12
Supplementary Information Development of a Multi-Target Peptide for Potentiating Chemotherapy by Modulating Tumor Microenvironment

ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

  • Upload
    others

  • View
    2

  • Download
    0

Embed Size (px)

Citation preview

Page 1: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Supplementary InformationDevelopment of a Multi-Target Peptide for Potentiating Chemotherapy by Modulating Tumor Microenvironment

Page 2: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Table S1. The primers for RT-PCR reactions [1].Primer Applied biosystems/ref (5'to3')

Mouse IL-6FORWARD: CGGAGAGGAGACTTCACAGAG

REVERSE:CATTTCCACGATTTCCCAGA

Mouse TNF-αFORWARD: TATGGCTCAGGGTCCAACTC

REVERSE:GGAAAGCCCATTTGAGTCCT

Mouse CCL2FORWARD: ATGCAGTTAACGCCCCACTC

REVERSE:CCCATTCCTTCTTGGGGTCA

Mouse IL-10FORWARD: GCCTTATCGGAAATGATCCA

REVERSE:AGGGTCTTCAGCTTCTCACC

Mouse TGF β1FORWARD: ATTCCTGGCGTTACCTTGG

REVERSE:AGCCCTGTATTCCGTCTCCT

Mouse β-actinFORWARD: CAGGTCCAGACGCAGGATGGC

REVERSE: CTACAATGAGCTGCGTGTGG

Page 3: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Table S2. Primary antibodies used in this studyAntigen Antibody Dilution Vendor

CD206 Rabbit-anti-CD206 Pab 1:100 Abcam, Cambridge, UKCD34 Goat-anti- CD34 Pab 1:200 R&D systems, Minneapolis, MN, USAKi-67 Rabbit-anti- Ki-67 Pab 1:100 Millipore, Darmstadt, GermanyCD4 Mouse-anti-CD4 Mab 1:50 R&D systems, Minneapolis, MN, USACD8 Mouse-anti-CD8 Mab 1:100 Abcam, Cambridge, UK

Foxp3 Mouse-anti-Foxp3 Pab 1:500 Abcam, Cambridge, UKCD11b Rabbit-anti-CD11b Pab 1:200 Novus biologicals, Colorado, USAGr-1 Mouse-anti-Gr-1 Mab 1:50 R&D systems, Minneapolis, MN, USA

CD31 Goat-anti-CD31 Pab 1:100 Origo, GermanyCD68 Mouse-anti-CD68 Mab 1:100 DAKO, DenmarkGlut-1 Rabbit-anti-Glut-1 Pab 1:400 Abcam, Cambridge, UK

CD cluster of differentiation, Mab monoclonal antibody, Pab polyclonal antibody.

Page 4: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Table S3. The main pharmacokinetic parameters of free Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox and nRGD-Lipo-Dox in rats (n = 5).Parameters Dox PEG-Lipo-Dox iRGD-Lipo-Dox nRGD-Lipo-DoxAUC(0-t)

a (µg·mL-

1·h)11.273±2.389 1134.733±225.043 632.102±182.25*** 904.852±273.115*

AUC(0-∞)a (µg·mL-

1·h)11.667±2.389 1146.869±233.422 632.586±181.91*** 908.2±276.18*

MRT(0-t)a (h) 7.95±1.217 11.112±1.977 7.267±2.496 8.352±1.748

MRT(0-∞)a (h) 12.373±6.572 11.88±2.533 7.344±2.447 8.595±1.862

Cmaxa (µg/mL) 3.147±0.538 149.482±13.916 147.173±25.333 152.135±7.799*

T1/2za (h) <5 min 10.089±4.357 7.164±2.644 9.32±1.178***

CLza (mL·h-1·g) 442.469±83.595 4.502±0.884 8.444±2.384 5.918±1.709

Data represent mean ± SD (n = 5). *, p < 0. 05, ***, p < 0. 01 vs control.

Page 5: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Fig. S1. The chemical structure of nRGD.

Page 6: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Fig. S2. nRGD was cleaved to afford iRGD after treatment of legumain. Mass-Spectrometry of intact FITC-nRGD (A) and FITC-iRGD (B) and peptide fragments of nRGD after treatment of legumain (C).

Page 7: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Fig. S3. The average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox equivalent, dose of 5 mg/kg) and normal saline counted using Maestro in-vivo imaging system (n = 3). *, p < 0.05, ***, p < 0.01.

Page 8: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Fig. S4. Cellular uptake of free Dox,PEG-Lipo-Dox,iRGD- Lipo-Dox and nRGD- Lipo-Dox in HUVEC

cells (n = 3, mean ± SD). *, p < 0.05, ***, p < 0.01.

Page 9: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Fig. S5. In vitro cytotoxicities of Dox groups against 4T1, HUVEC and RAW 264.7 cells at 37 °C for 24 h. The cytotoxicity of Dox groups against 4T1 (A), CoCl2 induced 4T1 (B), RAW 264.7 (C), LPS induced RAW 264.7 (D), IL-4 induced RAW 264.7 (E) and HUVEC (F). Data represent mean ± SD (n = 3). *, p < 0.05, ***, p < 0.01.

Page 10: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Fig. S6 Inhibiting effect of nRGD on the cell uptake of nRGD- Lipo-Dox by 4T1 and RAW 264.7 cells. Data represent mean ± SD (n = 3). *, p < 0.05, ***, p < 0.01.

Page 11: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

Fig. S7 Histological evaluations for different organs (heart, liver, spleen, lung, kidney and bone) of tumor bearing mice on day 20 after twice administrations of Dox formulations at an equivalent dose of 5 mg/kg. Tissue sections were stained with hematoxylin and eosin and imaged at magnification of 200× except for bone at 100×. Lesions of the organs were indicated with black arrows.

Page 12: ars.els-cdn.com · Web viewThe average signals of Dox groups in normal organs and tumors at 48 h after single administration of Dox, PEG-Lipo-Dox, iRGD-Lipo-Dox, nRGD-Lipo-Dox (Dox

References

[1] Xu Z, Wang Y, Zhang L, Huang L. Nanoparticle-delivered transforming growth factor-beta siRNA enhances vaccination against advanced melanoma by modifying tumor microenvironment. ACS nano. 2014;8:3636-45.