Aspartic Acid 397 in Subunit B of the Na�-pumpingNADH:Quinone Oxidoreductase from Vibrio cholerae FormsPart of a Sodium-binding Site, Is Involved in CationSelectivity, and Affects Cation-binding Site CooperativityReceived for publication, August 14, 2013 Published, JBC Papers in Press, September 12, 2013, DOI 10.1074/jbc.M113.510776

Michael E. Shea, Oscar Juarez, Jonathan Cho, and Blanca Barquera1

From the Department of Biology and Center of Biotechnology and Interdisciplinary Studies, Rensselaer Polytechnic Institute,Troy, New York 121801

Background: Na�-NQR is the main sodium pump in Vibrio cholerae.Results:Mutations at position NqrB-Asp-397 alter cation specificity and interaction between binding sites.Conclusion: NqrB-Asp-397 is part of one Na�-binding site and determines cation specificity and binding site cooperativity.Significance: The results provide new insights into the structure/function of Na� uptake in Na�-NQR.

The Na�-pumping NADH:quinone complex is found inVibrio cholerae and other marine and pathogenic bacteria.NADH:ubiquinoneoxidoreductase oxidizesNADHand reducesubiquinone, using the free energy released by this reaction topump sodium ions across the cell membrane. In a previousreport, a conserved aspartic acid residue in the NqrB subunit atposition 397, located in the cytosolic face of this protein, wasproposed to be involved in the capture of sodium.Here, we stud-ied the role of this residue through the characterization ofmutant enzymes in which this aspartic acid was substituted byother residues that change charge and size, such as arginine,serine, lysine, glutamic acid, and cysteine. Our results indicatethat NqrB-Asp-397 forms part of one of the at least two sodium-binding sites and that both size and charge at this position arecritical for the function of the enzyme. Moreover, we demon-strate that this residue is involved in cation selectivity, has acritical role in the communication between sodium-bindingsites, by promoting cooperativity, and controls the electrontransfer step involved in sodium uptake (2Fe-2S3 FMNC).

The Na�-pumping NADH:ubiquinone oxidoreductase (Na�-NQR)2 is a membrane-bound complex present in variousmarine and pathogenic bacteria, including Vibrio cholerae(1–3). This enzyme is the entry site of electrons into the aerobicrespiratory chain, catalyzing the electron transfer from NADHto ubiquinone, which is coupled to the pumping of sodium ionsacross the membrane. The sodium gradient produced by Na�-NQR is used by the cell for ATP synthesis, transport of nutri-ents, rotation of the flagellum, among other processes (4–7).Na�-NQR is a 200-kDa protein complex of six subunits, corre-sponding to the six open reading frames of the nqrA–F operon.Subunits NqrB, NqrC, NqrD, NqrE, and NqrF contain one or

more transmembrane helices, whereas subunit A is hydrophilicand located in the cytosol (8).The electrons move through the different redox centers in

enzyme in a linear pathway. During the first step of electrontransfer, the noncovalently bound FAD accepts two electronsfrom NADH (9). Subsequently, the electrons are transferredstepwise by passing to the 2Fe-2S center, the two FMN mole-cules covalently attached to NqrC and NqrB (in this order),riboflavin, and finally to ubiquinone-8 (10). Our results showedthat the one-electron reduction of FMN inNqrC (FMNC) is thestep involved in sodium uptake and that the reduction of ribo-flavin is involved in sodium translocation (11). The data indi-cate that the couplingmechanism of the enzyme ismediated byconformational changes, which are energized by the differentredox reactions of the enzyme. Indeed, Neehaul et al. (12) dem-onstrated that electrons move downhill in the electron transferchain and that themidpoint potential of FMNC increases in thepresence of sodium, suggesting that the electron transfer isthermodynamically regulated by this ion, although most of thecontrol is exerted at the kinetic level, probably through confor-mational changes.We have identified a series of acidic residues within the

transmembrane helices of the subunits NqrB, NqrD, and NqrEthat possibly form part of the structures involved in sodiumtransport. Seven of these 17 acidic residues are essential for theenzyme activity, and four of these, located on the cytosolic faceof the plasmamembrane, seem to have an important role in thesodium uptakemechanism (13). In particular, aspartic acid 397in NqrB is especially important for enzyme catalysis. Themutant in which the acidic residue was substituted to an ali-phatic group (NqrB-D397A) becomes insensitive to sodium,following an unsaturable behavior, with a Km(app) at least 2orders ofmagnitude larger comparedwithwild typeNa�-NQR.This observation suggests that this residue could be part of oneor more sodium-binding sites or that it could be involved insodium uptake by the enzyme, forming part of vestibules orgates that guide sodium to the binding sites that control itsentry. In the this study we have examined the role of the NqrB-Asp-397 residue by making substitutions that have the poten-

1 To whom correspondence should be addressed: Rm. 2239 CBIS, RensselaerPolytechnic Institute, Troy, NY 121801. Tel.: 518-276-3861; E-mail:barqub@rpi.edu.

2 The abbreviations used are: NQR, NADH:ubiquinone oxidoreductase; UC,uncoupled activity.

THE JOURNAL OF BIOLOGICAL CHEMISTRY VOL. 288, NO. 43, pp. 31241–31249, October 25, 2013© 2013 by The American Society for Biochemistry and Molecular Biology, Inc. Published in the U.S.A.

