1 2 3 4 5 1

1

1 Department of Biology, University of Waterloo, Waterloo, Ontario, Canada; 2 UFZ, Helmholtz Centre for Environmental

Research, Leipzig, Germany; 3 Eawag–Swiss Federal Institute of Aquatic Science and Technology, Dubendorf, Switzerland;4 Biodiversity Institute of Ontario, University of Guelph, Guelph, Ontario, Canada; 5 Department of Biology, Wilfrid Laurier

University, Waterloo, Ontario, Canada

A cell line, RTgutGC, was developed from the intestine of

Oncorhynchus mykiss. RTgutGC has an epithelial-like

shape, been passaged over 100 times, and cryopreserved

successfully. A rainbow trout origin was confirmed by

sequencing a 652 bp region of the mitochondrial cyto-

chrome c oxidase I gene. RTgutGC is grown routinely in

Leibovitz�s L15 without glutamine supplemented with 10%

fetal bovine serum (FBS). Cell viability was evaluated with

Alamar blue (AB) for metabolic activity and carboxyfluo-

rescein diacetate acetoxymethyl ester (CFDA AM) for

membrane integrity. Viability was unchanged by lipopoly-

saccharide (LPS) for cultures in FBS. For cultures at low

cell densities in L15 without FBS or glutamine, cell viability

declined in a LPS dose-dependent manner, allowing calcu-

lation of the concentration causing a 50% decline in via-

bility (EC50). When glutamine was present, the EC50 was

increased for both AB and CFDA AM. As the cell density

increased, LPS became much less cytotoxic and no EC50

could be calculated for very confluent cultures. Only high-

density cultures had alkaline phosphatase (AP) activity.

Thus, glutamine and possibly AP protect against LPS

cytotoxicity. RTgutGC should be a useful in vitro tool for

studying problems of nutrition and gastrointestinal health

in fish.

KEY WORDSKEY WORDS: alkaline phosphatase, cell line, glutamine, intes-

tine, rainbow trout, tumour necrosis factor alpha

Received 31 May 2009, accepted 1 December 2009

Correspondence: Niels Bols, University of Waterloo, 200 University Ave,

Waterloo, Ontario, Canada N2L 3G1. E-mail: ncbols@uwaterloo.ca

Fish feeds of the future will likely be much more complex than

those currently used and development will require research

from a wide range of disciplines, including in vitro approaches

with cell lines. Cell lines offer the advantage of allowing

problems to be investigated quickly and inexpensively at the

molecular and cellular levels in order to gain information that

can be used to design the most efficient in vivo studies of the

problems. Examples of the use of human and rodent gastro-

intestinal cell lines in food research abound. They have been

used to detect beneficial bioactive compounds in foods

(Giron-Calle et al. 2004), identify potentially destructive and

protective agents for the intestinal mucosa in foods (King

et al. 2006), determine the bioavailability of compounds in

food (Jin et al. 2006), examine interactions between food

components and drugs (Lilja et al. 2005; Sun et al. 2008),

discover antivirals in food (Bojsen et al. 2007) and study

probiotics (Larsen et al. 2007). Problems in the development

of fish feed where cell lines might be applied are in identifying

and studying antinutritional factors, nutriceuticals and

immuno-stimulants. As plant-based diets have been examined

as alternatives to fishmeal, the problem of antinutritional

factors has been identified. This includes protease inhibitors,

lectins, phytic acid, saponins, phytoestrogens, antivitamins

and allergens (Francis et al. 2001). As fish in aquaculture are

maintained at high densities, the problem of immunological

impairment and disease outbreaks can arise. This might be

prevented through efficient incorporation of nutriceuticals

and immuno-stimulants in new feed formulations.

Mammalian cell lines have been established from most of

the anatomical regions of the GI tract: oesophagus, stomach,

small intestine, and colon/rectum. The majority of these cell

lines are from human GI tract tumours. These include

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

� 2010 Blackwell Publishing Ltd

2011 17; e241–e252. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

doi: 10.1111/j.1365-2095.2010.00757.x

Aquaculture Nutrition

epithelial cell lines from oesophageal adenocarcinoma and

squamous cell carcinoma (Boonstra et al. 2007), gastric ade-

nocarcinoma (Li et al. 2002) and colorectal carcinoma (Oh

et al. 1999). Conditionally immortalized cell lines have been

developed from the foetal small intestine (Quaroni & Beaulieu

1997). Cell lines, such as Caco-2 andHT-29 from human colon

adenocarcinomas, can be made to differentiate into entero-

cytes as well by manipulating the in vitro culture conditions

(Simon-Assmann et al. 2007). Immortal rodent GI tract cell

lines have been obtained through the use of SV40 ts-T-antigen

transgenic mice and rats as the source of cultures (Obinata

2007), and several rodent cell lines appear to have been

immortalized spontaneously, such as IEC-6 (Quaroni et al.

1979). A spontaneously immortalized chicken intestinal cell

line also has been developed (Velge et al. 2002). By contrast,

although cell lines have been prepared from most tissues and

organs of fish, none are from the GI tract (Bols & Lee 1991).

In this work, we describe the development of a rainbow

trout intestinal epithelial cell line, RTgutGC. The cell line is

characterized for some general properties such as cell mor-

phology, and for intestinal specific properties, such as alkaline

phosphatase (AP), which is expressed by some but not all

intestinal epithelial cell lines. For the purpose of showing how

the cell line could be used to investigate GI health, we have

studied the actions glutamine and LPS as well. In mammals,

glutamine has been found to have both nutritive and protective

roles in vivo (Souba et al. 1990; Sukhotnik et al. 2007), and the

cellular basis of these roles have been studied successfully with

human intestinal cell lines (Turowski et al. 1994; Lenaerts

et al. 2006). LPS is a constituent of the outer membrane of

Gram negative bacteria, which are part of resident intestinal

flora, and can cause gastrointestinal injury. Interestingly, the

intestine is considered hyporesponsive to LPS relative to other

tissues (Naik et al. 2001; Zayat et al. 2008). The hyporespon-

siveness is thought to be because of the lack of critical LPS

recognition and signalling molecules, including the Toll-like

receptor (TLR4) and the myeloid differentiation receptor

(MD-2). Mammalian intestinal cell lines have been useful for

studying this; but at high concentrations, LPS kills these cells

(Abreu et al. 2001; Bocker et al. 2003; Lenoir et al. 2008).

A rainbow trout intestinal epithelial cell line termed

RTgutGC was initiated and used in this study. Development

and growth conditions for RTgutGC are discussed in the

following text. Also, two human intestinal epithelial cell lines

were used in this study: HT-29 and Caco-2. Both human

intestinal epithelial cell lines were obtained from American

Type Tissue Culture (ATCC). The human intestinal epithelial

cell lines were routinely cultured in Dulbecco�s Modified

Eagle Medium (DMEM) with 10% foetal bovine serum

(FBS; Sigma, St. Louis, MO, USA) at 37 �C and 5% CO2.

