This article was downloaded by: [Northeastern University]On: 26 November 2014, At: 20:45Publisher: Taylor & FrancisInforma Ltd Registered in England and Wales Registered Number: 1072954 Registered office: Mortimer House,37-41 Mortimer Street, London W1T 3JH, UK

Journal of Toxicology and Environmental Health, PartA: Current IssuesPublication details, including instructions for authors and subscription information:http://www.tandfonline.com/loi/uteh20

Are Atlantic Cod in Store Lungegårdsvann, a SeawaterRecipient in Bergen, Affected by EnvironmentalContaminants? A qRT-PCR SurveyPål A. Olsvik a , Kai K. Lie a , Anders Goks⊘yr b , Torbj⊘rn Midtun b , Sylvia Frantzen a &

Amund Maage aa National Institute of Nutrition and Seafood Research ,b Department of Molecular Biology , University of Bergen , Bergen, NorwayPublished online: 30 Jan 2009.

To cite this article: Pål A. Olsvik , Kai K. Lie , Anders Goks⊘yr , Torbj⊘rn Midtun , Sylvia Frantzen & Amund Maage (2009)Are Atlantic Cod in Store Lungegårdsvann, a Seawater Recipient in Bergen, Affected by Environmental Contaminants?A qRT-PCR Survey, Journal of Toxicology and Environmental Health, Part A: Current Issues, 72:3-4, 140-154, DOI:10.1080/15287390802538956

To link to this article: http://dx.doi.org/10.1080/15287390802538956

PLEASE SCROLL DOWN FOR ARTICLE

Taylor & Francis makes every effort to ensure the accuracy of all the information (the “Content”) containedin the publications on our platform. However, Taylor & Francis, our agents, and our licensors make norepresentations or warranties whatsoever as to the accuracy, completeness, or suitability for any purpose of theContent. Any opinions and views expressed in this publication are the opinions and views of the authors, andare not the views of or endorsed by Taylor & Francis. The accuracy of the Content should not be relied upon andshould be independently verified with primary sources of information. Taylor and Francis shall not be liable forany losses, actions, claims, proceedings, demands, costs, expenses, damages, and other liabilities whatsoeveror howsoever caused arising directly or indirectly in connection with, in relation to or arising out of the use ofthe Content.

This article may be used for research, teaching, and private study purposes. Any substantial or systematicreproduction, redistribution, reselling, loan, sub-licensing, systematic supply, or distribution in anyform to anyone is expressly forbidden. Terms & Conditions of access and use can be found at http://www.tandfonline.com/page/terms-and-conditions

140

Journal of Toxicology and Environmental Health, Part A, 72: 140–154, 2009Copyright © Taylor & Francis Group, LLCISSN: 1528-7394 print / 1087-2620 online DOI: 10.1080/15287390802538956

UTEHAre Atlantic Cod in Store Lungegårdsvann, a Seawater Recipient in Bergen, Affected by Environmental Contaminants? A qRT-PCR Survey

Atlantic Cod and Environmental Contaminant EffectsPål A. Olsvik1, Kai K. Lie1, Anders Goksøyr2, Torbjørn Midtun2, Sylvia Frantzen1, and Amund Maage1

1National Institute of Nutrition and Seafood Research and 2Department of Molecular Biology, University of Bergen, Bergen, Norway

The aim of this study was to examine the transcriptional levels ofselected genes in liver and head kidney of Atlantic cod Gadusmorhua sampled in Store Lungegårdsvann, a seawater recipient sit-uated in the middle of the city of Bergen, Norway, for effects of con-taminants released from municipal sewage effluents and formerdump sites. Five males and six females were caught with fish traps inStore Lungegårdsvann in 2006. Cod from a location near Jondal inthe Hardanger Fjord were used as controls (five males and fourfemales). The following 12 genes were picked as potential markers ofcontaminant exposure: cytochrome P-450 1A (CYP1A), cytochromeP-450 2C33-like (CYP2C33-like), cytochrome P-450 3C (CYP3C),glutathione S-transcriptase p (GST) (detoxification and biotransfor-mation), Mn superoxide dismutase (Mn SOD), glutathione reduc-tase (GR), heat-shock protein 70 (HSP70) (oxidative stress),vitellogenin A (VtgA), vitellogenin B (VtgB), zona pellucida 2 (ZP2)(effects of estrogen disruptors), B-cell lymphoma 2 (Bcl-2), andcyclin-dependent kinase inhibitor 1A (CDKN1A) (radiation). Theresults showed that two males caught in Store Lungegårdsvann pos-sessed high transcriptional levels of VtgA, VtgB, and ZP2 mRNA inthe liver. In addition, CYP1A was 4.9-fold higher expressed in malesfrom Store Lungegårdsvann compared to males from the referencepopulation. CYP2C33-like mRNA expression was significantlyhigher (1.8-fold) in females from Store Lungegårdsvann than infemales from the reference population. CYP1A was significantlylower (4.7-fold) expressed in head kidney of females from StoreLungegårdsvann than in females from Hardanger Fjord. In a fol-low-up examination with sexually mature cod sampled in StoreLungegårdsvann in 2007, the livers were shown to contain high lev-els of polychlorinated biphenyls (PCB) and dioxin-like PCB. In con-clusion, fish inhabiting Store Lungegårdsvann are exposed not onlyto endocrine disruptors but also to other contaminants that affectthe transcription of phase I biotransformation genes.

In recent years there has been increasing focus on pharma-ceuticals and their fate in the environment. Large quantities ofdrugs are released from hospitals and populated areas throughthe sewage into the aquatic environment (Daughton & Ternes1999). Studies showed that release of pharmaceuticals fromsewage effluents to seawater recipients might represent a seri-ous environmental risk (Weigel et al., 2004; Brown et al.,2007). Many drugs have been detected at levels up to a few μg(Roberts & Thomas 2006; Larsson et al., 2007). Of specialconcern have been pharmaceuticals that may contribute to fem-inization of male fish, such as ethynylestradiol (EE2). It wasshown that EE2 affected gonadal development and led to popu-lation collapse of fish at exposure concentrations below 10 ng/L (Metcalfe et al., 2001; Kidd et al., 2007), a concentrationoften found near sewage effluent sites. Other drugs of concernare propranolol, diclofenac, gemfibrozil, ibuprofen, and fluox-etine (Fent et al., 2006, Brown et al., 2007). Hospital effluentsmay also contain large quantities of radioactive elements andother toxic chemical substances. As a group, pharmaceuticalsare complex molecules with different physicochemical andbiological properties. Since most pharmaceuticals are designednot to bioaccumulate in human tissues, drugs are unlikely tobioaccumulate to high levels in exposed fish (Trudeau et al.,2005). Similarly, most drugs used for humans generally exertlow acute toxicity. It is likely that biological impact of drugexposure on fish may occur in individuals through receptor-mediated mechanisms, since many drugs bind to nuclear recep-tors, including steroid, pregnane X, and thyroid or peroxisomeproliferator-activated receptors (PPAR). Absorbed substancesare eventually metabolized by phase I (oxidation, reduction,and hydrolysis) and phase II (conjugation, glucuronidation,methylation, and acetylation) mechanisms in fish prior toexcretion mainly via the bile or urine. In addition, chronicexposure to persistent drugs may lead to secondary, indirecteffects in the fish. Such responses may mediate oxidativestress.

This work was financed by the National Institute of Nutrition andSeafood Research, Bergen, Norway. We gratefully acknowledgeHui-Shan Tung and Eva Mykkeltvedt, NIFES, for analytical help.

Address correspondence to Pål A. Olsvik, National Institute ofNutrition and Seafood Research, N-5817 Bergen, Norway. E-mail:pal.olsvik@nifes.no

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

ATLANTIC COD AND ENVIRONMENTAL CONTAMINANT EFFECTS 141

Store Lungegårdsvann, a seawater recipient situated in themiddle of the city of Bergen, Norway, received considerableamounts of sewage from surrounding urban areas but mayalso be affected by effluents from the Haukeland UniversityHospital and other hospitals in the area, in addition to previ-ous waste dumping. Earlier studies showed that the old sedi-ments in Store Lungegårdsvann contain elevated concentrationsof polychlorinated biphenyls (PCB), polycyclic aromatichydrocarbons (PAH), tributyltin (TBT), and mercury (Hg)(Johnsen et al., 1998), which may also exert negative effectson marine organisms. Fish travel freely in and out of thisrecipient through the narrow channel Damsgårdsundet, so itis unlikely that Store Lungegårdsvann harbor contains anyisolated fish populations. Animals inhabiting this locationmight therefore most likely be affected to various degrees byenvironmental contaminants.