OCTOBER 25, 2013 • VOLUME 288 • NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 31241

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

tial to be functionally viable instead of the aliphatic groups thatmay have a more general effect on the structure of the enzymeand the properties of the resulting mutants studied by kineticmethods.Our results show that both size and charge are important for

proper functioning of the enzyme and that NqrB-Asp-397 is anessential component in one of the sodium-binding sites, partic-ipating in cation selectivity. The data reported here are key tothe understanding of the catalytic mechanism of Na�-NQR.Here, we show that the structural and functional role of NqrB-Asp-397 is finely tuned, and any substitution has a significanteffect in the cooperativity between cation-binding sites, whichdemonstrates that the complex relation between these sites isessential for sodium transport.Moreover, we show that the enzyme is partially functional

with only one sodium-binding site, which indicates that thesites are connected to independent and probably parallelsodium pumping pathways.

EXPERIMENTAL PROCEDURES

Bacterial Strains and Growth Conditions—V. cholerae wildtype Na�-NQR and mutant strains were grown in 30-liter fer-mentors in LB (Luria Bertani) medium in the presence of 100�g/ml ampicillin, 50 �g/ml streptomycin, under constant aer-ation and agitation at 37 °C. Arabinose was added to induce theexpression of Na�-NQR, as reported previously (1).Mutant Construction—Mutagenesis reactions were per-

formed as reported previously (14) with the Quikchange site-Directed mutagenesis kit (Stratagene), using as template thewild type nqr operon cloned into a pBAD expression vector.Primers designed to mutate the NqrB-Asp-397 to lysine, glu-tamic acid, asparagine, serine, and cysteine are listed in Table 1.A V. cholerae deletion strain lacking the genomic nqr operon(�nqr) was used to express the mutant gene copies. Mutationswere verified by DNA sequencing.Enzyme Purification—Cells were lysed using a microfluid-

izer, andmembraneswere recovered as described previously (1,13).Wild typeNa�-NQR andmutant enzymeswere solubilizedusing n-dodecyl �-D-maltoside and purified using nickel-nitri-lotriacetic acid affinity chromatography, as reported before.Samples were concentrated in Millipore spin devices and keptin liquid nitrogen until used.Steady State Activity—NADH dehydrogenase and ubiqui-

none reductase activities were measured spectrophotometri-cally at 340 and 282 nm, respectively, as reported previously(13). All measurements were performed in buffer containing 50mM Tris-HCl (pH 8.0), 1 mM EDTA, 5% (v/v) glycerol, and0.05% (w/v) n-dodecyl �-D-maltoside.Stopped-flow Experiments—Fast spectrophotometric reduc-

tion reactions were performed using an Applied Photophysics

SX.18MV-R stopped flow spectrophotometer, as reportedbefore (10). Enzyme samples were desalted in buffer containing50 mM Tris-HCl (pH 8.0), 1 mM EDTA, 5% (v/v) glycerol, and0.05% (w/v) n-dodecyl �-D-maltoside and mixed with buffercontaining 250 �M K2-NADH and 100 mMNaCl (final concen-trations). The kinetic phases of the reduction process wereassigned as reported before (10).Iodoacetamide Inactivation Kinetics—Na�-NQR (5 �M) was

incubated in the presence of 5 mM iodoacetamide, in buffercontaining 50 mM Tris, 50 mM HEPES, 50 mM MES, 1 mM

EDTA, 5% glycerol, 0.05% �-D-n-dodecylmaltoside (pH 8.0).The inactivation reactionwas stopped by a 2000-fold dilution atdifferent times, and the enzyme activity was measured at pH8.0. The effect of sodium on the inactivation kinetics was mea-sured by adding the cation to the incubation buffer.

RESULTS

Cation Effect on EnzymeActivity—In our earlier examinationof conserved acidic residues in themembrane-spanning helicesof Na�-NQR, we showed that NqrB-Asp-397 has an especiallyimportant role in the sodium translocation process (13). Whenthis residue was replaced by alanine, the enzyme turnover wasseverely inhibited, apparently due to the impairment in sodiumuptake. In wild type Na�-NQR, the sodium dependence of thesteady state turnover follows a Michaelis-Menten behavior,with a Km(app) of 1–2 mM (13). In contrast, the kinetics of theNqrB-D397A mutant show an unsaturable behavior forsodium. This suggests that either this residue forms part of thesodium-binding sites or that it is part of a vestibule or gatewaythrough which the cation has access to its binding site. Toaddress these two possibilities, the cation selectivity was stud-ied in mutants at this position in which size and charge weremodified.Table 2 shows the NADH dehydrogenase (NADHDH) and

ubiquinone reductase (CoQred) activities of the wild typeenzyme, together with those of the six NqrB-Asp-397 mutantsused in this study, in the absence and in the presence of 100mM

NaCl or LiCl. In the wild type enzyme, the CoQred (the physio-logic activity of the enzyme) is stimulated 8-fold in the presenceof saturating amounts of sodium. In the case NqrB-D397K, theintroduction of a positive charge abates completely the stimu-latory effect of sodium, demonstrating that the presence of thepositive charge in the binding site is not the factor that increaseselectron flow per se. The mutations that eliminate the negativecharge, but that introduce polar residues with a partial negativecharge such as asparagine and serine, were stimulated twotimes by sodium. The activity for the semiconservative mutantNqrB-D397E, which contains a carboxylate but increases thesize of the residue, was stimulated by sodium to almost thesame extent as the activities of NqrB-D397S and NqrB-D397N.