The primary culture that led to the RTgutGC cell line was

derived from a small female rainbow trout (O. mykiss). The

fish was not fed for 2 days prior to sampling and anaesthe-

tised in an aqueous solution of 1 : 10000 tricaine metha-

nesulphonate (MS222; Syndel, Vancouver, BC, Canada)

before dissection. The gut was cut out and carefully cleaned

and rinsed with cell culture–grade distilled water. It was then

placed in Dulbecco�s phosphate-buffered saline free of

Ca2+and Mg2+ (DPBS; Sigma) but containing 50 lg mL)1

gentamicin. The gut was cut open longitudinally and inten-

sively rinsed with the DPBS/gentamicin solution. Thereafter,

pieces of about 1 mm2 were isolated from the distal portion

of the gut and placed in 12.5 cm2 culture flasks in Leibovitz�s

L15 medium containing 30% FBS and penicillin (100 IU

mL)1) and streptomycin (100 lg mL)1). The volume of the

medium was adjusted so as to just cover the tissue fragments.

The flasks were placed in a 20 �C incubator in ambient air.

The flasks were regularly observed and the medium carefully

exchanged every 2 weeks. After a period of 8 weeks, two

flasks showed an extensive stroma surrounded by epithelial-

like cells. Moreover, dendritic-like cells were visible across

the culture surface, particularly in otherwise bare areas. The

cells in one of the flasks were treated with versene and 0.1%

(w/v) trypsin (Sigma) and sub-cultured into 12.5-cm2 flasks

containing L15 medium with 20% FBS.

Cells at passage 94 were collected by enzymatic dispersion as

described for the propagation of cells. Approximately 1 · 105

cells in 50 lL of DPBS were aseptically placed on indicating

FTA� cards (Whatman�, Piscataway, NJ, USA) for DNA

extraction, labelled, covered and allowed to dry at room

temperature. The cards were placed in sterile bags and sub-

mitted to the Biodiversity Institute of Ontario (Guelph, ON,

Canada) for DNA barcoding (molecular genotyping using

cytochrome c oxidase subunit I) as described by Cooper et al.

(2007) using a PCR primer cocktail developed for fishes as

described by Ivanova et al. (2007). Sequence analysis for

species identification used both the Barcode of Life Data

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

(BOLD; Ratnasingham & Hebert 2007) system (http://

www.barcodinglife.org) as well as the NCBI BLAST search

engine (http://www.ncbi.nlm.nih.gov/BLAST).

Primary cultures were sub-cultivated at different time points

(ranging from 72 to112 h). Commercial trypsin was used to

detach adherent cells and continually propagated until

morphology became uniform and designated RTgutGC.

RTgutGC cultures have been successfully cryopreserved in a

liquid nitrogen dewar at early (7–9), middle (52–75) and late

passages (91–115). In all cases, the cells were frozen in L15

supplemented with 10% (v/v) dimethyl sulphoxide (DMSO)

and 10% FBS. Growth characteristics of RTgutGC were

determined as described previously for a rainbow trout liver

cell line, RTL-W1 (Lee et al. 1993).

RTgutGC were routinely maintained at room temperature in

L15 supplemented with 10% FBS and 1% P/S. Cells were

commonly maintained in 75-cm2 flasks and at confluency

(approximately 7–8 · 106 cells flask-1) were split (1 : 2) into

new 75-cm2 flasks, which usually became confluent again

6 days later. Optimal basal media composition for RTgutGC

proliferation assays were performed with different sera sup-

plementations. Proliferation was evaluated using 12-well

tissue culture plates. Approximately 5.0 · 104 cells well-1

were seeded into each well with 2 mL of growth medium and

allowed to attach overnight prior to treatment with altered

basal medium. The day 0 reference point was determined by

counting a triplicate of wells using a Coulter particle counter.

Counts were made every 3 days over a 15 days time period.

RTgutGC was screened for b-galactosidase activity using a

histochemical kit (Sigma). Briefly, 1.0 · 106 cells were seeded

into replicate 35-mm2 tissue culture petri dishes (BD Bio-

sciences, Mississauga, ON, Canada). The cells were fixed

with 1X fixation buffer from the kit. Cells were exposed to

the staining mixture for 12 h. b-galactosidase activity was

seen as blue colouring within cells.

RTgutGC was screened for AP activity using a histo-

chemical kit for detecting AP activity in leucocytes (Sigma).

Briefly, cells at different densities (2.5 · 105, 1.0 · 106, and

2.0 · 106) were seeded into replicate slide flasks (Nunc,

Rochester, NY, USA). The cells were fixed using a citrate-

buffered acetone solution for 30 s and washed for 45 s with

deionized water. Then, cells were exposed to an AS-MX

phosphate alkaline solution mixed with diazonium salt

solution for 2 h. This was followed by a wash in deionized

water for 2 min and counterstaining in Mayer�s haemat-

oxylin solution for 10 min. A final wash was performed with

tap water to remove excess stain. AP was seen as purple

granular colouring within cells.

RTgutGC cells were exposed to either 20 or 50 lg mL)1

LPS. Cultures treated with 20 lg mL)1 LPS were exposed for

4 h. Cultures treated with 50 lg mL)1 LPS were exposed for

24 h. Cells were collected at desired time points after LPS

treatment. Pellets were washed with DPBS, and RNA

extracted using GenElute mammalian total RNA miniprep

kit (Sigma). RNA was quantified using a NanoDrop 100

(Thermo Scientific). To remove genomic DNA, 2 lg RNA

was incubated with DNase I for 30 min at 37 �C and 5 min

at 75 �C. cDNA was generated using the following steps.

1 lL of 0.5 lg mL)1 oligo-(dT)23 anchored primer (Sigma)

was added to each RNA sample and heated to 70 �C for

10 min and put on ice. To each sample, 4 lL 5 · buffer

(250 mM Tris–HCl pH 8.3, 375 mM KCl, 15 mM MgCl2;

Invitrogen, Burlington, Canada), 1 lL 10 mM dNTP mix,

2 lL 0.1 M dithiothreitol (DTT) and 80 U Superscript III

reverse transcriptase (Invitrogen) were added. Samples

equilibrated at room temperature for 10 min. Samples were

then incubated for 50 min at 42 �C and 5 min at 95 �C.Resulting cDNA was diluted 1 : 20 in nuclease-free water

and stored at )80 �C. All polymerase chain reactions (PCR)

contained the following: 0.5 lL 10 mM dNTP mix (Sigma),

1.25 U Taq polymerase (Sigma), 1.5 mM MgCl2 (Sigma),

2.5 lL 10· reaction buffer (100 mM Tris–HCl pH 8.3,

500 mM KCl; Sigma), 1.25 lL 10 lM forward and reverse

primers, 2.5 lL diluted cDNA and nuclease-free water to a

total volume of 25 lL. The primer sequence, cycle number

and annealing temperature for each primer were listed in

Table 1. PCR reactions were carried out using Mastercycler

personal thermocycler (Eppendorf). Cycle conditions for

each reaction were as follows: 5 min at 95 �C, a set number

of cycles with 95 �C for 30 s, 30 s at primer-specific annealing

temperature, 75 �C for 1 min and a final extension at 72 �Cfor 5 min. PCR products were visualized on 1.5% agarose

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

stained with ethidium bromide (EtBr). UV transillumination

was performed using Fluorochem 8000 (Alpha Innotech, San

Leandro, CA, USA).

