Er

CHa

b

c

Bd

e

f

g

a

ARR2A

KTTmRG

1

ceewOs

j

0h

Aquatic Toxicology 128– 129 (2013) 147– 157

Contents lists available at SciVerse ScienceDirect

Aquatic Toxicology

jou rn al h om epa ge: www.elsev ier .com/ locate /aquatox

ffects of tris(1,3-dichloro-2-propyl) phosphate and triphenyl phosphate oneceptor-associated mRNA expression in zebrafish embryos/larvae

hunsheng Liua,∗, Qiangwei Wangb, Kang Liangc, Jingfu Liuc, Bingsheng Zhoub, Xiaowei Zhanga,ongling Liua, John P. Giesyd,e,f,g, Hongxia Yua,∗

State Key Laboratory of Pollution Control and Resource Reuse & School of the Environment, Nanjing University, Nanjing, ChinaState Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, ChinaState Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871,eijing 100085, ChinaToxicology Centre, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5B3Department of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, Saskatchewan, Canada S7N 5B3Zoology Department, Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824, USADepartment of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong, China

r t i c l e i n f o

rticle history:eceived 17 October 2012eceived in revised form2 November 2012ccepted 11 December 2012

eywords:DCPPPPRNA expression

eceptorenomics

a b s t r a c t

Tris(1,3-dichloro-2-propyl) phosphate (TDCPP) and triphenyl phosphate (TPP) are frequently detected inbiota, including fish. However, knowledge of the toxicological and molecular effects of these currentlyused flame retardants is limited. In the present study, an in vivo screening approach was developed to eval-uate effects of TDCPP and TPP on developmental endpoints and receptor-associated expression of mRNAin zebrafish embryos/larvae. Exposure to TDCPP or TPP resulted in significantly smaller rates of hatchingand survival, in dose- and time-dependent manners. The median lethal concentration (LC50) was 7.0 mg/Lfor TDCPP and 29.6 mg/L for TPP at 120 hour post-fertilization (hpf). Real-time PCR revealed alterations inexpression of mRNAs involved in aryl hydrocarbon receptors (AhRs)-, peroxisome proliferator-activatedreceptor alpha (PPAR�)-, estrogenic receptors (ERs)-, thyroid hormone receptor alpha (TR�)-, glucocorti-coid receptor (GR)-, and mineralocorticoid receptor (MR)-centered gene networks. Exposure to positivecontrol chemicals significantly altered abundances of mRNA in corresponding receptor-centered genenetworks, a result that suggests that it is feasible to use zebrafish embryos/larvae to evaluate effectsof chemicals on mRNA expression in these gene networks. Exposure to TDCPP altered transcriptional

profiles in all six receptor-centered gene networks, thus exerting multiple toxic effects. TPP was easilymetabolized and its potency to change expression of mRNA involved in receptor-centered gene networkswas weaker than that of TDCPP. The PPAR�- and TR�-centered gene networks might be the primary path-ways affected by TPP. Taken together, these results demonstrated that TDCPP and TPP could alter mRNAexpression of genes involved in the six receptor-centered gene networks in zebrafish embryos/larvae,and TDCPP seemed to have higher potency in changing the mRNA expression of these genes.

. Introduction

Organophosphate esters (OP esters) are a group of synthetichemicals that were widely used as flame retardants and plasticiz-rs in various products, such as plastics, foams, textiles, varnishes,lectronics equipment and furniture with high-production volume

orldwide (van der Veen and de Boer, 2012). Recently, the use ofP esters has been increasing gradually as other flame retardants

uch as penta- and octabrominated diphenyl ethers (PBDEs) have

∗ Corresponding authors at: School of the Environment, Nanjing University, Nan-ing 210093, China. Tel.: +86 13062571352.

E-mail addresses: liuchunshengidid@126.com (C. Liu), yuhx@nju.edu.cn (H. Yu).

166-445X/$ – see front matter © 2012 Elsevier B.V. All rights reserved.ttp://dx.doi.org/10.1016/j.aquatox.2012.12.010

© 2012 Elsevier B.V. All rights reserved.

been phased out of use (Reemtsma et al., 2008; van der Veen andde Boer, 2012).

Among OP esters, tris(1,3-dichloro-2-propyl) phosphate(TDCPP) and triphenyl phosphate (TPP) are commonly usedwith annual production in the United States been estimated tobe between 4.5 × 105 and 4.5 × 106 kg from 1986 to 1990, andincreased to between 4.5 × 106 and 2.3 × 107 kg in 1994, 1998,2002 and 2006 (U.S. Environmental Protection Agency InventoryUpdate Reporting, http://www.epa.gov/iur). Environmental moni-toring has demonstrated that TDCPP and TPP were distributed in

indoor air, surface water, drinking water, sediment, wildlife andhuman tissues (Andresen et al., 2004; Bacaloni et al., 2007; Caoet al., 2012; Chen et al., 2011; Hartmann et al., 2004; Marklundet al., 2005; Stackelberg et al., 2004; Sundkvist et al., 2010; van

1 gy 12

db51ld1

moTdMMfo(tsg(z(oa

pm(ddec2gcspeaF(cme

2

2

oBt(psUaRRwR(f

48 C. Liu et al. / Aquatic Toxicolo

er Veen and de Boer, 2012). For example, in Germany, TDCPP haseen detected in surface water at a maximum concentration of0 ng/L in the River Ruhr (Andresen et al., 2004). Concentrations of1 OP esters were measured in fishes and mussels from Swedish

akes and coastal areas, and TPP was one of the most frequentlyetected compounds, with concentrations ranging from 21 to80 ng/g lipid weight (Sundkvist et al., 2010).

Limited information is currently available on the thresholds andechanisms of toxicity of TDCPP and TPP. Results of epidemiol-

gy and controlled laboratory studies with animals suggest thatDCPP or/and TPP cause developmental toxicity and endocrine-isruption (Dishaw et al., 2011; C. Liu et al., 2012; X. Liu et al., 2012;cGee et al., 2012; Meeker and Stapleton, 2010). For example,cGee et al. (2012) reported that exposure to TDCPP (0.05–50 �M)

rom 5.25 hpf to 96 hpf in zebrafish embryos/larvae caused devel-pmental toxicity by altering embryogenesis, with a LC50 of 8.5 �M3.7 mg/L). C. Liu et al. (2012) and X. Liu et al. (2012) reportedhat exposure to TDCPP or TPP significantly up-regulated expres-ion of mRNA of genes involved in steroidogenesis and resulted inreater concentrations of both testosterone (T) and 17�-estradiolE2) in culture medium of H295R cells and in blood plasma ofebrafish. Using primary cultured avian hepatocytes, Crump et al.2012) demonstrated that TDCPP could alter abundances of mRNAf genes associated with phase I and II metabolism, lipid regulation,nd growth.

Coordinated expression of gene networks in various metabolic,hysiological, and developmental processes were, in large part,ediated by a superfamily of receptors, mostly nuclear receptors

McKenna and O’Malley, 2002). Results of multiple studies haveemonstrated that several environmental pollutants, such asioxin-like chemicals and estrogens, can bind to one or sev-ral receptors and alter related expression of mRNA that canause adverse effects on health (Ankley et al., 2010; Mandal,005; Mortensen and Arukwe, 2007). In the present study, 48enes involved in six receptor-centered gene networks wereollected from SABioscience Gene Network Central (http://www.abiosciences.com/genenetwork/genenetworkcentral.php) andrevious published data in fishes (Pellegrini et al., 2005; Zhangt al., 2008), and were integrated as “associations” and visualizeds networks as described in SABioscience Gene Network Central.urthermore, quantitative real-time polymerase chain reactionqRT-PCR) was developed to evaluate effects of six positive controlhemicals and two OP esters (TDCPP and TPP) on expression ofRNA of receptors and selected associated genes in zebrafish

mbryos/larvae.

. Materials and methods

.1. Materials and reagents

Perfluorooctanesulfonic acid potassium salt (PFOS) wasbtained from Tokyo Kasei Kogyo Co. Ltd. (Tokyo, Japan).enzo[a]pyrene (B[a]P), 17�-estradiol (E2), 3,3′,5-triiodo-l-hyronine (T3), dexamethasone (DEX), fludrocortisone acetateFCA), tris(1,3-dichloro-2-propyl) phosphate (TDCPP), triphenylhosphate (TPP) and 3-amino-benzoic acid ethyl ester, methane-ulfonate salt (MS-222) were purchased from Sigma (St. Louis, MO,SA). All chemicals were dissolved in dimethyl sulfoxide (DMSO)s stock solutions and stored in −20 ◦C. RNAlater RNA Stabilizationeagents were obtained from QIAGEN (Tokyo, Japan). GeneJETTM

NA Purification and Maxima® First Strand cDNA Synthesis Kits

ere purchased from Fermentas (St Leon-Rot, Germany). SYBR®

ealtime PCR Master Mix -Plus- Kits were purchased from ToyoboTokyo, Japan). Standards of TDCPP and TPP were purchasedrom Dr. Ehrenstorfer GmbH (Germany). Tributyl-D27-phosphate

8– 129 (2013) 147– 157

(TnBP-D27) was obtained from Cambridge Isotope Laboratories(UK).