TABLE 1Primers designed for mutating NqrB-Asp-397

Mutation Sequence of forward primer

NqrB- D397K GCGAACCTATTTGCGCCACTGTTTAAACATGTGGTTGTAGAGAGAAATATCANqrB- D397E GCGAACCTATTTGCGCCACTGTTTGAACATGTGGTTGTAGAGAGAAATATCANqrB- D397N GCGAACCTATTTGCGCCACTGTTTAATCATGTGGTTGTAGAGAGAAATATCANqrB D397S GCGAACCTATTTGCGCCACTGTTTAGCCATGTGGTTGTAGAGAGAAATATCANqrB- D397A GCGAACCTATTTGCGCCACTGTTTGCGCATGTGGTTGTAGAGAGAAATATCANqrB- D397C GCGAACCTATTTGCGCCACTGTTTTGCCATGTGGTTGTAGAGAGAAATATCA

NqrB-Asp-397 Role in a Sodium-binding Site of Na�-NQR

31242 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 43 • OCTOBER 25, 2013

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

We also introduced a cysteine residue at this position, whichhas a similar size comparedwith aspartate, and at pH 8.0,�50%of this residue was charged negatively. In this mutant, sodiumhas a stimulatory effect of 2.6 times, the highest found in themutants studied. These results show that the role played byNqrB-Asp-397 is highly specific in terms of both charge andsize. Altering the charge (NqrB-D397N and NqrB-D397C) orthe size (NqrB-D397E) at this sequence position is sufficient todramatically change the sensitivity for Na� of the CoQredactivity.It must be pointed out that the NADH dehydrogenase activ-

ity (NADHDH) is largely unaffected in all the mutants, whichdemonstrates that the general structure of these proteins is notaltered by the mutation. Indeed, Neehaul et al. (17) using deu-terium exchange experiments recently demonstrated that themutant NqrB-D397E contains approximately the same confor-mational flexibility as the wild type enzyme and is able toundergo a series of conformational changes induced by theredox reaction and by the addition of different cations.Wehaveshown that this activity represents the total rate at which theelectrons enter the enzyme and that the main effect of sodiumoccurs at the level of electron branching between two separateactivities, the NADH oxidase and the ubiquinone reductaseactivities (10). In the wild type enzyme exposed to sodium,�90% of the electrons flow to ubiquinone, although in itsabsence they are directed to oxygen. In these mutants, a similareffectwas observed as follows: theNADHDHwas unaltered, andthe CoQred activity was diminished, in agreement with the spe-cific effect of the mutations on the sodium-dependent activity.We have previously reported that Na�-NQR is able to trans-

locate lithium, as well as sodium, and that these two cationscompete for the binding sites in the enzyme (16). Table 2 showsthat the CoQred activity of the wild type enzyme is stimulatedthree times by lithium and that the mutants NqrB-D397A andNqrB-D397K, which are completely insensitive to sodium, arealso not stimulated by lithium. However, the activities of themutantsNqrB-D397C,NqrB-D397E,NqrB-D397N, andNqrB-D397S were stimulated by lithium, and interestingly, the frac-tion of stimulation was greater for lithium compared withsodium. The CoQred activity of NqrB-D397C was stimulated1.9 times by lithium and 2.6 times by sodium. The stimulationby lithium was 65% (1.9:2.9) of what it was in the wild typeenzyme, whereas stimulation by sodium was only 33% (2.6:8.0)as much. In the case of NqrB-D397N, NqrB-D397E, and NqrB-D397S, this ratio was 1.6, 1.5, and 1.4, respectively. Thus, muta-

tions at this position have a more severe effect on the sodium-dependent activity compared with the activity dependent onlithium. These results strongly suggest that NqrB-Asp-397 hasa role in the cation selectivity filter of the enzyme.Kinetic Properties of theMutants—To further investigate the

effects of mutations at position NqrB-Asp-397 on the interac-tions of the enzyme with sodium and lithium, the kinetic prop-erties ofmutants were studied (Table 2). In all cases, the uncou-pled activity (UC) (basal activity independent of the cation) wasunaltered (60 s�1), compared with the wild type enzyme activ-ity. The ratio of kcat (maximum turnover rate of the enzyme)with respect to the uncoupled activity indicates the cation sen-sibility of the enzyme, which in all cases was similar to the stim-ulation with saturating concentrations of sodium, as found inTable 3.All themutations have a large effect on the kcat obtainedwith

sodium as substrate, reducing the rate to 20–25% of the wildtype activity (Table 3). This effect ismore evident by comparingthe “coupled” turnover rate (kcatC), which is the rate involvingexclusively the pumping activity. For all the mutants, this valuerepresents only 8–10% of the wild type activity. However, theKm(app) was not affected in the mutants NqrB-D397E, NqrB-D397S, and NqrB-D397N. Despite the large effect of the muta-tions on the activity of the enzyme, in all of these cases thesaturation kinetics followed a rectangular hyperbola (Fig. 1A),as described by the Michaelis-Menten equation. In contrast,the effect of the NqrB-D397C mutation on the sodium-depen-dent kinetics was more complex, showing negative cooperativ-ity (n� 0.4–0.6) (Fig. 1C). Negative cooperativity in enzymaticreactions can be caused by twodifferentmechanisms as follows:kinetic cooperativity between subunits in multimeric homo-oligomers, as shown in glyceraldehyde-3-phosphate dehydro-genase (15), or as result of two reactions working simultane-ously. Na�-NQR is a monomeric enzyme, so the mechanismfollowing kinetic cooperativity can be discarded. Thus, it can besuggested that the effect observed is the result of two indepen-dent pathways of sodium transport working simultaneously.Data for the NqrB-D397C mutant were fitted to the followingmechanisms.Model A describes a mechanism in which the two binding

siteswork in sequence as follows: the binding of the first sodiumion triggers the opening of the second binding site, and only theenzyme with the two occupied sites can be active. Model Bdescribes a two-component Michaelis-Menten system, whichmechanistically can be attributed to an enzyme with two sodi-

TABLE 2Na�-NQR NADH dehydrogenase (NADHDH) and ubiquinone reductase (CoQred) activities (s�1) of wild-type and NqrB-Asp-397 mutants in theabsence and presence of saturating concentrations of sodium and lithium (100 mM)�ME means �-mercaptoethanol.

