLR2- and TLR4-dependent manner.

To distinguish between cell activation triggeredthrough different TLRs, we analyzed IL-1β and IL-6secretion in HCECs pretreated with or without neu-tralizing antibodies. Using ELISA, we found that IL-1β

was secreted in a TLR2- and TLR4-dependent manner,whereas IL-6 was secreted in a mainly TLR4-dependentmanner. Braedel et al. showed that A. fumigatus inducedactivation of mouse dendritic cells, as well as IL-8, IL-12, and IL-6 expression in a TLR2- and TLR4-dependentmanner. The authors also showed that release of IL-12by mouse dendritic cells in response to A. fumigatusantigens depended on the expression of TLR2, whereasthe release of IL-6 depended on the expression of func-tional TLR4 molecules.8 Studies by Netea et al. showedthat macrophage cells from TLR2-knockout or TLR4-

deficient mice produced less TNF and IL-1β than didmacrophages of control mice on stimulation with A. fu-migatus conidia. In contrast, macrophages from TLR2-knockout mice showed decreased production of TNFand IL-1β in response to A. fumigatus hyphae.22 Ligandstimulation and antibody blocking tests by Zhang etal. showed that inoculation of primary human cornealepithelial cells with flagellin resulted in IκB-α degra-dation and subsequent secretion of IL-6 and IL–8.16

The authors also showed that functional blocking withTLR5at the same time could greatly reduce cell acti-vation, which indicated that the recognition of flag-ellin by human corneal epithelial cells was mediatedby TLR5.16 Kumar et al. reported that treatment of hu-man telomerase-immortalized corneal epithelial cellswith TLR2-neutralizing antibody resulted in a signifi-cant decrease in Pam3Cys-induced hBD2 productionas well as IL-6, IL-8, and TNF-α secretion.12 Thus,TLRs in HCECs may play different roles in immuno-logical responses to various microorganisms. We previ-ously showed that IL-8 and TNF-α were secreted ina TLR-NF-κB dependent manner in human cornealepithelial cells challenged by A. fumigatus.9,10 In thisstudy, we further elucidated that challenge of HCECswith A. fumigatus promoted the secretion of IL-1β andIL-6 in a TLR2- and TLR4-dependent manner and re-sulted in different pathological progressions in fungalinfections.

In summary, HCECs can express TLR2 and TLR4mRNA and protein. TLRs and the downstream NF-κB signaling pathway are essential for the activationof human epithelial cells and subsequent expression ofcytokines such as IL-1β and IL-6 after challenge by A.fumigatus. TLR2 and TLR4 may play different roles inrecognition and defense of fungi. The discovery that A.fumigatus supernatant- and hyphae-challenged HCECsrespond in a TLR2- and TLR4-dependent manner maybe promising for the prevention and treatment of fungalkeratitis.

ACKNOWLEDGMENTSThis work was supported by the National Scientific

Foundation of China (Grant No. 30571997), the Min-istry of Education of the People’s Republic of China(Grant No. 200704022081), and the Department of Sci-ence and Technology of Shandong Province (Grant No.2007GG2002031). The authors thank Dr. Fu-Shin X.Yu (School of Medicine, Wayne State University) for

453 A. fumigatus Activate HCECs via TLR2 and 4

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 10

/27/

14Fo

r pe

rson

al u

se o

nly.

helping design the research protocol and assisting inediting the manuscripts. The authors also thank col-leagues from the key laboratory of Cardiovascular Re-modeling and Function Research, Qilu Hospital ofShandong University, for technical assistance.

REFERENCES[1] Zhong WX, Xie LX, Shi WY, et al. Spectrum of infection of fungal ker-

atitis: Analysis of 654 cases. Zhonghua Yi Xue Za Zhi 2006;86:1681–1685.

[2] Kurpakus-Wheater M, Kernacki KA, Hazlett LD. Maintaining cornealintegrity: How the “window” stays clear. Prog Histochem Cytochem.2001;36:185–259.

[3] Gopinathan U, Garg P, Fernandes M, Sharma S, Athmanathan S, RaoGN. The epidemiological features and laboratory results of fungalkeratitis: A 10-year review at a referral eye care center in South India.Cornea 2002;21:555–559.