The aim of this study was to examine the transcriptionallevels of genes encoding proteins potentially affected by envi-ronmental contaminants including pharmaceuticals in liver andhead kidney of Atlantic cod Gadus morhua sampled in StoreLungegårdsvann. The Atlantic cod is a key ecological speciesin the North Atlantic, but is also an important commercial spe-cies. Five males and six females were caught with fish traps inStore Lungegårdsvann. Cod from a location near Jondal in theHardanger Fjord were used as controls (five males and fourfemales). In order to assess the general status of contaminationof Store Lungegårdsvann, another 10 individuals of cod weresampled and analyzed for liver contents of heavy metals, dioxins,dioxin-like PCB, PCB, and PAH.

MATERIALS AND METHODS

Fish SamplingJuvenile cod were caught in Store Lungegårdsvann and

compared to control fish caught at an assumed unpollutedsite. Fish from Store Lungegårdsvann (Bergen, 60.4°N/5.3°E,n = 11) had a mean weight of 232 ± 165 g (5 males and 6females). Three males and three females from this locationwere in an early reproduction stage and had developedgonads. Control fish were sampled from a location in theHardanger Fjord north of Jondal (60.3°N/6.3°E, n = 9), andhad a mean weight of 251 ± 123 g (5 males and 4 females).Except for one female, which was in an early reproductivestage, none of the control fish had developed gonads. Fishfrom both wild populations were caught in February andMarch 2006 using fish traps and transported live to the labin Bergen for tissue collection. In addition, 10 sexuallymature fish were caught in Store Lungegårdsvann 18 April2007 with nets for analysis of contaminant levels in theliver. These individuals had an average weight of 3.0 ± 2.1kg (range 1.7–7.7 kg). Equal amounts of liver tissue fromthese individuals were pooled into two or one samples foranalyses.

Tissue SamplingThe fish were killed by a blow to the head. After weight and

length determination, the genders of the individuals were deter-mined by examination of the gonads. Tissue samples from liverand head kidney were dissected out and immediately frozen incryotubes in liquid nitrogen and stored at –80°C before furtherprocessing.

Chemical Analysis of Contaminants in Cod LiverAt the laboratory, livers were dissected and homogenized

before analyses. In preparation for metal analyses, tissue sam-ples were wet digested using a Milestone microwave lab system(Milestone, Sorisole, Italy). The samples were analyzed by Agi-lent ICP-MS 7500c instrument (Yokogawa Analytical System,Inc., Tokyo) following the method of Julshamn et al. (2007).

For the determination of PCB7 samples were extracted withhexane using accelerated solvent extraction cell (Dionex ASE300, Sunnyvale, CA). PCB-53 (Ultra Scientific RPC-0325, E& M. Lind, LGC Standards AB, Boras, Sweden) was added asinternal standard. The sample solution was concentrated to 50μl and analyzed by gas chromatography and mass spectrometry(GC-MS). Analyses of the PCB7 congeners (PCB 28, 52, 101,118, 138, 153, and 180) were performed on a Thermo QuestTrace GC 2000 series (Thermo Quest, Milan, Italy) coupled toa Fisons instrument MD 800 mass-selective detector (FisonsInstruments, Mainz, Germany). The method was tested in sev-eral proficiency tests where materials such as oily fish, rape oil,chorizo, and lard were included and the results showed a z-score better than ± 1.

Analyses of the 17 PCDD/Fs and 12 dioxin-like PCBs forwhich the World Health Organization (WHO) has establishedtoxicity equivalent factors (TEF) was performed by high-reso-lution gas chromatography/high-resolution mass spectrometry(HRGC/HRMS, MAT 95XL Thermo Finnigan, Bremen, Ger-many), equipped with a fused silica capillary column (RTX-5SILMS, Restek, Bellefonte, PA). Quantification of each con-gener is based on the isotope dilution methods 1613 and 1668of the U.S. Environmental Protection Agency (EPA). Themethod quantifies 17 congeners of dioxins and furans (PCDD/PCDF), 4 congeners of non-ortho PCB (PCB-77, 81, 126, and169), and 8 congeners of mono-ortho PCB (PCB-105, 114,118, 123, 156, 157, 167, and 189), all expressed as upperbound values. The analyses of metals, PCB, and dioxins/DL-PCB at NIFES are all accredited after ISO 17025 by the Nor-wegian Accreditation Authority.

Analyses of 13 different PAH compounds were conductedby the commercial lab Eurofins AS (Eurofins AS, Oslo, Norway).Their method is based on analyses by GC-MS. The followingcompounds were analyzed: anthracene, benz[a]anthracene,benzo[a]pyrene, benzo[b]fluoranthene, benzo[g,h]perylene,benzo[k] fluoranthene, crysene/trifenylene, dibenzo[a,h]anthracene,fluoranthene, fluorene, indeno[1,2,3-cd]pyrene, phenanthreneand pyrene.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

142 P. A. OLSVIK ET AL.

RNA ExtractionTissues (100 mg) were homogenized before RNA extraction

using zirconium beads (4 mm) in a Retsch MM 310 homogenizer(Retsch GmbH, Haan, Germany). Total RNA was extractedusing Trizol reagent (Invitrogen, Life Technologies, Carlsbad,CA), according to the manufacturer’s instructions. Genomic DNAwas eliminated from the samples by DNase treatment usingDNA-free according to the manufacturer’s description (Ambion,Austin, TX). The RNA was then stored at –80°C before furtherprocessing. The quality of the RNA was assessed with theNanoDrop ND-1000 UV-Vis spectrophotometer (NanoDropTechnologies, Wilmington, DE) and the Agilent 2100 bioanalyzer(Agilent Technologies, Palo Alto, CA). The RNA 6000 NanoLabChip kit (Agilent Technologies, Palo Alto, CA) was usedto evaluate the integrity of the RNA.

Quantitative Real-Time RT-PCRTwelve target genes were evaluated for transcriptional dif-

ferences in the current study. Their symbols, names, and func-tions are shown in Table 1. Polymerase chain reaction (PCR)primer sequences used for the quantification of the referencegenes β-actin (ACTB), actin-related protein 2 (ARP-2), andelongation factor 1 alpha (EF1A), and 12 target genes, cyto-chrome P-450 (CYP) 1A (CYP1A), CYP2C33-like, CYP3C,glutathione S-transferase π (GST), Mn superoxide dismutase(Mn SOD), glutathione reductase (GR), heat-shock protein 70

(HSP70), vitellogenin A (VtgA), vitellogenin B (VtgB), zonapellucida 2 (ZP2), B-cell lymphoma 2 (Bcl-2), and cyclin-dependent kinase inhibitor 1A (CDKN1A), are shown in Table 2.The primer pairs amplify PCR products between 63 and 145base pairs (bp) long. Since some of the assays did not spanexon-exon borders, all RNA samples were subjected to DNasetreatment to avoid genomic DNA contamination. Table 2 alsoshows the GenBank accession numbers of the examined genes.