Commercial phenol extracted LPS from Escherichia coli

(Sigma) was prepared at 20 mg mL)1 in L15/ex (Schirmer

et al. 1997; Dayeh et al. 2003). Cells were seeded in 96-well

tissue culture plates at a density of 4.0 · 104 cells well)1 in

200 lL L15. Cells were allowed to attach for 24 h prior to

exposure. HT-29 and Caco-2 were dosed with LPS concen-

trations of 5, 15, 50, 150 and 500 lg mL)1. RTgutGC was

dosed with LPS concentrations of 5, 15, 50, 100 and

150 lg mL)1. Each concentration was tested in sextuplicates.

Dosing was performed by directly adding the stock solution

into the culture well. The final concentration of L15/ex in the

culture wells was 0.5% (v/v). A control was performed by

adding L15/ex to the cells.

Cell viability after exposure was conducted using two fluo-

rescent dyes: Alamar blue (AB) and 5-carboxyfluorescein

diacetate acetoxymethyl ester (CFDA-AM). These dyes were

used concurrently and prepared in L15/ex to give final

concentrations of 5% (v/v) AB and 4 lM CFDA-AM. Cells

were exposed to indicator dyes for approximately 1 h and

quantified with the SPECTRAmax� GEMINI XS micro-

plate reader (Molecular Devices, Sunnyvale, CA, USA) at

respective excitation and emission wavelengths of 530 (±30)

and 595 (±35) nm for AB, and 485 (±22) and 530 (±30) nm

for CFDA-AM.

Statistical analyses were performed using GraphPad InStat

(version 3.00 for Windows 95; GraphPad Software, San

Diego, CA, http://www.graphpad.com, USA). For graphical

presentation and derivation of effective concentration (EC50)

values, the data were processed with GraphPad Prism 4

(GraphPad Software) using a variable slope dose–response

sigmoidal model. EC50s values were compared using an

unpaired t-test, with results indicated on Table 2. In all cases,

a P-level £0.05 was considered significantly different.

Cells of the RTgutGC cell line are adherent with an epithe-

lial-like morphology. In the early passage cultures, the cell

Table 1 Primers used in study, including PCR product size and number of cycles

Gene Primers

Annealing

temperature

Product

size (bp)

Cycle

number Primer reference

b-actin (Gene

Accession: AJ438158)

F 5¢ ATCGTGGGGCGCCCCAGGCACC 3¢R 5¢ CTCCTTAATGTCACGCACGATTTC 3¢

53 �C 514 30 (Brubacher et al. 2000)

TNF-a1 (Gene

Accession:

NM_001124357)

F 5¢ TGGCTATGGAGGCTGTGTGGGGTC 3¢R 5¢ GCCTTCGCCAATTTCGGACTCAGC 3¢

68 �C 512 30 Unpublished

TNF-a2 F 5¢ TGGAGAGGGGCCTTGAAAATAG 3¢R 5¢ CGTCCTGCATCGTTGCCA 3¢

68 �C 206 30 (Komatsu et al., 2009)

Table 2 Effect of glutamine on the cytotoxicity of lipopolysaccharide to RTgutGC

Culture conditions1 EC50s from viability assessments with Statistical comparison

Basal media Glutamine

Alamar Blue

(n = 2)

5-carboxyfluorescein

diacetate acetoxymethyl ester

(n = 2) t-test

L15 ex2 None 18.3 ± 0.0 25.7 ± 0.9 P < 0.05

L15 ex 2 mM 35.43 ± 5.3 36.23 ± 1.1 P > 0.05

L154 None 27.0 ± 2.3 30.1 ± 6.9 P > 0.05

L15 2 mM 49.73 ± 2.6 70.23 ± 4.0 P < 0.05

1 4.0 · 104 cells well)1 of 96 well plate.2 L15 salts plus galactose and sodium pyruvate.3 Significantly different from above EC50 without glutamine (t test, P < 0.05).4 Leibovtiz�s L15 without glutamine.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

morphology was heterogenous, with thin bipolar cells along

with epithelial-like cells (Fig. 1a, b). Some of the epithelial-

like cells were large and flagstone shaped. After approxi-

mately 20 passages, the bipolar fibroblast-like cells and the

larger epithelial-like cells had disappeared from cultures,

leaving a relatively uniform population of epithelial-like cells

(Fig. 1c). The following results were obtained with these

more homogenous cultures. The cells remained adherent

whether the cultures were maintained for a week after they

had grown to become confluent or whether the cultures were

initiated at very high cell densities. In the latter case, the

cultures consisted of a tightly packed monolayer in which

mounds of cells were embedded.

PCR amplification of RTgutGC DNA from the FTA card

produced a 652 nucleotide fragment that yielded a 100%

sequence identity match to reference sequence profiles

derived from O. mykiss on BOLD and in GenBank. The

sequence for this line was deposited in BOLD within the

project �Characterizing Cell Lines from Fish and Shellfish

(CCLF)� under sample ID �RTgut-2�. Sequence alignment

analysis using the NCBI BLAST search engine as well as the

BOLD database returned a 100% match for O. mykiss

cytochrome C oxidase subunit I (Hubert et al. 2008).

CCTCTATTTAGTATTTGGTGCCTGAGCCGGGAT-

AGTAGGCACCGCCCTGAGTCTACTGATTCGGGCG-

GAACTAAGCCAGCCGGGCGCTCTTCTGGGGGAT-

GACCAAATCTATAACGTGATCGTCACAGCCCATG-

CCTTCGTTATGATTTTCTTTATAGTCATGCCAATT-

ATAATCGGGGGCTTTGGAAACTGAıCCTCTATTTA-

GTATTTGGTGCCTGAGCCGGGATAGTAGGCAC-

CGCCCTGAGTCTACTGATTCGGGCGGAACTAAGC-

CAGCCGGGCGCTCTTCT CCTCTATTTAGTATTTGG-

TGCCTGAGCCGGGATAGTAGGCACCGCCCTGAG

TCTACTGATTCGGGCGGAACTAAGCCAGCCGGG

CGCTCTTCTGGGGGATGACCAAATCTATAACGT

GATCGTCACAGCCCATGCCTTCGTTATGATTTT-

CTTTATAGTCATGCCAATTATAATCGGGGGCT

TTGGAAACTGAıCCTCTATTTAGTATTTGGTG

CCTGAGCCGGGATAGTAGGCACCGCCCTGA

GTCTACTGATTCGGGCGGAACTAAGCCAG

CCGGGCGCTCTTCT CCTCTATTTAGTATT-

TG GTGCCTGAGCCGGGATAGTAGGCACC-

GCCCTGAGTCTACTGATTCGGGCGGAACT.

Cells of the RTgutGC cell line were routinely grown in the

basal medium, L15, without a supplement of glutamine but

with a supplement of FBS. In L15 alone without glutamine,

the cells remained attached to the culture surface for at least

30 days, but did not increase in number. This was also true

for cultures in L15 without glutamine but with 10% dialyzed

FBS (dFBS; Fig. 2). Cell growth was supported only by

(a) (b) (c)

Figure 1 Appearance of RTgutGC cultures at different passage numbers. Photomicrographs of passage 6 (a), 12 (b) and above 100 (c) were

taken on an inverted phase contrast microscope. Scale bar indicates 100 lm.