No cation 100 mM Na�

CoQredNa�/CoQred

100 mM Li�

CoQredLi�/CoQredMutant NADHDH CoQred NADHDH CoQred NADHDH CoQred

Wild typea 448.9 66.3 600.1 528.5 8.0 587.2 205.5 3.1NqrB-D397Aa 622.2 � 68.4 72.3 � 8.3 580.2 � 70.1 70.6 � 3.2 0.98 629.8 � 25 72.3 � 4.2 1.0NqrB-D397E 544.7 � 44.3 66 � 4.8 673.7 � 67.4 129.6 � 8.8 2 695.4 � 74.3 96.4 � 10.3 1.5NqrB-D397C 501.4 � 92.5 65.7 � 7.7 656.6 � 101.6 152.9 � 11.4 2.3 690.9 � 84.5 102.9 � 7.2 1.6NqrB-D397C� �ME 495.4 � 31.5 61.9 � 8.7 694.6 � 100.9 162.2 � 12.3 2.6 696.7 � 102.6 110.6 � 5.9 1.8NqrB-D397K 519.9 � 28.4 61.3 � 2.5 487.7 � 29.3 58.8 � 2.6 0.96 521.9 � 45 59.8 � 6.2 0.98NqrB-D397N 560.8 � 30.5 59.7 � 2.5 681.6 � 33.7 122.9 � 4.3 2 660.4 � 34.9 95.5 � 6.2 1.6NqrB-D397S 511.7 � 50 57.7 � 4.1 662.9 � 83.9 101.3 � 8.3 1.8 603.2 � 84.5 80.7 � 5 1.4

a Data were taken from Ref.13. The average and S.D. are presented for experiments that were repeated 6–10 times.

NqrB-Asp-397 Role in a Sodium-binding Site of Na�-NQR

OCTOBER 25, 2013 • VOLUME 288 • NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 31243

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

um-binding sites with exit pathways that work independently,in other words to two independent and parallel sodium-pump-ing sites.The best fit for the data of NqrB-D397C was obtained with

model B, which allowed us to calculate the kinetic parametersfor two different sodium-pumping sites, for sites I and II. Asshown in Table 3, the coupled turnover rate (kcatC), the ratiokcatC/Km(app), and the stimulation by sodium (kcat/UC) of site Iin the NqrB-397C mutant are similar to the data found in theother mutants analyzed. This suggests that in the mutants

NqrB-D397E, NqrB-D397N, and NqrB-D397S only, sodium-binding site I is active, although site II is inactive, whichaccounts for the effect on turnover rate and essentially no per-turbation on Km(app).According to our data, sodium-binding site II might be

located in NqrB and aspartate 397 participates directly in thisbinding site.Moreover, both size and charge in this position arecritical for its function, which explains why NqrB-D397E,NqrB-D397N, and NqrB-D397S are inactive. In the case ofNqrB-D397C, the cysteine substitution produces an enzyme

TABLE 3Kinetic parameters of wild-type Na�-NQR and NqrB-Asp-397 mutantsThe kinetic parameters for themutants NqrB-D397E, NqrB-D397S, NqrB-D397K, andNqrB-D397Nwere obtained by fitting the data to a singleMichaelis-Mentenmodel.In the case of NqrB-D397C, the kinetics exhibit negative cooperativity, and data were fitted to a two-component model (model B), obtaining parameters of two differentsodium-pumping sites. kcatC indicates basal activity independent of the presence of cations; turnover rate, including the uncoupled and coupled activities, indicates theturnover rate related to the sodium-dependent activity. The experimentswere repeated at least 10 times, using protein preparations from three to five different batches. kcatCand the ratios kcatC/Km(app) and kcatC/UCwere calculated using the averages used in this table. For themutant NqrB-D397C, the parameters of site II could not be calculateddue to the low affinity of the site for sodium. �ME means �-mercaptoethanol.

Mutant Cation UC kcat kcatC Km(app) kcatC/Km(app) kcatC/UC

s�1 s�1 s�1 mM s�1 mM�1

Wild type Li� 60 � 7.3 180 � 25 120 3.5 � 1.1 34.3 2.9NqrB- D397E Li� 66 � 8.8 110 � 16 44 2.5 � 0.8 17.6 1.7NqrB- D397N Li� 61 � 4 100 � 15 39 2.4 � 1.2 16.3 1.6NqrB- D397S Li� 62 � 10.6 124 � 21 46 2.9 � 1.4 15.8 1.7NqrB- D397C� �ME Li� 63 � 3.1 115 � 8 52 2.7 � 0.8 19.3 1.9Wild type Na� 60 � 9 500 � 42 440 2.5 � 0.9 176 8NqrB- D397E Na� 69 � 11.2 127 � 12 58 1.8 � 0.7 32.2 1.9NqrB- D397N Na� 59 � 16.3 127 � 15 68 3.1 � 1.1 21.9 2.2NqrB- D397S Na� 58 � 10.8 115 � 17 57 2.8 � 1.3 20.3 1.6NqrB- D397C Na� 62 � 5.3 �170 52 � 4.3 (site I) 0.7 � 0.2 74.3 1.8

�50 (site II) �60NqrB- D397C � �ME Na� 57 � 7.7 �170 53 � 6.7 (site I) 0.25 � 0.06 212 1.9

�65 (site II) �50

FIGURE 1. Saturation kinetics of wild type Na�-NQR and NqrB-Asp-397 mutants. The Co-Qred activity was measured in the presence of different concen-trations of sodium and lithium. Open circles, wild type; black circles, NqrB-D397E; red circles, NqrB-D397C; blue circles, NqrB-D397N; and green circles, NqrB-D397S. Data in A and B were fitted using the equation for a Michaelis-Menten enzyme. Data in C were fitted to the equations for model A (black dotted line) andB (red). Only the fitting to model B is able to explain the apparent negative cooperativity observed in the Lineweaver-Burk plot in the inset. The data pointscorrespond to the average of at least 10 different experiments. Error bars were omitted for clarity purposes.