A two-step real-time reverse-transcription (RT) PCR proto-col was developed to measure the mRNA levels of the selectedgenes in Atlantic cod. The reverse-trancription reactions wererun in triplicate on 96-well reaction plates with the GeneAmpPCR 9700 machine (Applied Biosystems, Foster City, CA)using TaqMan reverse transcription reagent containing Multi-scribe reverse transcriptase (50 U/μl) (Applied Biosystems,Foster City, CA). Standard curves for efficiency calculationswere made by twofold serial dilutions of total RNA. Serialdilutions (1000–31 ng total RNA) in triplicates were analyzedby quantitative RT-PCR (qRT-PCR) in separate sample wellsand the resulting Ct values were recorded. Total RNA inputwas 500 ng in each reaction for all genes. No template control(ntc) and RT-control (a duplicate RNA sample analysis whereonly the RT enzyme is left out) reactions were run for qualityassessment. RT-controls were not performed for every individualsample, but were run for each assay or gene, with the samesample as used to make the dilution curves on the 96-wellplates. Reverse transcription was performed at 48°C for 60 min

TABLE 1 Gene Symbols, Names, and Functions of the Studied Genes

Symbol Gene name Function

ACTB β-actin Cytoskeletal Structural proteinARP-2 Actin-related protein-2 Cytoskeletal Structural proteinEF1A Elongation factor 1 alpha Protein synthesisCYP1A Cytochrome P450 1A P450 family - phase I metabolism geneCYP2C33-like Cytochrome P450 2C33-like P450 family - phase I drug metabolism geneCYP3C1 Cytochrome P450 3C P450 family - oxidation of a variety of

structurally unrelated compounds, including steroids, fatty acids, and xenobiotics

GSP π Glutathione-S-transferase π class Phase II metabolism/conjugation geneMn SOD Manganese superoxide dismutase Oxidative stressGR Glutathione reductase Oxidative stressHSP70 Heat shock protein 70 Stress/Oxidative stressVtgA Vitellogenin A Biomarker for endocrine disruptors in male fishVtgB Vitellogenin B Biomarker for endocrine disruptors in male fishZP2 Zona pellucida 2 Biomarker for endocrine disruptors in male fishBcl-2 B cell/lymphoma 2 Radiation - suppresses apoptosisCDKN1A Cyclin dependent kinase inhibitor 1A Radiation - may be an important intermediate

by which p53 mediates its role as an inhibitor of cellular proliferation in response to DNA damage

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

ATLANTIC COD AND ENVIRONMENTAL CONTAMINANT EFFECTS 143

by using oligo dT primers (2.5 μM) for all genes in 30 μl totalvolume. The final concentration of the other chemicals in eachRT reaction was: MgCl2 (5.5 mM), dNTP (500 mM of each),10× TaqMan RT buffer (1×), RNase inhibitor (0.4 U/μl), andMultiscribe reverse transcriptase (1.67 U/μl).

Two microliters cDNA from each RT reaction for all geneswas transferred to a new 96-well reaction plate and the real-timePCR was run in 20-μl reactions on the LightCycler 480 real-timePCR system (Roche Applied Sciences, Basel, Switzerland).Real-time PCR was performed by using SYBR Green MasterMix (LightCycler 480 SYBR Green master mix kit, RocheApplied Sciences, Basel, Switzerland), which contains Fast-Start DNA polymerase and gene specific primers (500 nM ofeach). PCR was achieved with initial denaturation and enzymeactivation for 5 min at 95°C, followed by 40 cycles of 10 sdenaturation at 95°C, 20 s annealing at 60°C, and 30 s elonga-tion at 72°C.

Immunospecific Detection of Vitellogenin and CYP1A in Cod Liver

The following antibodies and applied dilutions were used forenzymatic detection of Vtg and CYP1A in cod liver: rabbit-anti-cod VTG CS1 (Biosense Laboratories AS, Bergen, Norway),diluted 1:3000; rabbit-anti-cod CYP1A IgG (Goksøyr et al.,1987), diluted 1:250; mouse-anti-cod CYP1A NP-7 (BiosenseLaboratories AS, Bergen, Norway), diluted 1:2000; horseradishperoxidase (HRP)-conjugated goat anti-rabbit immunoglobulin(Ig) G (Dako, Glostrup, Denmark), diluted 1:2000; and HRP-conjugated goat anti-mouse IgG (Dako, Glostrup, Denmark),diluted 1:1000. Approximately 0.2 g cod liver was added to

homogenization buffer (0.1 M NaH2PO4·H2O, 0.15 M KCl,1 mM ethylenediamine tetraacetic acid [EDTA], 1 mM dithio-threitol [DTT], 10% v/v glycerol, pH 7.4, 4 ml per g liver) andhomogenized in order to prepare the S-9 fraction (Nilsen et al.,1998). The homogenate was transferred and centrifuged for20 min at 9000 × g at 4°C using a Heraeus Sepatech Biofuge13 centrifuge. The supernatant was subsequently transferredand stored at –80°C until further analysis. The Bradford (1976)assay was applied to determine protein concentration of codliver S-9 PMS fraction. Samples were diluted 1:400 in dH2Oand added in 50-μl volumes (2 × 2 parallels) to enzyme-linkedimmunosorbent assay (ELISA) plates (Nunc 96 wells, flat bottom).Three hundred microliters Bradford solution (1:1 CoomassieG-250/17% phosphoric acid) was then added to the samples.Absorbance was measured at 595 nm using a Tecan SPECTRAFluor plate reader (Tecan, Crailsheim, Germany). An eight-point standard curve of bovine serum albumin (BSA) was usedfor reference.

For 1DE sodium dodecyl sulfate (SDS)–polyacrylamide gelelectrophoresis (PAGE) and Western blot, separation of pro-teins was performed using the Mini PROTEAN electrophoresissystem (Bio-Rad Laboratories, Richmond, CA), with 7.5%polyacrylamide gels. Liver samples were added to 1 volume ofLaemmli sample buffer (125 mM Tris-HCl, pH 6.8, 10% glyc-erol, 2% SDS, 5% 2-β-mercaptoethanol) and heated to 95°Cfor approximately 5 min. Five micrograms protein from eachsample was applied to the gel and separated at 200 V constantvoltage. Proteins were subsequently electrotransferred toPVDF membranes using the Mini Trans-blot system (Bio-RadLaboratories, Richmond, CA), in accordance with Towbin et al.(1979). Before primary antibody incubation, the membranes

TABLE 2 PCR Primers, Amplicon Sizes, and Accession Numbers for the Studied Genes

Gene Accession no. Forward primer (5′ – 3′) Reverse primer (5′ – 3′)Amplicon size (bp)

ACTB EX739174 CACAGCCGAGCGTGAGATT ACGAGCTAGAAGCGGTTTGC 95ARP-2 EX741634 TCTGCTCCGTGTGGAAGTTG CGAGAAGATCCTCTGCCACAA 131EF1A EX721840 CGGTATCCTCAAGCCCAACA ACGAGCTAGAAGCGGTTTGC 93CYP1A EX725014 CCTTGACCTCTCGGAGAAAGAC CGCCCCGCTAGCTATAGACA 145CYP2C 33-like EX722026 CAGCAAGTCCCTTTGATCCAA CAGAAGGCTGAGGAAGTGTTCA 116CYP3C1 EX725058 CCCTATGCCTACATGCCCTTT TCCAGAGGAACAACGGTGTCT 143GST š EX730032 GTCCCCCTGCTGCCATTC CCTCCATACACCGCCACCTA 126Mn SOD GE905819 ATGTGGCCTCCTCCATTGAA GCATCACGCCACCTATGTCA 129GR EX728929 TCACGCTCACCACCAAGGA GTGTGGAGGCCAGTCGTGTT 121HSP70 BG933934 CCCCTGTCCCTGGGTATTG CACCAGGCTGGTTGTCTGAGT 121VtgA AF284035 AGACTGGCCTGGTCGTCAAA GCGAGGATAGAGGCAGGGAT 121VtgB AF284034 GTTCAACGAGCGCATCTTCA TTGTTGATGCCCAGATCCTTC 121ZP2 GE905820 GCCACTCTTCCCAACATCGA CGGAGCCACAGGAAGTTACAG 124Bcl-2 EX732379 GGAGCTGGAGGCCATCAAA TCCTTCAGCTTCTCTGCTTCCT 63CDKN1A EG645323 ACGTGCACACAGCATTGGAA GCCTCTCTCCAGCCTCAACC 111

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

144 P. A. OLSVIK ET AL.

were washed for 5 min in Tris-buffered saline with 0.05%Tween-20 (TTBS), and blocked in a 3% dry-milk/TTBS solu-tion for 1 h. Primary antibody incubations were overnight, andmembranes were subsequently washed 2 × 5 min in TTBS.Secondary antibodies were then added, and the membraneswere incubated for at least 3 h. All antibodies were diluted in a3% dry-milk/TTBS solution. Finally, membranes were washed2 × 5 min in double-distilled water (dH2O), 2 × 5 min in TTBS,and again 3 × 4 min in distilled water. Following the finalwashing step, membranes were allowed to air dry before addingthe chemiluminescence reagents (enhanced chemiluminescence[ECL] kit, Amersham Pharmacia Biotech, Piscataway, NJ) forchemiluminescent and colorimetric detection of immunostainedproteins. The membranes were left in ECL solution for 5 min,air-dried, and transferred to a film-developing box. ECL hyper-films were exposed for approximately 2 s and developed usingan Optimax x-ray developer (ProTec, Oberstenfeld, Germany).For additional colorimetric detection using Opti-4CN (Bio-RadLaboratories, Richmond, CA), membranes were washed 2 × 5min in TTBS and rinsed in dH2O. Opti-4CN solution was thenadded to the membranes and left to react for 15–30 min. Atsufficient signal intensity, the reaction was quenched by washing3 × 5 min with dH2O.