[4] S. Akira, K. Takeda. Toll-like receptor signaling. Nat Rev Immunol.2004;4:499–511.

[5] Takeda K, Akira S. TLR signaling pathway. Semin Immunol.2004;16:3–9.

[6] Zhang D, Zhang G, Matthew S, et al. A toll-like receptor that pre-vents infection by uropathogenic bacteria. Science 2004;303:1522–1526.

[7] Meier A, Kirschning CJ, Nikolaus T, et al. Toll-like receptor (TLR)2and TLR2 are essential for Aspergillus-induced activation of murinemacrophages. Cell Microbiol. 2003;5:561–570.

[8] Braedel S, Radsak M, Einsele H, et al. Aspergillus fumigatus antigensactivate innate immune cells via toll-like receptors 2 and 4. Br JHaematol. 2004;125:392–399.

[9] Wu XY, Gao JL, Ren MY. Expression profiles and function oftoll-like receptors in human corneal epithelia. Chin Med J (Engl).2007;120:893–897.

[10] Gao JL, Wu XY. Aspergillus fumigatus activate human corneal ep-ithelial cells via toll-like receptor 2 and 4. Chinese J Ophthalmol.2006;42:628–633.

[11] Rohde M, Schwienbacher M, Nikolaus T, Heesemann J, Ebel F.Detection of early phase specific surface appendages during ger-mination of Aspergillus fumigatus conidia. FEMS Microbiol Lett.2002;206:99–105.

[12] Kumar A, Zhang J, Yu FS. Toll-like receptor 2-mediated expressionof beta-defensin-2 in human corneal epithelial cells. Microbes Infect2006;8:380–389.

[13] Abreu MT, Vora P, Faure E, et al. Decreased expression of toll-likereceptor-4 and MD-2 correlates with intestinal epithelial cell protec-tion against dysregulated proinflammatory gene expression in re-sponse to bacterial lipopolysaccharide. J Immunol. 2001;167:1609–1616.

[14] Becker MN, Diamond G, Verghese MW, et al. CD14-dependentlipopolysaccharide-induced beta-defensin-2 expression in humantracheobronchial epithelium. J Biol Chem. 2000;275:29731–29736.

[15] Cario E, Podolsky DK. Differential alteration in intestinal epithelialcell expression of toll-like receptor 3 (TLR3) and TLR4 in inflammatorybowel disease. Infect Immun. 2000;68:7010–7017.

[16] Zhang J, Xu K, Ambati B, et al. Toll-like receptor 5-mediated cornealepithelial inflammatory responses to Pseudomonas aeruginosa flag-ellin. Invest Ophthamol Vis Sci. 2003; 44:4247–4254.

[17] Akira S, Hemmi H. Recognition of pathogen-associated molecularpatterns by TLR family. Immunol Lett. 2003;85:85–95.

[18] Ueta M, Hamuro J, Kiyono H, et al. Triggering of TLR3 by polyI:Cin human corneal epithelial cells to induce inflammatory cytokines.Biochem Biophys Res Comm. 2005;331:285–294.

[19] Kiryu H, Yoshida S, Saenaga Y, Asahi M. Invasion and survival ofFusarium solani in the dexamethasone-treated cornea of rabbits. JMed Vet Mycol. 1991;29:395–406.

[20] Dong X, Shi W, Zeng Q, et al. Roles of adherence and matrix met-alloproteinases in growth patterns of fungal pathogens in cornea.Curr Eye Res. 2005;30:613–620.

[21] Latge JP. Aspergillus fumigatus and aspergillosis. Clin Microbiol Rev.1999;12:310–350.

[22] Netea MG, Warris A, Meer J, et al. Aspergillus fumigatusevades immune recognition during germination through loss oftoll-like receptor-4-mediated signal transduction. J Infect Dis.2003;188:320–326.

J. Zhao and X.-Y. Wu 454

Cur

r E

ye R

es D

ownl

oade

d fr

om in

form

ahea

lthca

re.c

om b

y M

ichi

gan

Uni

vers

ity o

n 10

/27/

14Fo

r pe

rson

al u

se o

nly.