NqrB-Asp-397 Role in a Sodium-binding Site of Na�-NQR

31244 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 43 • OCTOBER 25, 2013

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

with an active site I and a partially functional site II that has lowaffinity for sodium. In this mutant, sites I and II are likely dis-connected, and the large difference in the kinetic parametersproduces the negative cooperativity in the saturation kinetics ofthis mutant. In the wild type enzyme, both sites are functionaland cannot be distinguished due to positive cooperativity. Thesubstitution of aspartate by cysteine produces an enzyme inwhich site II is perturbed, and the cooperativity with site 1 isdisrupted, which reveals the participation of the two bindingsites.To corroborate that NqrB-Asp-397 forms part of a sodium-

binding site, we tested the effect of the cation concentration onthe inactivation of the NqrB-D397C mutant by the thiol-mod-ifying agent iodoacetamide. The inactivation kinetics were fol-lowed using a constant concentration of the inhibitor, andpseudo-first order rate of inactivation was calculated by fittingthe data to a single exponential decay. The experiment wasperformed with different concentrations of sodium, and asobserved in Fig. 2, increasing concentrations of the cation pro-tected the mutant against iodoacetamide inactivation, with aKm of 80 mM. In contrast, wild type Na�-NQR is not inhibitedby iodoacetamide at these concentrations. This demonstratesthe thiol group that is specifically modified in these conditionsis the cysteine residue at position NqrB-397.Data in Table 3 confirm that the lithium-dependent activity

is not affected as much as the sodium-dependent activity inthese mutants, because the lithium stimulation (kcatC/UC) is60% comparedwithwild typeNa�-NQR. Results inTable 3 alsodemonstrate that the effect of the mutation(s) is primarily onthe kcatC value, which is reduced to �32–43% in all themutants, although Km(app) remained completely unaffected.These data suggest that in all mutants, both sitesmight be func-tional with lithium and have the same apparent affinity. Thisalso suggests that NrB-Asp-397 has an important role in theselectivity filter of the enzyme by determining the size of thecation(s) that can go into the binding site. Lithium is smallerthan sodium and requires five instead of six ligands (19), which

explains the less severe effect on the lithiumdependent activity.However, all themutants affected kcatC, indicating that this res-idue might be also involved in other steps in the transport pro-cess. It is clear that NqrB-Asp-397 residue forms part of at leastone sodium-binding site (site II) inNqrB, determining to a largeextent the size of the site. Thus, this residue is involved in thecation selectivity filter and affects the cooperativity between thetwo binding sites.Fast Kinetics of Electron Transfer—Fast kinetic measure-

ments were performed to understand the effect of twomutants,NqrB-D397E and NqrB-D397C, on the internal electron trans-fer reactions. Fig. 3 shows the different spectral components ofthe reaction and the kinetics of the enzyme reduction at 450 nmin three conditions as follows: with no cation present, 100 mM

NaCl, and 100 mM LiCl. The first component in the twomutants corresponds to the two-electron reduction of FAD(FAD 3 FADH2), which is cation-independent and the firstreaction in the reduction process (10). The difference spectrahave minima at 390 and 460 nm and maxima at 525 nm, with arate constant similar to the one obtained for the wild type(Table 4) (10). The second phase of reduction in wild typeNa�-NQR is stimulated by sodium and lithium and is the one-elec-tron reduction of riboflavin (RibH�3 RibH2). We have shownpreviously that the real sodium-dependent step is the one-elec-tron reduction of FMNC, but due to the rates of the subsequentsteps in the reaction, this intermediate cannot be detected, i.e.once that the electron passes the bottle neck at FMNC, it israpidly transferred to FMNB and then to riboflavin (11). ForNqrB-D397E and NqrB-D397C, the second phase of reductioncontained two transitions: RibH�3 RibH2, as in wild type, andthe 2(FMN3 FMN�), which is not catalytically relevant and isfound in the third phase of reduction in the wild type enzyme.The rate of reduction of riboflavin was stimulated by the pres-ence of sodium and lithium, which roughly corresponds to thestimulation of the steady state activity in these two mutants(50% stimulation approximately).

FIGURE 2. Iodoacetamide inactivation kinetics of the NqrB-D397C mutant. The inactivation kinetics were measured at different sodium concentrationsover a 1-h time interval (left panel). Black, no sodium; red, 25 mM NaCl; blue, 50 mM NaCl; green, 100 mM NaCl; magenta, 200 mM NaCl; purple, 400 mM NaCl. Therates of inactivation were calculated by fitting the data to a single exponential decay and were plotted against the sodium concentration used in eachexperiment (n � 3) (right panel).