StatisticsTo evaluate the stability of the three reference genes (ACTB,

EF1AB, and ARP) in the two studied tissues, the geNormVBA applet for Microsoft Excel was used (Vandesompeleet al., 2002). The Ct values were transformed to quantitiesusing standard curves, according to the geNorm manual.geNorm was then used to calculate a normalization factorbased on the expression of the three examined referencegenes. Mean normalized expression (MNE) was calculatedfor the 12 target genes. Differential gene expression betweenthe populations within each gender was analyzed with Stu-dent’s t-test using the GraphPad Prism 4.0 software (GraphPadSoftware, Inc., San Diego, CA). An alpha level of .05 wasconsidered significant. Principal component analysis (PCA)was performed for each tissue. Normalized gene expressionand condition factor (CF) data were analyzed using SIRIUS6.5 for Windows (PRS, Bergen, Norway), after standardiza-tion of the data set to evaluate whether the transcription of thestudied genes in fish from the contaminated locations differfrom fish from the reference site. The purpose of PCA is toexpress the main information in the variables by a lowernumber of variables, the so-called principal components(PC1, PC2, . . .). A high positive or negative loading reveals asignificant variable in the actual PCA model. Score plotsfrom the PCA explore the main trends in the data, and theirrespective loading reveal variables with a significant load-ing, and are presented combined as a biplot. The samplesand loadings positively correlated are located in the samearea in the biplot.

RESULTSPotential markers for four types of responses to contaminants

were selected for screening in the current examination. CYP1A,CYP2C33-like, CYP3C, and GST were included as markersfor phase I and II biotransformation. Mn SOD, GR, and HSP70are all known to respond to reactive oxygen species (ROS) andwere included as oxidative stress markers. Two vitellogeningenes, VtgA and VtgB, in addition to one eggshell proteingene, ZP2, were chosen as markers of estrogenic effects,whereas Bcl-2 and CDKN1A were picked as potential markersfor radiation. Table 1 gives an overview of the function of theproteins encoded by the selected genes as well as gene symbolsand names.

To document the safety of seafood, an Environmental Mon-itoring Program (a public database) of contaminants in Norwegianseafood caught in the Barents Sea, Norwegian Sea, and theNorth Sea was established in 1994. The seafood database(Miljødatabase) includes baseline levels of a number of con-taminants on commercially important fish species such as cod,saithe, mackerel, herring, sandeel and farmed salmon. In Table 3the levels of cadmium (Cd), Hg (also data from muscle tissue),lead (Pb), (PCB7 (PCB congeners 28, 52, 101, 118, 153, and180), dioxin-like PCB, PCDD/F, and PCDD/F + dioxin-likePCB of 10 cod sampled in Store Lungegårdsvann were com-pared to baseline levels of these chemicals in cod liver fromunpolluted locations, mainly from the Barents Sea and the Lofotenarea (adult fish ranging in size from 1 to 12.4 kg). Pooled tis-sues from 10 individuals were used for the dioxin and dioxin-like PCB analysis, while 2 pooled samples of 5 fish were usedfor the other analyses. The levels of contaminants in liver ofcod from Store Lungegårdsvann were higher or in line withsimilar samples taken from adjacent areas around Bergen city(Puddefjorden, Vågen, and Sandviken, data not shown). Dioxin-like PCB levels in cod liver were highly correlated with the lengthof the fish (Spearman rank correlation, r2 = .99, n = 4). Datashow that the area is heavily contaminated with Hg with a 10-foldincrease in hepatic Hg compared with fish from the open seas.The area is also heavily contaminated with PCB, including thedioxin-like planar PCB. The PCB7 is approximately 50-foldhigher than background levels. Hence, a high TEQ value forthese is also found in cod liver, while the dioxins (PCDD/F) areonly slightly elevated and quite close to background levels. Themarker PAH benzo[a]pyrene is also at a low level in these fish.

Transcriptional levels of three cytochrome P-450 genes aswell as GST in male and female cod liver are shown in Figure 1.CYP1A was significantly 4.9-fold more expressed in liver ofmales from Store Lungegårdsvann compared to males from thereference site (Figure 1A). No significant differences wereobserved in CYP1A levels between females from the two pop-ulations. CYP2C33-like mRNA expression was significantlyhigher (1.8-fold) in females from Store Lungegårdsvann thanfemales from the reference population (Figure 1B). Only minorexpression differences were found for CYP3C and GST inliver (Figure 1, C and D). No differences were seen between

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

ATLANTIC COD AND ENVIRONMENTAL CONTAMINANT EFFECTS 145

the two populations for the three oxidative stress marker genesin liver (Figure 2), although a trend toward GR downregulationwas observed in males from Store Lungegårdsvann (Figure 2B).Of the studied genes, the most distinct responses were found inthe transcription of markers of environmental estrogens in theliver (Figure 3). Both VtgA (Figure 3A) and VtgB (Figure 3B)in addition to ZP2 (Figure 3C) were highly expressed in twomales caught in Store Lungegårdsvann. The mRNA levels ofVtgA, VtgB, and ZP2 were approximately 5 × 106–fold higherwhen expressed in these 2 males compared to the 3 other malescaught in Store Lungegårdsvann as well as 5 males from thereference site, a clear sign they have been exposed to environ-mental estrogens. In addition, one of the female fish (L1)caught in Store Lungegårdsvann had high levels of these tran-scripts. This individual was, however, mature with eggs. Thetwo markers for radiation, Bcl-2 and CDKN1A, were equallyexpressed in fish from the two populations (Figure 4). Principalcomponent analysis (PCA) is commonly used to analyzemicroarray data but can also be useful evaluating single-geneexpression data. Analyzing the liver data, it can be seen thatGST groups together with the yolk and eggshell protein genesin the two male individuals from Store Lungegårdsvann wereaffected by environmental estrogens (R2 = 54.1%, Figure 5).None of the other genes grouped together in a clear gender- orpopulation-specific way.

In head kidney only one gene was significantly differen-tially expressed between the two populations (Figures 6–8).CYP1A was 4.7-fold significantly lower expressed in femalecod from Store Lungegårdsvann compared to females from thereference population (Figure 6A). No significant differences

were observed for any of the other studied genes in head kidneytissue (CYP2C33-like, CYP3C, GST, Mn SOD, GR, HSP70,Bcl-2, and CDKN1A). The yolk and eggshell genes were notexpressed in head kidney tissue of Atlantic cod.

Eleven individuals from the Store Lungegårdsvann popula-tion and nine individuals from the Hardanger Fjord populationwere selected for Western blot analysis of Vtg protein in liversamples. Colorimetric detection of immunostained proteins byOpti-4CN showed high levels of Vtg in the three mature females,individuals L1, L3, and L11. (Figure 9, only L1 and L3 shownin this figure). Only one of these females (L1) had a high tran-scriptional level of Vtg (see earlier description). It appears thatmost of the Vtg is either degraded or incompletely synthesized,and the size thus appears much smaller than expected. Detec-tion by the more sensitive ECL technique showed additional, butlower, presence of Vtg in one male and two other female indi-viduals, L10, L12, and L13. L10 is one of the two males fromStore Lungegårdsvann that contained high VtgA, VtgB, andZP2 mRNA levels. The other of these two male individuals,L6, did not contain quantifiable levels of Vtg proteins in theliver. A limited set of plasma samples was available for Vtganalysis. Intense staining of Western blots was observed in threesexually mature females (L1, L3, and L8), whereas weak stain-ing was observed in L10, one of the affected males) (results notshown). Four individuals, all males, from the two popula-tions were selected for immunospecific detection of CYP1A inliver. Two different antibodies were applied in this experi-ment. Both ECL and Opti-4CN detection reveal a higher pres-ence of CYP1A in the individuals from Store Lungegårdsvann(Figure 10).