2.2. Animals and chemical exposure protocol

Fertilization of eggs and culture of adult zebrafish (AB strain,6-month old) were performed as previously described (Liu et al.,2009; Shi et al., 2009). Eggs were examined under a stereo micro-scope and those exhibiting normal development were used forsubsequent experiments. Briefly, eggs were randomly distributedinto six-well culture plates. Each well contained 20 eggs, with10 mL of exposure solution. Eggs were exposed from 4 to 120 hourpost-fertilization (hpf), by which time they had developed into free-swimming larvae and most organs had completed development(Amsterdam et al., 2004). Each exposure concentration was repli-cated in four separate wells. Control groups received 0.01% DMSO(v/v). At 48 hpf exposure solutions were replaced by fresh water,or exposed to appropriate concentration and exposure continueduntil 120 hpf. For positive control chemicals, exposure concentra-tions were 10 �g B[a]P/L, 5 mg PFOS/L, 200 �g E2/L, 30 �g T3/L,25 mg DEX/L, and 25 mg FCA/L. These concentrations were selectedbased on published data or range-finding studies to determine con-centrations that significantly altered expression of correspondingreceptor-associated mRNAs (Duarte-Guterman et al., 2010; Kazetoet al., 2004; Krøvel et al., 2008; J. Wang et al., 2011; X. Wang et al.,2011; Tseng et al., 2005). For TDCPP and TPP, exposure experimentsincluded two parts. First, zebrafish embryos were exposed to 0, 0.8,4, 20, 100 or 500 mg/L TDCPP or TPP from 4 to 120 hpf, and rates ofhatching and survival monitored. Second, based on the results of theacute toxicity test, a different set of zebrafish embryos was exposedto 0.02, 0.2 or 2 mg/L TDCPP or TPP from 4 to 120 hpf, and effectson expression of mRNA of genes in six receptor-centered networkswere determined. After exposure, larvae were anesthetized withMS-222, and preserved in RNAlater RNA Stabilization Reagents forsubsequent total RNA isolation.

2.3. Quantification of TDCPP or TPP in exposure solutions

In acute toxicity test, exposure solutions were collected at 4,48(1) (prior to renewing of exposure solutions), 48(2) (after renew-ing of exposure solutions) and 120 hpf in 0.8-mg/L treatment groupfor TDCPP or TPP measurement. Concentrations of TDCPP or TPP inexposure solutions were also determined at 48(2) (after renewingof exposure solutions) and 120 hpf when zebrafish embryos wereexposed to 0.02, 0.2 and 2 mg/L TDCPP or TPP. Quantification ofTDCPP or TPP was performed using a published protocol (J. Wanget al., 2011; X. Wang et al., 2011). Briefly, exposure solutions werefiltered through 0.22 �m nylon membrane filters (Jiuding High-Tech Filtration, China), and the filtered samples were immediatelyused for LC–MS/MS analysis. The calibration and quantificationwere performed by using an internal standard method with TDCPPor TPP standard prepared in water/acetonitrile (60/40), with TnBP-D27 internal standard.

2.4. Quantitative real-time polymerase chain reaction (qRT-PCR)

Total RNA was isolated from larvae using GeneJETTM RNAPurification kits following the manufacturer’s instructions. Concen-tration of total mRNA was determined and quality was verifiedby use of a previously reported protocol (C. Liu et al., 2012; X.Liu et al., 2012). Syntheses of first-strand cDNA and qRT-PCRwere performed by use of Maxima® First Strand cDNA Synthe-

sis and SYBR® Realtime PCR Master Mix -Plus- Kits accordingto the manufacturer’s instructions (C. Liu et al., 2012; X. Liuet al., 2012). Sequences for primers were designed using Primer3 software (http://frodo.wi.mit.edu/as) (Table S1). Housekeeping

gy 128– 129 (2013) 147– 157 149

g1cmfwmrci

2

twwcImD

3

3

t(ota4t

oroart0

3

as5Rw

io4T2r5l04iomw

Fig. 1. Cumulative survival (A and B) and hatching (C) of zebrafish embryos/larvaeexposed to 0, 0.8, 4, 20, 100 or 500 mg/L tris(1,3-dichloro-2-propyl) phosphate

C. Liu et al. / Aquatic Toxicolo

enes glyceraldehyde-3-phosphate dehydrogenase (GAPDH) and8S small subunit ribosomal RNA (18S rRNA) did not vary uponhemical exposure and were used as internal controls. The ther-al cycle was set at 95 ◦C for 2 min, followed by 40 cycles of 95 ◦C

or 15 s and 60 ◦C for 1 min. The mRNA expression level of geneas normalized to housekeeping mRNA contents using the 2−��Ct

ethod. The average cycle threshold (Ct) value of GAPDH and 18SRNA was used for the expression calculation of target genes. Eachoncentration included four biological replicates and each replicatencluded 15 larvae.

.5. Statistical analyses

Normality and homogeneity of data were evaluated by use ofhe Kolmogorov–Smirnow and Levene’s tests, respectively. One-ay analysis of variance (ANOVA) and Tukey’s multiple range testere used to determine the significant differences between the

ontrol and each exposure group. A level of significance for type error (˛) was set at P-value < 0.05. All data were expressed as

ean ± SEM. The statistical analyses were conducted using Kyplotemo 3.0 software (Tokyo, Japan)

. Results

.1. Quantification of TDCPP or TPP in exposure solutions

In time-course study, mean concentrations of TDCPP in 0.8-mg/Lreatment group were 0.80, 0.74, 0.84 and 0.80 mg/L at 4, 48(1)prior to renewing of exposure solutions), 48(2) (after renewingf exposure solutions), and 120 hpf, respectively. Mean concen-rations of TPP in 0.8-mg/L treatment group were 0.83, 0.79, 0.80nd 0.00 mg/L at 4, 48(1) (prior to renewing of exposure solutions),8(2) (after renewing of exposure solutions), and 120 hpf, respec-ively. No TDCPP or TPP were detected in control groups.

Based on results above, we measured concentrations of TDCPPr TPP in 0.02, 0.2 and 2 mg/L treatment groups at 48(2) (afterenewing of exposure solutions) and 120 hpf. Mean concentrationsf TDCPP in 0.02, 0.2 and 2 mg/L treatment groups were 0.02, 0.19nd 1.96 mg/L at 48(2) hpf and 0.02, 0.17 and 1.89 mg/L at 120 hpf,espectively. Mean concentrations of TPP in 0.02, 0.2 and 2 mg/Lreatment groups were 0.02, 0.19 and 1.80 mg/L at 48(2) hpf and.00, 0.00 and 1.39 mg/L at 120 hpf, respectively.

.2. Acute toxicity

No significant effects on rates of hatching of eggs or survivalnd malformation (spinal curvature, pericardial edema and yolkac edema) of larvae were observed after exposure to 10 �g B[a]P/L,

mg PFOS/L, 200 �g E2/L, 30 �g T3/L, 25 mg DEX/L, or 25 mg FCA/L.ates of hatching and survival were >90% and rate of malformationas <5% in all exposure groups including controls.

Exposure to TDCPP caused dose- and time-dependent decreasen the rate of hatching and survival (Fig. 1). No significant effectsn survival were observed in embryos/larvae exposed to 0.8 or

mg/L 12, 24, 48, 72, 96 and 120 hpf. However, exposure to 20 mg/LDCPP resulted in significantly lesser survival by 18.2%, 20.1%,0.1%, 100% and 100% at 24, 48, 72, 96 and 120 hpf, respectively,elative to the control. Exposure to greater concentrations (100 or00 mg/L) caused 100% mortality by 12 hpf. The 120-hpf median

ethal concentration (LC50) was 7.0 mg TDCPP/L. Treatment with.8 or 4 mg/L TDCPP did not significantly alter rates of hatching at8, 54, 60 or 72 hpf. However, significantly lower rates of hatch-

ng were observed at 54, 60 and 72 hpf when exposed to 20, 100r 500 mg/L. No significant effects on hatching, survival or malfor-ation (spinal curvature, pericardial edema and yolk sac edema)ere observed when exposed to 0.02, 0.2 or 2 mg/L TDCPP. Rates

(TDCPP). Values represent mean ± SEM (n = 4 samples). .Significant difference fromthe control group is indicated by *P < 0.05.

of hatching and survival were >90% and rate of malformation was<5% in all exposure groups including controls.

TPP caused dose- and time-dependent decrease in the rate ofhatching and survival (Fig. 2). At 12, 24 and 48 hpf exposure to 0.8,4, 20, 100 or 500 mg TPP/L caused no significant effects on ratesof hatching and survival. However, at 72, 96 and 120 hpf, exposureto 100 or 500 mg TPP/L resulted in 100% mortality. The LC50 was29.6 mg TPP/L at 120 hpf. Rates of hatching at 48 hpf were not sig-nificantly different from that of the control, when exposed to 0.8, 4,20, 100 or 500 mg TPP/L. However, treatment with 100 or 500 mg

TPP/L resulted in significantly lesser rates of hatching that was 100%at 54 hpf. No significant effects on rates of survival, hatching or mal-formation (spinal curvature, pericardial edema and yolk sac edema)were observed when exposed to 0.02, 0.2 or 2 mg TPP/L. Rates of

150 C. Liu et al. / Aquatic Toxicology 12

Fig. 2. Cumulative survival (A and B) and hatching (C) of zebrafish embryos/larvaeexposed to 0, 0.8, 4, 20, 100 or 500 mg/L tris(1,3-dichloro-2-propyl) phosphate (TPP).Vg

hi

3

ewu((c(

alues represent mean ± SEM (n = 4 samples). Significant difference from the controlroup is indicated by *P < 0.05.

atching and survival were >90% and rate of malformation was <5%n all exposure groups including controls.