NqrB-Asp-397 Role in a Sodium-binding Site of Na�-NQR

OCTOBER 25, 2013 • VOLUME 288 • NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 31245

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

To corroborate that themutations at positionNqrB-Asp-397affect exclusively the sodium-dependent step of the reaction,the reduction kinetics in the double mutant NqrB-D397C/NqrB-T236Y were also studied (Fig. 4). The mutation at posi-tion NqrB-Thr-236 eliminates the site for the covalent attach-ment of the FMNcofactor in this subunit (14), and thus it allowsus to study the first three steps of the reaction (NADH 3FAD3 2Fe-2S3 FMNC). As observed in Fig. 4, the reductionprocess occurred in three steps. In the first step, the reduction

of FAD (FAD 3 FADH2) was unaffected by the mutation (ataround 320 s�1) (Table 4). The reductions of FMNC and the2Fe-2S center (FMN 3 FMN. and 2Fe-2SOX 3 2Fe-2SRED)were observed in the second phase, with a rate dependent onsodium concentration, as shown in Fig. 4G, inset. The third stepcorresponds to the full reduction of FMNC (FMNC

. 3FMNCH2), which is not catalytically relevant, as reportedbefore. The rate of the second step was stimulated 50% bysodium, which confirms the effect of the mutation on the sodi-um-sensitive step of the reaction. The fast kinetics analysis ofNqrB-D397C and Nqr-D397E corroborates that the Na�

uptake step is controlled by the electron transfer step from the2Fe-2S center to FMNC.

The study of mutations at this site not only confirms thatNa�-NQR uses at least two Na�-binding sites for the uptake ofthe ion but demonstrates that a functional relationship betweenthese two sites is required to perform the sodium translocation.Most mutations at NqrB-Asp-397 avert site II, disrupting thecooperative behavior between the two Na�-binding sites.

DISCUSSION

We have demonstrated, using 22Na� equilibrium bindingtitrations and activity measurements, that Na�-NQR containsup to three functional sodium-binding sites (16). At least two ofthese sites participate in catalysis and exhibit cooperativebehavior, in which the binding of sodium to one site increasesthe affinity of the second site (or third site). These binding sitesare specific for sodiumand are unable to bind large cations suchas potassium and rubidium, but they are able to use lithium as

FIGURE 3. Kinetic components of the reduction process of the mutants NqrB-D397E (top) and NqrB-D397C (bottom) in the absence of cations and inthe presence of saturation concentrations of NaCl and LiCl (100 mM). Black line represents the first component of the reduction, which corresponds in allthe cases to the FAD3 FADH2 transition. The red line corresponds to the second phase and contains the RibH�3 RibH2 and 2(FMN3 FMN.) transitions. Theblue line represents the reduction of the covalently bound FMN in the NqrC subunit (FMNC

.3FMNCH2), which occurs during the last phase of reduction. Panelson the right show the kinetics of absorbance change at 450 nm, in the three conditions mentioned.O, no cation; - -, 100 mM LiCl; ���, 100 mM NaCl.

TABLE 4Rate constants for the reduction of the wild-type Na�-NQR and Nqr-BD397 mutants in the absence of cation (NC) and in the presence of100 mM NaCl or 100 mM LiClEach individual experiment corresponds to the average of 12 kinetic traces. At leastthree individual experiments were averaged (corresponding to at least 36 individualtraces).

NqrB-Asp-397 Role in a Sodium-binding Site of Na�-NQR

31246 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 43 • OCTOBER 25, 2013

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

substrate, possibly because lithium has a smaller ionic radius(19), a common feature among sodium-binding proteins. Pre-viously, a number of conserved acidic residues, located in thetransmembrane helices of NqrB, NqrD, and NqrE, were shownto have an important role in sodium transport. Aspartic acid397 in NqrB is one of the essential parts for sodium transport,because the mutation to an aliphatic residue (NqrB-D397A)decreases the apparent affinity of the enzyme for sodium inmore than 2 orders ofmagnitude (13).Moreover, this residue isabsolutely conserved in all the members of the Na�-NQR fam-ily and in the related RNF family, which are also sodium-pump-ing enzymes (13, 18). This suggests that this residue could havea participation in the sodium transport mechanism of theenzyme. It is possible that NqrB-Asp-397 could be part of oneor more sodium-binding sites or that it might form part ofthe vestibule or other hydrophilic cavities, guiding sodium to itsbinding sites. The data in this report allow us to clearly distin-guish between these two possibilities, which ultimately clarifiesthe role, location, and interactions of sodium-binding site II.The data in this report demonstrate that NqrB-Asp-397

forms part of a sodium-binding site (site II), because any alter-ations in size or charge at this position disrupts completely thesodium-dependent activity of the enzyme. If this residue wouldform part of a hydrophilic pocket, like a vestibule or an entrygateway, it might not be absolutely conserved in both the Na�-NQR and the RNF proteins, and the changes to other residuesshould have been tolerated by the enzyme, especially the semi-conservative substitution to glutamic acid. This absoluterequirement of aspartate acid at this position suggests thatsodium-binding site II has a specific functional geometry andthat aspartate is the only residue, with the proper size andcharge, to allow the site to be functional.The effects observed on the kinetic parameters for all the

mutants in this site can be explained by themodel shown in Fig.5. According to this model, Na�-NQR should present at leasttwo sodium-pumping sites, one in NqrB (site II) and another(site I) in NqrD and/or NqrE, which have a limited accessibilityto the aqueous environment in the oxidized form of the