TABLE 3 Concentrations of Cd, Pb, Hg, ∑PCB7 (PCB congeners 28, 52, 101, 118, 153, and 180), Dioxin-Like PCBs (dl-PCB), Dioxins (PCDD/F), Total TE (PCDD/F + dl-PCB), and PAH in Pooled Liver Samples of 10 Atlantic Cod (Gadus morhua) From Store

Lungegårdsvann in the City of Bergen, Norway

ChemicalStore Lungegårdsvann

mean (min-max) NBackground levels mean (min-max) N SFT class

Cd (mg/kg ww) 0.041 (0.017–0.065) 2 <0.01–0.46 96Pb (mg/kg ww) 0.09 (0.05–0.13) 2 <0.04–0.07 96Hg (mg/kg ww) 0.55 (0.15–0.95) 2 <0.03–0.09 96Hg (muscle)(mg/kg ww) 0.46 (0.064–1.1) 10 <0.01–0.45 598 IIIPCB7(μg/kg ww) 4900 (1900–7900) 2 114 (11–680) 97 IVdl PCB (ng TE/kg ww) 760 1 15.6 (1.5–100) 88PCDD/F (ng TE/kg ww) 7.8 1 2.44 (0.32–11) 88 IPCDD/F+dl PCB (ng TE/kg ww) 770 1 18.1 (1.8–110) 88PAH as benzo(a)pyrene (μg/kg ww) <0.5 2 -

Note. Hg content in muscle is also shown. Background levels are from Atlantic cod ranging in size from 0.4 to 13 kg captured over severalyears in presumably unpolluted commercial fishing grounds in the Norwegian and Barents Seas. The background levels data were obtainedfrom the NIFES seafood database (Miljødatabase). SFT classification of pollution status is shown, where I = insignificantly or weakly contam-inated, III = markedly contaminated, IV = heavily contaminated.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

146 P. A. OLSVIK ET AL.

DISCUSSIONVitellogenins (Vtg) are phosphoglycolipoproteins synthe-

sized in the liver of oviparous animals in response to circulatingestrogens, but these proteins are also easily induced in juvenilesand males by estrogenic chemicals. Vtg are therefore commonlyused as functional biomarkers for exposure to estrogenic dis-ruptors in the aquatic environment (Arukwe & Goksøyr, 2003;Goksøyr, 2006; Navas & Segner, 2006, Porte et al., 2006). Vtgthat contain a complete yolk protein domain structure havebeen divided into two types; VtgA and VtgB (Reith et al.,2001). Based on sequence similarity with VtgA and VtgB inhaddock Melanogrammus aeglefinus, a codfish closely relatedto the studied species, genes encoding the two Vtg were identi-fied in the Atlantic cod. The Atlantic cod EST encoding VtgAused to generate PCR primers showed a 95% similarity withhaddock (GenBank accession number: AF284035), whereasthe Atlantic cod EST encoding VtgB showed a 94% similarity withthe haddock gene (GenBank accession number: AF284034).Cohen et al. (2005), using a mass spectrometric approach, alsoproposed that Atlantic cod has at least two distinct forms ofVtg, in agreement with current finding. In the 2 males fromStore Lungegårdsvann containing high transcriptional levels of

Vtg, VtgA was 1.32 × 105-fold higher expressed compared tothe levels in 3 other males caught in this recipient. In compari-son, VtgB was 3.7 × 105-fold higher expressed in these 2males. The transcriptional levels of Vtg in the three unaffectedmales from Store Lungegårdsvann were in accordance withfive males sampled at the reference site.

An important aspect of studying Vtg transcripts in liver isthe turnover time of mRNA; expression of Vtg mRNA mayreflect only recent (up to several days) exposure to estrogeniccompounds in male fish. Vitellogenin mRNA has a half-life ofabout 24 h in the presence of endogenous estradiol stimulationin the sheepshead minnows Cyprinodon variegatus (Hemmeret al., 2002). In the African clawed frog Xenopus laevis, VtgmRNA has a half-life of 16–30 h in the absence of exogenousestradiol stimulation or 500 h with exogenous estradiol present(Blume & Shapiro, 1989). On the other hand, the half-life ofVtg protein in plasma may be months. For example, the half-life of plasma Vtg induced by EE2 in rainbow trout Oncorhynchusmykiss range from 50 to 145 d (Schultz et al., 2001). In floun-der Platichthys flesus and sheepshead minnow plasma Vtg pro-tein half-lives are about 14 d (Allen et al., 1999; Schultz et al.,2001). Thus, the correlation between Vtg mRNA and protein

FIG. 1. Transcriptional levels of (A) CYP1A, (B) CYP2C33-like, (C) CYP3C, and (D) GST in liver of Atlantic cod Gadus morhua from StoreLungegårdsvann (L) compared to the levels in a reference population (C). M = male, F = female. MNE = mean normalized expression. Asterisk indicatessignificant difference, p < .05 (Student’s t-test).

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

ATLANTIC COD AND ENVIRONMENTAL CONTAMINANT EFFECTS 147

levels in a certain tissue may not necessary be linear in exposedanimals. It was found that mRNAs are synthesized in short ran-dom bursts independent of extrinsic factors such as transcrip-tional activators (Raj et al., 2006), further emphasizing the lowcorrelation often seen between mRNA and protein abundancesfor long-lived proteins (Anderson & Seilhamer, 1997). Thismight explain the low correlation between Vtg mRNA and pro-tein levels observed in one of the males sampled in StoreLungegårdsvann. Of course, Vtg transcription in fish dependson the size and reproductive status. For example, Vtg has servedas an ideal marker for detecting the onset of puberty and mat-uration stage in female fish. Our results suggest that Vtg tran-scription in liver of cod has an on–off characteristic, given themagnitude of mRNA difference between the two affectedmales and the unaffected males. If possible, one should mea-sure both Vtg mRNA and tissue/plasma levels of the protein if theaim is to distinguish between recent (24–36 h) or chronic (weeksto months) exposure of wild male fish to estrogenic disruptors.Unfortunately, only a limited set of plasma samples was avail-able in this study. These samples showed intense Vtg stainingin sexually mature females, but weak staining was observed inone of the males showing high Vtg mRNA levels (L10).

Several studies suggested that zona radiata proteins mightbe useful supplementary biomarkers for estrogenic disruptorsin addition to Vtg (Arukwe et al., 1997). The zona pellucida 2(ZP2) mRNA levels were therefore quantified in the presentstudy. It was shown that ZP precursor proteins are synthesized

in liver tissue of most fish under the influence of endogenousestradiol (Arukwe & Goksøyr, 2003; Hiramatsu et al., 2005),secreted into the bloodstream, and then incorporated into the innerlayer of the vitelline envelope of growing oocytes. The mRNAlevels of ZP2 were strongly upregulated in liver of the sametwo males from Store Lungegårdsvann that contained high lev-els of Vtgs. Compared to the Vtgs, ZP2 was approximately 2 ×105-fold higher expressed in these 2 males than in unaffectedindividuals, suggesting that the expression of genes encoding Vtgsand eggshell proteins in liver tissue of male fish are equallyreliable indicators of endocrine disruption.

As part of a sequencing effort, several unreported cytochromeP-450 (CYP) genes were discovered in Atlantic cod. Three ofthese cytochrome P-450 genes were selected for examinationin the current study: CYP1A, CYP2C33-like, and CYP3C.Among these CYP, most is known about CYP1A, an enzymethat metabolizes aromatic and chlorinated hydrocarbons andis induced in fish by such chemicals via the AH receptor(Goksøyr, 1995). CYP1A transcript levels in liver of malesfrom Store Lungegårdsvann were approximately fivefold higherexpressed compared to males from the reference population.Western blot analysis verified the higher expression of CYP1Alevels in male Atlantic cod from Store Lungegårdsvann, withCYP1A band volumes 5- to 10-fold higher than control fish. Itis well known that CYP1A expression shows gender-specificdifferences in fish exposed to contaminants (Elskus, 2004; Fossiet al., 2007). CYP1A levels should therefore preferentially be

FIG. 2. Transcriptional levels of (A) manganese superoxide dismutase (Mn SOD), (B) glutathione reductase (GR), and (C) heat-shock protein 70 (HSP70) inliver of Atlantic cod Gadus morhua from Store Lungegårdsvann (L) compared to the levels in a reference population (C). M = male, F = female. MNE = meannormalized expression.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