Figure 2 Growth curves for RTgutGC grown in different L15 media

compositions. Cultures were initiated at approximately 5.0 · 104

cells well)1 in 12-well tissue culture plates at room temperature. The

next day, cell number was determined with a Coulter counter for

three wells (starting count) and cells were grown in L15 alone, 10%

fetal bovine serum (FBS), 20% FBS or 10% dFBS. Subsequent cell

counts were made every 3 days over a 15-days period and expressed

as a percentage of the starting count.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

complete FBS (Fig. 2). Cells grew with either 10 or 20%

FBS, but with 20% FBS the cells were packed more tightly

into confluent monolayers, yielding in the end more cells per

culture (Fig. 2). However, 10% FBS was used for the routine

maintenance of the cell line to reduce costs.

RTgutGC had an aneuploid karyotype and were confirmed

to be from rainbow trout. Only a few metaphase plates from

RTgutGC cultures were examined, but they had more

chromosomes than the usual diploid chromosome number,

which for rainbow trout can vary with the strain but com-

monly is reported as being between 58 and 64 (Thorgaard

1983; Colihuegue et al. 2001). Therefore, RTgutGC are

concluded not to be diploid but aneuploid. RTgutGC has

properties consistent with immortal cell lines. RTgutGC was

maintained for 4 years, undergoing more than 100 sub-

cultivations (passages) or approximately 150 population dou-

blings. The cells were successfully cryopreserved at different

passage levels with 10% DMSO as a cryoprotectant. The

number of positive staining b-galactosidase cells was minimal

(Fig. 3).

Cytochemical staining of RTgutGC cultures for AP revealed

staining only in super confluent cultures (Fig. 4). These were

cultures that had been initiated at very high densities and the

mounds of cells within the monolayer stained intensely, but

the cells in monolayers did not (Fig. 4).

Transcripts for two isoforms of TNF-a were detected by RT-

PCR in RTgutGC cultures after 4- or 24-h exposures to LPS

at 20 or 50 lg mL)1, respectively (Fig. 5). Expression seemed

higher after 24 h. By contrast, no expression was seen in

control cultures.

Under some culture conditions, exposure to increasing con-

centrations of LPS progressively decreased the viability of

RTgutGC cells. Viability was evaluated with AB, which

measures energy metabolism and CFDAAM, which indicates

(a) (b)

Figure 3 Examination of RTgutGC cultures for b-galactosidase activity. A histochemical stain for b-galactosidase activity was applied over-

night to cultures of RTgutGC. Photomicrographs are shown for fixed (a) and stained (b) cells. Cells showing blue staining were found in a small

percentage of RTgutGC cultures, with some indicated by arrows. Scale bar indicates 100 lm.

Phasecontrast

Subconfluent Confluent Super confluent

Alkalinephosphatase

stain

Figure 4 Examination of RTgutGC cultures for alkaline phosphatase activity at varying cell densities. A histochemical stain for AP activity was

applied for 2.5 h to cultures for RTgutGC. The top row shows RTgutGC seeded at varying densities prior to detecting AP activity. The bottom

row shows RTgutGC seeded at varying densities after AP staining. Scale bar indicates 100 lm.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

plasma membrane integrity. No change in viability was

observed during a 24-h exposure to up to 150 lg LPS mL)1

in medium with FBS. Yet, 24-h exposure to 50 lg LPS mL)1

in L15 alone without glutamine caused a pronounced

change in the appearance of cultures, with cells shriveling and

detaching (Fig. 6). Both AB and CFDA AM indicated a

decline in cell viability, although the magnitude of the decline

depended on the cell density (Fig. 7). When approximately

1.0 · 104 cells had been added per well, viability had declined

by 79.2% ± 6.6 (n = 2) and 68.9% ± 10.7 (n = 2) as

measured, respectively, by AB and CFDA AM; and in

contrast, when approximately 8.0 · 104 cells had been added

per well, viability had declined only by 8.2% ± 7.6 (n = 2)

and 5.0% ± 7.0 (n = 2) as measured, respectively, by AB

and CFDA AM. With cell density kept constant at approxi-

mately 4.0 · 104 cells well)1, cultures showed a progressive

decline in viability with increasing LPS (Fig. 8). From the

dose–response curves for AB and CFDAAM, EC50s could be

calculated and compared. The EC50s for AB were generally

lower, but only in two experimental conditions were the

EC50s for AB and CFDA AM statistically different from one

another (Table 2).

The viability of cultures to increasing concentrations of

LPS was compared with and without 2 mM glutamine

(Fig. 8). This was carried out in a simple salt solution, L15/

ex, which consisted of L15 salts plus galactose and pyruvate,

as well as in the basal medium, L15. In both cases, the dose–

response curves for both AB and CFDA AM were shifted to

(a)

Control

+2 mM L-GLU

NO L-GLU

LPS (µg mL–1)

(c) (d)

(b)

Figure 6 Appearance of RTgutGC cul-

tures with lipopolysaccharide (LPS)

treatment. RTgutGC cells were seeded

into 25-cm2 tissue culture flasks in L15

with and without glutamine. After 24-h

exposure with 50 lg mL)1 LPS with

glutamine, images were taken: control

(a) and dosed (b). Similarly, images were

taken of exposures without glutamine:

control (c) and dosed (d). Some areas of

cytotoxicity are indicated with a circle.

Scale bar indicates 100 lm.

Figure 7 Bar graphs of RTgutGC exposed to lipopolysaccharide

(LPS) seeded at varying cell densities. Cultures were seeded at

approximately 1.0 · 104, 2.0 · 104, 4.0 · 104 or 8.0 · 104 cells well)1

in a 96-well culture plate with L15. The next day, a fixed LPS con-

centration (50 lg mL)1) was directly dosed to six wells for each cell

density. After 24 h, the viability of cultures was evaluated with

Alamar blue for energy metabolism and CFDA-AM for cell mem-

brane integrity. Both assays are fluorescent and read as relative

fluorescent units (RFUs), which were expressed as percentages of the

RFUs in control wells. The means with standard deviations for the

percentage cell viability with the two assays are plotted against LPS

concentration for one of two independent experiments.

TNF-α1

TNF-α2

β-actin

TNF-α1

Control 24 hControl(a) (b)4 h

TNF-α2

β-actin

Figure 5 RTgutGC cultures were exposed to 20 lg mL)1 lipopoly-

saccharide (LPS) for 4 h (a) or 50 lg mL)1 LPS for 24 h (b). Cells

were collected and reverse transcription polymerase chain reaction

performed to measure TNF-a expression. Individual bands represent

expression of TNF-a1, TNF-a2 and b-actin at the transcript level as

indicated in the labels on the figure.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

the right in the presence of glutamine, yielding higher EC50

values (Table 2).