.3. Transcriptional responses to positive control chemicals

Exposure to positive cont1rol chemicals significantly alteredxpression of mRNA of genes in the six receptor-centered net-orks (Table S2 and Fig. 3). Exposure to 10 �g B[a]P/L significantlyp-regulated mRNA expression of aryl hydrocarbon receptor 1b

AhR1b), aryl hydrocarbon receptor 2 (AhR2), AhR repressor aAhRRa), aryl hydrocarbon receptor interacting protein (AIP),ytochrome P450 1A1 (CYP1A1), nuclear receptor co-repressor 2NCOR2), cytochrome P450 1B1 (CYP1B1) and sp1 transcriptional

8– 129 (2013) 147– 157

factor (SP1) genes by 2.3-, 2.2-, 1.4-, 1.2-, 2.5-, 1.3-, 1.6- and 1.3-fold,respectively. Exposure to 5 mg PFOS/L significantly up-regulatedthe expression of mRNA of peroxisome proliferator-activatedreceptor alpha (PPAR�) (1.7-fold), lipoprotein lipase (LPL) (2.0-fold), interleukin 8 (IL8) (1.4-fold) and interleukin 6 (IL6) (5.3-fold)genes, while mRNA expression of dUTP pyrophosphatase (DUT)gene was significantly down-regulated by 0.6-fold. Expression ofmRNA of other genes, such as peroxisome proliferator-activatedreceptor gamma coactivator 1 alpha (PPARgc1a) and peroxisomeproliferator-activated receptor gamma (PPARg) gene were notaltered by exposure to PFOS. Significant up-regulation of expres-sion of mRNA of estrogen receptor 1 (ER1) (2.1-fold), estrogenreceptor 2b (ER2b) (1.7-fold), vitellogenin 1 (VTG1) (9.8-fold),vitellogenin 2 (VTG2) (6.1-fold), vitellogenin 4 (VTG4) (40.8-fold),vitellogenin 5 (VTG5) (9.0-fold), and progesterone receptor (PGR)(2.1-fold) genes were observed upon exposure to 200 �g E2/L,while expressions of mRNA of estrogen receptor 2a (ER2a) andcyclin D1 (CCND1) genes were significantly down-regulated by0.6- and 0.7-fold, respectively. Treatment with thyroid hormoneat a concentration of 30 �g T3/L significantly up-regulated expres-sion of mRNA of thyroid hormone receptor alpha (TR�) (4.9-fold),PPARgc1a (1.3-fold), NCOR (1.3-fold), C1D nuclear receptor core-pressor (C1D) (1.3-fold), NCOR2 (1.4-fold) and histone deacetylase3 (HDAC3) (1.3-fold) genes, while mRNA expression of fusion (FUS)gene was not significantly altered. Exposure to 25 mg/L of theglucocorticoid receptor (GR) agonist DEX caused significant up-regulation of mRNA expression of GR (2.1-fold), heparanase (HPSE)(1.9-fold), P65 transcriptional factor (RelA) (1.6-fold), and heatshock protein alpha, class 1 member 1 (HSP90aa1) (1.2-fold) genes,while mRNA expression of death-associated protein 3 (DAP3) andtransforming growth factor beta 1 (TGFb1) genes was not sig-nificantly changed. Exposure to 25 mg/L of the mineralocorticoidreceptor (MR) agonist FCA significantly up-regulated expression ofmRNA of MR (2.7-fold), HPSE (2.2-fold), adrenergic receptor beta 2a(ADRB2a) (1.7-fold) and epidermal growth factor receptor (EGFR)(1.6-fold) genes, while expression of mRNA of 11 beta hydrox-ysteroid dehydrogenase (11�HSD), adrenergic receptor beta 2b(ADRB2b) and ubiquitin-conjugating enzyme 2I (UBE2I) genes werenot changed.

3.4. Transcriptional responses to TDCPP

Exposure to TDCPP caused dose-dependent alterations inexpression of mRNA related to the following receptor-centeredgene networks: AhRs, PPAR�, ERs, TR�, GR and MR (Table S2 andFig. 4). Exposure to the two concentrations of TDCPP caused sig-nificant up-regulation in expression of mRNA of AhR1b (1.2- and1.2-fold), AIP (1.2- and 1.5-fold), aryl hydrocarbon receptor nucleartranslocator 2 (ARNT2) (1.2- and 1.7-fold), aryl hydrocarbon recep-tor nuclear translocator-like 1a (ARNTl1a) (1.5- and 2.0-fold), arylhydrocarbon receptor nuclear translocator-like 1b (ARNTl1b) (1.5-and 2.1-fold), NCOR2 (1.3- and 1.5-fold), CYP1B1 (1.3- and 1.4-fold)and SP1 (1.3- and 1.4-fold) genes in 0.2 and 2 mg/L exposure groups.TDCPP significantly up-regulated mRNA expression of all of thegenes selected for the PPAR�-centered gene network, in a dose-dependent manner. PPARgc1a and LPL mRNA expressions weresignificantly up-regulated by 1.4- and 2.1-fold, and 1.3- and 2.0-fold when exposed to 0.2 or 2 mg TDCPP/L, respectively. Exposureto 0.02 mg TDCPP/L significantly up-regulated expression of mRNAsof ER1 (1.8-fold), ER2b (1.5-fold), VTG1 (1.8-fold), VTG2 (1.9-fold),VTG4 (2.0-fold), VTG5 (2.2-fold) and PGR (1.8-fold) genes. No sig-nificant effects were observed at the two greatest concentrations

(0.2 and 2 mg/L). TDCPP caused significant up-regulation of expres-sion of mRNA of ER2a, NCOA1, NCOA2, NCOA3, and CCND1 genesrelative to the control in larvae exposed to 0.2 or 2 mg/L. TDCPPsignificantly up-regulated expression of mRNA of genes in the

C. Liu et al. / Aquatic Toxicology 128– 129 (2013) 147– 157 151

Fig. 3. Receptor-centered gene networks modified from SABioscience Gene Network Central (http://www.sabiosciences.com/genenetwork/genenetworkcentral.php) andeffects of (A) 10 �g B[a]P/L (benzo[a]pyrene), (B) 5 mg PFOS/L (heptadecafluorooctanesulfonic acid potassium salt), (C) 200 �g E2/L (17�-estradiol), (D) 30 �g T3/L (3,3′ ,5-triiodo-l-thyronine), (E) 25 mg DEX/L (dexamethasone), and (F) 25 mg FCA/L (fludrocortisone acetate) on expression of mRNA of selected genes in embryos/larvae ofzebrafish. Physical interaction: a relationship where two gene products are interacting with each other physically; up-regulation: activating types of functional and tran-scriptional regulations; down-regulation: inhibiting types of functional and transcriptional regulations; other: relationships where the type has not been yet classified;regulation: functional and transcriptional regulations where the regulation has not been identified as inhibiting or activating; co-expression: genes whose expressions havebeen shown to be positively or negatively correlated in microarray experiments; chemical modification: phosphorylations, acetylations, ubiquinations, and other typesof post-translational modification; predicted protein interaction: protein interactions that have been predicted through computational algorithms; predict TF regulation:transcriptional regulations where cis-regulatory element for a given transcription factor (TF) have been found in the promoter of a target gene.

152 C. Liu et al. / Aquatic Toxicology 128– 129 (2013) 147– 157

(Cont

TaPaag

Fig. 3.

R�-centered gene network. The following effects were observedt different concentrations of TDCPP: TR� (1.2- and 1.6-fold),

PARgc1a (1.4- and 2.1-fold), NCOR (1.2- and 1.4-fold), C1D (1.2-nd 1.4-fold), NCOR2 (1.3- and 1.5-fold), HDAC3 (1.2- and 1.4-fold)nd FUS (1.5- and 1.8-fold) in 0.2 or 2 mg/L. In the GR-centeredene network, a significant up-regulation in the mRNA expression

inued)

of GR (1.3- and 1.3-fold), DAP3 (1.3- and 1.8-fold), RelA (1.3- and1.5-fold), TGFb1 (1.3- and 1.5-fold), and HSP90aa1 (1.2- and 1.9-

fold) genes was observed upon exposure to 0.2 or 2 mg/L TDCPP.Exposure to 2 mg TDCPP/L significantly up-regulated expression ofmRNAs of MR, 11�HSD, ADRB2a and UBE2I genes by 1.2-, 1.4-, 1.3-and 1.6-fold, respectively.