148 P. A. OLSVIK ET AL.

quantified in male individuals searching for biomarkers forexposure to certain toxicants like PCB and dl-PCB in wild pop-ulations (Goksøyr, 1995). The higher levels of CYP1A tran-scripts in males from Store Lungegårdsvann indicate that codinhabiting this location are affected by environmental contami-nants. An opposite CYP1A expression pattern was observed inhead kidney tissue, where significantly lower transcriptionalCYP1A levels were found in female fish. These results clearlysuggest that CYP1A expression display gender-specific expres-sion in Atlantic cod exposed to mixtures of toxicants. In fish

and other vertebrates the CYP2 and CYP4 families show thegreatest degree of diversity (Burnett et al., 2007). The sequencefor one of these CYP, the CYP2C33-like (GenBank accessionno.: EX722026), apparently contains two introns. When theintrons are removed the best BLAST hit for this EST is againstCYP2C33-like (E-score 10-63). PCR primers for this assaywere placed within the coding region (nucleotides 173–334).This gene was significantly higher expressed in liver of femalesfrom Store Lungegårdsvann than males. The CYP2C33-likesequence in cod shows similarity to human CYP2C19, a gene

FIG. 3. Transcriptional levels of (A) vitellogenin A (VtgA), (B) vitellogenin B (VtgB), and (C) zona pellucida 2 (ZP2) in liver of Atlantic cod Gadus morhuafrom Store Lungegårdsvann (L) compared to the levels in a reference population (C). M = male, F = female. MNE = mean normalized expression. CM and CFlink to the Y1 axis, LM and LF link to the Y2 axis.

FIG. 4. Transcriptional levels of (A) B-cell lymphoma (Bcl-2) and (B) cyclin-dependent kinase inhibitor 1A (CDKN1A) in liver of Atlantic cod Gadus morhuafrom Store Lungegårdsvann (L) compared to the levels in a reference population (C). M = male, F = female. MNE = mean normalized expression.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

ATLANTIC COD AND ENVIRONMENTAL CONTAMINANT EFFECTS 149

encoding a protein responsible for the metabolism of a number oftherapeutic agents such as the anticonvulsant drug S-mephenytoin,omeprazole, proguanil, certain barbiturates, diazepam, propra-nolol, citalopram, and imipramine (Desta et al., 2002). AlthoughCYP2C33-like was higher expressed in female fish from thecontaminated location, the mechanisms underlying this gender-specific expression in liver of cod from Store Lungegårdsvannremains unknown. Paralogous CYP3A genes were found inseveral fish species. Tseng et al. (2005) cloned a novel CYP3Agene, named CYP3A65, in the zebrafish Danio rerio, transcrip-tionally inducible by xenobiotics via the AHR2 signaling pathway.CYP3C1, belonging to a new CYP3 subfamily, was recentlyidentified by Corley-Smith et al. (2006), who showed that

CYP3C1 responded differentially to xenobiotics compared toCYP3A65. Our CYP3C1-like sequence resembles both CYP3C1and CYP3A65, with BLAST E-scores of 3e 10-52 and 4e 10-51,respectively.

Discharge from the Haukeland University Hospital, themain hospital in the city of Bergen and Hordaland County,enters the sea at Holen, a municipal wastewater treatment plantsituated approximately 3 km westward from the narrow chan-nel Damsgårdsundet that connects Store Lungegårdsvann withthe Byfjorden. This municipality wastewater treatment works(WTW) only removes solids, with no chemical or biologicaltreatment. The tide might therefore transport pharmaceuticalsand their residues back toward the Store Lungegårdsvann area.

FIG. 5. Principle component analysis (PCA) of mRNA expression in liver; performed in order to check if individuals group together according to population orgender. Gene names, populations (CM/CF = control males/females, LM/LF = Store Lungegårdsvann males/females) and CF = condition factor are presented inthe figure. The shadowed area outlines the grouping of the VtgA, VtgB, ZP2 and GST genes with two males (LM) and one female (LF) from StoreLungegårdsvann. The PCA model (component 1 and 2) explains r2 = .54 of the data variation.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

150 P. A. OLSVIK ET AL.

FIG. 6. Transcriptional levels of (A) CYP1A, (B) CYP2C33-like, (C) CYP3C, and (D) GST in head kidney of Atlantic cod Gadus morhua from StoreLungegårdsvann (L) compared to the levels in a reference population (C). M = male, F = female. MNE = mean normalized expression. Asterisk indicatessignificant difference, p < .05 (Student’s t-test).

FIG. 7. Transcriptional levels of (A) manganese superoxide dismutase (Mn SOD), (B) glutathione reductase (GR), and (C) heat-shock protein 70 (HSP70) inhead kidney of Atlantic cod Gadus morhua from Store Lungegårdsvann (L) compared to the levels in a reference population (C). M = male, F = female. MNE = meannormalized expression.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

ATLANTIC COD AND ENVIRONMENTAL CONTAMINANT EFFECTS 151

However, a recent study in Oslo city showed that the propor-tion of pharmaceuticals from the hospitals entering the sea viathe WTW was only about 2%, with the exception of paraceta-mol at 12% (Thomas et al., 2007; Langford et al., 2008). Theauthors examined the occurrence of 20 pharmaceutical com-pounds in effluents from two major Oslo city hospitals alongwith effluent from the city’s WTW. Thus, most of the pharma-ceuticals and their residues in urban recipients stem from thehouseholds, entering the marine environment via municipalsewage wastewater. During episodes with heavy rain, StoreLungegårdsvann receives effluents directly when the sewagepipelines are overloaded (Bergen municipality, unpublishedresults). The marine biota in this recipient is therefore probablyexposed to fluctuating levels of pharmaceutical compoundsoriginating mainly from the households.

Of course, drugs in the environment might not occur inisolation; the effects on fish and other species, especially in alocation like Store Lungegårdsvann with multiple contami-nants, depend upon other toxicants that might be altering othermechanisms, producing additive/synergetic effects or antago-nistic effects. Several pesticides as well as a number of indus-trial chemicals like PCB and alkylphenols were shown topossess estrogenic bioactivity in fish by their ability to stimu-late vitellogenesis (Pait & Nelson, 2002). In addition, severalcommonly used drugs, like antidepressants, anti-seizure medi-cations, and sedatives, act on the central nervous system inmammals. These drugs also have the potential to be endocrinedisruptors. This might for example be neuroendocrine effectsproduced by benzodiazepine, one of the most important typesof sedatives, as reported in humans and chicken (Harvey, 1993;

FIG. 8. Transcriptional levels of (A) B-cell lymphoma (Bcl-2) and (B) cyclin-dependent kinase inhibitor 1A (CDKN1A) in head kidney of Atlantic cod Gadusmorhua from Store Lungegårdsvann (L) compared to the levels in a reference population (C). M = male, F = female. MNE = mean normalized expression.

FIG. 9. Western blot of Vtg in liver of Atlantic cod from Store Lungegårdsvann (L) compared to the levels in the reference population from the HardangerFjord (H). The staining was visualized with opti-4CN substrate.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

152 P. A. OLSVIK ET AL.

Humbert, 1994). Livers of Atlantic cod sampled in StoreLungegårdsvann in 2007 contained high levels of PCB7,approximately 50-fold higher than the background levels infish caught in clean locations. It is mainly dioxin-like (dl)PCB that are responsible for the high levels of dioxin-TEQ inliver of cod from Store Lungegårdsvann (Table 3). The levelsof PCDD/F in cod liver are quite low compared to fish caughtin the severely contaminated Grenland Fjords in eastern Norway(Ruus et al., 2006). Since these chemicals accumulate withage in fish (Ruus et al., 2006; Pandelova et al., 2008), thelarge size of the specimens collected in 2007 may explain thehigh levels of dioxins and dl-PCB present in the cod liver.Adjusted for weight, the corresponding concentration of diox-ins and dl-PCB might be approximately 10-fold lower in thespecimens sampled for gene expression analysis in 2006,weighing around 300 g. The Norwegian Scientific Committeefor Food Safety recently reviewed risk assessment of dioxinsand dioxin-like PCBs (dl-PCB) in fish liver. Levels of dioxinsand dl-PCB in cod liver sampled in contaminated marine envi-ronments, i.e., close to cities or industrial areas, varied from30 to 740 ng TEQ/kg. In liver of cod sampled in open coast-lines the levels of dioxins and dl-PCBs ranged from 40 to 130ng TEQ/kg, whereas the levels in fish caught in the Lofoten/Barents Sea areas ranged from 3 to 66 ng TEQ/kg. Thus,the levels of dioxin and dl-PCB detected here from liver ofcod caught in Store Lungegårdsvann are higher than previousreported levels of these chemicals found in fish from Norwegianwaters.