For a comparison with mammalian intestinal epithelial cell

lines, cultures of Caco-2 and HT-29 at 4.0 · 104 cells in

DMEM with glutamine were exposed to increasing concen-

trations of LPS and evaluated for viability after 24 h with AB

and CFDA AM. For HT-29, the EC50s for AB and CFDA

AM were, respectively, 174.9 ± 2.9 and 161.7 ± 2.9 lg

mL)1 (n = 2) and were not statistically different (t-test,

P > 0.05) from each other or from the EC50s for Caco-2,

which were 173.5 ± 26.7 and 156.7 ± 9.7 9 lg mL)1

(n = 2) for, respectively, AB and CFDA AM. These values

with the human cell lines were significantly higher than the

EC50s for RTgutGC at 4.0 · 104 cells in L15 with glutamine,

which were 49.7 ± 2.6 and 70.2 ± 4.0 lg mL)1 (n = 2) for,

respectively, AB and CFDA AM.

A cell line, RTgutGC, is described for the first time from the

gastrointestinal tract of fish. RTgutGC was confirmed as

derived from rainbow trout, O. mykiss, by amplifying and

sequencing a 652-bp region of the mitochondrial cytochrome

c oxidase I gene (COI), which has been demonstrated to

unambiguously diagnose several thousand species of fishes

(reviewed in Ward et al. 2009), including North American

freshwater species such as rainbow trout (Hubert et al. 2008).

This sequence covers the 648-bp segment of the 5¢ region of

the COI gene that continues to be used to form the library of

primary barcodes for the animal kingdom (Hebert et al.

2003) and has been successfully used to identify many other

cell lines (Lorenz et al. 2005; Cooper et al. 2007). The

development and basic characteristics of RTgutGC were

similar to other cell lines from rainbow trout. The line

seemed to be continuous as some cultures have been main-

tained continuously for 4 years and subjected to over 100

passages. The cell line was heteroploid. Nearly all rainbow

trout cell lines developed to date appear to have immortal-

ized spontaneously and are heteroploid (Bols et al. 2005).

Like these cell lines, RTgutGC required serum for growth

and could be cryopreserved. RTgutGC cells had an epithe-

lial-like morphology. Several epithelial-like cell lines have

been developed from a variety of adult rainbow trout tissues,

including the gill, liver, pituitary and spleen (Lee et al. 1993;

Bols et al. 1994, 1995; Ganassin & Bols 1999). However, in

comparison to them, the cells in confluent cultures of

RTgutGC are more uniformly cobblestone. RTgutGC

should be a useful tool for investigating many topics on fish

intestinal epithelial cells. This is illustrated in the following

Figure 8 Cytotoxicity curves of three intestinal cell lines after lipo-

polysaccharide (LPS) treatment. Cultures were initiated at approxi-

mately 4.0 · 104 cells well)1 in a 96-well culture plate. The next day,

varying concentrations of LPS were directly dosed to six wells for

each concentration. RTgutGC was exposed to lipopolysaccharide

(LPS) with and without glutamine in L15/ex (a) or L15 (b). Two

mammalian intestinal cell lines, HT-29 and Caco-2, were exposed to

LPS in Dulbecco�s Modified Eagle Medium (c). After 24 h, the via-

bility of cultures was evaluated with Alamar Blue for energy metab-

olism and 5-carboxyfluorescein diacetate acetoxymethyl ester for cell

membrane integrity. Both assays used fluorescent dyes and read as

relative fluorescent units (RFUs), which were expressed as percent-

ages of the RFUs in control wells. The means with standard devia-

tions for the percentage cell viability with the two assays are plotted

against LPS concentration for one of two independent experiments.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

text by investigating their requirement for glutamine, their

expression of AP and their cellular response to LPS.

The survival and growth of RTgutGC in medium without

glutamine is similar to the behaviour of some but not all

mammalian intestinal epithelial cell lines and similar to non-

intestinal fish cell lines. The rat intestinal cell line, RIE-1,

underwent apoptosis upon glutamine starvation (Papacon-

stantinou et al. 1998). By contrast, RTgutGC survived in the

complete absence of glutamine. Previously, fish cell lines from

embryos and from the liver, spleen, and skin of adults also

were shown to survive in L15 in the absence of serum and

glutamine (Bols et al. 1994). With a supplement of serum, L15

without glutamine supported the proliferation of these fish

cell lines (Bols et al. 1994) and in this study RTgutGC. Thus,

only the small amount of glutamine in serum was sufficient to

support the growth of these cell lines. Similar results have

been obtained with the Caco-2 cell line. This human intestinal

cell line grew in the absence of glutamine in basal medium that

was supplemented with growth factors or FBS (Turowski

et al. 1994; Lenaerts et al. 2006). At least one fish cell line

grew in the complete absence of glutamine. CHSE-214 pro-

liferated in L15 with dFBS and no glutamine (Bols et al.

1994). However, RTgutGC did not. Rather than being a

difference between the two cell lines, the results might reflect

the use of dFBS with a molecular weight (MW) cutoff of

1000 for CHSE-214 and 10 000 for RTgutGC. With the

10 000 MW cut-off, more small nutrients and growth factors

would have been lost, possibly preventing this dialyzed serum

from supporting growth in the absence of glutamine. Further

research will be needed to determine whether the response of

RTgutGC to glutamine deprivation is general to fish cells or

to intestinal epithelial cells.

As with many mammalian intestinal epithelial cell lines,

RTgutGC expressed AP activity only under some culture

conditions. Little or no AP activity was seen in normally

grown human and rat intestinal epithelial cell lines, such HT-

29, T84, LoVo and IEC-6 (Herz & Halwer 1990; Nollevaux

et al. 2006). However, AP activity could be induced by a

variety of treatments, such as sodium butyrate (Herz &

Halwer 1990; Fukushima et al. 1998). Another human cell

line, Caco-2, expressed AP when the cells were grown to

confluency (Matsumoto et al. 1990). The AP induced under

these conditions was the intestinal form of AP (IAP) and

considered a marker of differentiation, as in vivo only dif-

ferentiated enterocytes expressed IAP. However, for some of

these cell lines, other AP isoforms also were induced (Herz &

Halwer 1990; Fukushima et al. 1998). For RTgutGC, AP

activity was not detected cytochemically in cultures under

normal growth conditions. However, seen in cultures that

had been initiated at very high cell densities, where clumps of

cells attached on top of the monolayer. Determining the

nature of the observed AP as induction of IAP, which has

been identified in fish (Bates et al. 2007), and whether this

represents enterocyte differentiation will be interesting ques-

tions to explore with the cell line in the future.

LPS up-regulated the expression in RTgutGC of transcripts

for two isoforms of TNF-a, which is a major pro-inflam-

matory cytokine and an immunoregulator in mammals

(Cruse & Lewis 2004). Previous in vivo studies have shown

the induction of TNF-a2 transcripts in the rainbow trout

intestine (Mulder et al. 2007). Recently, expression of TNF-

a2 protein as well as transcripts was shown to be inducible in

the rainbow trout gut (Komatsu et al. 2009). Transcript

induction was demonstrated in primary cultures and protein

induction was revealed immunohistochemically in rainbow

trout in which Aeromonas salmonicida had been placed via

the rectum into the posterior intestine for 6 h (Komatsu et al.

2009). RTgutGC should be a convenient in vitro alternative

for studying pro-inflammatory cytokine expression in the fish

intestine.