enzyme. The reduction of the enzyme by twoNADHmoleculesproduces a four two-electron-reduced FAD, a reduced 2Fe-2Scenter. This triggers the one electron transfer from the 2Fe-2Scenter to FMNC, which is the redox step involved in sodiumcapture (11). In this redox state, one sodium-binding site isopen and filled with the cation This produces an inter-subunitcommunication that opens the second sodium-binding site,increasing its apparent affinity, which in turn produces thecooperative behavior observed in the wild type enzyme (16).According to this model, the sodium-binding site located inNqrB (site II) is disrupted in the NqrB-D397E, NqrB-D397S,and NqrB-D397N mutants, due mainly to lack of proper sizeand charge of these residues. Site I is partially active and respon-sible for the activity observed in these mutants. The fact thatsite II is inactive explains the dramatic decrease in the kcatC andkcatC/Km(app) ratio, although Km(app) remained constant. InNqrB-D397C, site I is fully functional and site II is partiallyactive, exhibiting a low affinity for sodium.Cysteine seems to bethe only residue capable of partially replacing aspartic acid,because it the closest residue in terms of size and charge. Fur-ther evidence supporting the ability of cysteine to partiallyreplace the aspartate residue in binding site II comes from thesodium protection experiments. As mentioned before, themutant NqrB-D397C is specifically inhibited by the thiol-mod-ifying reagent iodoacetamide. The addition of sodium to theinactivation buffer protects the enzyme, demonstrating that thecysteine residue interacts directly with the cation. The largedifference in the kinetic properties between the two sodium-binding sites in this mutant is therefore responsible for theapparent negative cooperativity observed. In contrast to thewild type enzyme, in which the two binding sites work sequen-tially, in NqrB-D397C they operate independently. A key find-ing of this work is the fact that the enzyme can function withonly one binding site, which demonstrates that the sites are notconnected and work independently.Interestingly, NqrB-Asp-397 seems to have a much more

important role in the binding of sodium, compared with thebinding of lithium, because mutations at this site are less

FIGURE 4. Kinetic components (left) and reduction kinetics (right) of the mutant NqrB-D397E/NqrB-T236Y in the in the presence different concentra-tions of NaCl. No sodium, A and black line in G; 1 mM NaCl, B and blue line in G; 2 mM NaCl, C and red line in G; 5 mM NaCl, D and green line in G; 10 mM NaCl, E anddark blue line in G; 20 mM NaCl, F and cyan line in G. The black, red, and blue lines in A–E correspond to the first, second, and third components, respectively, ofthe reduction process. Inset in G shows the dependence of the rate of the second phase with respect to NaCl concentration.

NqrB-Asp-397 Role in a Sodium-binding Site of Na�-NQR

OCTOBER 25, 2013 • VOLUME 288 • NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 31247

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

disruptive in lithium-dependent activity. All the mutants areable to bind lithium with a similar apparent affinity, likelybecause it has a smaller ionic radius compared with sodiumand can use only five ligands instead of the six ligands neededfor sodium ligation (19), explaining the less disruptive effectof the mutations on the lithium dependent activity. Thus, itseems that NqrB-Asp-397 participates in the cation selectiv-ity filter, by determining the size of the ion that the enzymecan bind.We previously used an FTIR electrochemical method to

study changes that take place upon oxidation and reduction ofNa�-NQR (17). The results demonstrate that the enzymeundergoes large structural rearrangements that are triggered bythe reduction process and by the binding of sodium and lith-ium, which confirms our hypothesis that indicates that thesodium pumping mechanism of the enzyme is driven by con-formational changes. Signals in the amide I and II regions sug-gest that these movements involve �-helices, �-sheet, and�-turn structures. The data also provide structural confirma-tion demonstrating that both the oxidized and reduced forms ofthe enzyme can interact with sodium, which was previouslyshown by our group (16), and that sodium is bound by a mono-

dentate carboxylate in the oxidized form and bidentate carbox-ylate in the reduced form, with peaks at 1370 and 1410 cm�1.The mutant NqrB-D397E also undergoes a structural rear-

rangement upon reduction and after the cation uptake but notto the same extent that the wild type Na�-NQR does, whichagrees with our model in which only one sodium-binding sitemay be active in this mutant. The mutant spectra also show apeak at 1714 cm�1, a position typical of C�Omodes of proto-nated aspartate and glutamic acids, which is absent in wild typeNa�-NQR. Although further studies are necessary to elucidatethe identity of this acidic group, it can be envisioned that itcould be part of sodium-binding site II, which is disrupted inthe mutant. The mutation may produce a major change in thissite, altering the hydrophobicity, in which the protonated car-boxylate could be more stable. In NqrB-D397E, the peaks cor-responding to the monodentate and bidentate carboxylate areinverted with respect to the wild type enzyme. This indicatesthat the mutation causes a significant change in the struc-tural interaction of the pumped ions with the binding site(s)and is consistent with the weaker binding of both Na� andLi� observed in steady state kinetic measurement on themutant enzyme. Finally, this study opens the possibility to

FIGURE 5. Model of sodium-binding site cooperativity in Na�-NQR. The model describes two sodium-pumping sites in NqrB (site II) and in NqrD/E (site I). Inthe oxidized form of the enzyme, the two sites are preformed (A) and sodium exchange may be slow. The one-electron reduction of FMNC increases theaccessibility of sodium to one site (B and C) and upon binding to this site, an inter-subunit interaction occurs, which opens the second site (D) producing a fullyactive enzyme. E represents a partially active form, where site II is disrupted by mutations at NqrB-Asp-397. Disruption of site II interrupts the interaction withsite I, eliminating the cooperative behavior of these two sites.

NqrB-Asp-397 Role in a Sodium-binding Site of Na�-NQR

31248 JOURNAL OF BIOLOGICAL CHEMISTRY VOLUME 288 • NUMBER 43 • OCTOBER 25, 2013

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

discriminate between Na�-binding sites and characterizethem independently.REFERENCES1. Barquera, B., Hellwig, P., Zhou, W., Morgan, J. E., Hase, C. C., Gosink,

K. K., Nilges, M., Bruesehoff, P. J., Roth, A., Lancaster, C. R., and Gennis,R. B. (2002) Purification and characterization of the recombinant Na�-translocating NADH:quinone oxidoreductase from Vibrio cholerae. Bio-chemistry 41, 3781–3789

2. Hayashi, M., Nakayama, Y., and Unemoto, T. (2001) Recent progress intheNa� -translocatingNADH-quinone reductase from themarineVibrioalginolyticus. Biochim. Biophys. Acta 1505, 37–44