C. Liu et al. / Aquatic Toxicology 128– 129 (2013) 147– 157 153

Fig. 3. (Continued)

3

,(ia

.5. Transcriptional responses to TPP

TPP caused transcriptional responses mainly in AhRs-, PPAR�-

TR�-, GR- and MR-centered gene networks in the present studyTable S2 and Fig. 4). Exposure to 2 mg TPP/L resulted in signif-cant up-regulation of expression of mRNA of CYP1A1, NCOR2nd CYP1B1 genes by 1.7-, 1.5- and 1.4-fold, respectively. In the

PPAR�- and TR�-centered gene networks, expressions of mRNA forPPAR�, PPARgc1a, LPL, IL6, PPARg, TR�, and NCOR2 genes were up-regulated by 1.2-, 1.3-, 1.8-, 3.9-, 1.2-, 1.4- and 1.5-fold, respectively,

after exposure to 2 mg TPP/L. Exposure to 2 mg TPP/L also up-regulated expression of mRNA of RelA, TGFb1, HSP90aa1, 11�HSDand EGFR genes, while expression of MR and HPSE genes was down-regulated.

154 C. Liu et al. / Aquatic Toxicology 128– 129 (2013) 147– 157

F P) andc

4

edRiatama

oGsecf2tpat

ig. 4. Dose-dependent effects of (A) tris(1,3-dichloro-2-propyl) phosphate (TDCPentered gene networks in zebrafish embryos/larvae.

. Discussion

Results of previous studies have suggested that zebrafishmbryos/larvae could be used as a model to investigate endocrine-isrupting effects of chemicals (Chen et al., 2012; Jin et al., 2009;aldúa and Babin, 2009; Yu et al., 2010). In this study, 48 genes

nvolved in six receptor-centered gene networks were collected,nd integrated as “associations” and visualized as networks. Fur-hermore, to evaluate the effects of six positive control chemicalsnd two organophosphate esters (OP esters: TDCPP and TPP) onRNA expression along these constructed gene networks, a PCR

rray was developed for zebrafish embryos/larvae.Exposure to positive control chemicals B[a]P, PFOS, E2, T3, DEX

r FCA altered expression of mRNA in AhRs-, PPAR�-, ERs-, TR�-,R- and MR-centered gene networks, respectively. These resultsuggested that 5-day old zebrafish larvae could be used to evaluateffects of chemicals on transcription of genes in these receptor-entered gene networks. AhR is a ligand-activated transcriptionactor that mediates responses to numerous chemicals, such as,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). In zebrafish, there are

hree AhR genes, AhR1a, AhR1b and AhR2. The AhR1b and AhR2roteins were capable of high-affinity binding of TCDD and causedssociated transcriptional responses, while AhR1a does not appearo be capable of binding TCDD (Andreasen et al., 2002; Karchner

(B) triphenyl phosphate (TPP) on expression of mRNA for genes in six receptor-

and Franks, 2005). Therefore, in the present study, AhR1b andAhR2 were selected and the AhRs-centered gene network wasconstructed. Exposure to AhR agonists, such as TCDD and B[a]P up-regulated expression of AhR, AhRR, AIP, CYP1A1, NCOR2, SP1 andCYP1B1 (Hakkola et al., 1997; Huang et al., 2002; Jin et al., 2012;Ma, 1997; Tsuchiya et al., 2003; Zhang et al., 2006). Those resultsare consistent with the findings of the study reported upon here.Exposure to B[a]P can significantly up-regulate expression of mRNAfor ARNT in mouse hepatoma Hepa1c1c7 cells (Ko et al., 2004).However, no significant alterations in expression of ARNTl1a,ARNTl1b or ARNT2 mRNAs were observed in the present study.The reasons for this are not known. There are complicated regula-tion/interaction relationships between AhRs and ARNTs accordingto the constructed gene network. Therefore, additional studiesmight be needed to clarify the relationship between AhRs andARNTs in zebrafish embryos/larvae after B[a]P exposure in future.Furthermore, exposure to TPP did not alter expression of mRNAof AhR1b or AhR2, but expressions of mRNA of CYP1A1, NCOR2and CYP1B1 were significantly up-regulated in 2-mg/L exposuregroup. Therefore, time-course experiments with mRNA and protein

might be needed to understand mechanisms. Exposure to TDCPPsignificantly up-regulated expression of mRNA for AhR1b and allassociated genes: AhRRa, AhRRb, AIP, ARNT2, ARNTl1a, ARNTl1b,CYP1A1, NCOR2, CYP1B1 and SP1 in a dose-dependent manner.

gy 128

Tet

idptImsaoPbeDnosombaTsw

isIEiasVspgmV(orTuszwunurrie2bsofdpwsr

C. Liu et al. / Aquatic Toxicolo

hese results suggested that, at least, TDCPP could up-regulatexpression of mRNA of AhR1b gene and increase abundances ofranscriptions of associated genes.

PPAR� belongs to the nuclear receptor super-family and isnvolved in lipid homeostasis, inflammation, adipogenesis, repro-uction, wound healing and carcinogenesis (Abbott, 2009). In theresent study, six genes that were demonstrated to have interac-ion/regulation relationships with PPAR� were selected. IL6 andL8 are involved in immune responses and LPL is involved in

etabolism of lipids (Moyes et al., 2009). In the present study, expo-ure to the PPAR� agonist PFOS resulted in significantly greaterbundances of mRNA of PPAR�, LPL, IL6 and IL8 genes. The resultsf previous studies have also demonstrated that treatment withFOS could up-regulate expression of mRNA for IL6 and LPL genesoth in vivo and in vitro, which resulted in immunotoxicity (DeWittt al., 2009; Krøvel et al., 2008; Liao et al., 2012; Wan et al., 2012).UT catalyses hydrolysis of dUTP to dUMP in the presence of mag-esium ions, and is responsible for maintaining balance of poolsf free nucleotides in cells (McCarthy et al., 2009). In the presenttudy exposure to PFOS significantly down-regulated expressionf mRNA of DUT gene, a result that is opposite to the effect onRNA expression of PPAR� gene. Therefore, further study might

e needed to clarify the relationship between PPAR� and DUTfter PFOS exposure. In the present study exposure to TDCPP orPP significantly up-regulated expression of mRNA of PPAR� andeveral other genes involved in the PPAR�-centered gene net-ork.

ERs are transcriptional factors that can regulate target genesnvolved in reproduction, development, metabolism and homeo-tasis in vertebrates (Shibata et al., 1997; McKenna et al., 1999).n zebrafish, there are three ER genes, encoding ER1, ER2a andR2b. Each protein can bind E2 and transactivate reporter genes

n vitro (Menuet et al., 2002). However, specific functions and mech-nisms of action of these three ERs remain unknown. In the presenttudy, three ER and nine associated genes, those encoding VTG1,TG2, VTG4, VTG5, NCOA1, NCOA2, NCOA3, PGR and CCND1, wereelected based on the information from Gene Network Central andrevious published results of studies with fishes and were inte-rated as “associations”. Exposure to E2 significantly up-regulatedRNA expressions of ER1 (ER�), ER2b (ER�2), VTG1, VTG2, VTG4,TG5 and PGR, and down-regulated mRNA expressions of ER2a

ER�1) and CCND1 in 5-day zebrafish larvae. mRNA expressionsf NCOAs (NCOA1, NCOA2 and NCOA3) were not changed. Theseesults suggest that different ERs might have different functions.he results of a previous study demonstrated that E2 exposurep-regulated ER� expression and down-regulated ER�1 expres-ion, while expression of ER�2 remained unchanged in liver ofebrafish (Menuet et al., 2004). In the present study when embryosere exposed to TPP, mRNA expression of only ER2b was slightlyp-regulated, while mRNA expression of other genes was not sig-ificantly altered. However, exposure to TDCPP caused significantp-regulation of mRNA expression of all the genes selected, aesult that suggests that TDCPP might have estrogenic activity. Theesults of a previous study have also demonstrated that TDCPP canncrease the concentration of E2 in blood plasma and up-regulatexpression of VTG in zebrafish (C. Liu et al., 2012; X. Liu et al.,012). Our results suggest, according to integrated “associations”etween these genes in this study, that up-regulation of expres-ion of VTGs and PGR might have resulted from up-regulationf ER1 and ER2b, and up-regulation of ER2a might be the resultrom up-regulation of expression of NCOAs. When exposed to E2own-regulation of mRNA expression of ER2a gene was accom-

anied by down-regulation of mRNA expression of CCND1 gene,hile mRNA expression of NCOA genes was not affected. This result

uggests that down-regulation of expression of CCND1 might beesponsible for the observed down-regulation of expression of ER2a

– 129 (2013) 147– 157 155

after exposure to E2. Collectedly, the results demonstrated thatTDCPP could up-regulate mRNA expressions of ER1, ER2b and otherassociated genes, such as VTGs, and thus might have estrogenicactivity.