LPS at concentrations that were broadly similar to the lethal

concentrations reported with mammalian intestinal epithelial

cell lines reduced cellular viability of RTgutGC in sub-con-

fluent cultures. Literature values for the LPS concentrations

cytotoxic to mammalian intestinal epithelial cells varied,

likely because of differences in exposure conditions and

endpoints, but ranged from approximately 40 lg mL)1 for

SCBN (Chin et al. 2006) to 600 lg mL)1 for Caco-2 (Hiro-

tani et al. 2008). When the same endpoints that were used

with RTgutGC were applied to HT29 and Caco-2, the EC50s

were between 150 and 175 lg mL)1, which were within the

published range but higher than with RTgutGC. The differ-

ences in the basal media and temperature used to culture cells

for the two species may account for the differences between

the rainbow trout and human intestinal epithelial cell lines.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

Fish cells are often considered less sensitive to LPS than

mammalian cells (Iliev et al. 2005; Maier et al. 2008), but

usually viability has not been the response measured and

intestinal epithelial cells have not been compared.

Generally, fish cells are thought to be less responsive to

LPS because they appear to lack the CD14/LY96/TLR4

recognition and signalling system (Iliev et al. 2005). Mam-

malian intestinal epithelial cells are known to be hypore-

sponsive to LPS because they express no or low MD2 (Ly96)

(Lenoir et al. 2008) and possibly TLR4 (Abreu et al. 2001;

Bocker et al. 2003). Thus, for intestinal cell viability, there

might be little difference between mammals and fish in their

response to LPS. The reduction in cellular viability caused by

LPS might be initiated through a mechanism independent of

the CD14/TLR4-signalling pathway. Impairment of mito-

chondrial function represents one action of LPS independent

of CD14 (Glover et al. 1996). Changes in AB reduction

indicates changes in energy metabolism (O�Brien et al. 2000),

including mitochondrial activity (Zhang et al. 2004). Thus,

the decline in AB reduction by RTgutGC in response to LPS

might be a CD14/LY96/TLR4 independent response. The

steps between the impairment of energy metabolism in

RTgutGC and the loss of membrane integrity remain to be

elucidated. Furthermore, the loss of cell viability could be

associated with apoptosis or by some alternative mode of cell

death.

The sensitivity of RTgutGC to the toxic actions of LPS was

influenced by several culture conditions that hint at possible

protective mechanisms. As the cell density of cultures was

increased, the cells became less susceptible to LPS. In other

culture systems, cell density has been found to modulate the

induction of NO synthase by LPS (de Oliveira et al. 2002),

but modulation of cell killing by LPS has not been previously

reported. One possible reason for the cells being less sus-

ceptible to LPS-killing at high cell density was the elevated

levels of AP activity. Recently, several studies have suggested

that AP in the gut detoxifies LPS (Bates et al. 2007; Koyama

et al. 2002; Vaishnava & Hooper 2007). Thus, in the future,

RTgutGC could be used to study the possible protective

action of AP against LPS at the cellular level.

Another protective mechanism could involve glutamine. In

the presence of 2 mM glutamine, the dose–response curve for

the cytotoxicity of LPS to RTgutGC was shifted to the right,

meaning that a higher concentration of LPS was needed to

reduce cellular viability by 50%. In mammals, glutamine was

found to be generally protective for intestinal epithelial cells

both in vitro (Chow & Zhang 1998; Evans et al. 2005) and

in vivo (Sukhotnik et al. 2007) and appears to achieve this in

multiple ways. Glutamine can protect by supporting the

synthesis of glutathione and heat shock proteins and by

suppressing the induction of cytokines and the activation of

apoptosis (Evans et al. 2005; Roth 2008). The mechanisms

responsible for glutamine attenuating LPS remains to be

investigated, but the results hint that Gln could also have a

protective role in the fish intestine. Finally, no cytotoxicity

was observed when FBS was present. The serum presumably

protects by binding with LPS, making it less available to cells

and by generally supporting the health of cells.

In the future, further characterization of RTgutGC for

functional parameters should enhance the value of the cell

line in nutritional research. Some parameters of interest

would be the formation of tight junctions and the expression

of specific intestinal transporters. This might allow RTgutGC

to be the fish equivalent of the Caco-2 cell monolayer, which

has been used extensively to identify substrates, inhibitors

and inducers of intestinal transporters, especially P-glyco-

protein (Sun et al. 2008).

The research was supported by an NSERC Strategic grant

with the support of Skretting. The species identification was

performed through funding to the Canadian Barcode of Life

Network from Genome Canada (through the Ontario

Genomics Institute). We thank Heather Braid for her help

with the barcoding.

Abreu, M.T., Vora, P., Faure, E., Thomas, L.S., Arnold, E.T. &

Arditi, M. (2001) Decreased expression of toll-like receptor-4 and

MD-2 correlates with intestinal epithelial cell protection against

dysregulated proinflammatory gene expression in response to

bacterial lipopolysaccharide. J. Immunol., 167, 1609–1616.

Bates, J.M., Akerlund, J., Mittge, E. & Guillemin, K. (2007) Intes-

tinal alkaline phosphatase detoxifies lipopolysaccharide and pre-

vents inflammation in zebrafish in response to the gut microbiota.

Cell Host Microbe, 2, 371–382.

Bocker, U., Yezerskyy, O., Feick, P., Manigold, T., Panja, A.,

Kalina, U., Herweck, F., Rossol, S. & Singer, M.V. (2003)

Responsiveness of intestinal epithelial cell lines to lipopolysac-

charide is correlated with Toll-like receptor 4 but not Toll-like

receptor 2 or CD14 expression. Int. J. Colorectal Dis., 18, 25–32.

Bojsen, A., Buesa, J., Montava, R., Kvistgaard, A.S., Kongsbak,

M.B., Petersen, T.E., Heegaard, C.W. & Rasmussen, J.T. (2007)

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

Inhibitory activities of bovine macromolecular whey proteins

on rotavirus infection in vitro and in vivo. J. Dairy Sci., 90,

66–74.

Bols, N.C. & Lee, L.E.J. (1991) Technology and uses of cell cultures

from the tissues and organs of bony fish. Cytotechnology, 6, 163–

187.

Bols, N.C., Barlian, A., Chirino-Trejo, M., Caldwell, S.J., Goegan,

P. & Lee, L.E.J. (1994) Development of a cell line from primary

cultures of rainbow trout, Oncorhynchus mykiss (Walbaum), gills.

J. Fish. Dis., 17, 601–611.

Bols, N.C., Yang, B.Y., Lee, L.E.J. & Chen, T.T. (1995) Develop-

ment of a rainbow trout pituitary cell line that expresses growth

hormone, prolactin and somatolactin. Mol. Mar. Biol. Biotechnol.,

4, 154–163.

Bols, N.C., Dayeh, V.R., Lee, L.E.J. & Schirmer, K. (2005) Use of

fish cell lines in toxicology of fish. In: Biochemistry and Molecular

Biology of Fishes-Environmental Toxicology (Moon, T.W. &

Mommsen, T.P. eds), pp. 43–84. Elsevier Science, Amsterdam.

Boonstra, J.J., van der Velden, A.W., Beerens, E.C.W., et al. (2007)

Mistaken identity of widely used esophageal adenocarcinoma cell

line TE-7. Cancer Res., 67, 7996–8001.