3. Bogachev, A. V., and Verkhovsky, M. I. (2005) Na�-translocating NADH:quinone oxidoreductase: progress achieved and prospects of investiga-tions. Biochemistry 70, 143–149

4. Steuber, J., Krebs, W., and Dimroth, P. (1997) The Na�-translocatingNADH:ubiquinone oxidoreductase from Vibrio alginolyticus–redoxstates of the FADprosthetic group andmechanism of Ag� inhibition. Eur.J. Biochem. 249, 770–776

5. Dibrov, P. A., Lazarova, R. L., Skulachev, V. P., and Verkhovskaya, M. L.(1986) The sodium cycle. II. Na�-coupled oxidative phosphorylation inVibrio alginolyticus cells. Biochim. Biophys. Acta 850, 458–465

6. Dashper, S. G., Brownfield, L., Slakeski, N., Zilm, P.S., Rogers, A.H., andReynolds, E.C. (2001) Sodium ion-driven serine/threonine transport inPorphyromonas gingivalis. J. Bacteriol. 183, 4142–4148

7. Kojima, S., Yamamoto, K., Kawagishi, I., andHomma,M. (1999) The polarflagellar motor of Vibrio cholerae is driven by an Na� motive force. JBacteriol. 181, 1927–1930

8. Duffy, E. B., and Barquera, B. (2006) Membrane topology mapping of theNa�-pumping NADH:quinone oxidoreductase from Vibrio cholerae byPhoA-green fluorescent protein fusion analysis. J. Bacteriol. 188,8343–8351

9. Bogachev, A. V., Belevich, N. P., Bertsova, Y. V., and Verkhovsky, M. I.(2009) Primary steps of the Na�-translocating NADH:ubiquinone oxi-doreductase catalytic cycle resolved by the ultrafast freeze-quench ap-proach. J. Biol. Chem. 284, 5533–5538

10. Juarez, O., Morgan, J. E., and Barquera, B. (2009) The electron transferpathway of the Na�-pumping NADH:quinone oxidoreductase fromVibrio cholerae. J. Biol. Chem. 284, 8963–8972

11. Juarez, O., Morgan, J. E., Nilges, M. J., and Barquera, B. (2010) The energytransducing redox steps of the Na�-pumping NADH:quinone oxi-doreductase from Vibrio cholerae. Proc. Natl. Acad. Sci. U.S.A. 107,12505–12510

12. Neehaul, Y., Juarez, O., Barquera, B., andHellwig, P. (2012) Thermodynamiccontribution to the regulation of electron transfer in the Na�-pumpingNADH:quinone oxidoreductase from Vibrio cholerae. Biochemistry 51,4072–4077

13. Juarez, O., Athearn, K., Gillespie, P., and Barquera, B. (2009) Acid residuesin the transmembrane helices of the Na�-pumping NADH:quinone oxi-doreductase (Na�-NQR) from Vibrio cholerae involved in sodium trans-location. Biochemistry 48, 9516–9524

14. Barquera, B., Nilges, M. J., Morgan, J. E., Ramirez-Silva, L., Zhou, W., andGennis, R. B. (2004)Mutagenesis study of the 2Fe-2S center and the FAD-binding site of the Na�-translocating NADH:ubiquinone oxidoreductasefrom Vibrio cholerae. Biochemistry 43, 12322–12330

15. Roitel, O., Sergienko, E., and Branlant, G. (1999) Dimers generated fromtetrameric phosphorylating glyceraldehyde-3-phosphate dehydrogenasefrom Bacillus stearothermophilus are inactive but exhibit cooperativity inNAD binding. Biochemistry 38, 16084–16091

16. Juarez, O., Shea,M. E.,Makhatadze, G. I., and Barquera, B. (2011) The roleand specificity of the catalytic and regulatory cation-binding sites of theNa�-pumping NADH:quinone oxidoreductase from Vibrio cholerae.J. Biol. Chem. 286, 26383–26390

17. Neehaul, Y., Juarez, O., Barquera, B., and Hellwig, P. (2013) Infrared spec-troscopic evidence of a redox-dependent conformational change involv-ing ion binding residue NqrB-D397 in the Na�-pumping NADH:quinoneoxidoreductase from Vibrio cholerae. Biochemistry 52, 3085–3093

18. Schmidt, S., Biegel, E., and Muller, V. (2009) The ins and outs of Na�

bioenergetics in Acetobacterium woodii. Biochim. Biophys. Acta 1787,691–696

19. Gouaux, E., andMackinnon, R. (2005) Principles of selective ion transportin channels and pumps. Science 310, 1461–1465

NqrB-Asp-397 Role in a Sodium-binding Site of Na�-NQR

OCTOBER 25, 2013 • VOLUME 288 • NUMBER 43 JOURNAL OF BIOLOGICAL CHEMISTRY 31249

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from

Michael E. Shea, Oscar Juárez, Jonathan Cho and Blanca BarqueraInvolved in Cation Selectivity, and Affects Cation-binding Site Cooperativity

Forms Part of a Sodium-binding Site, IsVibrio choleraeOxidoreductase from -pumping NADH:Quinone+Aspartic Acid 397 in Subunit B of the Na

doi: 10.1074/jbc.M113.510776 originally published online September 12, 20132013, 288:31241-31249.J. Biol. Chem. 

  10.1074/jbc.M113.510776Access the most updated version of this article at doi:

 Alerts:

  When a correction for this article is posted• 

When this article is cited• 

to choose from all of JBC's e-mail alertsClick here

  http://www.jbc.org/content/288/43/31241.full.html#ref-list-1

This article cites 19 references, 8 of which can be accessed free at

by guest on March 7, 2018

http://ww

w.jbc.org/

Dow

nloaded from