Thyroid hormones, thyroxine (T4) and triiodothyronine (T3) areproduced by the thyroid gland, and their roles in development andmetabolism have been well established in vertebrates (Power et al.,2001). The two hormones (T4 and T3) exert their major effects bybinding to their receptors (TRs), such as TR� in zebrafish (Poweret al., 2001). In this study, six genes were selected and integratedas “associations”. Exposure to T3 up-regulated mRNA expression ofall the genes selected except for FUS, which suggests that the TR�-associated pathway was responsible for exposure to TR agonists in5-day zebrafish larvae. Treatment with TPP or TDCPP caused tran-scriptional responses in the TR�-associated pathway, where TDCPPhad greater potency. The results of an epidemiology study sug-gested that TDCPP and TPP might had thyroid system-disruptingactivity, where TDCPP and TPP concentrations in dust were corre-lated with the concentrations of free T4 in human plasma (Meekerand Stapleton, 2010). The results of the correlation analysis sug-gested that TDCPP and TPP could modulate functions of the thyroidsystem by interacting with TR�. Steroid hormones, including glu-cocorticoids and mineralocorticoids, are essential for regulationof diverse physiological functions, such as glucose metabolism,mineral balance, and behavior (Greenwood et al., 2003). Glucocorti-coids and mineralocorticoids exert their major effects by binding totheir receptors (GR and MR, respectively), thus resulting in alter-ations in down-stream transcription (Greenwood et al., 2003). Inthe present study, exposure to GR or MR agonist significantly up-regulated mRNA expression of several genes involved in GR- orMR-centered gene networks, which suggests that it is feasible touse 5-day old zebrafish larvae to evaluate effects of chemical on GR-and MR-associated mRNA expression. Treatment with TDCPP orTPP significantly up-regulated expression of GR and MR and severalother genes involved in the two gene networks.

In summary, the results of this study confirmed that 5-day oldzebrafish larvae could be used to evaluate the effects of chem-icals on mRNA expression in AhR-, PPAR�-, ER-, TR�-, GR- andMR-centered gene networks. Exposure to TDCPP altered profilesor relative abundances of transcripts of all the receptor-centeredgene networks studied. TPP was less potent compared withTDCPP, and the PPAR�- and TR�-centered gene networks werethe primary targets for TPP. Furthermore, TPP could be easilymetabolized by zebrafish larvae, which might be primary reasonfor weaker potency in altering expression of mRNAs involved inreceptor-centered gene networks compared with TDCPP. In addi-tion, concentrations of TDCPP or TPP that we determined to beeffective in expression of mRNAs involved in six receptor-centeredgene networks in this study were several orders of magnitudegreater than those reported in the water environment (Andresenet al., 2004; van der Veen and de Boer, 2012). Therefore, directeffects of TDCPP or TPP on expression of mRNA involved in thesereceptor-centered networks might not be expected at their currentlevels of occurrence.

Acknowledgements

This work was supported by grants from the National NaturalScience Foundation of China (21207063) and the Natural ScienceFoundation of Jiangsu Province, China (BK2011032, BK2010384).Prof. Giesy was supported by the Canada Research Chair program,

an at large Chair Professorship at the Department of Biology andChemistry and State Key Laboratory in Marine Pollution, City Uni-versity of Hong Kong, and the Einstein Professor Program of theChinese Academy of Sciences.

1 gy 12

A

fj

R

A

A

A

A

A

B

C

C

C

C

D

D

D

G

H

H

H

J

J

K

K

56 C. Liu et al. / Aquatic Toxicolo

ppendix A. Supplementary data

Supplementary data associated with this article can beound, in the online version, at http://dx.doi.org/10.1016/.aquatox.2012.12.010.

eferences

bbott, B.D., 2009. Review of the expression of peroxisome proliferator-activatedreceptors alpha (PPAR�), beta (PPAR�), and gamma (PPAR�) in rodent andhuman development. Reproductive Toxicology 27, 246–257.

msterdam, A., Nissen, R.M., Sun, Z., Swindell, E.C., Farrington, S., Hopkins, N., 2004.Identification of 315 genes essential for early zebrafish development. Proceed-ings of the National Academy of Sciences of the United States of America 101,12792–12797.

ndreasen, E.A., Spitsbergen, J.M., Tanguay, R.L., Stegeman, J.J., Heideman, W.,Peterson, R.E., 2002. Tissue-specific expression of AHR2, ARNT2, and CYP1Ain zebrafish embryos and larvae: effects of developmental stage and 2,3,7,8-tetrachlorodibenzo-p-dioxin exposure. Toxicological Sciences 68, 403–419.

ndresen, J.A., Grundmann, A., Bester, K., 2004. Organophosphorus flame retar-dants and plasticisers in surface waters. Science of the Total Environment 332,155–166.

nkley, G.T., Bennett, R.S., Erickson, R.J., Hoff, D.J., Hornung, M.W., Johnson, R.D.,Mount, D.R., Nichols, J.W., Russom, C.L., Schmieder, P.K., Serrrano, J.A., Tietge, J.E.,Villeneuve, D.L., 2010. Adverse outcome pathways: a conceptual framework tosupport ecotoxicology research and risk assessment. Environmental Toxicologyand Chemistry 29, 730–741.

acaloni, A., Cavaliere, C., Foglia, P., Nazzari, M., Samperi, R., Lagana, A., 2007. Liquidchromatography/tandem mass spectrometry determination of organophospho-rus flame retardants and plasticizers in drinking and surface waters. RapidCommunications in Mass Spectrometry 21, 1123–1130.

ao, S., Zeng, X., Song, H., Li, H., Yu, Z., Sheng, G., Fu, J., 2012. Levels and distributionsof organophosphate flame retardants and plasticizers in sediment from TaihuLake, China. Environmental Toxicology Chemistry 31, 1478–1484.

hen, D., Letcher, R.J., Chu, S., 2011. Determination of non-halogenated, chlorinatedand brominated organophosphate flame retardants in herring gull eggs basedon liquid chromatography–tandem quadrupole mass spectrometry. Journal ofChromatography A 1220, 169–174.

hen, Q., Yu, L., Yang, L., Zhou, B., 2012. Bioconcentration and metabolism of decarbo-modiphenyl ether (BDE-209) result in thyroid endocrine disruption in zebrafishlarvae. Aquatic Toxicology 110, 141–148.

rump, D., Chiu, S., Kennedy, S.W., 2012. Effects of tris(1,3-dichloro-2-propyl) phos-phate and tris(1-chloropropyl) phosphate on cytotoxicity and mRNA expressionin primary cultures of avian hepatocytes and neuronal cells. Toxicological Sci-ences 126, 140–148.

eWitt, J.C., Shnyra, A., Badr, M.Z., Loveless, S.E., Hoban, D., Frame, S.R., Cunard, R.,Anderson, S.E., Meade, B.J., Peden-Adams, M.M., Luebke, R.W., Luster, M.I., 2009.Immunotoxicity of perfluorooctanoic acid and perfluorooctane sulfonate andthe role of peroxisome proliferator-activated receptor alpha. Critical Reviews inToxicology 39, 76–94.

ishaw, L.V., Powers, C.M., Ryde, I.T., Roberts, S.C., Seidler, F.J., Slotkin, T.A., Stapleton,H.M., 2011. Is the pentaBDE replacement, tris(1,3-dichloro-2-propyl) phosphate(TDCPP), a developmental neurotoxicant? Studies in PC12 cells. Toxicology andApplied Pharmacology 256, 281–289.

uarte-Guterman, P., Langlois, V.S., Pauli, B.D., Trudear, V.L., 2010. Expression andT3 regulation of thyroid hormone- and sex steroid-related genes during silurana(Xenopus) tropicalis early development. General and Comparative Endocrinol-ogy 166, 428–435.

reenwood, A.K., Butler, P.C., White, R.B., Demarco, U., Pearce, D., Fernald, A.D., 2003.Multiple corticosteroid receptors in a teleost fish: distinct sequences, expressionpatterns, and transcriptional activities. Endocrinology 144, 4226–4236.

akkola, J., Pasanen, M., Pelkonen, O., Hukkanen, J., Evisalmi, S., Anttila, S., Rane, A.,Mäntylä, M., Purkunen, R., Saarikoski, S., Tooming, M., Raunio, H., 1997. Expres-sion of CYP1B1 in human adult and fetal tissues and differential inducibility ofCYP1B1 and CYP1A1 by Ah receptor ligands in human placenta and culturedcells. Carcinogenesis 18, 391–397.

artmann, P.C., Burgi, D., Giger, W., 2004. Organophosphate flame retardants andplasticizers in indoor air. Chemosphere 57, 781–787.

uang, P., Ceccatelli, S., Håkansson, H., Grandison, L., Rannug, A., 2002. Constitutiveand TCDD-induced expression of Ah receptor-responsive genes in the pituitary.Neurotoxicology 23, 783–793.

in, K., Park, C.M., Lee, Y., 2012. Identification of differentially expressed genes by2,3,7,8-tetrachlorodibenzo-p-dioxin in human bronchial epithelial cells. Humanand Experimental Toxicology 31, 107–112.

in, Y., Chen, R., Sun, L., Qian, H., Liu, W., Fu, Z., 2009. Induction of estrogen-responsive gene transcription in the embryo, larval, juvenile and adult lifestages of zebrafish as biomarkers of short-term exposure to endocrine disruptingchemicals. Comparative Biochemistry and Physiology 150C, 414–420.

archner, S.I., Franks, D.G., hahn, M.E., 2005. AHR1B, a new functional aryl hydro-

carbon receptor in zebrafish: tandem arrangement of ahr1b and ahr2 genes.Biochemistry Journal 15, 153–161.

azeto, Y., Place, A.R., Trant, J.M., 2004. Effects of endocrine disrupting chemicalson the expression of CYP19 genes in zebrafish (Danio rerio) juveniles. AquaticToxicology 69, 25–34.