Brubacher, J.L., Secombes, C.J., Zou, J. & Bols, N.C. (2000) Con-

stitutive and LPS-induced gene expression in a macrophage-like

cell line from the rainbow trout (Oncorhynchus mykiss). Dev.

Comp. Immunol., 24, 565–574.

Chin, A.C., Flynn, A.N., Fedwick, J.P. & Buret, A.G. (2006) The

role of caspase-3 in lipopolysaccharide-mediated disruption of

intestinal epithelial tight junctions. Can. J. Physiol. Pharmacol., 84,

1043–1050.

Chow, A. & Zhang, R. (1998) Glutamine reduces heat shock-

induced cell death in rat intestinal epithelial cells. J. Nutr., 128,

1296–1301.

Colihuegue, N., Iturra, P., Estay, F. & Diaz, N.F. (2001) Diploid

chromosome number variations and sex chromosome polymor-

phism in five cultured strains of rainbow trout (Oncorhynchus

mykiss). Aquaculture, 198, 63–77.

Cooper, J.K., Sykes, G., King, S., Cottrill, K., Ivanova, N.V.,

Hanner, R. & Ikonomi, P. (2007) Species identification in cell

culture, a two-pronged molecular approach. In Vitro Cell. Dev.

Biol. -AN, 43, 344–351.

Cruse, J.M. & Lewis, R.E. (2004) Major histocompatibility complex.

In: Atlas of Immunology (Spiegel, J., Pennell, J., Roberson, P.,

Yanchak, J. & Rodriguez, A. eds), pp. 127–145. CRC Press, New

York.

Dayeh, V.R., Schirmer, K., Lee, L.E.J. & Bols, N.C. (2003) The use

of fish-derived cell lines for investigation of environmental con-

taminants. In: Current Protocols in Toxicology (Morgan, K.ed.),

pp. 1–17. John Wiley & Sons, New York.

Evans, M.E., Jones, D.P. & Ziegler, T.R. (2005) Glutamine inhibits

cytokine-induced apoptosis in human colonic epithelial cells via

the pyrimidine pathway. Am. J. Physiol. Gastrointest. Liver

Physiol., 289, G388–G396.

Francis, G., Makkar, H.P.S. & Becker, K. (2001) Antinutritional

factors present in plant-derived alternative fish feed ingredients

and their effects in fish. Aquaculture, 199, 197–227.

Fukushima, K., Sasaki, I., Hasegawa, H., Takahashi, K.I., Naito,

H., Funayama, Y. & Matsuno, S. (1998) Sodium butyrate-induced

liver-type alkaline phosphatase activity in a small intestinal epi-

thelial cell line, IEC6. Dig. Dis. Sci., 43, 1116–1123.

Ganassin, R. & Bols, N.C. (1999) A stromal cell line from rainbow

trout spleen, RTS34st, that supports the growth of rainbow trout

macrophages and produces conditioned medium with mitogenic

effects on leukocytes. In Vitro Cell. Dev. Biol., 35, 80–86.

Giron-Calle, J., Vioque, J., el Mar Yust, M., Pedroche, J., Alaiz, M.

& Milan, F. (2004) Effect of chickpea aqueous extracts, organic

extracts, and protein concentrates on cell proliferation. J. Med.

Food, 7, 122–129.

Glover, R.E., Mile, B., Rowlands, C.C. & Jackson, S.K. (1996)

Lipopolysaccharide decreases oxygen consumption by momo mac

6 cells; an electronegative resonance oximetry study. Biochim.

Biophys. Acta, 1310, 5–9.

Hebert, P., Ratnasingham, S. & deWaard, J. (2003) Barcoding

animal life: cytochrome c oxidase subunit 1 divergences among

closely related species. Proc. R. Soc. Lond. B Biol. Sci., 270,

S96–S99.

Herz, F. & Halwer, M. (1990) Differential effects of sodium butyrate

and hyperosmolality on the modulation of alkaline phosphatases

of LoVo cells. Exp. Cell Res., 168, 50–54.

Hirotani, Y., Ikeda, K., Kato, R., Myotoku, M., Umeda, T., Ijiri,

Y. & Tanaka, K. (2008) Protective effect of lactoferrin against

intestinal mucosal damaged induced by lipopolysaccharide

in human intestinal Caco-2 cells. Yakugaku Zasshi, 128, 1363–

1368.

Hubert, N., Hanner, R., Holm, E., et al. (2008) Identifying Canadian

freshwater fishes through DNA barcodes. PLoS ONE, 3, 1–8.

Iliev, D.B., Roach, J.C., Mackenzie, S., Planas, J.V. & Goetz, F.W.

(2005) Endotoxin recognition, In fish or not in fish? FEBS Lett.,

579, 6519–6528.

Ivanova, N.V., Zemlak, T.S., Hanner, R.H. & Hebert, P.D.N. (2007)

Universal primer cocktails for fish DNA barcoding. Mol. Ecol.

Notes, 7, 544–548.

Jin, F.X., Welch, R. & Glahn, R. (2006) Moving toward a more

physiological model: application of mucin to refine the in vitro

digestion/Caco-2 cell culture system. J. Agric. Food Chem., 54,

8962–8967.

King, R.E., Bomser, J.A. & Min, D.B. (2006) Bioactivity of resve-

ratrol. Compr. Rev. Food Sci. Food Saf., 5, 65–70.

Komatsu, K., Tsutsui, S., Hino, K., Araki, K., Yoshiura, Y.,

Yamamoto, A., Nakamura, O. & Wantanabe, T. (2009) Expres-

sion profiles of cytokines released in intestinal epithelial cells of the

rainbow trout, Oncorhynchus mykiss, in response to bacterial

infection. Dev. Comp. Immunol., 33, 499–506.

Koyama I, Matsunaga., T, Harada.T. & Kokari S, Komoda.T.

(2002) Alkaline phosphatases reduce toxicity of lipopolysaccharide

in vivo and in vitro through dephosphorylation. Clin. Biochem., 35,

455–461.

Larsen, N., Nissen, P. & Willats, W.G.T. (2007) The effect of calcium

ions on adhesion and competitive exclusion of Lactobacillus spp

and E coli 0138. Int. J. Food Microbiol., 114, 113–119.

Lee, L.E.J., Clemons, J.H., Bechtel, D.G., Caldwell, S.J., Han, K.B.,

Pasitschniak-Arts, M., Mosser, D.D. & Bols, N.C. (1993) Devel-

opment and characterization of a rainbow trout liver cell line

expressing cytochrome P450-dependent monooxygenase activity.

Cell Biol. Toxicol., 9, 279–294.

Lenaerts, K., Mariman, E., Bouwman, F. & Renes, J. (2006) Glu-

tamine regulates the expression of proteins with a potential health-

promoting effect in human intestinal Caco-2 cells. Proteomics, 6,

2454–2464.

Lenoir, C., Sapin, C., Broquet, A.H., et al. (2008) MD-2 controls

bacterial lipopolysaccharide hyporesponsiveness in human intes-

tinal epithelial cells. Life Sci., 82, 519–528.

Li, H., Chen, D., Li, X., Zhang, H., Lu, Y., Ye, C. & Ren, X.D.