Given the multiplicity of toxicants in Store Lungegårdsvann, itcannot be concluded whether natural or synthetic estrogens(17β-estradiol and 17α-ethynylestradiol) in sewage effluentsor other environmental contaminants like PCB or dl-PCBmediated Vtg and CYP1A induction in liver of male fish. Pre-viously it was shown that estradiol and sexual maturation medi-ate suppression of CYP1A activity (Gray et al., 1991; Goksøyr,1995). Ethynylestradiol was previously reported to affect bothCYP1A and CYP3A protein expression in the Atlantic cod(Hasselberg et al., 2005). AHR ligands may act both as estrogensand anti-estrogens, through mechanisms of ER-“hijacking” andproteasome activation, respectively (Ohtake et al., 2003, 2007,2008). Thus, AHR and estrogen receptor (ER) ligands maycounteract each other, and at present it is unknown which acti-vation pathway will be preferred under various environmentalconditions. Navas and Segner (2001), however, indicated thatestradiol inhibitory action did not overcome xenobiotic induc-tion of CYP1A in rainbow trout. It was also shown that fishliving in habitats contaminated with PCB exhibit little induc-tion of CYP1A protein expression and activity upon exposureto typical CYP1A-inducing chemicals (Meyer et al., 2002;Brammel et al., 2004). Based on potent and fast induction ofVtg mRNA in one of the two affected males examined in thisstudy, it is likely that these individuals were exposed either towaterborne drugs or, even more likely, to food items enrichedwith estrogenic compounds.

In conclusion, fish inhabiting Store Lungegårdsvann areaffected by endocrine disruptors, but also by other contaminants

FIG. 10. Western blot of hepatic CYP1A proteins in male Atlantic cod from Store Lungegårdsvann (L) compared to the levels in the reference population fromthe Hardanger Fjord (H); n = 4. PVDF membranes were probed with anti-cod CYP1A IgG and GAR-HRP secondary antibodies. The staining was visualized withopti-4CN substrate.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

ATLANTIC COD AND ENVIRONMENTAL CONTAMINANT EFFECTS 153

that modify the transcription of phase I biotransformation geneslike CYP1A and CYP2C33-like. Genes encoding proteinsaffected by oxidative stress or radiation were not differentiallyexpressed in liver or head kidney tissues of Atlantic cod inhab-iting a heavily contaminated urban seawater recipient compared tofish from a clean location.

REFERENCESAllen, Y., Matthiessen, P., Scott, A. P., Haworth, S., Feist, S., and Thain, J. E.

1999. The extent of oestrogenic contamination in the UK estuarine andmarine environments - further surveys of flounder. Sci. Total Environ.233:5–20.

Anderson, L., and Seilhamer, J. 1997. A comparison of selected mRNA andprotein abundances in human liver. Electrophoresis 18:533–537.

Arukwe, A., Knudsen, F. R., and Goksøyr, A. 1997. Fish zona radiata (eggshell)protein: A sensitive biomarker for environmental estrogens. Environ. HealthPerspect. 105:418–422.

Arukwe, A., and Goksøyr, A. 2003. Eggshell and egg yolk proteins in fish:hepatic proteins for the next generation: Oogenetic, population, and evolu-tionary implications of endocrine disruption. Comp.Hepatol. 2:4.

Blume, J. E., and Shapiro, D. J. 1989. Ribosome loading, but not protein-synthesis, is required for estrogen stabilization of Xenopus laevis vitellogeninmessenger-RNA. Nucleic Acids Res. 17:9003–9014.

Bradford, M. 1976. A rapid and sensitive method for the quantitation of micro-gram quantities of protein utilizing the principle of protein–dye binding.Anal. Biochem. 72:248–254.

Brammell, B. F., Price, D. J., Birge, W. J., and Elskus, A. A. 2004. Apparentlack of CYP1A response to high PCB body burdens in fish from a chronicallycontaminated PCB site. Mar. Environ. Res. 58:251–255.

Brown, J. N., Paxeus N.,, Förlin, L., and Larsson, D. G. J. 2007. Variations inbioconcentration of human pharmaceuticals from sewage effluents into fishblood plasma. Environ. Toxicol. Pharmacol. 24:267–274.

Burnett, K. G., Bain, L. J., Baldwin, W. S., Callard, G. V., Cohen, S.,Di Giulio, R. T., Evans, D. H., Gómez-Chiarri, M., Hahn, M. E.,Hoover, C. A., Karchner, S. I., Katoh, F., MacLatchy, D. L., Marshall, W. S.,Meyer, J. N., Naccik, D. E., Oleksiak, M. F., Rees, B. B., Singer, T. D.,Stegeman, J. J., Towle, D. W., Van Veld, P. A., Vogelbein, W. K., Whitehead, A.,Winn, R. N., and Crawford, D. L. 2007. Fundulus as the premier teleostmodel in environmental biology: Opportunities for new insights usinggenomics. Comp. Biochem. Physiol. D Genom. Proteom. 2:257–286.

Cohen, A. M., Mansour, A. A. H., and Banoub, J. H. 2005. ‘De novo’ sequenc-ing of Atlantic cod vitellogenin tryptic peptides by matrix-assisted laserdesorption/ionization quadrupole time-of-flight tandem mass spectrometry:Similarities with haddock vitellogenin. Rapid Commun. Mass Spectrom.19:2454–2460.

Corley-Smith, G. E., Su, H. T., Wang-Buhler, J. L., Tseng, H. P., Hu, C. H.,Hoang, T., Chung, W. G., and Buhler, D. R. 2006. CYP3C1,the first member ofa new cytochrome P450 subfamily found in zebrafish (Danio rerio). Biochem.Biophys. Res. Commun. 340:1039–1046.

Daughton, C. G., and Ternes, T. A. 1999, Pharmaceuticals and personal careproducts in the environment: agents of subtle change? Environ. HealthPerspect. 107:907–938.

Desta, Z., Zhao, X. J., Shin, J. G., and Flockhart, D. A. 2002. Clinical significanceof the cytochrome P4502C19 genetic polymorphism. Clin. Pharmacokinet.41:913–958.

Elskus, A. A. 2004. Estradiol and estriol suppress CYP1A expression in rainbowtrout primary hepatocytes. Mar. Environ. Res. 58:463–467.

Fent, K., Weston, A. A., and Caminada, D. 2006. Ecotoxicology of humanpharmaceuticals. Aquat. Toxicol. 76:122–159.

Fossi, M. C., Casini, S., and Marsill, L. 2007. Potential toxicological hazarddue to endocrine-disrupting chemicals on Mediterranean top predators:State of art, gender differences and methodological tools. Environ. Res.104:174–182.

Goksøyr, A., Andersson, T., Hansson, T., Klungsøyr J.,, Zhang, Y., andFörlin, L. 1987. Species characteristics of the hepatic xenobiotic and steroid

biotransformation systems of 2 teleost fish, Atlantic cod (Gadus morhua) andrainbow trout (Salmo gairdneri). Toxicol. Appl. Pharmacol. 89:347–360.

Goksøyr, A. 1995. Use of cytochrome P450 1A in fish as a biomarker ofaquatic pollution. Arch. Toxicol. Suppl. 17:80–95.

Goksøyr, A. 2006. Endocrine disruptors in the marine environment: Mechanismsof toxicity and their influence on reproductive processes in fish. J. Toxicol.Environ. Health A 69:175–184.

Gray, E. S., Woodin, B. R., and Stegeman, J. J. 1991. Sex-differences inhepatic monooxygenases in winter flounder (Pseudopleuronectes americanus)and scup (Stenotomus chrysops) and regulation of P450 forms by estradiol.J. Exp. Zool. 259:330–342.

Harvey, S. 1993. Benzodiazepine antagonism of thyrotropin-releasing-hormonereceptors—Biphasic actions on growth-hormone secretion in domestic-fowl. J.Endocrinol. 137:35–42.

Hasselberg, L., Grøsvik, B. E., Goksøyr, A., and Celander, M. C. 2005. Inter-actions between xenoestrogens and ketoconazole on hepatic CYP1A andCYP3A, in juvenile Atlantic cod (Gadus morhua). Comp. Hepatol. 4:2.