8– 129 (2013) 147– 157

Ko, C., Kim, S., Park, C., Kim, B., Shin, C., Choi, S., Chung, S., Noh, J., Jeun, J., Kim,N., Park, R., 2004. Benzo(a)pyrene-induced apoptotic death of mouse hepatomaHepa1c1c7 cells via activation of intrinsic caspase cascade and mitochondrialdysfunction. Toxicology 199, 35–46.

Krøvel, A.V., Søfteland, L., Torstensen, B., Olsvik, P.A., 2008. Transcriptional effects ofPFOS in isolated hepatocytes from Atlantic salmon Salmo salar L. ComparativeBiochemistry and Physiology 148C, 14–22.

Liao, Y., Wang, J., Huang, Q., Fang, C., Kiyama, R., Shen, H., Dong, S., 2012. Evalua-tion of cellular response to perfluorooctane sulfonate in human umbilical veinendothelial cells. Toxicology In Vitro 26, 421–428.

Liu, C., Yu, L., Deng, J., Lam, P.K.S., Wu, R.S.S., Zhou, B., 2009. Waterborne exposureto fluorotelomer alcohol 6:2 FTOH alters plasma sex hormone and gene tran-scription in the hypothalamic-pituitary-gonadal (HPG) axis of zebrafish. AquaticToxicology 93, 131–137.

Liu, C., Yan, W., Zhou, B., Guo, Y., Liu, H., Yu, H., Giesy, J.P., Wang, J., Li,G., Zhang, X., 2012. Characterization of a bystander effect induced by theendocrine-disrupting chemical 6-propyl-2-thiouracil in zebrafish embryos.Aquatic Toxicology 118, 108–115.

Liu, X., Ji, K., Choi, K., 2012. Endocrine disruption potentials of organophosphateflame retardants and related mechanisms in H295R and MVLN cell lines and inzebrafish. Aquatic Toxicology 114, 173–181.

Ma Jr., Q.J.P.W., 1997. A novel cytoplasmic protein that interacts with the Ah recep-tor, contains tetratricopeptide repeat motifs, and augments the transcriptionalresponse to 2,3,7,8-tetrachlorodibenzo-p-dioxin. Journal of Biological Chemistry272, 8878–8884.

Mandal, P.K., 2005. Dioxin: a review of its environmental effects and its aryl hydro-carbon receptor biology. Journal of Comparative Physiology 175B, 221–230.

Marklund, A., Andersson, B., Haglund, P., 2005. Organophosphorus flame retardantsand plasticizers in air from various indoor environment. Journal of Environmen-tal Monitoring 7, 814–819.

McCarthy, O., Musso-Buendia, A., Kaiser, M., Brun, R., Ruiz-Perez, L.M., Johansson,N.G., pacanowska, D.G., Gilbert, I.H., 2009. Design, synthesis and evaluation ofnovel uracil acetamide derivatives as potential inhibitors of Plasmodium falci-parum dUTP nucleotidohydrolase. European Journal of Medical Chemistry 44,678–688.

McGee, S.P., Cooper, E.M., Stapleton, H.M., Volz, D.C., 2012. Early zebrafish embryo-genesis is susceptible to developmental TDCPP exposure. Environmental HealthPerspectives 120, 1585–1591.

McKenna, N.J., Lanz, R.B., O’Malley, B.W., 1999. Nuclear receptor co-regulators: cel-lular and molecular biology. Endocrine Reviews 20, 321–344.

McKenna, N.J., O’Malley, B.W., 2002. Combinatorial control of gene expression bynuclear receptors and coregulators. Cell 108, 465–474.

Meeker, J.D., Stapleton, H.M., 2010. House dust concentrations of organophosphateflame retardants in relation to hormone levels and semen quality parameters.Environmental Health Perspectives 118, 318–323.

Menuet, A., Pellegrini, E., Anglade, I., Blaise, O., Laudet, V., Kah, O., Pakdel, F., 2002.Molecular characterization of three estrogen receptor forms in zebrafish: bind-ing characteristics, transactivation properties, and tissue distributions. Biologyof Reproduction 66, 1881–1892.

Menuet, A., Page, Y.L., Torres, O., Kern, L., Kah, O., Pakde, F., 2004. Analysis of theestrogen receptor (ER) reveals distinct effects of ERalpha, ERbeta1 and ERbeta2.Journal of Molecular Endocrinology 32, 975–986.

Mortensen, A.S., Arukwe, A., 2007. Effects of 17�-ethynylestradiol on hormonalresponses and xenobiotic biotransformation system of atlantic salmon (Salmosalar). Aquatic Toxicology 85, 113–123.

Moyes, K.M., Drackley, J.K., Morin, D.E., Bionaz, M., Rodriguez-Zas, S.L., Everts, R.E.,Lewin, H.A., Loor, J.J., 2009. Gene network and pathway analysis of bovinemammary tissue challenged with Streptococcus uberis reveals induction of cellproliferation and inhibition of PPAR� signaling as potential mechanism for thenegative relationships between immune response and lipid metabolism. BMCGenomics 10, 542.

Pellegrini, E., Menuet, A., Lethimonier, C., Adrio, F., Gueguen, M.M., Tascon, C.,Anglade, I., Pakdel, F., Kah, O., 2005. Relationships between aromatase andestrogen receptors in the brain of teleost fish. General and ComparativeEndocrinology 142, 60–66.

Power, D.M., Llewellyn, L., Faustino, M., Nowell, M.A., Bjornsson, B.T., Einarsdot-tir, I.E., Canario, A.V.M., Sweeney, G.E., 2001. Thyroid hormones in growthand development of fish. Comparative Biochemistry and Physiology 130C,447–459.

Raldúa, D., Babin, P.J., 2009. Simple, rapid zebrafish larva bioassay for assessing thepotential of chemical pollutants and drugs to disrupt thyroid gland function.Environmental Science and Technology 43, 6844–6850.

Reemtsma, J., Quintana, J., Rodil, R., García-López, M., Rodríguez, I., 2008.Organophosphorus flame retardants and plasticizers in water and air. I. Occur-rence and fate. Trends in Analytical Chemistry 27, 727–737.

Shi, X., Liu, C., Wu, G., Zhou, B., 2009. Waterborne exposure to PFOS causes disruptionof the hypothalamic-pituitary-thyroid axis in zebrafish larvae. Chemosphere 77,1010–1018.

Shibata, H., Spencer, T.E., Onate, S.A., Jenster, G., Tsai, S.Y., Tsai, M., O’Malley,B.W., 1997. Role of co-activators and co-repressors in the mechanism ofsteroid/thyroid receptor action. Recent Progress in Hormone Research 52,

141–149.

Stackelberg, P.E., Furlong, E.T., Meyer, M.T., Zaugg, S.D., Henderson, A.K., Reissman,D.B., 2004. Persistence of pharmaceutical compounds and other organic wastew-ater contaminants in a conventional drinking-water-treatment plant. Science ofthe Total Environment 329, 99–113.

gy 128

S

T

T

v

W

W

Zhang, Z., Pelletier, R.D., Wong, Y.N., Sugawara, M., Zhao, N., Littlefield, B.A.,

C. Liu et al. / Aquatic Toxicolo

undkvist, A.M., Olofsson, U., Haglund, P., 2010. Organophosphorus flame retardantsand plasticizers in marine and fresh water biota and in human milk. Journal ofEnvironmental Monitoring 12, 943–951.

seng, H., Hseu, T., Buhler, D.R., Wang, W., Hu, C., 2005. Constitutive and xenobiotics-induced expression of a novel CYP3A gene from zebrafish larva. Toxicology andApplied Pharmacology 205, 247–258.

suchiya, Y., Nakajima, M., Yokoi, T., 2003. Critical enhancer region to whichAhR/ARNT and Sp1 bind in the human CYP1B1 gene. Journal of Biochemistry133, 583–592.

an der Veen, I., de Boer, J., 2012. Phosphorus flame retardants: properties, pro-duction, environmental occurrence, toxicity and analysis. Chemosphere 88,1119–1153.

an, H.T., Zhao, Y.G., Wei, X., Hui, K.Y., Giesy, J.P., Wong, C.K.C., 2012. PFOS-induced

hepatic steatosis, the mechanistic actions on �-oxidation and lipid transport.Biochimica et Biophysica Acta 1820, 1092–1101.

ang, J., Shi, X., Du, Y., Zhou, B., 2011. Effects of xenoestrogens on the expression ofvitellogenin (vtg) and cytochrome P450 aromatase (cyp19a and b) genes. Journalof Environmental Science and Health 40A, 960–967.

– 129 (2013) 147– 157 157

Wang, X., Liu, J., Yin, Y., 2011. Development of an ultra-high-performance liq-uid chromatography–tandem mass spectrometry method for high throughputdetermination of organophosphorus flame retardants in environmental water.Journal of Chromatography A 1218, 6705–6711.

Yu, L., Deng, J., Shi, X., Liu, C., Yu, K., Zhou, B., 2010. Exposure toDE-71 alters thyroid hormone levels and gene transcription in thehypothalamic-pituitary-thyroid axis of zebrafish larvae. Aquatic Toxicology 97,226–233.

Zhang, X., Hecker, M., Jones, P.D., Newsted, J., Au, D., Kong, R., Wu, R.S.S., Giesy,J.P., 2008. Responses of the medaka HPG axis PCR array and reproductionto prochloraz and ketoconazole. Environmental Science and Technology 42,6762–6769.