(2002) Changes of NF-kB, p53, Bcl-2 and caspase in apoptosis

induced by JTE-522 in human gastric adenocarcinoma cell line

AGS cells: role of reactive oxygen species. World J. Gastroenterol.,

8, 431–435.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd

Lilja, J.J., Raaska, K. & Neuvonen, P.J. (2005) Effects of orange

juice on pharmacokinetics of atenolol. Eur. J. Clin. Pharmacol., 61,

337–340.

Lorenz, J.G., Jackson, W.E., Beck, J.C. & Hanner, R. (2005) The

problems and promise of DNA barcodes for species diagnosis of

primate biomaterials. Philos. T. R. Soc. B., 360, 1869–1877.

Maier, V.H., Schmitt, C.N.Z., Gudmundsottir, S. & Gudmundsson,

G.H. (2008) Bacterial DNA indicated as an important induced of

fish cathelicidins. Mol. Immunol., 45, 2352–2358.

Matsumoto, H., Erickson, R.H., Gum, J.R., Yoshioka, M., Gum, E.

& Kim, Y.S. (1990) Biosynthesis of alkaline phosphatase during

differentiation of the human colon cancer cell line Caco-2. Gas-

troenterology, 98, 1199–1207.

Mulder, I., Wadsworth, S. & Secombes, C. (2007) Cytokine expres-

sion in the intestine of rainbow trout (Oncorhynchus mykiss) dur-

ing infection with Aeromonas salmonicida. Fish Shellfish Immunol.,

23, 747–759.

Naik, S., Kelly, E.J., Meijer, L., Pettersson, T. & Sanderson, I.R.

(2001) Absence of Toll-like receptor 4 explains endotoxin hypo-

responsiveness in human intestinal epithelium. J. Pediatr. Gastro-

enterol. Nutr., 32, 449–453.

Nollevaux, G., Deville, C., El Moualij, B., Zozi, W., Deloyer, P.,

Schneider, Y.J., Peulen, O. & Dandrifosse, G. (2006) Development

of a serum-free co-culture of human intestinal epithelium cell-lines

(Caco-2/HT29-5M21). BMC Cell Biol., 7, 1–11.

Obinata, M. (2007) The immortalized cell lines with differentiation

potentials, their establishment and possible application. Cancer

Sci., 98, 275–283.

O�Brien, J., Wilson, I., Orton, T. & Pognan, F. (2000) Investiga-

tion of the Alamar Blue (resazurin) fluorescent dye for the

assessment of mammalian cell cytotoxicity. Eur. J. Biochem.,

267, 5421–5426.

Oh, J.H., Ku, J.L., Yoon, K.A., Kwon, H.J., Kim, W.H., Park, H.S.,

Yeo, K.S., Song, S.Y., Chung, J.K. & Park, J.G. (1999) Estab-

lishment and characterization of 12 human colorectal-carcinoma

cell lines. Int. J. Cancer, 81, 902–910.

de Oliveira, L.C.B., Oliveira, C.J.R., Fries, D.M., Stern, A. &

Monteiro, H.P. (2002) Effects of lipopolysaccharide on low- and

high-density cultured rabbit vascular smooth muscle cells, differ-

ential modulation of nitric oxide release, ERK1/ERK2 MAP ki-

nase activity, protein tyrosine phosphatase activity, and DNA

synthesis. Braz. J. Med. Biol. Res., 35, 181–190.

Papaconstantinou, H.T., Hwang, K.O., Rajaraman, S., Hellmich,

M.R., Townsend, C.M. & Ko, T.C. (1998) Glutamine deprivation

induces apoptosis in intestinal epithelial cells. Surgery, 124, 152–

160.

Quaroni, A. & Beaulieu, J. (1997) Cell dynamics and differentiation

of conditionally immortalized human intestinal epithelial cells.

Gastroenterology, 113, 1198–1213.

Quaroni, A., Wands, J., Trelstad, R.L. & Isselbacher, K.J. (1979)

Epithelioid cell-cultures from Rat Small-Intestine - Characteriza-

tion By Morphologic And Immunological Criteria. J. Cell Biol.,

80, 248–265.

Ratnasingham, S. & Hebert, P.D.N. (2007) BOLD, the Barcode of

Life Data System (http://www.barcodinglife.org). Mol. Ecol.

Notes, 7, 355–364.

Roth, E. (2008) Nutritive effects of glutamine. J. Nutr., 138, 2025S–

2031S.

Schirmer, K., Chan, A.G.J., Greenberg, B.M., Dixon, D.G. & Bols,

N.C. (1997) Methodology for demonstrating and measuring the

photocytotoxicity of fluoranthene to fish cells in culture. Toxicol.

In Vitro, 11, 107–119.

Simon-Assmann, P., Turck, N., Sidhoum-Jenny, M., Gradwohl, G.

& Kedinger, M. (2007) In vitro models of intestinal cell differen-

tiation. Cell Biol. Toxicol., 23, 241–256.

Souba, W.W., Klimberg, V.S., Plumley, D.A., Salloum, R.M.,

Flynn, T.C., Bland, K.I. & Copeland, E.M. (1990) The role of

glutamine in maintaining a healthy gut and supporting the

metabolic response to injury and infection. J. Surg. Res., 48, 383–

391.

Sukhotnik, I., Agam,M., Shamir,R., Shehadeh,N., Lurie,M., Coran,

A.G., Shiloni, E. &Mogilner, J. (2007) Oral glutamine prevents gut

mucosal injury and improves mucosal recovery following lipopoly-

saccharide endotoxemia in a rat. J. Surg. Res., 143, 379–384.

Sun, H., Chow, E.C.Y., Liu, S., Du, Y. & Pang, K.S. (2008) The

Caco-2 cell monolayer: usefulness and limitations. Expert. Opin.

Drug. Metab. Toxicol., 4, 395–411.

Thorgaard, G.H. (1983) Chromosomal differences among rainbow

trout populations. Copeia, 3, 650–662.

Turowski, G.A., Rashid, Z., Hong, F., Madri, J.A. & Basson, M.D.

(1994) Glutamine modulates phenotype and stimulates prolifera-

tion in human colon cancer cell lines. Cancer Res., 54, 5974–5980.

Vaishnava, S. & Hooper, L.V. (2007) Alkaline phosphatase, keeping

the peace at the gut epithelial surface. Cell Host Microbe, 2, 365–

367.

Velge, P., Bottreau, E., Quere, P., Pardon, P., Nicolle, J.C., Moris-

son, M., Bout, D. & Dimier, I. (2002) Establishment and charac-

terization of partially differentiated chicken enterocyte cell clones.

Eur. J. Cell Biol., 81, 203–212.

Ward, R.D., Hanner, R. & Hebert, P.D.N. (2009) The campaign to

DNA barcode all fishes, FISH-BOL. J. Fish Biol., 74, 329–356.

Zayat, M., Lichtenberger, L.M. & Dial, E.J. (2008) Pathophysiology

of LPS-induced gastrointestinal injury in the rat, Role of secretory

phospholipase a(2). Shock, 30, 206–211.

Zhang, H.X., Du, G.H. & Zhang, J.T. (2004) Assay of mitochondrial

functions by resazurin in vitro. Acta Pharmacol. Sin., 25, 385–389.

. . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . . .

Aquaculture Nutrition 17; e241–e252 � 2010 Blackwell Publishing Ltd