Hemmer, M. J., Bowman, C. J., Hemmer, B. L., Friedman, S. D., Marcovich, D.,Kroll, K. J., and Denslow, N. D. 2002. Vitellogenin mRNA regulation andplasma clearance in male sheepshead minnows, (Cyprinodon variegatus)after cessation of exposure to 17 beta-estradiol and p-nonylphenol. Aquat.Toxicol. 58:99–112.

Hiramatsu, N., Cheek, A. O., Sullivan, C. V., Matsubara, T., and Hara, A.2005. Vitellogenesis and endocrine disruption. In Environmental toxicology,eds. T. P. Mommsen and T. W. Moon, pp. 431–471. Amsterdam: Elsevier.

Humbert, T. 1994. Benzodiazepines neuroendocrine effects. Ann. Med. Psychol.152:161–171.

Johnsen, T. M., Bjerkeng, B., Molvær, J., and Nygaard, E. 1998. Miljøvurderingav utfylling av sprengstein i Store Lungegårdsvann. Oslo, Norway: NIVA,Report 3927-98.

Julshamn, K., Maage, A., Norli, H. S., Grobecker, K. H., Jorhem, L., andFecher, P. 2007. Determination of arsenic, cadmium, mercury, and lead byinductively coupled plasma/mass spectrometry in foods after pressuredigestion: NMKL1 inter-laboratory study. J. Am. Off. Assoc. Chem. Int.90:844–856.

Kidd, K. A., Blanchfield, P. J., Mills, K. H., Palace, V. P., Evans, R. E.,Lazorchak, J. M., and Flick, R. W. 2007. Collapse of a fish population afterexposure to a synthetic estrogen. Proc. Natl. Acad. Sci. USA 104: 8897–8901.

Langford, K. H., Barron, L., and Thomas, K. V. 2008. Determination of pharma-ceutical compounds in hospital effluents and their contribution to wastewatertreatment works. 2nd Norwegian Environmental Toxicology Symposium,2–4 April 2008, Trondheim, Norway.

Larsson, D. G. J., Pedro, C. D., and Paxeus, N. 2007. Effluent from drug man-ufactures contains extremely high levels of pharmaceuticals. J. Haz. Mater.148:751–755.

Meyer, J. N., Nacci, D. E., and Di Giulio, R. T. 2002. Cytochrome P4501A(CYP1A) in killifish (Fundulus heteroclitus): Heritability of alteredexpression and relationship to survival in contaminated sediments. Toxicol.Sci. 68:69–81.

Metcalfe, C. D., Metcalfe, T. L., Kiparissis, Y., Koenig, B. G., Khan, C.,Hughes, R. J., Croley, T. R., March, R. E., and Potter, T. 2001. Estrogenicpotency of chemicals detected in sewage treatment plant effluents as deter-mined by in vivo assays with Japanese medaka (Oryzias latipes). Environ.Toxicol. Chem. 20:297–308.

Navas, J. M., and Segner, H. 2001. Estrogen-mediated suppression of cytochromeP4501A (CYP1A) expression in rainbow trout hepatocytes: Role of estrogenreceptor. Chem. Biol. Interact. 138:285–298.

Navas, J. M., and Segner, H. 2006. Vitellogenin synthesis in primary culturesof fish liver cells as endpoint for in vitro screening of the (anti) estrogenicactivity of chemical substances. Aquat. Toxicol. 80:1–22.

Nilsen, B. M., Berg, K., and Goksøyr, A. 1998. Induction of cytochrome P4501A (CYP1A) in fish. A biomarker for environmental pollution. MethodsMol. Biol. 107:423–438.

Ohtake, F., Takeyama, K., Matsumoto, T., Kitagawa, H., Yamamoto, Y.,Nohara, K., Tohyama, C., Krust, A., Mimura, J., Chambon, P., Yanagisawa, J.,Fujii-Kuriyama, Y., and Kato, S. 2003. Modulation of oestrogen receptorsignalling by association with the activated dioxin receptor. Nature 423:545–550.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014

154 P. A. OLSVIK ET AL.

Ohtake, F., Baba, A., Takada, I., Okada, M., Iwasaki, K., Miki, H., Takahashi, S.,Kouzmenko, A., Nohara, K., Chiba, T., Fujii-Kuriyama, Y., and Kato, S.2007. Dioxin receptor is a ligand-dependent E3 ubiquitin ligase. Nature446:562–566.

Ohtake, F., Baba, A., Fujii-Kuriyama, Y., and Kato, S. 2008. Intrinsic AhRfunction underlies cross-talk of dioxins with sex hormone signalings. Biochem.Biophys. Res. Commun. March 19 [Epub ahead of print].

Pait, A. S., and Nelson, J. 2002. Endocrine disruption in fish: An assessment ofrecent research and results. NOAA Technical Memo. Silver Spring,:NOAA, Center for Coastal Monitoring & Assessment.

Pandelova, M., Henkelmann, B., Roots, O., Simm, M., Jaerv, L., Benfenati, E.,and Schramm, K. W. 2008. Levels of PCDD/F and dioxin-like PCB in Balticfish of different age and gender. Chemosphere 71:369–378.

Porte, C., Janer, G., Lorusso, L. C., Ortiz-Zarragoitia, M., Cajaraville, M. P.,Fossi, M. C., and Canesi, L. 2006. Endocrine disruptors in marine organisms:Approaches and perspectives. Comp. Biochem. Physiol. C Toxicol. Pharmacol.143:303–315.

Raj, A., Peskin, C. S., Tranchina, D., Vargas, D. Y., and Tyagi, S. 2006.Stochastic mRNA synthesis in mammalian cells. PLoS Biol. 4:1707–1719.

Reith, M., Munholland, J., Kelly, J., Finn, R. N., and Fyhn, H. J. 2001. Lipovi-tellins derived from two forms of vitellogenin are dif0ferentially processedduring oocyte maturation in haddock (Melanogrammus aeglefinus). J. Exp.Zool. 291:58–67.

Roberts, P. H., and Thomas, K. V. 2006. The occurrence of selected pharma-ceuticals in wastewater effluent and surface waters of the lower Tynecatchment. Sci. Total Environ. 356:143–153.

Ruus, A., Berge, J. A., Hylland, K., Bjerkeng, B., Bakke, T., and Naes, K.2006. Polychlorinated dibenzo-p-dioxins (PCDDs) and dibenzofurans

(PCDFs) in the Grenland Fjords (Norway)—Disposition, levels, andeffects. J. Toxicol. Environ. Health A 69:185–200.

Schultz, I. R., Orner, G., Merdink, J. L., and Skillman, A. 2001. Dose-responserelationships and pharmacokinetics of vitellogenin in rainbow trout afterintravascular administration of 17 alpha-ethynylestradiol. Aquat. Toxicol.51:305–318.

Thomas, K. V., Dye, C., Schlabach, M., and Langford, K. H. 2007. Sourceto sink tracking of selected human pharmaceuticals from two Oslocity hospitals and a wastewater treatment works. J. Environ. Monit. 9:1410–1418.

Towbin, H., Staehelin, T., and Gordon, J. 1979. Electrophoretic transfer ofproteins from polyacrylamide gels to nitrocellulose sheets—Procedure andsome applications. Proc. Natl. Acad. Sci. USA 76:4350–4354.

Trudeau, V. L., Metcalfe, C. D., Mimeault, C., and Moon, T. W. 2005.Pharmaceuticals in the environment: Drugged fish? In Environmentaltoxicology, eds. T. P. Mommsen and T. W. Moon, pp. 475–494. Amsterdam:Elsevier.

Tseng, H. P., Hseu, T. H., Buhler, D. R., Wang, W. D., and Hu, C. H. 2005.Constitutive and xenobiotics-induced expression of a novel CYP3A genefrom zebrafish larva. Toxicol. Appl. Pharmacol. 205:247–258.

Vandesompele, J., De Preter, K., Pattyn, F., Poppe, B., Van Roy, N., De Paepe, A.,and Speleman, F. 2002. Accurate normalization of real-time quantitativeRT-PCR data by geometric averaging of multiple internal control genes.Genome Biol. 3:RESEARCH0034.

Weigel, S., Berger, U., Jensen, E., Kallenborn, R., Thoresen, H., and Hühnerfuss, H.2004. Determination of selected pharmaceuticals and caffeine in sewageand seawater from Tromsø/Norway with emphasis on ibuprofen and itsmetabolites. Chemosphere 56:583–592.

Dow

nloa

ded

by [

Nor

thea

ster

n U

nive

rsity

] at

20:

45 2

6 N

ovem

ber

2014