2006. Preferential inducibility of CYP1A1 and CYP1A2 by TCDD: dif-ferential regulation in primary human hepatocytes versus transformedhuman cells. Biochemical and Biophysical Research Communications 341,399–407.

1

Supplementary Material

Effects of tris(1,3-dichloro-2-propyl) phosphate and triphenyl phosphate on

receptor-associated mRNA expression in zebrafish embryos/larvae

Chunsheng Liu1,*, Qiangwei Wang2, Kang Liang3, Jingfu Liu3, Bingsheng Zhou2,

Xiaowei Zhang1, Hongling Liu1, John P. Giesy4,5,6,7, Hongxia Yu1,*

1State Key Laboratory of Pollution Control and Resource Reuse & School of the Environment, Nanjing University, Nanjing, China 2State Key Laboratory of Freshwater Ecology and Biotechnology, Institute of Hydrobiology, Chinese Academy of Sciences, Wuhan 430072, China 3State Key Laboratory of Environmental Chemistry and Ecotoxicology, Research Center for Eco-Environmental Sciences, Chinese Academy of Sciences, P.O. Box 2871, Beijing 100085, China 4Toxicology Centre, University of Saskatchewan, Saskatoon, SK, Saskatchewan, Canada S7N 5B3 5Department of Veterinary Biomedical Sciences, University of Saskatchewan, Saskatoon, SK, Canada S7N 5B3 6Zoology Department, Center for Integrative Toxicology, Michigan State University, East Lansing, MI 48824, USA 7Department of Biology and Chemistry, City University of Hong Kong, Kowloon, Hong Kong, China

*Authors for correspondence: Dr. Chunsheng Liu Prof. Hongxia Yu School of the Environment, School of the Environment, Nanjing University, Nanjing University, Nanjing 210093, China Nanjing 210093, China Email: liuchunshengidid@126.com Email: yuhx@nju.edu.cn

Number of pages: 6, number of tables: 2

2

Table S1. Sequences of primers for selected genes and amplicon characteristics. Gene Name Sequence of the primers (5’-3’) Efficiency Amplicon size Accession number

AhR1b Forward: ggagagcacttgaggaaacg

Reverse: ggatccagatcgtcctttga

94% 179 bp NM_001024816

AhR2 Forward: atctccatgggcaaaacaag

Reverse: tccctcttgtgtcgataccc

95% 180 bp NM_131264

AhRRa Forward: gctgctgatgtttggactga

Reverse: gacgctgtgttcacgtcact

101% 163 bp NM_001035265

AhRRb Forward: acctgggatttcatcagacg

Reverse: gctgtacagatgagccgtca

101% 155 bp NM_001033920

AIP Forward: ccatcacttgaagcctccat

Reverse: tgcatgtgctccaacttctc

98% 196 bp NM_214712

ARNT2 Forward: gaatggtctcggtccgtcta

Reverse: agctggtcacctgcagtctt

97% 173 bp NM_131674

ARNTl1a Forward: tctcctgggggaaagaagat

Reverse: ccatcgctgcttcatcatta

102% 190 bp NM_131577

ARNTl1b Forward: ctcgctgaatgccatagaca

Reverse: cccgagacgactgtattggt

97% 176 bp NM_178300

CYP1A1 Forward: cctgggcggttgtctatcta

Reverse: tgaggaatggtgaagggaag

99% 184 bp AF210727

NCOR2 Forward: ttgaaccagtttcaccacca

Reverse: tgacaatggctgagttgctc

95% 165 bp NM_001007032

CYP1B1 Forward: gctcagctcggtaacactcc

Reverse: cgttagacacgaaccggaat

102% 193 bp AY727864

SP1 Forward: tcctccattaatcggtcgag

Reverse: tgtgtgtgagcacaaaacga

96% 170 bp NM_212662

PPARα Forward: gattcaaatcttgccgtggt

Reverse: tcgtcgctgagagactgaga

95% 159 bp NM_001161333

PPARgc1a Forward: aatcaggattcggtgtggag

Reverse: ttggatgcttcattgccata

93% 200 bp AY998087

LPL Forward: ctggccttctcaccaaacat

Reverse: gcctttgaatcccaatgcta

97% 174 bp NM_131127

DUT Forward: tacagacgctggatgagacg

Reverse: aatgcagcaacacaaacagc

96% 194 bp NM_001006005

IL8 Forward: gtcgctgcattgaaacagaa

Reverse: cttaacccatggagcagagg

98% 158 bp XM_001342570

IL6 Forward: tcctggtgaacgacatcaaa

Reverse: tcatcacgctggagaagttg

99% 177 bp JN698962

PPARg Forward: tgccgcatacacaagaagag

Reverse: atgtggttcacgtcactgga

95% 158 bp NM_131467

ER1 Forward: ggtccagtgtggtgtcctct

Reverse: cacacgaccagactccgtaa

103% 189 bp NM_152959

3

Table S1-Continued (a). Gene Name Sequence of the primers (5’-3’) Efficiency Amplicon size Accession number

ER2a Forward: agcttgtgcacatgatcagc

Reverse: gctttcatccctgctgagac

104% 188 bp NM_180966

ER2b Forward: ttgtgttctccagcatgagc

Reverse: ccacatatggggaaggaatg

97% 156 bp NM_174862

VTG1 Forward: ctgcgtgaagttgtcatgct

Reverse: gaccagcattgcccataact

99% 175 bp NM_001044897

VTG2 Forward: tactttgggcactgatgcaa

Reverse: agacttcgtgaagcccaaga

97% 152 bp AY729644

VTG4 Forward: ctacaaggtggaggctctgc

Reverse: ggaggacaaatcaccagcat

99% 175 bp NM_001045294

VTG5 Forward: agctaatgctctgcccgtta

Reverse: gttcagcctcaaacagcaca

95% 170 bp NM_001025189

NCOA1 Forward: tgagagcctctgttggaggt

Reverse: ctctgaccctggtttggtgt

93% 181 bp XM_686652

NCOA2 Forward: agagcctgtcagtcccaaga

Reverse: ggtcgtagccaccatcagtt

96% 170 bp NM_131777

NCOA3 Forward: aactcacctgcccacaaatc

Reverse: agaggcctgttgctggtcta

94% 153 bp XM_687846

PGR Forward: caacaggtggttgtggacag

Reverse: atttggagatgtccgctttg

98% 166 bp NM_001166335

CCND1 Forward: tgacttgccttgacttgtcg

Reverse: gaaaaagcagggagcacttg

101% 163 bp NM_131025

TRα Forward: caatgtaccatttcgcgttg

Reverse: gctcctgctctgtgttttcc

104% 194 bp NM_131396

NCOR Forward: agggtaaggagcagagcaca

Reverse: gcaaaactggttcaggtggt

97% 153 bp EF016488

C1D Forward: acggagagctgacagaccat

Reverse: gccgacatcagatccagttt

96% 197 bp NM_001007059

HDAC3 Forward: agccatgaaggtgtccattc

Reverse: agaagctgcttgcaggactc

94% 190 bp NM_200990

FUS Forward: ccaatatgcaggagcaggat

Reverse: cttccccgtctctctgtctg

103% 176 bp NM_201083

GR Forward: agaccttggtccccttcact

Reverse: cgcctttaatcatgggagaa

102% 162 bp EF567112

DAP3 Forward: tcgaccgttcatgtaaacca

Reverse: ctggatgctgagacacctga

95% 174 bp NM_001098737

HPSE Forward: cggcagtctgaacagatgaa

Reverse: aacacgggacaaatccacat

94% 153 bp NM_001045005

RelA Forward: tataagccacacccacacga

Reverse: gaatgggttgttttgcgtct

103% 174 bp AY163839

4

Table S1-Continued (b). Gene Name Sequence of the primers (5’-3’) Efficiency Amplicon size Accession number

TGFb1 Forward: aactactgcatggggtcctg

Reverse: ggacaattgctccaccttgt

94% 183 bp AY178450

HSP90aa1 Forward: ggatctggtgatcctgctgt

Reverse: tccagaacgggcatatcttc

99% 180 bp NM_131328

MR Forward: tttgagggaccagacaaacc

Reverse: cacactttggctgtcgaaga

96% 195 bp EF567113

11βHSD Forward: tggtgaagtatgccatcgaa

Reverse: gcaaagctttttgagccatc

99% 162 bp AY578180

ADRB2b Forward: cccgattacaagctgatggt

Reverse: tatgagcaaccccactgtca

102% 165 bp NM_001089471

ADRB2a Forward: gctgatctggtcatgggatt

Reverse: atgtgatggcgatgtaacga

103% 178 bp NM_001102652

EGFR Forward: aacgcaaataatggcaggac

Reverse: tctccagaaccacagtgcag

95% 191 bp AY332223

UBE2I Forward: tggaaagagggaagatgtgg

Reverse: cgaatgaagtgaaggggtgt

93% 155 bp NM_131351

18S rRNA Forward: acgcgagatggagcaataac

Reverse: cctcgttgatgggaaacagt

99% 171 bp FJ915075

GAPDH Forward: gatacacggagcaccaggtt

Reverse: gccatcaggtcacatacacg

97% 163 bp NM_001115114

5

Table S2. Effects of positive control chemicals, TDCPP and TPP on expression of mRNA of associated genes in six receptor-centered gene networks in zebrafish embryos/larvaea,b,c. Receptor-centered

gene networks

Gene

names

Positive

control

chemicals

TDCPP (mg/L) TPP (mg/L)

0.02 0.2 2 0.02 0.2 2

AhRs-centered

gene network

AhR1b 2.27±0.05* 1.07±0.03 1.18±0.04* 1.22±0.02* 1.09±0.02 1.09±0.08 0.92±0.03

AhR2 2.23±0.02* 0.91±0.04 1.17±0.12 1.17±0.02 1.01±0.02 1.28±0.13 0.98±0.03

AhRRa 1.40±0.02* 1.46±0.05* 1.07±0.03 0.88±0.05 1.04±0.03 0.95±0.03 0.97±0.03

AhRRb 0.93±0.05 0.89±0.04 1.38±0.05* 1.03±0.09 1.20±0.02* 0.99±0.03 0.97±0.03

AIP 1.21±0.03* 0.94±0.05 1.21±0.03* 1.47±0.01* 1.09±0.01 1.05±0.12 0.95±0.01

ARNT2 1.01±0.05 0.82±0.15 1.23±0.03* 1.66±0.03* 1.11±0.04 1.04±0.03 1.13±0.03

ARNTl1a 0.96±0.02 0.84±0.05 1.47±0.04* 1.96±0.09* 1.11±0.02 0.91±0.02 1.11±0.04

ARNTl1b 0.94±0.03 0.86±0.04 1.48±0.04* 2.08±0.01* 1.14±0.05 0.92±0.01 1.15±0.06

CYP1A1 2.47±0.01* 0.93±0.02 0.88±0.02 1.35±0.04* 1.14±0.12 1.09±0.13 1.69±0.13*

NCOR2 1.27±0.03* 0.87±0.02 1.26±0.02* 1.53±0.06* 1.14±0.03 1.09±0.02 1.52±0.15*

CYP1B1 1.57±0.05* 1.16±0.02* 1.33±0.03* 1.42±0.06* 1.08±0.02 1.11±0.03 1.39±0.06*

SP1 1.31±0.03* 1.09±0.03 1.28±0.02* 1.44±0.04* 1.08±0.03 0.97±0.03 0.97±0.04

PPARα-centered gene

work

PPARα 1.69±0.11* 1.07±0.02 1.00±0.03 1.14±0.03* 1.11±0.02 1.11±0.02 1.24±0.02*

PPARgc1a 1.03±0.08 0.84±0.12 1.36±0.02* 2.08±0.16* 1.16±0.03 1.14±0.13 1.25±0.04*

LPL 1.98±0.13* 1.17±0.13 1.31±0.04* 2.03±0.04* 1.08±0.02 1.22±0.09 1.83±0.05*

DUT 0.58±0.01* 0.91±0.10 1.36±0.10* 1.42±0.07* 1.15±0.11 1.12±0.09 0.82±0.05

IL8 1.42±0.07* 1.47±0.04* 1.66±0.03* 1.25±0.03* 0.99±0.01 0.99±0.02 1.13±0.05

IL6 5.30±1.26* 0.81±0.15 1.17±0.30 2.37±0.13* 1.13±0.27 1.08±0.16 3.88±0.42*

PPARg 0.97±0.05 0.98±0.03 0.97±0.02 1.27±0.02* 1.14±0.02 1.34±0.00* 1.20±0.02*

ERs-centered gene

network

ER1 2.10±0.12* 1.77±0.10* 1.09±0.02 1.09±0.06 0.97±0.04 0.97±0.03 0.97±0.04

ER2a 0.59±0.07* 1.02±0.03 1.22±0.02* 1.28±0.02* 1.19±0.02 0.90±0.06 0.97±0.04

ER2b 1.70±0.03* 1.49±0.04* 1.01±0.03 1.05±0.05 1.07±0.01 1.01±0.02 1.21±0.05*

VTG1 9.75±0.65* 1.83±0.07* 1.10±0.02 1.06±0.02 1.01±0.02 1.13±0.12 1.02±0.03

VTG2 6.10±0.25* 1.92±0.06* 1.02±0.04 0.97±0.04 1.00±0.03 0.97±0.03 0.91±0.05

VTG4 40.75±2.61* 2.01±0.08* 0.93±0.14 0.86±0.10 1.00±0.05 0.90±0.12 0.92±0.10

VTG5 8.95±0.85* 2.18±0.13* 1.23±0.08 1.06±0.01 1.00±0.04 1.06±0.04 1.08±0.05

NCOA1 0.93±0.03 1.00±0.03 1.18±0.01* 1.43±0.03* 1.15±0.03 1.04±0.02 1.06±0.03

NCOA2 0.86±0.05 1.00±0.03 1.21±0.02* 1.36±0.03* 1.09±0.03 1.06±0.09 0.99±0.03

NCOA3 0.87±0.03 0.95±0.03 1.11±0.01* 1.19±0.01* 0.96±0.01 0.89±0.09 0.81±0.12

PGR 2.11±0.30* 1.77±0.10* 1.21±0.07 0.97±0.08 0.93±0.08 1.11±0.03 1.04±0.09

CCND1 0.72±0.03* 1.02±0.03 1.59±0.13* 1.91±0.14* 1.16±0.02 1.21±0.08 1.07±0.03

6

Table S2-Continued Receptor-centered

gene networks

Gene

names

Positive control

chemicals

TDCPP (mg/L) TPP (mg/L)

0.02 0.2 2 0.02 0.2 2

TRα-centered

gene network

TRα 4.88±0.23* 0.89±0.03 1.20±0.04* 1.56±0.04* 1.10±0.01 1.13±0.03 1.37±0.03*

PPARgc1a 1.32±0.03* 0.84±0.13 1.36±0.03* 2.08±0.16* 1.16±0.03 1.14±0.13 1.25±0.04*

NCOR 1.32±0.05* 0.97±0.02 1.19±0.02* 1.38±0.01* 1.13±0.06 1.17±0.08 1.17±0.08

C1D 1.32±0.08* 1.02±0.03 1.22±0.02* 1.42±0.05* 1.05±0.02 0.99±0.04 0.99±0.04

NCOR2 1.35±0.08* 0.87±0.02 1.26±0.02* 1.53±0.06* 1.14±0.04 1.09±0.02 1.52±0.15*

HDAC3 1.29±0.05* 1.06±0.04 1.19±0.03* 1.41±0.04* 1.06±0.01 0.96±0.02 0.91±0.06

FUS 1.03±0.12 0.89±0.02 1.45±0.03* 1.80±0.02* 1.10±0.04 1.02±0.01 1.19±0.03*

GR-centered

gene network

GR 2.11±0.02* 0.89±0.04 1.26±0.03* 1.33±0.03* 1.22±0.02* 1.00±0.02 0.91±0.04

DAP3 1.15±0.04 0.95±0.08 1.32±0.03* 1.76±0.04* 1.05±0.02 0.88±0.08 0.87±0.13

HPSE 1.86±0.07* 1.39±0.11* 1.05±0.02 1.11±0.09 1.03±0.02 0.85±0.07 0.80±0.03*

RelA 1.63±0.04* 0.98±0.03 1.27±0.03* 1.45±0.05* 1.13±0.05 1.04±0.02 1.20±0.01*

TGFb1 1.41±0.17 0.89±0.04 1.30±0.02* 1.45±0.03* 1.12±0.03 1.04±0.03 1.39±0.03*

HSP90aa1 1.18±0.04* 0.85±0.13 1.16±0.02* 1.85±0.03* 1.06±0.03 1.09±0.02 1.47±0.07*

MR-centered

gene network

MR 2.67±0.17* 0.90±0.03 1.17±0.02* 1.24±0.06* 1.08±0.03 0.96±0.03 0.84±0.01*

HPSE 2.19±0.19* 1.39±0.11* 1.05±0.02 1.11±0.09 1.03±0.02 0.85±0.07 0.80±0.03*

11βHSD 0.99±0.08 1.00±0.03 1.04±0.03 1.38±0.05* 1.13±0.02 1.38±0.02* 1.23±0.02*

ADRB2b 1.24±0.13 1.82±0.21* 0.92±0.02 1.25±0.17 1.08±0.04 1.03±0.02 1.05±0.06

ADRB2a 1.73±0.14* 1.30±0.06* 1.07±0.02 1.25±0.03* 1.05±0.02 0.95±0.03 0.90±0.03

EGFR 1.61±0.14* 1.31±0.17 1.03±0.02 1.25±0.33 1.13±0.02 1.18±0.14 1.43±0.03*

UBE2I 1.22±0.11 1.06±0.13 1.32±0.09 1.57±0.10* 1.05±0.02 0.97±0.06 0.93±0.04

aValues represent the mean of four replicate samples. bGene expressions were expressed as fold change relative to control. cPositive control chemicals: B[a]P (10 µg/L ) for AhRs-centered gene network; PFOS (5 mg/L) for PPARα-centered gene network; E2 (200 µg/L) for ERs-centered gene network; T3 (30 µg/L) for TRα-centered gene network; DEX (25 mg/L) for GR-centered gene network; FCA (25 mg/L) for MR-centered gene network. *P<0.05 indicates significant difference between exposure groups and the corresponding control group.